WO2022159730A1 - Methods of treating lung inflammation - Google Patents

Abstract

A method of treating lung inflammation caused by a viral infection is disclosed. The method of treatment can include topoisomerase I inhibitors and pharmaceutical compositions comprising topoisomerase I inhibitors, which can be administered in combination with another therapeutic agent such as an anti-viral therapeutic. The method can be used to treat a range of viral infections, including but not limited to SARS-CoV-2.

Description

Methods of Treating Lung Inflammation

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 63/140,536, filed on January 22, 2021, the disclosure of which is herein incorporated by reference in its entirety.

GOVERNMENT SPONSORSHIP

This invention was made with government support under Grant No. HSHQDC-16-A- B0006 awarded by the Department of Homeland Security Science and Technology Directorate and Grant Nos. U01AI150748 and R01AI143840 awarded by the National Institutes of Health. The government has certain rights in the invention.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on January 17, 2022, is named 242096_000054_SL.txt and is 9,344 bytes in size.

BACKGROUND OF THE INVENTION

1. Field of the Invention

Embodiments of the present invention relate generally to methods of treating lung inflammation caused by a viral infection (such as for example and not limitation, a SARS-CoV-2 viral infection), and more specifically to methods of treatment using inhibitors of topoisomerase I (Topi) in combination with an antiviral therapeutic (e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof). Provided herein are methods of using Topi inhibitors to control the inflammatory response to such infection, in combination with antiviral therapeutics, and thus to protect the subject against lung damage resulting directly or indirectly from the immune response to the virus while also treating or inhibiting the viral infection.

2. Background

The host innate immune response is the first line of defense against pathogens and is orchestrated by the concerted expression of genes induced by microbial stimuli. Deregulated expression of these genes is linked to the initiation and progression of numerous diseases associated with exacerbated inflammation. Topi has been identified as a critical positive regulator of RNA polymerase II (RNAPII) transcriptional activity at pathogen-induced genes. Notably, depletion or chemical inhibition of Topi suppresses the host response against replicating Influenza and Ebola viruses as well as bacterial products. As a result, pharmacological inhibition of Topi protects mice from death in experimental models of septic shock and acute liver failure. Topi inhibition could therefore be used as therapy against life threatening infections characterized by an exacerbated immune response as it controls the magnitude of the transcriptional response to such infections.

The ongoing coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has affected millions of lives worldwide and poses an overwhelming burden on global health systems and economy. The development of novel therapeutics against SARS-CoV-2 remains a top priority. While prophylactic measures are being evaluated and distributed, drugs available to target SARS-CoV-2 and function therapeutically are direly needed, especially for severe cases of COVID-19.

Disease progression in severe COVID-19 features an initial phase of increasing viremia that wears off and is followed by a second phase characterized by a steep increase in systemic inflammation (Lee et al., 2020; Merad and Martin, 2020; Siddiqi and Mehra, 2020).

Several studies have shown that levels of inflammatory molecules can help distinguish those who survive COVID-19 from those who do not. For example, increased levels of interleukin- 6 (IL-6) and fibrin degradation products (D-dimer), as well as other single measurements like C- reactive protein (CRP) or combined-measurement parameters (Sequential Organ Failure Assessment; SOFA score), have been correlated with risk for death from COVID-19. (Zhou et al., 2020a). Notably, all non-survivors experienced sepsis (Zhou et al., 2020a). Therefore, the increased systemic inflammation that occurs during disease progression provides a biological rationale for interrupting hyper-inflammation to reduce disease severity. Guided by this logic, clinical trials have begun to examine the efficacy of cytokine blockers and anti-inflammatory molecules as potential COVID-19 therapeutics (Merad and Martin, 2020).

However, inhibition of single cytokines such as interleukin 6 (IL-6) or granulocytemacrophage colony-stimulating factor (GM-CSF) might not be sufficient (Hermine et al., 2021; Salvarani et al., 2021). This is due to the fact that many signaling molecules and pathways are involved in triggering an inflammatory response. Additionally, levels of individual cytokines can vary depending on the age and the clinical history of the patient, thus limiting the scope of therapeutics that only target a single inflammatory molecule.

Infection causes a rapid and orchestrated gene induction governed by expression of antiviral and inflammatory mediators. This is often referred to as “infection-induced gene program.” In many instances, the magnitude of induction of the inflammatory components in a gene program can be overwhelming and become more harmful than protective. Such overt induction of inflammatory genes can be driven by unique features of the infectious agent. For example, viral antagonism in infected cells may delay initial responses, causing inappropriate and prolonged production of pro-inflammatory genes and immunopathology later in infection (Channappanavar et al., 2016; Channappanavar and Perlman, 2017). Alternatively, excessive inflammation may be immune mediated and driven by excessive local or systemic recruitment and activation of immune cells. The ultimate result is an overt expression of inflammatory mediators that is fatal to the host.

Reducing the magnitude of the induction of gene expression upon infection might hold the key to the development of novel therapeutics for infections associated with hyper-inflammation. Previously, the inventors reported that chromatin factors play key roles in controlling the induction of inflammatory gene expression programs (Marazzi et al., 2012; Miller et al., 2015; Nicodeme et al., 2010; Ho et al., 2020; Ho et al., 2021). Targeting the activity of these proteins acting on the chromatin template, where infection-induced gene transcription is executed, leads to partial suppression (buffering) of multiple genes (Marazzi et al., 2012; Miller et al., 2015; Nicodeme et al., 2010). Such simultaneous inhibition of many virus-induced genes “in one go” can have a clear advantage over conventional single target therapies (Marazzi et al., 2018).

In fact, there are at least two scenarios in which reducing the induction of gene expression upon infection could be advantageous. In the first scenario, partial suppression of infection- induced antiviral and inflammatory genes in the cells targeted by virus results in retaining an amount of antiviral molecules for blocking viral replication while avoiding excessive induction of inflammatory genes and pathways. A second scenario is when the gene programs are triggered by noninfected immune cells that respond to pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs) in an overwhelmingly inflammatory fashion.

This latter scenario occurs in many instances of infection that leads to sepsis.

The inventors have previously shown that the host enzyme topoisomerase 1 (TOPI) is required to fully transactivate infection-induced genes and thus controls the establishment of inflammatory gene programs during many viral and bacterial infection and co-infections (Rialdi et al., 2016). Therapeutic administration (after infection) of one to three doses of topoisomerase inhibitors can rescue mortality in four animal models of inflammation-induced death (Rialdi et al., 2016). These data support the hypothesis that host-directed epigenetic therapy can suppress hyper- inflammatory responses upon infection without compromising pathogen clearance. At that time (2016), the inventors also predicted that this strategy could be useful for future pandemics. The inventors present here a series of experiments in which they tested the hypothesis that combining a therapeutic for modifying the host response to SARS-CoV-2 infection via epigenetic therapy in combination with anti-viral therapeutics can ameliorate severe COVID-19.

What is needed, therefore, is a method of treating viral infections (including but not limited to SARS-CoV-2 and other coronaviruses) that infect the lungs while also controlling lung inflammation resulting directly or indirectly from the viral infection. Such inhibition may occur by administering a compound that inhibits Topi activity) and anti-viral therapeutics (e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof). It is to such a method of treatment that embodiments of the present invention are directed.

BRIEF SUMMARY OF THE INVENTION

As specified in the Background Section, there is a great need in the art to identify technologies for treating viral infections (including but not limited to SARS-CoV-2 and other coronaviruses) that infect the lungs while also controlling lung inflammation resulting directly or indirectly from the viral infection. The present invention satisfies this and other needs. Embodiments of the present invention relate generally to methods of treating lung inflammation caused by such viruses by administering a therapeutically effective amount of a compound that inhibits Topi activity, in combination with a therapeutically effective amount of an antiviral therapeutic (e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof). In one aspect, the present invention provides a method of treating lung inflammation caused by a viral infection in a subject in need thereof, comprising: administering a therapeutically effective amount of a compound that inhibits Topi activity, in combination with a therapeutically effective amount of an antiviral therapeutic (e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof). In some embodiments of the present invention, a compound that inhibits Topi activity comprises chemical and/or biological inhibitors and combinations thereof.

In some embodiments of the present invention, the chemical inhibitor is selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof. More than one chemical inhibitor may be utilized in the treatment method. Indenoisoquinolines are preferred in some embodiments. In some embodiments, the Topi inhibitor is topotecan.

In other embodiments of the present invention, the biological inhibitor is selected from the group consisting of (i) silencing or interfering nucleic acids specific to and/or capable of binding Topi; (ii) transcriptional regulators of Topi; (iii) translational regulators of Topi; and (iv) post- translational regulators of Topi. Exemplary silencing or interfering nucleic acids include but are not limited to siRNA specific to Topi. Exemplary transcriptional regulators of Topi include but are not limited to transcription factors, transcription activators, repressors, and/or small molecules affecting transcription and the proteins involved in such process. Exemplary translational and post-translational regulators include but are not limited to regulators that phosphorylate and/or dephosphorylate Topi. More than one biological inhibitor may be utilized in the treatment method. In some embodiments, siRNA is a preferred biological inhibitor.

In some embodiments of the present invention, the at least one compound that inhibits Topi activity is an aptamer that is capable of binding to the Topi protein or a nucleic acid encoding Topi . More than one aptamer may be utilized in the treatment method.

In some embodiments, the Topi inhibitor is administered before the antiviral therapeutic is administered. In some embodiments, the Topi inhibitor is administered in more than one dose. In some embodiments, the antiviral therapeutic is administered in more than one dose. In some embodiments, the viral infection is a coronavirus. In an embodiment, the coronavirus is SARS- CoV-2.

In some embodiments, the antiviral therapeutic is remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

In another aspect, the present invention provides a method of treating SARS-CoV-2 in a subject in need thereof, comprising: administering a therapeutically effective amount of a compound that inhibits Topi activity, in combination with a therapeutically effective amount of an antiviral therapeutic(e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof).

In one aspect, the present invention provides a method of treating lung inflammation caused by a viral infection in a subject in need thereof, comprising: administering a therapeutically effective amount of a compound that inhibits Topi activity, in combination with a therapeutically effective amount of an antiviral therapeutic (e.g., remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof). In some embodiments of the present invention, a compound that inhibits Topi activity comprises chemical and/or biological inhibitors and combinations thereof.

In some embodiments of the present invention, the chemical inhibitor is selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof. More than one chemical inhibitor may be utilized in the treatment method. Indenoisoquinolines are preferred in some embodiments. In some embodiments, the Topi inhibitor is topotecan.

In other embodiments of the present invention, the biological inhibitor is selected from the group consisting of (i) silencing or interfering nucleic acids specific to and/or capable of binding Topi; (ii) transcriptional regulators of Topi; (iii) translational regulators of Topi; and (iv) post- translational regulators of Topi. Exemplary silencing or interfering nucleic acids include but are not limited to siRNA specific to Topi. Exemplary transcriptional regulators of Topi include but are not limited to transcription factors, transcription activators, repressors, and/or small molecules affecting transcription and the proteins involved in such process. Exemplary translational and post-translational regulators include but are not limited to regulators that phosphorylate and/or dephosphorylate Topi. More than one biological inhibitor may be utilized in the treatment method. In some embodiments, siRNA is a preferred biological inhibitor.

In some embodiments of the present invention, the at least one compound that inhibits Topi activity is an aptamer that is capable of binding to the Topi protein or a nucleic acid encoding Topi . More than one aptamer may be utilized in the treatment method.

In some embodiments, the Topi inhibitor is administered before the antiviral therapeutic is administered. In some embodiments, the Topi inhibitor is administered in more than one dose. In some embodiments, the antiviral therapeutic is administered in more than one dose. In some embodiments, the viral infection is a coronavirus. In an embodiment, the coronavirus is SARS- CoV-2.

In some embodiments, the antiviral therapeutic is remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

These and other objects, features and advantages of the present invention will become more apparent upon reading the following specification in conjunction with the accompanying drawing figures.

DESCRIPTION OF THE DRAWINGS

Fig. 1A-1H show that SARS-CoV-2 restructures chromatin in host cells. (1A) Top: normalized Hi-C contact matrices are shown for the uninfected (0 hpi) control (lower left) and 24 h post-infection (hpi; upper-right) for a representative 30-Mb region of chromosome 9. White rectangles highlight regions with strong changes in interaction patterns between conditions. Middle: pairwise correlation matrices for uninfected control and 24 hpi Hi-C experiments analysis for the same region shown in the upper panel. Bottom: PCI values are shown along with H3K27ac ChlP-seq levels for the region depicted. (IB) Distribution of A and B compartment domain sizes genome wide for uninfected control and 24 hpi A549-ACE2 cells. (1C) Venn diagram schematic depicting the seven possible patterns of peak occurrence (i-vii), along with the number of peaks observed for each pattern at 0, 8, and 24 hpi. ON/OFF indicates the presence or absence of peaks, respectively. (ID) Differential H3K27ac across infection time points. H3K27ac ChlP-seq peaks were classified across the infection time course into clusters by their pattern of occurrence. Heatmap indicates the normalized H3K27ac read count intensity within each unique peak (rows) for each of the three time points (columns; 0, 8, and 24 h), for the clusters (i-vii) described in (1C). (IE) Scatterplot comparing the PCI values for every 25-kb region in the genome for uninfected control and infected cells (8 and 24 hpi). Data points colored red or blue indicate that they overlap with a significantly regulated H3K27ac peaks (4-fold, adjusted p value < 0.05). (F) Distribution of the change in PCI values between uninfected and 24 hpi at the promoters of genes that are either expressed in A549-Ace2 cells, induced, or repressed by SARS-CoV-2 infection (>1.5-fold, adjusted p value < 0.05). (G) Gene expression dynamics and changes in the number of connected active enhancers presented as a heatmap of log-odds ratios. Both interaction rewiring and changes in K27ac at PIRs is taken into account. (H) Dynamics of promoter interactions and enhancer activity (proxied by K27ac) between 0 and 24 hpi for the TIPARP gene (upregulated upon infection). K27ac peaks gained at 24 hpi are highlighted in dark red (log2 fold change [LFC] > 2, padj < 0.05). Lost (blue) and gained (dark red) promoter interactions with K27ac regions (“enhancers”) at 24 hpi are shown as colored arcs and the rest shown in black. Light-gray arcs represent interactions with regions without K27ac detected at any time point.

Fig. 2A-2E show H3K27ac profiles in SARS-CoV-2-infected A549-ACE2 cells, related to Fig. 1. (2A) Upper panels: Normalized Hi-C contact matrices are shown for the uninfected (Ohpi) control versus 8 hours (8 hpi; leftmost panel) or 24 hours post infection with SARS-CoV-2 (24 hpi; middle left panels) for a representative 30 Mb region of chromosome 9. Normalized Hi-C contact matrices for the same chromosome is shown in Influenza A (IAV) infected and control HBTE cells in the middle-right (Ohpi versus 6hpi) and right most panels (Ohpi versus 18hpi). White rectangles highlight regions with strong changes in interaction patterns between conditions. Middle panels: pairwise correlation matrices for comparisons shown in the upper panel. Lower panel: PCI values, which represent the PC A loadings describing the chromatin compartment membership (+ values for the A compartment, - values for the B compartment) are shown along with H3K27ac ChlP-seq levels for the region depicted. Cells infected for 24 hours show increased segregation of chromatin into smaller A and B compartment domains in both Influenza A and SARS-CoV-2 infected cells. (2B) Distribution of A and B compartment domain sizes genome wide for uninfected control A549-ACE2 or HBTE cells, SARS-CoV-2 infected A549-ACE2 cells and IAV infected HBTE cells at the indicated time points. (2C) Principle Component (PCA) analysis of ChlP-seq experimental replicates. PCA was performed across the genome using the set of peaks identified in each experimental replicate. Percentage of variance explained by the first two components is shown along the axes. PCA was performed using scikit-leam (Pedregosa et al., 2011). (2D) Transcription factor binding site motif enrichment for each of the clusters shown in Figures 1C and ID. Motif enrichment was calculated within H3K27ac-marked regions. Bar plots indicate the negative log p value of enrichment for the top 100 motif classes (see Methods). Bars are colored by motif. AP-1: Yellow; IRF: Green; NFKB: Red; STAT: Blue; Other: Grey (2E) Dynamics of promoter interactions and enhancer activity (proxied by K27ac) between 0 and 24 hpi for the NFKBIZ gene that is upregulated upon infection. K27ac peaks gained at 24hpi are highlighted in dark red (log2-fold change (LFC) > 2, padj < 0.05); there were no lost H3K27ac peaks detected in this locus at the same level of stringency. NFKBIZ promoter interactions with K27ac regions (“enhancers”) are shown as colored arcs, with lost and gained interactions at 24 hpi highlighted in blue and dark-red, respectively, and the rest shown in black. Light-gray arcs represent interactions with regions without K27ac detected at any time point.

Fig. 3 A-3H show that TOPI depletion in SARS-CoV-2 infected cells inhibits induction of inflammatory genes. (3A) PCA plot showing the relationship between samples, replicates, and treatment conditions. (3B) Heatmap showing relative changes in gene expression levels in no siRNA (no siRNA) or siTOPl (siTOPl)-treated cells when compared to nontargeting control siRNA-treated (siSCR) cells. Shown are genes that are differentially expressed between siTOPl and siSCR samples (adjusted p value < 0.05, fold change > 1.5). (3C) Gene Ontology analyses of downregulated target genes shown in (3B). (3D) qPCR validation of select target genes shown in (3B). Shown are the mean and SD of three replicates. *p < 0.05; **p < 0.01; ***p < 0.005, ****p < 0.001 by two-tailed, unpaired Students’ t test. Data are plotted relative to the corresponding uninfected controls. (3E) Western blot showing TOPI and tubulin levels in no siRNA (no si), control siRNA (siSCR)-, or TOPI siRNA (siTOPl)-treated uninfected and infected cells. Shown is a representative western blot of three independent experiments. (3F) Boxplots showing changes in gene expression levels upon SARS-CoV-2 infection, as quantified by RNA-seq, for all expressed genes (Exp), TOPI -dependent induced genes (Dep), and TOPI -independent induced genes (Indep). (3G) Violin plots showing changes in PCI (delta PCI) at 8 and 24 hpi at expressed genes (Exp), TOPI -dependent induced genes (Dep), and TOPI -independent induced genes (Indep). Horizontal lines indicate the means. (3H) Violin plots showing changes in H3K27ac levels (delta H3K27ac) for 8 and 24 hpi at expressed genes (Exp), TOPI -dependent induced genes (Dep), and TOPI -independent induced genes (Indep). Horizontal lines indicate the means. Fig. 4A-4C shows that TPT treatment phenocopies siRNA-mediated TOPI depletion in SARS-CoV-2-infected A549-ACE2 cells, related to Figure 3. (4A) qPCR analysis of CXCL3, CXCL2, IL6, EGR1, CXCL8 and TNFAIP3 expression levels in the presence and absence of OnM, lOOnM or 500nM TPT at 8 or 24h post infection. Data are shown relative to the corresponding uninfected controls. Bars show the mean and standard deviation of 3 replicates. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns: not significant by a two tailed Student’s t test. (4B) Percentage of Vero-E6 cells infected with SARS-CoV-2 48h post infection and in the presence of the indicated concentration of TPT or Remdesivir. Shown are the mean and standard deviation of two independent replicates. Values shown are relative to DMSO (no drug) treated samples. Pink highlighted area shows the 95% confidence interval of the fitted curve (non-linear 4 parameter inhibitor versus response). (4C) Cell proliferation assays of Vero-E6 cells treated with the indicated concentrations of TPT or Remdesivir. Shown are the mean and standard deviation of two independent replicates. Values shown are relative to DMSO (no drug) treated samples. 95% confidence intervals (CI) could not be determined for the fitted curve (non-linear 4 parameter inhibitor versus response).

Fig. 5A-5H show that TPT treatment reduces inflammatory gene expression in SARS- CoV-2 infected hamsters. (5 A) Schematic showing the infection and treatment regime used. (5B) PCA plot showing the relationship between treatment and infection groups. (5C) Heatmap showing gene expression levels of genes that are dysregulated with TPT treatment in uninfected (green), DMSO- (red and purple), or TPT-treated (blue and yellow) hamsters at days 4 and 6 post-infection. (5D) Gene Ontology analysis of genes that are downregulated with TPT treatment at days 4 (top) and 6 (bottom) post-infection. (5E) Representative hematoxylin and eosin (H&E) scan of lungs in DMSO-treated, infected hamsters at 4 days post-infection. Arrow indicates diffuse lung inflammatory damage, bronchiolar epithelium cell death, bronchiolar luminal secretion, and hemorrhage. Arrowheads indicate diffuse alveoli destruction with massive immune cell infiltration and exudation. Open arrows indicate vasculitis. (5F) Representative H&E scan of lungs in infected, DMSO-treated hamsters 6 days post-infection. Lung tissue consolidation affected most of the lung lobe examined. Arrowhead indicates bronchial secretion, infiltration and alveolar space exudation, immune cell infiltration, and hemorrhage. Arrow indicates alveolar and bronchiolar cell proliferation. (5G) Representative H&E scan of lungs in infected, TPT-treated hamsters 4 days post-infection showing diffuse milder inflammatory damage. Arrows indicate bronchiolar epithelium cell death with milder peribronchiolar infiltration. Arrowheads indicate diffuse alveolar wall thickening with capillary congestion. No conspicuous alveolar space infiltration, exudation, or hemorrhage was observed. Open arrows indicate that vasculitis is very mild and rare. (5H) Representative H&E scan of lungs in infected, TPT-treated hamsters 6 days post-infection showing patchy lung tissue consolidation with cell proliferation. Most alveolar areas are without exudation and infiltration.

Fig. 6A-B show TPT suppresses gene programs upregulated in autopsy lung from COVID- 19 patients. (6 A) GSEA of lung tissue gene expression profiles from CO VID-19 deceased patients versus healthy patients (Nienhold et al., 2020). Signed -loglO adjusted p values indicate enrichment of downregulated (top panel) and upregulated (bottom panel) gene signatures from TPT-treated hamsters infected with SARS-CoV-2. Sign of enrichment is given by the normalized enrichment score (NES). Dashed lines indicate a significance levels of p = 0.05. Differences in mean NES are shown. *p = 10-3; **p = 5 * 10-4, ***p = 10-7. (6B) Expression in lung autopsy tissue of COVID-19 patients and healthy controls (Nienhold et al., 2020) of genes downregulated in TPT-treated SARS-CoV-2-infected hamsters (log2(ab solute fold change [log2|FC|] > 1, false discovery rate [FDR] = 10%). Patient groups are indicated by the topmost bar. Gene set enrichment scores, calculated as -logl0(p)*sign(NES), are indicated in the middle bar. The lower heatmap shows the individual gene expression profile of the indicated TPT-inhibited gene for a given patient (columns). Heatmap is sorted by column from the highest (left) to lowest enrichment score (right).

Fig. 7A-7C show that TPT suppresses gene programs in immune cell subsets, related to Figure 5. (7 A) Gene set enrichment analysis of lung-cell-type gene expression profiles from bronchoalveolar lavage fluid (BALF) of COVID19 patients with moderate and severe disease versus healthy patients (Liao et al., 2020). Signed -loglO adjusted P values indicate enrichment of downregulated (left panel) and upregulated (right panel) gene signatures from TPT-treated hamsters infected with SARS-CoV-2. The sign of enrichment is given by the normalized enrichment score (NES). (7B) Expression by lung immune-cell type (macrophage, dendritic cells or neutrophils) of severe COVID19 patients and healthy controls (Liao et al., 2020) of genes downregulated in TPT-treated Sars-CoV-2-infected hamsters (log2|FC| > 1, FDR = 10%). Cell types are indicated by the topmost bar and in the column names; Macrophages: Orange, myeloid Dendritic cells (mDC): Green and Neutrophils: Purple. Patient groups are indicated by the second bar, where healthy patients are in blue, and severe COVID19 patiends in red. Gene set enrichment scores, calculated as -loglO(P)*sign(NES) are indicated in the middle bar. The sign of enrichment is given by the normalized enrichment score (NES). Positive, higher scores indicate that TPT- inhibited genes are more upregulated in a given patient, whereas negative, lower scores indicate that TPT-inhibited genes are more downregulated in a given patient. The lower heatmap shows the individual gene expression profile of the indicated TPT-inhibited gene for a given patient (in columns). Heatmap columns are sorted by cell type and enrichment score from the highest (left) to lowest enrichment score (right). (7C) THP1 cells were transfected with purified SARS-CoV-2 viral RNA (vRNA) or treated with filtered, virus-free conditioned media supernatants from S ARS- CoV infected Calu-3 cells (see STAR Methods) in the presence or absence of lOOnM or 500nM of TPT. Expression of TOPI -dependent inflammatory genes were then measured by qPCR analysis. Data shown are mean and standard deviation of 4-6 biological replicates per condition. *p < 0.05; **p < 0.01, ***p < 0.001, ****p < 0.0001 by two tailed Student’s T Test. Data are plotted relative to Actin B expression.

Fig. 8A-8G show reduced TPT dosages have similar beneficial effects in SARS-CoV-2 - infected hamsters, related to Figure 5. (8 A) Schematic showing infection and treatment regime in 7-10 week old hamsters. (8B) Lung weight to body weight ratios of Hamsters infected with 1E4 PFU SARS-CoV-2 at Day 4 post infection, and treated with either DMSO (red) or 2mg/kg TPT (blue). Each dot represents an individual animal, and lines indicate the mean and SEM of Lung/Body weight ratios. (8C) Scatterplots depicting the percent of lung area that is involved in Broncho Pneumonia, as blindly scored by the pathologist (A.M). Each dot represents an individual animal, and the lines indicate the mean and SEM. (8D, 8E) Representative H&E sections of the left lung lobe of infected hamsters at day 4 post infection, and treated either with DMSO (8D) or 2mg/kg TPT (8E). Scale bar: 5mm and 250uM for the upper and lower panels respectively. (8F) Inflammatory gene expression in DMSO or TPT infected hamsters at day 4 post infection. Bars show the mean and SEM of 4 animals. *p < 0.05 by a one tailed Student’s t test, assuming equal variances. Data are plotted relative to Tbp expression. (8G) Plaque assays were performed on lysates derived from the lungs of hamsters infected with 1E5 PFU of SARS-CoV-2 and treated with either DMSO vehicle control or 2mg/kg TPT. Lungs were isolated at Days 4 or 8 post infection. Each point represents one animal (n = 4/condition). Shown are the mean and SEM of the LoglO(PFU yield/mL). p values were calculated using a two-tailed Student’s t test. DL: Detection limit.

Fig. 9A-9H show that late treatment of TPT in K18-hACE2 mice provides survival benefit during SARS-CoV-2 infection. (9 A) Schematic describing treatment regime used in mice. (9B) Survival curve of K18-hACE2 mice infected with 1E4 plaque-forming units (PFUs) SARS-CoV- 2. Mice were treated with either DMSO vehicle control (n = 15; DMSO, blue) or 2 mg/kg TPT (n = 21; TPT, red) at days 4 and 5 post-infection, p values were determined by log-rank (Mantel-Cox) test, and hazard ratios (log-rank) are shown. **p < 0.01. (9C) Corresponding curves showing the average body weight of mice relative to their initial starting weights through the course of the infection with 1E4 PFU SARS-CoV-2. The number of mice at each day is indicated in the table below. **p < 0.01, by two way mixed model ANOVA. Error bars show the mean and SEM of mice (DMSO, n = 15; TPT n = 21). (9D) Percentage of DMSO- or TPT-treated mice that have a maximum weight loss of <15% or >15% of their starting weights. *p < 0.05, Fisher’s exact test. (9E) Viral titers in the lungs of DMSO- or TPT-treated SARS-CoV-2-infected mice at days 7 and 14 post-infection, ns, not significant by two-tailed Student’ s t test. Mean and SEM are shown. (9F) qPCR analysis of the indicated inflammatory genes at days 7 post-infection, ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 by two-tailed Students t test. Each point represents an individual mouse. Means and SD are shown. Data are normalized to hypoxanthine guanine phosphoribosyl transferase (HPRT) expression in each sample. (9G) Post-recovery weight gain at the indicated days post-infection in DMSO-treated (n = 8) or TPT-day 4+5-treated (n = 8) mice. Weights are normalized to the weights of mice at day 14 post-infection, ns, not significant, by Students’ t test. (9H) Neutralizing antibody titers in DMSO or TPT-treated mice, ns, not significant by two-tailed Students’ t test. Mean and SEM are shown.

Fig. 10A-10C show that late treatment of TPT in K18-hACE2 mice offers no survival benefit during SARS-CoV-2 infection, related to Figure 9. (10A) Schematic showing infection and treatment regime in mice. Groups are color coded by treatment regime. Viral isolate USA- WA1/2020 (NR-52281) was used in these experiments. (10B) Survival curve of K18-hACE2 mice infected with 1E4 PFU of SARS-CoV-2 and subsequently subjected to the indicated TPT treatment regimes. Number of mice used are indicated in the legend. Blue: DMSO vehicle control only (n = 9); Red: TPT 2mg/kg on Days 1 and 2 post infection (n = 10); Green: TPT 2mg/kg on Days 3 and 4 post infection (n = 10). Ns: not significant, by logrank Mantel-Cox test. (10C) Weight loss curves in surviving mice shown in B. Numbers of mice at the end and start (end/start) points of the experiment are indicated in the legend keys. Weights are shown as means of the percentage of starting weights. Error bars show the SEM of each group. Blue: DMSO only; Red: TPT 2mg/kg on Days 1 and 2 post infection; Green: TPT 2mg/kg on Days 3 and 4 post infection; Purple: TPT 2mg/kg on Days 4 and 5 post infection. **p < 0.01; ns:not significant, by two-way mixed model ANOVA analysis.

Figure 11 shows that topotecan and topotecan/remdesivir treated animals had significant lower body weights than mock-treated infected controls on days 2 and 3 post infection (p.i.).

Figure 12 shows that topotecan and topotecan/remdesivir treated animals had improved macroscopic lung pathology (% lung lesions) and smaller lung weight/body ratio.

Figure 13 shows the effects of the treatments on viral load in nasal washes and in the lung.

DETAILED DESCRIPTION OF THE INVENTION

As specified in the Background Section, there is a great need in the art to identify technologies for treating lung inflammation resulting directly or indirectly from viral infections and use this understanding to develop novel therapeutics for the treatment of such diseases and conditions.

Embodiments of the present invention relate generally to methods of treating viral infections (including but not limited to SARS-CoV-2 and other coronaviruses) that infect the lungs while also controlling lung inflammation resulting directly or indirectly from the viral infection. The present invention satisfies this and other needs. Embodiments of the present invention relate generally to methods of treating lung inflammation caused by such viruses by administering a therapeutically effective amount of an anti-inflammatory therapeutic (e.g., a compound that inhibits Topi activity) in combination with a therapeutically effective amount of an antiviral therapeutic.

Surprisingly, as demonstrated herein, the use of low amounts of such inhibitors cause inhibition of Topi without affecting cell viability, while still providing the required effects on inflammatory gene expression that can result in lung inflammation. The Topi inhibitor at the therapeutically effective dosage and/or duration of treatment used in the methods does not form the typical long-lasting cleavage complex resulting in DNA damage, as evidenced by the absence of detrimental effect in vitro and in vivo on cellular viability. Short and reversible inhibition of Topi, as well as Topi depletion, specifically suppresses genes induced by viral agents. Such short and reversible inhibition results reveal a surprising gene specific activator-like role for Topi. Without wishing to be bound by theory, it is possible that the short and reversible inhibition results from decreased or non-existent cleavage complexes resulting in less DNA damage.

In some embodiments of the present invention, a method of treating lung inflammation caused by a viral infection comprises administration of a therapeutically effective amount of at least one compound that inhibits Topi activity, in combination with an antiviral therapeutic. In other embodiments, a method of treating such lung infection comprises administration of a pharmaceutical composition comprising at least one compound that inhibits Topi activity and at least one antiviral therapeutic, and may comprise other pharmaceutically acceptable compounds such as a carrier.

In some embodiments of the present invention, a compound that inhibits Topi activity comprises chemical inhibitors. In some embodiments of the present invention, the chemical inhibitor is selected from the group consisting of camptothecin, topotecan, irinotecan, plant- derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof. More than one chemical inhibitor may be utilized in the treatment method. Indenoisoquinolines are preferred in some embodiments. In some embodiments, the Topi inhibitor is topotecan.

In other embodiments of the present invention, the biological inhibitor is selected from the group consisting of (i) silencing or interfering nucleic acids specific to and/or capable of binding Topi; (ii) transcriptional regulators of Topi; (iii) translational regulators of Topi; and (iv) post- translational regulators of Topi. Exemplary silencing or interfering nucleic acids include but are not limited to siRNA specific to Topi. Exemplary transcriptional regulators of Topi include but are not limited to transcription factors, transcription activators, repressors, and/or small molecules affecting transcription and the proteins involved in such process. Exemplary translational and post-translational regulators include but are not limited to regulators that phosphorylate and/or dephosphorylate Topi. More than one biological inhibitor may be utilized in the treatment method. In some embodiments, siRNA is a preferred biological inhibitor. In some embodiments of the present invention, the at least one compound that inhibits Topi activity is an aptamer that is capable of binding to the Topi protein or a nucleic acid encoding Topi . More than one aptamer may be utilized in the treatment method.

In some embodiments of the present invention, the antiviral therapeutic comprises remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

In some embodiments of the present invention, the method comprises treating lung inflammation resulting from a viral infection, such as for example and not limitation, SARS-CoV- 2.

In some embodiments, the therapeutically effective amount of the at least one compound is determined by the type of viral infection. Certain infections may require a higher amount of the at least one compound than other such infections in order to be therapeutically effective. Further, certain microorganisms and/or portions of microorganisms may cause and/or exacerbate, directly or indirectly, diseases, conditions, infections, states and/or disorders with exacerbated immune responses that may require a higher amount of the at least one compound than those caused and/or exacerbated by other microorganisms and/or portions of microorganisms.

In some embodiments, the treatment method comprises the co-administration of at least one other therapeutic agent.

In some embodiments, the co-administered therapeutic agent is selected from the group consisting of (i) therapeutic agents that block inflammation; (ii) one or more anti-viral antibodies or antibodies directed at a pathogenic antigen; (iii) other immunomodulatory treatments; (iv) one or more bromodomain inhibitors; and (v) one or more antibiotics, anti-fungal drugs, anti-viral drugs, anti-parasitic drugs, or anti -protozoal drugs, including any combination of the foregoing.

In some embodiments, the Topi inhibitor is administered before the antiviral therapeutic is administered. In some embodiments, the Topi inhibitor is administered in more than one dose. In some embodiments, the antiviral therapeutic is administered in more than one dose. In some embodiments, the viral infection is a coronavirus. In an embodiment, the coronavirus is SARS- CoV-2. Definitions

To facilitate an understanding of the principles and features of the various embodiments of the invention, various illustrative embodiments are explained below and herein. Although exemplary embodiments of the invention are explained in detail, it is to be understood that other embodiments are contemplated. Accordingly, it is not intended that the invention is limited in its scope to the details of construction and arrangement of components set forth in the following description or examples. The invention is capable of other embodiments and of being practiced or carried out in various ways. Also, in describing the exemplary embodiments, specific terminology will be resorted to for the sake of clarity.

It must also be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, reference to a component is intended also to include composition of a plurality of components. References to a composition containing “a” constituent is intended to include other constituents in addition to the one named. In other words, the terms “a,” “an,” and “the” do not denote a limitation of quantity, but rather denote the presence of “at least one” of the referenced item.

Also, in describing the exemplary embodiments, terminology will be resorted to for the sake of clarity. It is intended that each term contemplates its broadest meaning as understood by those skilled in the art and includes all technical equivalents which operate in a similar manner to accomplish a similar purpose.

Ranges may be expressed herein as from “about” or “approximately” or “substantially” one particular value and/or to “about” or “approximately” or “substantially” another particular value. When such a range is expressed, other exemplary embodiments include from the one particular value and/or to the other particular value. Further, the term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and more preferably still up to ±1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.

Similarly, as used herein, “substantially free” of something, or “substantially pure”, and like characterizations, can include both being “at least substantially free” of something, or “at least substantially pure”, and being “completely free” of something, or “completely pure”.

By “comprising” or “containing” or “including” is meant that at least the named compound, element, particle, or method step is present in the composition or article or method, but does not exclude the presence of other compounds, materials, particles, method steps, even if the other such compounds, material, particles, method steps have the same function as what is named.

Throughout this description, various components may be identified having specific values or parameters, however, these items are provided as exemplary embodiments. Indeed, the exemplary embodiments do not limit the various aspects and concepts of the present invention as many comparable parameters, sizes, ranges, and/or values may be implemented. The terms “first,” “second,” and the like, “primary,” “secondary,” and the like, do not denote any order, quantity, or importance, but rather are used to distinguish one element from another.

It is noted that terms like “specifically,” “preferably,” “typically,” “generally,” and “often” are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention. Rather, these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment of the present invention. It is also noted that terms like “substantially” and “about” are utilized herein to represent the inherent degree of uncertainty that may be attributed to any quantitative comparison, value, measurement, or other representation.

The dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited. Instead, unless otherwise specified, each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value. For example, a dimension disclosed as “50 mm” is intended to mean “about 50 mm.” It is also to be understood that the mention of one or more method steps does not preclude the presence of additional method steps or intervening method steps between those steps expressly identified. Similarly, it is also to be understood that the mention of one or more components in a composition does not preclude the presence of additional components than those expressly identified.

The materials described hereinafter as making up the various elements of the present invention are intended to be illustrative and not restrictive. Many suitable materials that would perform the same or a similar function as the materials described herein are intended to be embraced within the scope of the invention. Such other materials not described herein can include, but are not limited to, materials that are developed after the time of the development of the invention, for example. Any dimensions listed in the various drawings are for illustrative purposes only and are not intended to be limiting. Other dimensions and proportions are contemplated and intended to be included within the scope of the invention.

As used herein, the term “Topoisomerase I” or “Topi” refers to an enzyme that plays a role in coiling and uncoiling DNA. Specifically, Topi is capable of cutting a single strand of the DNA double helix by an ATP-mediated reaction in order to repair damage and then rejoining the cut strand by ligation. The damaged DNA can be repaired by re-synthesizing the damaged section, homologous recombination or other repair method. In order for Topi to repair damaged DNA, the enzyme must cause the relaxation of the coil of the two DNA strands, cleave the DNA in the proper area so the damage can be repaired, and then after the cuts are made and replication or repair is complete, re-ligate and pair the DNA strands back together to reform the coil. The Topl- DNA complex is transient. If the activity of Topi is inhibited, then the enzyme is no longer able to rejoin the cleaved DNA strand after the cleavage step. This failure to repair the damage results in cell death.

The terms “Topi inhibitor” or “topoisomerase I inhibitor” or “compound that inhibits Topi activity” are interchangeable and refer to a compound that is capable of blocking or preventing, whether permanently or only for a short term, the ability of Topi to re-ligate the DNA strands. Exemplary inhibitors serve to stabilize the Topl-DNA complex, also known as the cleavage complex, such that the DNA ligation is prevented and the single-strand breaks are not repaired. These breaks lead to lethal DNA damage. Known Topi inhibitors include camptothecins and their derivatives such as topotecan (HYC AMTIN®, available from GlaxoSmithKline) and irinotecan (Pfizer). To overcome certain undesirable physical properties and physiological effects of camptothecins and derivatives, a second class of chemical inhibitors has been developed. This second class includes indenoisoquinolines and their derivatives. In contrast to camptothecins and their derivatives, the indenoisoquinolines are: 1) chemically stable in blood, 2) inhibitors of Topi cleavable complexes at distinct sites, 3) not substrates of membrane transporters, and 4) more effective as anti-tumor agents in animal models. Indenoisoquinolines form ternary complexes of Topi and DNA and act as interfacial inhibitors. Another class of Topi inhibitors includes plant- derived phenols such as, for example and not limitation, genistein, quercetin, resveratrol and epigallocatechin gallate, all of which can have phytoalexin functionality. Lamellarin D is also known to be a Topi inhibitor. Indenoisoquinolines are preferred inhibitors of Topi in some embodiments of the present invention. Exemplary biological inhibitors include silencing and/or interfering nucleic acids, such as for example and not limitation siRNA, that is capable of binding with specificity to nucleic acids encoding the topoisomerase I gene, as well as molecules that can regulate the transcription, translation, and post-translational modification of topoisomerase I. As Topi is known to have a phosphorylation site, molecules that regulate the phosphorylation and dephosphorylation of Topi can also be considered Topi inhibitors.

The term “aptamer” as used herein refers to nucleic acid (i.e., DNA, RNA and/or XNA) or peptide molecules that bind to or interact with a specific target molecule such as Topi. Such binding can disrupt (directly or indirectly) the normal binding activities or interactions of the target molecule with its own target molecules. The aptamer may include a ribozyme to cause selfcleavage in the presence of the target molecule. Nucleic acid aptamers are usually short oligonucleotides and may be modified to prevent or lessen degradation by nucleases. Nucleic acid aptamers may be designed to bind to or interact with various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Peptide aptamers are often designed to interfere with protein-protein interactions inside cells and can consist of a short variable peptide domain or loop attached at both ends to a protein scaffold that can serve to greatly increase the aptamer’ s binding affinity.

As used herein, the terms “silencing nucleic acid” and/or “interfering nucleic acid” refers to a nucleic acid that is capable of regulating expression of a gene and includes the concepts of gene silencing and RNA silencing, of which RNA interference is a specific example. These terms describe the ability of a cell to regulate gene expression during transcription or translation to reduce expression of certain genes. Transcriptional gene silencing can include, for example and not limitation, genomic imprinting, paramutation, transposon silencing, transgene silencing, position effect, RNA-directed DNA methylation, and modification of histones and associated induction of heterochromatin formation (RNA-induced transcriptional silencing). Translational gene silencing can include, for example and not limitation, RNA silencing, RNA interference, and nonsense-mediated decay. RNA silencing allows one or more genes to be downregulated or entirely suppressed by non-coding RNAs, particularly small RNAs. RNA silencing may also refer to the introduction of a synthetic antisense RNA molecule, or to sequence-specific regulation of gene expression triggered by double-stranded RNA (dsRNA). The most common method of RNA silencing is RNA interference (RNAi), in which endogenously expressed small RNAs such as, for example and not limitation, microRNA (miRNA), exogenously derived small interfering RNA (siRNA) and piwi-interacting RNA (piRNA), can induce the degradation of complementary messenger RNA (mRNA) or can repress translation of the mRNA. These small RNAs are typically non-coding RNAs approximately 20-30 nucleotides in length that can function as factors involved in, for example and not limitation, inactivating homologous sequences, promoting endonuclease activity, translational arrest, and/or chromatic or DNA modification. RNA silencing refers to the silencing activity of a range of small RNAs and is generally regarded as a broader category than RNAi. Specifically, RNA silencing may be thought of as referring to the broader scheme of small RNA related controls involved in gene expression and the protection of the genome against mobile repetitive DNA sequences, retroelements, and transposons to the extent that these can induce mutations. Further, the 3’ untranslated regions (3’UTRs) of mRNAs often contain regulatory sequences that post-transcriptionally cause RNA interference. Such 3’- UTRs often contain both binding sites for miRNAs as well as for regulatory proteins. By binding to specific sites within the 3’-UTR, miRNAs can decrease gene expression of various mRNAs by either inhibiting translation or directly causing degradation of the transcript. The 3’-UTR also may have silencer regions that bind repressor proteins that inhibit the expression of a mRNA. The 3’- UTR often contains microRNA response elements (MREs), which are sequences to which miRNAs bind. As used herein, the term “subject” refers to mammals and includes, without limitation, human and veterinary animals. In a preferred embodiment, the subject is human.

As used herein, the term “combination” and/or “co-administration” of a Topi inhibitor and at least a second pharmaceutically active ingredient, including but not limited to an antiviral therapeutic, means at least two, but any desired combination of compounds can be delivered simultaneously or sequentially (e.g., within a 24 hour period).

In the context of the present invention insofar as it relates to any of the diseases, disorders, conditions or states recited herein, the terms “treat”, “treatment”, and the like mean to relieve or alleviate at least one symptom associated with such disease, disorder, condition or state, or to slow or reverse the progression of same. Within the meaning of the present invention, the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease, disorder, condition or state) and/or reduce the risk of developing or worsening same. E.g., in connection with cancer the term “treat” may mean eliminate or reduce a patient’s tumor burden, or prevent, delay or inhibit metastasis, etc. The terms “treat”, “treatment”, and the like regarding a state, disease, disorder or condition may also include (1) preventing or delaying the appearance of at least one clinical or sub-clinical symptom of the state, disease, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disease, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disease, disorder or condition; or (2) inhibiting the state, disease, disorder or condition, i.e., arresting, reducing or delaying the development of the state, disease, disorder or condition or a relapse thereof (in case of maintenance treatment) or at least one clinical or sub-clinical symptom thereof; or (3) relieving the state, disease, disorder or condition, i.e., causing regression of the state, disease, disorder or condition or at least one of its clinical or sub-clinical symptoms.

As used herein, the term “therapeutically effective” applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof. Within the context of the present invention, the term “therapeutically effective” refers to that quantity of a compound or pharmaceutical composition containing such compound that is sufficient to delay the manifestation, arrest the progression, relieve or alleviate at least one symptom of a state, disease, disorder or condition treated by the methods of the present invention. Note that when a combination of active ingredients is administered the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. The therapeutically effective amount of the compound or pharmaceutical composition may be influenced by the state, disease, disorder or condition itself, and/or by the microorganism or portion of the microorganism that is the causative agent of the state, disease, disorder or condition. Importantly, the therapeutically effective amount of the Topi inhibitor as used to control inflammatory gene expression and thus decrease the exacerbated immune response can be lower than the therapeutically effective amount of such inhibitor in treating cancers and/or tumors, and/or is administered over a shorter period of time than that used to treat cancers and/or tumors. It is possible that the lower therapeutically effective amounts of Topi inhibitor(s) used in the methods described herein result in decreased or non-existent cleavage complexes, resulting in reversible inhibition, increased cell viability, and/or less or non-existent DNA damage.

The phrase “pharmaceutically acceptable”, as used in connection with compositions of the invention, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.

The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E.W. Martin.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985); Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984); Animal Cell Culture (R.I. Freshney, ed. (1986); Immobilized Cells and Enzymes (IRL Press, (1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994); among others.

Non-limiting examples of the viral infections, eliciting the lung inflammation treatable by the methods of the present invention include, e.g., coronaviruses such as SARS-CoV-2.

It is contemplated that when used to treat various infections, the compositions and methods of the present invention can be combined with other therapeutic agents suitable for the same or similar states, diseases, disorders or conditions. Also, two or more embodiments of the invention may be also co-administered to generate additive or synergistic effects. When co-administered with a second therapeutic agent, the embodiment of the invention and the second therapeutic agent may be simultaneously or sequentially (in any order). Suitable therapeutically effective dosages for each agent may be lowered due to the additive action or synergy.

As a non-limiting example, the invention can be combined with other therapies that block inflammation (e.g., via blockage of IL1, INFa/p, IL6, TNF, IL13, IL23, etc.).

The methods of the invention can be combined with other therapies that suppress inflammatory gene expression, such as for example and not limitation, bromodomain inhibitors.

The methods of the invention can be combined with other immunomodulatory treatments such as, e.g., therapeutic vaccines (including but not limited to GV AX, DC-based vaccines, etc.), checkpoint inhibitors (including but not limited to agents that block CTLA4, PD1, LAG3, TIM3, etc.) or activators (including but not limited to agents that enhance 4 IBB, 0X40, etc.). The inhibitory treatments of the invention can be also combined with other treatments that possess the ability to modulate NKT function or stability, including but not limited to CD Id, CD Id-fusion proteins, CD Id dimers or larger polymers of CD Id either unloaded or loaded with antigens, CD Id- chimeric antigen receptors (CDld-CAR), or any other of the five known CD1 isomers existing in humans (CD la, CD lb, CDlc, CDle), in any of the aforementioned forms or formulations, alone or in combination with each other or other agents.

For treatment of infections, combined therapy of the invention can encompass coadministering compositions and methods of the invention with an antibiotic, an anti-fungal drug, an anti-viral drug, an anti-parasitic drug, an anti -protozoal drug, or a combination thereof.

EXAMPLES

The present invention is also described and demonstrated by way of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular preferred embodiments described here. Indeed, many modifications and variations of the invention may be apparent to those skilled in the art upon reading this specification, and such variations can be made without departing from the invention in spirit or in scope. The invention is therefore to be limited only by the terms of the appended claims along with the full scope of equivalents to which those claims are entitled.

EXAMPLE 1 - Topoisomerase 1 inhibition therapy protects against SARS-CoV-2-induced inflammation and death in animal models.

Methods

Experimental model and subject details

Cells

Human alveolar basal epithelial carcinoma cells (A549, ATCC CCL-185), Calu-3 cells and monkey kidney epithelial cells (Vero E6, ATCC CRL-1586) were maintained at 37°C and 5% CO2 and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; GIBCO) supplemented with 10% fetal bovine serum (FBS; GIBCO). THP-1 cells were cultured in RPMI supplemented with 10% FBS, 10 mM non-essential amino acids, 1 mM sodium pyruvate and 4 mM L-glutamine.

Viral strains

For infections in A549-ACE2 cells and K18-hACE2 mice, SARS-related coronavirus 2 (SARS-CoV-2), isolate USA-WA1/2020 (NR-52281) was used (Blanco-Melo et al., 2020; Daniloski et al., 2021). For Infections with THP-1 cells (Figure 7C) and hamsters in Figure 5, isolate HKG/13 P2/2020 (MT835140) was used. For Infections with hamsters in Figure 8A-8G and all infections in K18-hACE2 mice (Figures 9A-9H and 10A-10C), isolate USA-WA1/2020 (NR-52281) was used. SARS-CoV-2 was grown in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM non-essential amino acids, 1 mM sodium pyruvate and 10 mM HEPES. Plaque assays were used to determine infectious titers of SARS- CoV-2 by infection of Vero E6 cells in Minimum Essential Media supplemented with 2% FBS, 4 mM L-glutamine, 0.2% BSA, 10 mM HEPES and 0.12% NaHCO3 and 0.7% agar.

Method details

Generation of A549-ACE2 cells

Generation of A549-ACE2 cells was performed as previously described (Blanco-Melo et al., 2020; Daniloski et al., 2021). Briefly, A549 cells were transduced with lentiviral vector pHR- PGK expressing human ACE2 coding sequence. A549 cells were then transduced with the lentivirus in the presence of polybrene (8 pg/ml). Cells were used for downstream assays after 48h post transduction.

Preparation of siTOPl sequencing libraries

7.5E4 A549-ACE2 cells were plated in a 24 well dishes. 16 hours post plating, cells were transfected with control, scrambled (siSCR), TOPI -targeting (siTOPl) or no siRNA (no siRNA) using Lipofectamine RNAiMax to a final concentration of 50nM. 48hours post transfection, the media was replaced, and fresh media was added to each well. Cells were then mock infected (PBS only) or infected with SARS-CoV-2 at MOI 0.5. Viral isolate USA-WA1/2020 (NR-52281) was used in these experiments. 24 hours post infection, media was removed, and cells were lysed in 250ul of Trizol reagent (Thermo Scientific). RNA was then extracted using the Purelink RNA Minikit (Invitrogen) with DNasel treatment, according to the manufacturer’s recommendations. RNA quality was determined using the RNA 6000 Nano kit and the Eukaryote Total RNA Nano assay on the Agilent 2100 Bioanalyzer System. RNA quantity was determined by Qubit RNA HS Assay Kit.

To then prepare RNA-sequencing libraries, 300 ng of RNA was depleted of ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat), according to the manusfacturer’ s instructions. Libraries were then prepared from rRNA depleted RNA using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina®, following the manufacturer’s instructions. Final libraries were quantified and sizing was determined using the High Sensitivity DNA Assay reagents and chip in the Agilent 2100 Bioanalyzer System and the Qubit IX dsDNA HS Assay Kit respectively. Individual libraries were then pooled and sequenced using 75bp paired end on the NextSeq 550 using the NextSeq 500/550 High Output Kit ChlP-seq library preparation

To prepare ChIP- Sequencing libraries, ~2E5 A549-ACE2 cells were plated into 12 well dishes. Cells were either mock infected (PBS only) or infected with SARS-CoV-2 virus at MOI 0.5. Viral isolate USA-WA1/2020 (NR-52281) was used in these experiments. 24 hours post infection, media was removed from the well, and replaced with Fixation buffer (PBS, 2% FBS, 1% Methanol-Free Formaldehye). Cells were fixed at room temperature for 10 min. 2M Glycine was then added to a final concentration of 0.125M, and cells were incubated at room temperature for 5min to quench the reaction. Supernatants were removed from wells, and each well was washed 3 times with cold PBS. Cells were then lysed in the well using 250ul of SDS Lysis Buffer [lOOmM NaCl, 50mM Tris pH8.0, 5mM EDTA, 0.02% NaN3, 0.5% SDS + IX Halt Protease and Phosphatase Inhibitor (Thermo Scientific)] and cell lysates were collected in a 1.5ml tube and snap frozen at -80°C. On the day of sonication, lysates were thawed, and diluted with 125ul of Triton Dilution Buffer [lOOmM Tris pH8.5, lOOmM NaCl, 5mM EDTA, 0.02% NaN3, 5% Triton X-100 + IX Halt Protease and Phosphatase Inhibitor], Lysates were then sonicated for 5 - 30 s ON/ 30 s OFF cycles twice using the Bioruptor Pico. Each sonicated lysate was then pre-cleared using lOul of Rabbit-IgG Dynabeads for 1 hour, rotating at 4°C. lug of anti-H3K27ac antibody was then added to 300ul of pre-cleared lysate. Immunoprecipitation (IP) was performed with overnight rotation at 4°C. To recover IP-complexes, lOul of Dynabeads M-280 Sheep anti-Rabbit IgG were added to each reaction and tubes were rotated for 2 hours at 4°C. Bead-chromatin complexes were then washed 6 times on a magnet using ice cold RIPA wash buffer [50mM HEPES-KOH pH7.6, lOOmM LiCl, ImM EDTA, 1% NP-40, 0.5% Na-Deoxy cholate], Washed beads were then incubated in 125ul Elution buffer [1% SDS, 0. IM NaHCO3] at 65°C overnight for elution and decrosslinking. ChIP DNA was then purified using the MinElute PCR purification kit (QIAGEN) and quantified using the Qubit IX dsDNA HS Assay Kit.

ChIP libraries were prepared using the NEBNext® Ultra II DNA Library Prep Kit for Illumina following the manufacturer’s recommendations. Ing of ChlP-DNA was used to prepare each library. ChIP input libraries were prepared by pooling equal amounts of purified sonicated and non-IPed DNA from each sample. Ing of the pooled ChlP-input DNA was used for library preparation. Libraries were quantified and sizing was determined using the High Sensitivity DNA Assay reagents and chip in the Agilent 2100 Bioanalyzer System and the Qubit IX dsDNA HS Assay Kit respectively. Individual libraries were then pooled and sequenced 75bp paired end on the NextSeq 550 using the NextSeq 500/550 High Output Kit v2.5.

Preparation ofHiC libraries

In situ Hi-C was performed as described (Heinz et al., 2018) with modifications. The day before infection, 200k A549-ACE2 cells were plated in a 12 well dishes. Cells were either mock- infected (PBS only) or infected with SARS-CoV-2 virus at MOI 0.5. Viral isolate USA-WA1/2020 (NR-52281) was used in these experiments. Twenty -four hours post infection, media was removed from the well, and replaced with Fixation buffer (PBS, 2% FBS, 1% Methanol -Free Formaldehyde). Cells were fixed at room temperature for 10 min. 2M Glycine was then added to a final concentration of 0.125M, and cells were incubated at room temperature for 5min to quench the reaction. Supernatants were then removed wells, and each well was washed 2 times with cold PBS. Cells were then lysed in the well using 250 pl of Lysis Buffer [0.5% SDS + Halt Protease and Phosphatase Inhibitors (Thermo Scientific)]. Cell lysates were collected in a 1.5ml tube. 1.5 mU RNaseA (Thermo Scientific) was added to each lysate, and lysates were then incubated at 37oC for Ih. RNaseA treated lysates were then snap frozen and stored in -80°C. After thawing, nuclei were collected at 1500 g for 5 minutes at room temperature. Most of the supernatant was discarded, leaving the nuclei in 10 pl liquid. Samples were resuspended in reaction buffer (25 pl 10% Triton X-100, 25 pl lOx Dpn II buffer, 188 pl water) and rotated at 37°C, 8 RPM for 15 minutes. Chromatin was digested overnight (ON) with either 2 pl (100 U) Dpn II (NEB) (later experiments) at 37°C, rotating overhead with 8 RPM. Nuclei were collected by centrifugation at 1500 g for 5 minutes at room temperature, 225 pl of the supernatant were discarded, leaving the nuclei in 25 pl liquid, and overhangs were filled in with Biotin- 14-dATP by adding 75 pl KI enow Master Mix (54.45 pl water, 7.5 pl NEBuffer 2, 0.35 pl 10 mM dCTP, 0.35 pl 10 mM dTTP, 0.35 pl 10 mM dGTP, 7.5 pl 0.4 mM Biotin- 14-dATP (Invitrogen), 2 pl 10% Triton X-100, 2.5 pl (12.5 U) Klenow fragment (Enzymatics)) and rotating overhead at RT, 8 RPM for 40 minutes. Reactions were stopped by adding 2.5 pl 0.5 M EDTA and placed on ice. Proximity ligation was performed by transferring the entire reaction into 1.5 mL Eppendorf tubes containing 400 pl ligase mix (322.5 pl water, 40 pl lOx T4 DNA ligase buffer (Enzymatics), 36 pl 10% Triton X-100, 0.5 pl 10% BSA, 1 pl (600 U) T4 DNA ligase (HC, Enzymatics) and rotating ON at 16°C, 8 RPM. Reactions were stopped with 20 pl 0.5 M EDTA, treated with 1 pl 10 mg/ml DNase-free RNase A for 15 minutes at 42°C, then 31 pl 5 M NaCl, 29 pl 10% SDS and 5 pl 20 mg/ml DNase-free proteinase K (Thermo) were added, proteins digested for 1 h at 55°C while shaking at 800 RPM, then crosslinks reversed ON at 65°C. After extraction with 600 pl pH 8-buffered phenol/chloroform/isoamyl alcohol (Ambion) followed by extraction with 600 pl chloroform, DNA was precipitated with 1.5 pl (22.5 pg) Glycoblue (Ambion) and 1400 pl 100% ethanol ON at -20°C. After centrifugation for 20’ at 16000 g, 4°C, the DNA pellet was washed twice with 80% ethanol, and the pellet airdried and dissolved in 131 pl TT (0.05% Tween 20/Tris pH 8). DNA (200 ng) was sheared to 300 bp in 130 pl TT on a Covaris E220 sonicator using the manufacturer’s protocol. Biotinylated DNA was captured on Dynabeads MyOne Streptavidin T1 (Thermo) by combining the sonicated DNA sample (130 pl) with 20 pl Dynabeads that had previously been washed with lx B&W buffer (2X B&W: 10 mM Tris-HCl pH = 7.5, 1 mM EDTA, 2 M NaCl) and had been resuspended in 130 pl 2x B&W containing 0.2% Tween 20. The binding reaction was rotated at RT for 45 minutes, and DNA-bound beads were vigorously washed twice with 150 pl lx B&W/0.1% Triton X-100, once with 180 pl TET (0.05% Tween 20, 10 mM Tris pH 8, 1 mM EDTA). Libraries were prepared on- beads using an NEBnext Ultra II DNA library prep kit using half the reagent/reaction volumes given in NEB’s instruction manual and 1.6 pmol Bioo DNA sequencing adapters (Illumina TruSeq-compatible) per reaction. Reactions were stopped by adding 5 pl 0.5 M EDTA, beads collected on a magnet and washed twice with 150 pl lx B&W/0.1% Triton X-100, twice with 180 pl TET and resuspended in 20 pl TT (0.05% Tween 20, 10 mM Tris pH 8.0). Libraries were amplified by PCR for 10 cycles (98°C, 30 s; lOx [98°C, 10 s; 63°C, 20 s; 72°C, 30 s]; 72°C, 2 min; 4°C, co), using 10 pl of the bead suspension in a 50 pl reaction with NEBNext Ultra II Q5 2x master mix (NEB) and 0.5 pM each Solexa 1GA/1GB primers (Solexa IGA: AATGATACGGCGACCACCGA (SEQ ID NO: 1), Solexa 1GB:

CAAGCAGAAGACGGCATACGA (SEQ ID NO: 2)). Libraries were precipitated onto magnetic beads by adding 40 pl 20% PEG8000/2.5 M NaCl and 2 pl SpeedBeads (8.9% PEG final) to 48 pl PCR reaction, thorough mixing by vortexing followed by 10-minute incubation at RT. Beads were collected using a magnet and the supernatant discarded. After washing beads twice by adding 180 pl 80% EtOH, moving the tube strip 6x from side to side of the magnet, collecting beads and discarding the supernatant, beads were air-dried, and DNA eluted by adding 20 pl TT. Libraries were sequenced paired-end for 42 cycles each to a depth of approximately 250 million reads per experiment on an Illumina NextSeq 500 sequencer. Preparation of hamster RNA sequencing libraries

For RNA sequencing analyses in infected hamsters shown in Figure 5A-5G, infected hamsters that were treated with TPT or vehicle control, were euthanized at days 4 and 6 post infection. Uninfected hamsters were used as controls. After euthanasia, lung left inferior lobe from hamsters were cut into pieces and lysed with RAI lysis buffer provided with the NucleoSpin® RNA Plus kit (Macherey-nagel), RNA extraction was performed according the manufacturer’s recommendations, including an on-column genomic DNA digestion step. RNA sequencing library preparation and sequencing were then performed by BGI Genomics

Hamster infections

For experiments shown in Figure 5A-5G, Female Golden Syrian hamster, aged 6-8 week old (~70-100 g), were obtained from Laboratory Animal Unit, University of Hong Kong (HKU). All experiments were performed in a Biosafety Level-3 animal facility, LKS Facility of Medicine, HKU. The study has been approved by the Committee on the Use of Live Animals in Teaching and Research, HKU. Virus stock (isolate HKG/13 P2/2020 (MT835140)) was diluted with Phosphate-buffered saline (PBS) to 2 x 104 PFU/ml. Syrian hamsters were obtained from the LASEC, Chinese University of Hong Kong via the Centre for Comparative Medicine Research at the University of Hong Kong. Hamsters were anesthetized with ketamine (150mg/kg) and xylazine (10 mg/mg) and then intranasally inoculation with 50 ul of diluted viruses containing 103 PFU of viruses. For drug treatments, lOmg/kg TPT resuspended in vehicle [5% DMSO + 5% corn oil in PBS] or vehicle alone was administered intraperitoneally to animals on the indicated days post infection.

For experiments shown in Figure 8A-8G, infection procedures were performed following protocols approved by the Icahn School of Medicine at Mount Sinai Institutional Animal Care and Use Committee (IACUC). Animal studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Research Council. 7-10 week old (~ 120-140 g) female Golden Syrian hamsters (Charles River) were anesthetized using 90mg/kg Ketamine and 2mg/kg Xylazine by intraperitoneal injection. Once anesthetized, hamsters were intransally infected with 1E5 PFU of SARS-CoV-2 virus (isolate USA-WA1/2020 (NR-52281)) re-suspended in lOOul of PBS. Animals were monitored daily for clinical signs of illness and weight loss after infection. For drug treatments, 2mg/kg TPT resuspended in vehicle [4.5% DMSO + 20% Sulfobutylether-P-Cyclodextrin (SBE-P-CD) in PBS] or vehicle alone was administered intraperitoneally to animals on the indicated days post infection.

K18-hACE2 mice infections

All mice infection procedures were performed following protocols approved by the Icahn School of Medicine at Mount Sinai Institutional Animal Care and Use Committee (IACUC). Animal studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Research Council. 5-10 week old female B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE2) mice purchased from Jackson Laboratories (Bar Harbor, ME) were anesthetized by an intraperitoneal injection of 90mg/kg Ketamine and 2 mg/kg xylazine. Once anesthetized, mice were infected with 1E4 PFU of SARS-CoV-2 virus (isolate USA-WA1/2020 (NR-52281)) suspended in 30ul of PBS. Mice were monitored daily for clinical signs of illness and weight loss after infection. Animals that reached 80% bodyweight or clinical signs that are irrevocably linked with death were humanely euthanized by intraperitoneal injection of 60mg/kg pentobarbital.

For drug treatments, 2mg/kg Topotecan-hydrochloride (TPT; 14129, Cayman Chemical Company) re-suspended in vehicle [4.5% DMSO + 20% Sulfobutylether-P-Cyclodextrin (SBE-P- CD) in PBS] was administered intraperitoneally to animals on the indicated days post infection.

Extraction ofRNA from lungs of infected hamsters and mice

Upon euthanasia, the superior lobe of infected hACE2-KI mice or Golden Syrian hamsters were collected for RNA extraction. Lungs were lysed and homogenized in Trizol. RNA extraction was performed using the Purelink RNA Mini Kit with a DNasel treatment step, according to the manufacturer’s recommendations. cDNA was synthesized from RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher).

Histological analysis

For histological slides shown in Figures 5E-5H, Lung left superior lobes of infected Golden Syrian hamster were fixed in 4% paraformaldehyde and then processed for paraffin embedding. The 4pm tissue sections were stained with hematoxylin and eosin for histopathological examination. Images were with Olympus BX53 semi-motorized fluorescence microscope using cell Sens imaging software. For histological slides shown in Figures S4D and S4E, the left lung lobe of infected Golden Syrian hamsters was fixed in 10% formalin for 48 hours. Embedding in paraffin blocks and staining with H&E were conducted by the Biorepository and Pathology Dean’s CoRE at the the Icahn School of Medicine at Mount Sinai. Microscopic sections were analyzed in a blinded fashion by the same pathologist (A.M.). A number was randomly assigned by the investigator to discriminate each section, which was then submitted for analysis. No information about treatments and mouse genotypes was communicated to the pathologist. Lungs were scored by the area involved in broncho-pneumonia.

Promoter capture Hi-C (PCHi-C)

The inventors combined PCHi-C (Schoenf elder et al., 2015) with Hi-C library generation as described previously (Nagano et al., 2017), with some modifications. Cells were fixed in 2% PFA for 10 minutes, lysed in lysis buffer (30 minutes on ice), and digested with DpnII (NEB) overnight at 37C rotating (950rpm). Restriction overhangs were filled-in with Klenow (NEB) using biotin- 14-dATP (Jena Bioscience), and ligation was performed in ligation buffer for 4 hours at 16C (T4 DNA ligase; Life Technologies). After overnight decrosslinking at 65C, the ligated DNA was tagmented to produce fragments of 300-700 bp range. Ligation products were isolated using MyOne Cl streptavidin beads (Life Technologies), followed by washing with Wash&Binding buffer and nuclease-free water. Isolated Hi-C ligation products on the beads were then used directly for PCR amplification, and the final Hi-C library was purified with AMPure XP beads (Beckman Coulter). Promoter Capture Hi-C was performed using a custom-design Agilent SureSelect system following the manufacturer’s protocol.

Quantification of viral titers by plaque assays

For quantification of viral titers in the lungs tissues of infected animals, the middle, inferior and post-caval lobes of infected mice/hamsters were collected and homogenized in 1ml of ice-cold PBS. Lysates were then centrifuged at lOOOOrpm for 5min to remove cellular debris, and the cleared lysates transferred to new tubes. Lysates were then diluted in 10-fold dilutions 6 times. Quantification of infectious SARS-CoV-2 titers was then performed by plaque assays. Briefly, Vero-E6 cells were plated as confluent monolayers in 12 well dishes. Media was removed, and wells washed in 1ml of PBS. 200ul of diluted lysates was then added per well and allowed to incubate for 1 hour at 37°C. After viral adsorption, lysates were removed from the well and cells were overlaid with Minimum Essential Media supplemented with 2% FBS, 4 mM L-glutamine, 0.2% BSA, 10 mM HEPES and 0.12% NaHCO3 and 0.7% agar. 72h post infection, agar plugs were fixed in 10% formalin for 24h before being removed. Plaques were visualized by immune staining with anti-mouse SARS-CoV-2 Nucleoprotein antibodies (mAb 1C7) for 1 hour at RTP followed by anti-mouse HRP-conjugated secondary antibody (abeam) for 1 hour at RTP after 3 washes in PBS + 0.1% Tween 20. Plaques were then developed using the TrueBlue substrate (KPL-Seracare) and viral titers calculated and expressed as PFU/ml.

Quantification of neutralizing antibodies in serum (microneutralization assays)

Microneutralization assays were performed as previously described (Amanat et al., 2020). Briefly, Vero E6 cells were seeded at a density of 20,000 cells per well in a 96-well cell culture plate in complete Dulbecco’s Modified Eagle Medium (cDMEM). The following day, heat- inactivated serum samples (dilution of 1 : 10) were serially diluted threefold in 1 * MEM (10% 10 x minimal essential medium (GIBCO), 2 mM L-glutamine, 0.1% sodium bicarbonate (wt/vol; GIBCO), 10 mM 4-(2-hy droxy ethyl)- 1 -piperazineethanesulfonic acid (HEPES; GIBCO), 100 U ml-1 penicillin, 100 ug/ml-1 streptomycin (GIBCO) and 0.2% bovine serum albumin (MP Biomedicals)). Then, 80 pl of each serum dilution and 80 pl of the SARS-CoV-2 virus, diluted to a concentration of 100 TCID50 (50% tissue culture infectious dose) were added to a 96-well cell culture plate and allowed to incubate for 1 h at room temperature. Media was then removed from the Vero E6 cells, and 120ul of the virus-serum mixture added to each well. The plate was then incubated at 37 °C for 1 h. Virus-serum mixture was then removed from the cells, and lOOul of each corresponding serum dilution and lOOul of IX MEM/1%FBS added back to each well. Cells were incubated for 48h at 37 °C before being fixed with 10% paraformaldehyde for 24h at 4°C. After fixation, formaldehyde was removed, and cells were washed with 200ul PBS, before being permeabilized with 150ul PBS/0.1% Triton X-100 for 15min. Plates were then washed three times with PBS + 0.1% Tween 20 (PBST) and blocked in 3% Milk/PBST for Ih at RTP. lOOul of 1 : 1000 diluted mAb 1C7 iwas then added to each well. Plates were incubated for a further Ih at RTP. After incubation, plates were wash 3 times with PBST, before anti-mouse IgG-HRP (1 :3000 in 3% milk) was added to the well. Plates were incubated for a further 1 hour at RTP, before being washed 3 times with PBST. Finally, SIGMAFAST OPD (Sigma-Aldrich) was added to wells. The reaction was stopped after 10 min through the addition of 50ul 3M HC1. OD490 was then measured on a Synergy 4 plate reader (BioTek). Concentrations of antibodies in serum were blank normalized and curve-fitted to calculate IC50 using Graphpad prism 8.0.

TPT treatment ofSARS-CoV-2 infected A549-ACE2 cells

1E5 A549-ACE2 cells were plated in a 24 well dishes 16h prior to infection. For infection, cells were then mock infected (PBS only) or infected with SARS-CoV-2 at MOI 2. TPT was added to a final concentration of lOOnM or 500nM. DMSO controls were also included. 8 and 24 hours post infection, media was removed, and cells were lysed in 250ul of Trizol reagent (Thermo Scientific). Uninfected and drug treated cells were also infected as controls. RNA was then extracted using the Purelink RNA Minikit (Invitrogen) with DNasel treatment, according to the manufacturer’s recommendations. Viral isolate USA-WA1/2020 (NR-52281) was used in these experiments.

TPT treatment of THP1 cells

THP1 cells were plated in 48 well dishes. For purified viral RNA (vRNA) treatment, THP1 cells were transfected with lug purified SARS-CoV-2 (isolate HKG/13_P2/2020 (MT835140)) vRNA using Lipofectamine 3000 according to the manufacturer’s recommendations. For supernatant treated cells, media of THP1 cells was replaced with conditioned media from infected cells. At 6 hours post treatment (either by vRNA transfection or conditioned media), remaining media was removed from THP1 cells, and cells were lysed in Trizol. RNA was then extracted according to the manufacturer’s recommendations. To make conditioned media, Calu-3 cells were infected with 0.1 MOI SAR-CoV-2 (HKG/13_P2/2020 (MT835140)). At 72hpi, supernatant was collected and filtered using YM100 Amicon Ultra Filter to remove residual viruses. Filtered supernatants were then used for downstream assays.

Viral growth and cytotoxicity assays in the presence of TPT or Remdesivir

Experiments were performed as previously described (Gordon et al., 2020). Briefly, 24h hours prior to the assay, 2000 Vero-E6 cells were seeded in 96 well plates and incubated at 37 °C, 5% CO2.Medium was replaced 2 hours before infection with DMEM (2% FBS) media containing drugs of interest at different doses and at concentrations 50% greater than those indicated. Cells were then infected with 100 PFU (MOI = 0.025) SARS-CoV-2 (isolate USA-WA1/2020 (NR- 52281)) in 50ul, bringing the final drug concentration to those indicated. Plates were then incubated for 48h at 37 °C, 5% CO2. Supernatants were then removed and cells were fixed in 4% paraformaldehyde for 24h. To determine % of infected cells, cells were stained for NP protein (1° antibody: anti-sera produced in the Garcia -Sastre laboratory; 1 : 10,000; 2° antibody: anti-rabbit Alexa flour 488nM) and a DAPI counterstain. Infected cells were visualized and quantified using the Celigo (Nexcelcom) imaging cytometer. Accumulation of viral NP protein in the nucleus was used as a proxy for infectivity. The percentage of infected cells per well was quantified as ((infected cells/total cells) - background) x 100 and the DMSO control was then set to 100% infection for analysis. The IC50 was then determined using Graphpad Prism 8.0 software by performing a non linear regression (inhibitor versus response) curve fit. To measure cytotoxicity of drugs, MTT assays (Roche) were performed according to the manufacturer’s instructions. These assays were performed in uninfected Vero-E6 cells using the same concentrations of drugs, and performed concurrently with viral replication assays. All assays were performed in biologically independent triplicates.

Quantification and statistical analysis

Mouse infection studies

Mice were randomly assigned into treatment groups. Statistical significance between survival curves was calculated using a Log-rank (Mantel-Cox) test using Graphpad Prism 8.0 software. Differences in weight loss curves were determined using a Two-Way Mixed Model ANOVA in Graphpad Prism 8.0 Software. Data are shown as ± SEM. To determine effects of drug treatment on morbidity, the maximum weight lost for each mouse in each condition was tabulated, Mice were grouped by those that had a maximum weight loss of either > 15% or < 15%. Differences in percentages of mice falling in these two groups under late TPT treatment or DMSO vehicle control treatment was then calculated using a Fisher’s Exact Test in Graphpad Prism 8.0 software.

Quantitative qPCR assays

The following primers were used for qPCR: [Human] HPRT1 F:

TGCTGAGGATTTGGAAAGGG (SEQ ID NO: 3), HPRT1 R:

ACAGAGGGCTACAATGTGATG (SEQ ID NO: 4), CXCL8 F:

ATACTCCAAACCTTTCCACCC (SEQ ID NO: 5), CXCL8 R: TCTGCACCCAGTTTTCCTTG (SEQ ID NO: 6), CXCL3 F: AAGTGTGAATGTAAGGTCCCC (SEQ ID NO: 7), CXCL3 R:

GTGCTCCCCTTGTTCAGTATC (SEQ ID NO: 8), CXCL2 F

AACCGAAGTCATAGCCACAC (SEQ ID NO: 9), CXCL2 R

CTTCTGGTCAGTTGGATTTGC (SEQ ID NO: 10), IL6 F:

ACTCACCTCTTCAGAACGAATTG (SEQ ID NO: 11), IL6 R:

CCATCTTTGGAAGGTTCAGGTTG (SEQ ID NO: 12), TNFAIP3 F:

GATAGAAATCCCCGTCCAAGG (SEQ ID NO: 13), TNFAIP3 R:

CTGCCATTTCTTGTACTCATGC (SEQ ID NO: 14), EGR1 F: TGTCACCAACTCCTTCAGC (SEQ ID NO: 15), EGR1 R: TCCTGTCCTTTAAGTCTCTTGTG (SEQ ID NO: 16), CXCL10 F: CXCL10 R CXCL11 F CXCL11 R: [Mouse] HprtF: GGCCAGACTTTGTTGGATTTG (SEQ ID NO: 17), Hprt R: CGCTCATCTTAGGCTTTGTATTTG (SEQ ID NO: 18), Ccr8 F:

AGTGGGCAGCTCTGAAAC (SEQ ID NO: 19), Ccr8 R: GCTCCATCGTGTAATCCATCG

(SEQ ID NO: 20), 1110 F: AGCCGGGAAGACAATAACTG (SEQ ID NO: 21), 1110 R:

GGAGTCGGTTAGCAGTATGTTG (SEQ ID NO: 22), Argl F:

AAGAATGGAAGAGTCAGTGTGG (SEQ ID NO: 23), Argl R:

GGGAGTGTTGATGTCAGTGTG (SEQ ID NO: 24), Ccr2 F:

GCTCTACATTCACTCCTTCCAC (SEQ ID NO: 25), Ccr2 R: ACCACTGTCTTTGAGGCTTG (SEQ ID NO: 26), Ccl5 F: GGGTACCATGAAGATCTCTGC (SEQ ID NO: 27), Ccl5 R: TCTAGGGAGAGGTAGGCAAAG (SEQ ID NO: 28), Ccr5 F:

TCCAGCAAGACAATCCTGATC (SEQ ID NO: 29), Ccr5 R: AACCATTCCTACTCCCAAGC

(SEQ ID NO: 30) [Hamster] Tbp F: CCCTTGTACCCTTCACCTATG (SEQ ID NO: 31), Tbp R:

ACATCCAAGATTCACCGTGG (SEQ ID NO: 32), Ccl5 F:

GCAAGGAAAGCAAATGGAGAC (SEQ ID NO: 33), Ccl5 R: GTGCTGGTTTCTTGGGTTTG

(SEQ ID NO: 34), Ccr5 F: GACATCTACCTGCTCAACCTG (SEQ ID NO: 35), Ccr5 R:

AACCAATGTGATAGAGCCCTG (SEQ ID NO: 36), Ccrl F:

CTCCTTCTCAGAGTTGTCACAG (SEQ ID NO: 37), Ccrl R:

GCACAAGACACAGAACACAAG (SEQ ID NO: 38), Ccl4 F:

TCCTGACCAGAAAAGGCAAG (SEQ ID NO: 39), Ccl4 R: AGCTCAGTTCAACTCCAAGTC

(SEQ ID NO: 40). qPCR assays performed for the quantification of gene expression in the in vitro models were done in 3 biological replicates. Expression of genes of interest were normalized to that of a housekeeping gene using the comparative Cq method, where using the comparative Cq method: 2-ACq, where ACq = Cq Target gene - Cq Housekeeping gene. For human samples either HPRT1 or ACTB was used as a housekeeping gene. For mouse and hamster samples, Hprt and Tbp were used respectively. Where samples were normalized to mock infected samples, ACq of infected replicates were exponentially transformed to 2 -ACq before being averaged and the standard deviation determined. The mean of infected samples was then compared to that of the corresponding uninfected (mock treated samples), such that the final ratio of ACqlnfected / ACqUninfected was determined. This method takes into account effects associated with experimental treatment. Statistical significance in gene expression was estimated with Graphpad Prism 8.0 software, and determined using two-tailed Student’ s t test under the assumption of equal variances between groups. Data are shown as ± SD. qPCR assays performed for gene expression analysis in the lungs of infected animals were done with 3-4 biological replicates (3-4 infected animals/condition). Expression of genes of interest were normalized to that of a housekeeping gene using the comparative Cq method, where using the relative Cq method: 2-ACq, where ACq = Cq Target gene - Cq Housekeeping gene. Statistical significance in gene expression was estimated with Graphpad Prism 8.0 software, and determined using one or two-tailed Student’s t test under the assumption of equal variances between groups. Tests used are indicated in the legends. Data are shown as ± SEM.

Illumina short read RNA sequencing analyses

After adaptor removal with cutadapt (Martin, 2011) and base-quality trimming to remove 3 'read sequences if more than 20 bases with Q < 20 were present, paired-end reads were mapped to the SARS-CoV-2 and human (hg38) or hamster (Mesocricetus auralus: MesAurl.0) reference genomes with STAR. Gene-count summaries were generated with featureCounts (Liao et al., 2014). A numeric matrix of raw read counts was generated, with genes in rows and samples in columns, and used for differential gene expression analysis with the Bioconductor Limma package (Ritchie et al., 2015) after removing genes with less than 50 total reads across all samples or of less than 200 nucleotides in length. Normalization factors were computed on the filtered data matrix using the weighted trimmed mean of M-values (TMM) method, followed by voom (Law et al., 2014) mean-variance transformation in preparation for Limma linear modeling. To specifically identify the effect of siRNA mediated TOPI depletion on the inflammatory responses to SARS- CoV-2 in A549-ACE2 cells shown in Figure 3A-3H, the inventors used interaction model (siTOPl_Infected:siTOP_uninfected - siSCR_Infected:siSCR_uninfected or no_siRNA_infected:no_siRNA:uninfected - siSCR_Infected:siSCR_uninfected), that takes into account basal differences between conditions. Gene ontology analysis were performed with clusterProfiler (Yu et al., 2012). To identify TPT dependent gene expression changes in infected hamsters shown in Figure 5A-5G, the inventors performed pairwise contrast between experimental groups (i.e: TPT D4 - DMSO D4; TPT D6 - DMSO D6). Pairwise comparisons were then performed between treatment groups and eBayes adjusted P values were corrected for multiple testing using the Benjamin-Hochberg (BH) method and used to select genes with significant expression differences (fold change > 1.5, adjusted P value < 0.05). For gene ontology analysis in hamsters, hamster gene ids were converted to available human orthologs using ENSEMBL, and inputted into clusterProfiler (Yu et al., 2012) program in R.

GSEA analysis for gene signatures in TPT treated hamsters

The inventors identified TOPI inhibitor gene signatures from TPT-treated Syrian hamsters infected with SARS-CoV-2. The inventors defined the up- and downregulated signatures as genes differentially expressed after 4 or 6 days of treatment (log2|FC| > 1, FDR = 10%). The inventors converted hamster genes to available human orthologs using ENSEMBL (Release 101). The inventors downloaded normalized transcript expression from targeted RNA-seq (398 genes) on lung autopsy tissue from COVID19 patients (16 patients, 34 samples), normal lung tissue (6 patients, 17 samples), and lung tissue from bacterial or viral pneumonia (4 patients, 5 samples) (Nienhold et al., 2020; GEO accession: GSE151764). Gene set enrichment analysis (Subramanian et al., 2005) was performed using the R package fgsea (Korotkevich et al., 2019). The inventors used Tukey’s multiple comparison test to identify significant differences in mean normalized enrichment scores.

For gene set enrichment analysis of lung-cell-type gene, the inventors downloaded UMI counts of single-cell RNA-seq of bronchoalveolar lavage fluid (BALF) from patients with moderate and severe COVID19, along with healthy controls (Liao et al., 2020). The inventors removed a sample from a patient with severe COVID19 identified to be co-infected with HPMV (Bost et al., 2020). The inventors removed cell doublets from individual patient samples using DoubletFinder (McGinnis et al., 2019). The inventors integrated patient samples using canonical correlation analysis in Seurat (Stuart et al., 2019). The inventors aggregated UMI counts for each cell-type from each patient sample, keeping ”pseudo-bulk” samples made up of at least 10 cells. Pseudo-bulk counts were robustly normalized with DESeq2 (Love et al., 2014)and gene expression was Z-scored across cells. The inventors performed GSEA (Subramanian et al., 2005) using the R package fgsea (Korotkevich et al., 2019).

ChlP-seq analysis

ChlP-seq datasets were processed and analyzed using an in-house automated pipeline (github.com/MarioPujato/NextGenAligner). Briefly, basic quality control for raw sequencing reads was performed using FASTQC (version 0.11.2) (bioinformatics.babraham.ac.uk/projects/fastqc). Adaptor sequences were removed using Trim Galore (version 0.4.2) (www.bioinformatics.babraham.ac.uk/projects/trim_galore/), a wrapper script that runs cutadapt (version 1.9.1) to remove the detected adaptor sequence from the reads. The quality-controlled reads were aligned to the reference human genome (hgl9/GRCh37) using bowtie2 (version 2.3.4.1) (Langmead and Salzberg, 2012). Aligned reads were then sorted using samtools (version 1.8) (Li et al., 2009) and duplicate reads were removed using picard (version 1.89) (broadinstitute. github.io/picard/). Peaks were called using MACS2 (version 2.1.0) (github.com/macs3-project/MACS ) (Zhang et al., 2008) with the control/input aligned reads as background (callpeak -g hs -q 0.01 -broad -c input/control). ENCODE blacklist regions (Amemiya et al., 2019) were removed using the hgl9-blacklist.v2.bed.gz file available at github.com/Boyle- Lab/Blacklist/tree/master/lists.

The ChlP-seq experimental design consisted of triplicates experiments for each condition (Ohr, 8hr, 24hr infections). PCA analysis indicating strong agreement between experimental replicates and clear separation between conditions (Figure 2A). Sequencing reads from replicates were thus combined, and alignment and peak calling was again performed as described above. For differential peak analysis, the union set of all peaks from these three conditions was generated using bedtools (Quinlan and Hall, 2010). For each of the resulting genomic regions, read counts were obtained for all 9 replicates. These read counts used as input to DESeq2 (Love et al., 2014). A fold change cutoff of greater than or equal to 1.5 and an FDR-corrected p value cutoff of less than or equal to 0.05 were used to identify differential peaks for each pairwise comparison between conditions. The inventors used the HOMER suite of tools (Heinz et al., 2010), modified to use a log base two scoring system and to include the large set of human motifs contained in the CisBP database (build 2.0) (Lambert et al., 2019) to identify enriched motifs within the sequences of differential and shared ChlP-seq peaks. To minimize redundancy, motifs were grouped into classes using the following procedure. Each human transcription factor was assigned the single best p value obtained for any of its corresponding motifs. Transcription factors with identical best motifs were merged then into a single class.

HiC analysis

Hi-C data was processed as described in Heinz et al. (2018). Briefly, Hi-C reads were trimmed at MboI/DpnII recognition sites (GATC) and aligned to the human genome (GRCh38/hg38) using STAR (Dobin et al., 2013), keeping only read pairs that both map to unique genomic locations for further analysis (MAPQ > 10). All PCR duplicates were also removed. PCA analysis of Hi-C experiments used to define chromatin compartments were performed with HOMER (Lin et al., 2012). For each chromosome, a balanced and distance normalized contact matrix was generated using window size of 50 kb sampled every 25 kb, reporting the ratios of observed to expected contact frequencies for any two regions. The correlation coefficient of the interaction profiles for any two regions across the entire chromosome were then calculated to generate a correlation matrix (also visualized in Figure 1 A). This matrix was then analyzed using Principal Component Analysis (PCA) from the prcomp function in R (r-proj ect.org), and the eigenvector loadings for each 25 kb region along the first principal component were assigned to each region (PCI values). The PCI values from each chromosome were scaled by their standard deviation to make them more comparable across chromosomes and analysis parameters. For each chromosome, PCI values are multiplied by -1 if negative PCI regions are more strongly enriched for active chromatin regions defined by H3K27ac peaks to ensure the positive PCI values align with the A/permissive compartment (as opposed to the B/inert compartment). chrY was excluded from the PCA analysis due to its small size and high repeat content. Balanced, normalized Hi-C contact maps were generated at 25 kb resolution for visualization (Figure 1A). Assignment of PCI values to Gencode gene promoters and other features was performed using HOMER’s annotatePeaks.pl function using the results from the PCA analysis.

Promoter capture Hi-C analysis Sequencing data from three biological replicates of PCHi-C at each of the three time points were aligned and quality-controlled with Hi CUP (Wingett et al., 2015). DpnII fragment-level reads were pooled over consecutive fragments over the total length of at least 5k, except for the baited promoter fragments that were left unbinned. To achieve a balanced dataset for the analysis of promoter interaction dynamics across time points, sequencing data for each replicate were subsampled to a similar number of HiCUP-processed valid captured reads per time point. Significant interactions were then detected for each time point jointly across the replicates by CHICAGO (Cairns et al., 2016), with minNPerBait set to 90 and all other parameters left at defaults.

A peak matrix was generated listing the CHICAGO scores at each time point for all interactions that exceeded a CHICAGO score cutoff of 5 in at least one time point. K-means clustering was used to partition the peak matrix into 7 clusters based on arcsinh-transformed CHICAGO scores, corresponding to interactions detected in a single time point (“Oh,” “8h,” “24h”), two time points (“0+8hpi,” “0+24hpi,” “8+24hpi”) or all time points (“0+8+24hpi”). To minimize the impact of false-negative calls at each time point on cluster assignment, the inventors additionally called interactions in each full-sized single replicate and filtered the above clusters to remove interactions that had CHICAGO scores above 3 in any single replicate/time point, for which the corresponding cluster was negative (e.g., interactions in the Ohpi cluster were filtered out if they had scores > 3 in any of the single-replicate 8hpi or 24hpi calls, etc.). This filtered interaction set was then curated based on their k-means cluster assignment into three categories: lost (“Ohpi” and “0+8h”), retained (the “0+8+24hpi” cluster) and gained (“8+24hpi” and “24hpi”), respectively, upon infection.

To assess the relationship between H3K27ac dynamics and changes in promoter-enhancer interactions at 0 versus 24 hpi, the inventors used Fisher’s test on 3x3 contingency tables between the “lost” (log2FC < -2; padj < 0.05), “constant” (padj > 0.1; baseMean > 50) and “gained” (log2FC > 2; padj < 0.05) H3K27ac peaks and the promoter interaction categories defined as above. Interactions without H3K27ac ChIP peaks at PIRs at either 0 or 24 hpi were removed from the analysis. Results were presented as heatmaps, with each combination of expression and promoter interaction category color-coded by the log-odds ratio (LORs) for the given versus the other two expression and promoter interaction categories combined, respectively. Confidence intervals (Cis) for the LORs were computed based on Fisher’s exact test, with LORs whose Cis cross zero greyed out on the heatmaps.

To assess the relationship between gene expression dynamics and change in the number of connected active enhancers, the inventors used the same promoter interaction and H3K27ac dynamics categories, and additionally classified genes into “down” (log2FC < 1, padj < 0.05), “neutral” (|log2FC < 0.5|, padj > 0.2) and “up” (log2FC > 1, padj < 0.05) at 24 versus 0 hpi. For each gene, change in the number of connected active enhancers C was computed as follows:

C = #(retained interactions with gained H3K27ac peaks) + #(gained interactions with gained H3K27ac peaks) + #(gained interactions with constant H3K27ac peaks) - #(retained interactions with lost H3K27ac peaks) - #(lost interactions with lost H3K27ac peaks) - #(lost interactions with constant H3K27ac peaks).

Genes were partitioned into three categories based on this quantity: “reduced” (C < 0), “constant” (C = 0), “increased” (C > 0). The relationship between these categories and the gene expression category (“down,” “neutral,” “up”) was probed and visualized using 3x3 contingency tables in the same manner as above.

Results

Cell signaling cascades converge on chromatin to dictate changes in gene expression upon cell-intrinsic and extrinsic signals. Gene expression programs are controlled by transcriptional activity, which is, in turn, influenced by changes in chromatin structural (physical movement of genes into chromatin compartments or enhancer-promoter interaction) and functional (epigenetic modifications that demarcate regions of gene activity) organization.

Comparison between how a signal is received and decoded at the chromatin level and the final output of gene expression can elucidate how a pathogen alters the host gene expression program during infection. More importantly, it can instruct the targeting of chromatin factors in order to achieve a partial suppression (buffering) of infection-induced gene expression programs.

In an effort to understand how SARS-CoV-2 alters chromatin function and gene activity upon infection, the inventors performed a combined structural and epigenetic analysis during infection. To first characterize structural chromatin changes, the inventors performed Hi-C on uninfected and SARS-CoV-2-infected A549 cells expressing the human SARS-CoV-2 entry receptor angiotensin-I-converting enzyme 2 (ACE2) (A549-ACE2) at both early (8 h) and late (24 h) time points post-infection. Reproducible results were achieved across replicates for all time points (not shown). The inventors’ analysis indicates that large portions of the genome alter their global interaction profiles as infection progresses, culminating in a major redistribution of chromatin associated with either the active (A) or inactive (B) compartments at the 24-h time point (Figure 1A).

Notably, compartment changes result in a shortening of the domain size, with large linear stretches of A and B compartment chromatin generally becoming divided into A/B subdomains (Figures 1 A and IB). To determine whether these topological effects are unique to SARS-CoV-2, the inventors performed temporal Hi-C profile during infection by influenza A virus (IAV). Our results indicate that similar to SARS-CoV-2 infection, influenza virus infection causes A-B and B-A changes and domain shortening at later time points post-infection (Figures 2A and 2B). These results indicate that chromosomal compartmentalization is affected by infection-induced signals, suggesting that large chromatin domains (megabases) lose structural constraints imposed by cohesin (Rao et al., 2017; Schwarzer et al., 2017).

While the resolution limit of Hi-C does not allow to us characterize single genes in A and B domains, the inventors could still determine if the large-scale structural changes were associated with functional changes to chromatin organization and transcriptional activity. To do this, the inventors performed chromatin immunoprecipitation sequencing (ChlP-seq) for histone 3 lysine 27 acetylation (K27ac), an epigenetic mark found at active regulatory regions (promoters and enhancers) that is commonly used to monitor dynamic changes in transcriptional activation. ChlP- seq for K27ac was performed in uninfected and infected A549-ACE2 cells at both early (8 h) and late (24 h) time points post-infection. The inventors’ analysis showed high correlation of K27ac levels between replicates (Figure 2C). While some regions of the genome showed no change in K27ac levels upon infection (cluster i), there were significant changes in K27ac levels at promoters and other regulatory regions during the course of infection (clusters ii-vii; Figure 1C). Regions that significantly gain (clusters v and vi; Figure 1C) and lose K27ac (clusters ii and iii; Figure 1C) over the course of infection were detected. The inventors then combined structural and functional information by overlaying the changes in K27ac and DNA topology. The inventors’ analysis indicates that regions that gain or lose K27ac are enriched in chromatin domains that move from B-A (inactive to active) or A-B (active to inactive) compartments, respectively (Figure IE). This partitioning occurs dynamically throughout infection (Figure IE; compare 8 h versus 24 h) and is associated with gene expression activity (Figure IF). These results suggest that the dynamic restructuring of genome compartmentalization by SARS-CoV-2 infection is highly associated with transcriptional activity.

To characterize whether a unique set of transcription factors might drive these changes, the inventors performed motif enrichment analysis of regions displaying differential H3K27ac activity. The inventors’ results indicate that repressed regions lack unique enrichment of immune- specific transcription factors at promoters, enhancers, and other putative regulatory regions (Figure 2D). Regions that gain K27ac signal display a strong enrichment for motifs recognized by nuclear factor KB (NF-KB) (red bars), API (orange bars), and to a lesser extent interferon regulatory factor (IRF) and signal transducer and activator of transcription (STAT) transcription factors (green and blue bars respectively, clusters v and vi; Figure 2D). These data suggest that the epigenetic landscape established as a result of the infection (and viral antagonism) is skewed toward the usage of regulatory regions controlling inflammatory responses

To then provide direct evidence that identified regulatory regions do indeed contact a given gene promoters to sustain gene transactivation, the inventors performed promoter capture Hi-C. This technique measures enhancer-promoter interactions at a single-gene resolution. Promoter capture Hi-C was conducted in SARS-CoV-2-infected A549-ACE2 cells at 8 and 24 hpi, as well as in uninfected cells (0 hpi). Following alignment and quality control, the inventors detected a total of 63,804 interactions between 11,244 promoters and 40,387 promoter-interacting regions (PIRs) across the three time points using CHICAGO (Cairns et al., 2016). Based on unsupervised clustering and post hoc filtering, the inventors classified the promoter interactions into three broad categories based on their dynamics upon infection: 10,983 “lost,” 11,022 “retained,” and 11,334 “gained” (see Methods section above for details).

To obtain a gene-level view, the inventors computed the change in the number of active enhancers connected to each gene between 0 and 24 hpi, accounting for promoter interaction rewiring and changes in enhancer activity at the PIRs of either preexisting or novel contacts. The inventors found a significant association between this property and gene expression dynamics (Figure 1G; Fisher’ s test p = 0.008). In particular, an increase in the number of promoter-connected active enhancers associated with upregulation of their respective target genes (Figure 1G; log-odds ratio [LOR] = 0.74; 95% confidence interval [CI], 0.13-1.30). Examples of the detected promoter interaction profiles at each time point for TIP ARP and NFKIBIZ genes that are strongly induced upon infection (log2 fold change [log2FC] > 1) are shown in Figures 1H and 2E, respectively.

Overall, the inventors’ results characterized the epithelial cell gene expression programs upon infection with respect to global topological effects, as well as local topological and epigenetic changes that dictate enhancer-promoter rewiring and gene activity. The inventors’ results indicate that because of infection-induced epigenetic remodeling and the effect of viral antagonism geared to suppress antiviral responses (Banerjee et al., 2020b; Lei et al., 2020), infection induces genes that are mostly inflammatory. These genes are regulated by specific repertoire of transcription factors and display prototypical epigenetic features of transactivation, suggesting that unique host chromatin factors dictate the magnitude of their transcriptional induction.

TOPI controls SARS-CoV-2-induced gene expression response

To determine whether chromatin factors can control the transactivation of SARS-CoV-2- induced genes, the inventors focused our attention on TOPI, a factor known to activate bacterial - and viral-infection-induced genes (Rialdi et al., 2016). The inventors performed small interfering RNA (siRNA)-mediated knockdown of TOPI (siTOPl) along with control siRNA (siSCR) in A549-ACE2 cells, followed by mock treatment (PBS only; uninfected controls) or infection with SARS-CoV-2. Gene expression changes in these cells were quantified by RNA sequencing (RNA- seq) at 24 h post-infection (hpi). The inventors’ analyses indicate that siTOPl treated cells had a distinct transcriptional response to the virus (Figure 2A) as compared to no siRNA or siSCR- treated cells, resulting in selective suppression of many infection-induced genes (fold change > 1.5, adjusted p value [padj] < 0.05; Figures 2B and 2C). Gene Ontology (GO) pathway analyses of genes that are downregulated upon TOPI knockdown suggest that many of these genes are involved in inflammatory responses (Figure 2C). The inventors further validated these results by qPCR for representative genes IL-6, CXCL2, CXCL3, CXCL8, EGR1, and TNFAIP3 (Figure 2D), verifying that depletion of TOPI protein levels (Figure 2E) reduces the expression of these inflammatory genes. To understand the specificity of TOPI, the inventors profiled infection-induced and TOPI dependent genes identified in Figure 2B with respect to their structural and epigenetic status at basal state and after infection. As controls, the inventors used all expressed genes or genes that are also induced by infection but unaffected by TOPI depletion (TOPI independent, “Indep”). The inventors’ analysis indicates that genes that depend on TOPI for their upregulation are induced to higher levels then TOPI -independent genes upon infection (Figure 2F). TOPI -dependent genes also displayed greater shifts toward active chromatin compartment (positive delta PCI levels; Figure 2G) and increases in K27ac signals (positive delta H3K27ac levels; Figure 2H) and an increase in number of enhancers (Wilcoxon p = 0.015) compared to TOPI -independent genes. These differences are typical features of genes that are amenable for selective inhibition by transcriptional and epigenetic inhibitors (Marazzi et al., 2018).

To determine whether inhibition of TOPI activity phenocopies depletion of TOPI and dampens inflammatory gene expression, the inventors treated SARS-CoV-2-infected A549-ACE2 cells with topotecan (TPT), a US Food and Drug Administration (FDA)-approved TOPI inhibitor. TPT treatment, unlike DMSO treatment, dampens the expression of IL-6, CXCL2, CXCL3, CXCL8, EGR1, and TNFAIP3 (Figure 4A), similar to what was observed in siTOPl -treated cells (Figures 2B and 2D). Reduced inflammatory gene expression was not a result of a direct antiviral effect of TPT. Unlike remdesivir, a drug with known antiviral activity toward SARS-CoV-2, TPT does not inhibit viral replication (Figures 4B and 4C), suggesting that its activity is directed toward suppression of host gene expression.

TOPI inhibition suppresses lung inflammation and lung damage in infected hamsters

To determine if inhibition of TOPI activity can dampen inflammatory gene expression in vivo, the inventors assessed the effects of TPT treatment in the golden Syrian hamster model (Munoz-Fontela et al., 2020) (hereafter referred as hamster), a nonlethal model of SARS-CoV-2 infection (Imai et al., 2020; Sia et al., 2020).

The inventors treated SARS-CoV-2-infected hamsters with either vehicle control (DMSO) or 10 mg/kg TPT at days 1 and 2 post-infection. Lungs from these animals were then collected for histology and transcriptome analysis at days 4 and 6 post-infection (Figure 5A). Clustering of RNA-seq reads using principal-component analysis (PCA) indicates that the gene expression profiles under the three conditions (uninfected, infected/DMSO treated, and infected/TPT treated) partition based on infection, treatment status, and the temporality of the infection (days 4 and 6), with each replicate clustering in close proximity to its counterpart (Figure 3B).

Differential expression (DE) analysis showed that TPT suppresses inflammatory gene expression in the lungs of infected hamsters (Figures 5C and 5D). Clustering of the DE data indicates that the gene expression profiles of TPT-treated infected lungs are more similar to that of the noninfected lungs rather than infected ones (Figure 5C). The GO categories associated with the TPT-suppressed genes indicates specific inhibition of virus-induced and inflammatory genes at both day 4 and day 6 post-infection (Figure 5D).

Histopathological analysis of infected, DMSO vehicle-treated hamster lungs at days 4 and 6 post-infection displayed diffused alveoli destruction, bronchiolar epithelium cell death, and hemorrhaging, coupled with massive immune cell infiltration and exudation, typically associated with increased expression of inflammatory mediators and recruitment of immune cells during infection (Figures 5E and 5F). On the contrary, TPT treatment diminished pathological features of lung damage in infected animals. Lungs from these animals did not have conspicuous alveolar space infiltration, exudation, or hemorrhaging at both days 4 and 6 post-infection (Figures 5G and 5H).

To determine the clinical significance of our observations, the inventors then asked if the genes that were downregulated by TPT treatment in SARS-CoV-2-infected hamsters also corresponded to immunopathological gene signatures that have been observed in COVID-19 patients. Cross-comparison of our results with the gene expression profiles in human lungs isolated from autopsies of COVID-19 patients and uninfected control lungs (Nienhold et al., 2020) indicated that TPT-suppressed genes are hyperactivated in patients who succumbed to infection (Figures 6A and 6B). In fact, TPT-inhibited genes are genes that are upregulated in COVID-19 lung autopsy tissue relative to healthy control (p < IE-3) (Figure 4A, left panel), while genes upregulated by TPT are downregulated in COVID-19 lung relative to control (p < IE-7) (Figure 6A, right panel). These results suggest that treatment with TPT might reverse COVID-19-induced lung gene expression responses. The gene expression profiles of TPT-inhibited genes in individual patients (heatmap, Figure 6B) and the corresponding gene set enrichment scores are shown in Figure 6B.

SARS-CoV-2-infected epithelial cells induce limited type I and type II interferon responses (Blanco-Melo et al., 2020). Since the inventors observed that these genes are downregulated in the presence of TPT in infected hamster lungs (Figure 5D), this suggested that TPT may also act on immune cells that are recruited to and/or activated in the lung upon infection. To determine if the TPT-dependent transcriptomic signature the inventors observed is driven by suppression of inflammatory genes solely in epithelial cells or also from immune cells, the inventors performed gene set enrichment analyses (GSEA) of gene expression profiles in immune cell types derived from single cell RNA seq (scRNA-seq) of the bronchoalveolar lavage fluid (BALF) from CO VID- 19 patients with severe disease or from healthy controls (Liao et al., 2020). Doing so allowed the inventors to characterize immune-cell-type-specific transcriptome signatures during infection with SARS-CoV-2. The inventors’ analyses indicate that a subset of genes suppressed by TPT in the animal model are expressed specifically by immune cells (macrophage, neutrophil, and dendritic cells) isolated from severe COVID-19 cases and not in healthy controls (Figures 7A and 7B). Notably, an interferon-stimulated gene (ISG) signature appears to mainly reside in phagocytes; however, the nature of the cells that produce the interferons and the nature of the interferons themselves that drive ISGs remain largely unknown.

Immune cells are unlikely to be productively infected by SARS-CoV-2 (Banerjee et al., 2020a), so their infection-induced gene programs targeted by TPT treatment are most likely driven by PAMP/DAMP-dependent stimulation (e.g., viral RNA released from apoptotic cells) or cytokine signaling from bystander infected epithelial cells. To determine if this is true, the inventors performed in vitro experiments in THP-1, a human monocytic cell line. The inventors’ data indicate that TPT suppresses, in a concentration-dependent manner, inflammatory genes in response to purified SARS-CoV-2 viral RNA or supernatant from productively infected cells (Figure 7C). The inventors were unable to detect productive SARS-CoV-2 infection of these cells, in line with a previous report (Banerjee et al., 2020a). Overall, the inventors’ analyses support the idea that TPT is active in both epithelial and immune cells and suppresses inflammatory gene programs induced by the infection. The inventors next sought to validate whether lower dosages of TPT, which are associated with negligible cytostatic effects (Guichard et al., 2001; Houghton et al., 1995; Nemati et al., 2010), were effective in suppressing SARS-CoV-2-infecti on-induced inflammation. The inventors performed a parallel experiment to the one described in Figure 5 A using 5-fold-lower dose of TPT (2 mg/kg) and the same regimen of TPT treatment at days 1 and 2 post-infection (Figure 8A). Lungs from infected and treated hamsters were assayed at day 4 post-infection.

Animals treated with TPT had reduced lung to body weight ratios post-infection (Figure 8B), which suggest reduced pulmonary edemas in these animals. In line with this, histopathological analyses showed reduced broncho-pneumonia (Figures 8C-8E) and immune cell infiltration (Table 1) in the lungs of TPT-treated animals when compared to DMSO-treated ones. qPCR analysis of representative genes also suggested reduced expression of inflammatory genes in TPT-treated animals (Figure 8F).

Table 1. Lung Scoring.

Gene suppression and reduced lung damage occurred despite of a moderate 3 -fold increase virus growth at day 4, where both TPT- and DMSO-treated lungs display similar viral titer. By day 8, virus growth in both TPT and DMSO treatment ceased to an undetectable level (Figure 8G), suggesting that TPT treatment does not change the overall kinetics of viral clearance.

Overall, these results suggest that lower doses of TPT treatment can still effectively suppress the expression of inflammatory molecules and ameliorate inflammation-induced pathology during SARS-CoV-2 infection. These results therefore support the hypothesis that TPT suppresses SARS-CoV-2-induced lung inflammation in vivo.

TOPI inhibition therapy suppresses SARS-CoV-2 morbidity and lethality in transgenic mice

To further verify the results, the inventors extended the studies to a complementary model and evaluated the effects of TPT treatment in transgenic mice that express the human ACE2 receptor under the cytokeratin 18 gene promoter (K18-hACE2). This mouse strain is susceptible to SARS-CoV-2 infection and displays a disease progression profile that shares many features of severe COVID-19 (Winkler et al., 2020). Importantly, loss of pulmonary function and weight loss in these mice occurs after the peak of viral replication and coincides with infiltration of immune cells (monocytes, T cells, and neutrophils) in the lung and alveolar spaces at day 4 post-infection (Winkler et al., 2020). As such, K18-hACE2 has been suggested as a model to define the basis of SARS-CoV-2-induced lung disease and test immune and antiviral countermeasures (Bao et al., 2020; Winkler et al., 2020).

To test whether TPT-mediated reduction of inflammation provides a protective effect in infected K18-hACE2 mice, the inventors performed three different regimes of TPT treatments, labeled as early, intermediate, and late, to respectively describe dosing of the inhibitor at 2 mg/kg on days 1+2, 3+4, or 4+5 post-infection respectively (Figures 9A and 10A).

The rationale behind this approach is that inhibition of inflammation could be detrimental during the early phases of the infection. The optimal protective effect of inhibiting inflammation should be achieved during the hyper-inflammatory phase of the disease, which would coincide with the later stage of infection. Late suppression of inflammatory response would have the added benefit of not altering early phases of the antiviral response. Indeed, the inventors’ results showed that early and intermediate treatment of TPT is ineffective in reducing the morbidity and mortality caused by SARS-CoV-2 infection (Figures 10B and 10C), despite intermediate TPT treatment significantly delaying the onset of weight loss (p = 0.0028, two-way ANOVA [mixed effects]).

Strikingly, the inventors found that late TPT treatment provided significant survival benefit (p = 0.0085, log-rank Mantel-Cox) to infected mice when compared to DMSO-vehicle-treated controls (Figure 9B). In addition, TPT significantly improved morbidity outcomes in infected mice. Despite an overall delay in weight loss kinetics in TPT mice (Figure 9C), fewer mice lost >15% of their body weight compared to DMSO-treated mice (Figure 9D; p = 0.0409, Fisher’s exact test). Importantly, TPT administration did not significantly change viral titers immediately after treatment (day 7 post-infection, Figure 9E), nor did it delay viral clearance kinetics, as no detectable virus, as measured by plaque assays, was found in the lungs of both TPT- and DMSO- treated mice by day 14 post-infection (Figure 9E). As expected, TPT treatment was also associated with suppression of inflammatory gene expression in the lung, as indicated by qPCR of representative genes (Figure 9F) and supporting our initial hypotheses.

Finally, the inventors assessed longer-term effects of TPT treatment in mice. TPT-treated mice survived past 9 weeks post-infection, with post-recovery weight gain levels (Figure 9G) similar to those of DMSO-treated mice. Levels of neutralizing antibody activity in the blood of DMSO- and TPT-treated mice were similar at 5 weeks post-infection (Figure 9H), suggesting that TPT treatment does not negatively impact adaptive immune responses.

Overall, these results indicate that inhibition of hyper-inflammation by therapeutic administration of TPT can rescue K18-hACE2 mice from lethal SARS-CoV-2 infection.

Discussion

Although the pathophysiology of SARS-CoV-2 has not yet been fully characterized, it has been observed that SARS-CoV-2 infection triggers hyper-activation of pro-inflammatory cytokines (IL-6, IL-ip, and tumor necrosis factor a [TNF-a]) and chemokines (CXCL8, CXCL9, CXCL10, and CCL2) (Huang et al., 2020; Lucas et al., 2020; Merad and Martin, 2020; Tang et al., 2020; Zhou et al., 2020a). The increased level of inflammatory molecules has been shown to correlate with COVID-19 disease severity (Del Valle et al., 2020; Moore and June, 2020). While the exact mechanism and cell-type-specific contributions to hyper-inflammation still needs to be fully elucidated, monocytes, macrophages, and dendritic cells are primary candidates and have been reported to contribute to the cytokine-mediated immunopathology seen in human (Del Valle et al., 2020; Giamarellos-Bourboulis et al., 2020; Moore and June, 2020). This is supported by previous studies of the immune response against SARS-CoV-1 and Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infections (Cheung et al., 2005; Wong et al., 2004). Additionally, non-myeloid cells have been recently shown to contribute to the hyper-inflammatory program (Zhou et al., 2020b). Elevated inflammatory responses contribute to sepsis and multiorgan failure, major causes of death from COVID-19 (Zhou et al., 2020a). Therefore, treatments that can suppress host inflammatory response might be effective therapeutic strategies for COVID- 19. In this light, it is important to highlight that glucocorticoids (dexamethasone, methylprednisolone, and hydrocortisone), which act as suppressors of systemic inflammation, have been reported to ameliorate the outcome of COVID-19, especially in hospitalized patients who require supplemental oxygen (WHO REACT Working Group et al., 2020).

Chromatin structure and function upon infection

While knowledge of SARS-CoV-2 pathogenesis is expanding rapidly, little is known about how epigenetic modifications and genome structure are affected by infection and in what capacity they affect gene activity (Liu et al., 2020). The data suggest that SARS-CoV-2 infection imposes both global and local (gene-specific) effects on host chromatin, ultimately dictating gene induction and suppression, and the establishment of a gene expression program in the infected cell.

Regarding SARS-CoV-2-infection-induced compartment movement, the inventors hypothesize, without being bound by theory, that A-B (active to inactive) and B-A (inactive to active) switches are driven by transcriptional and epigenome activity. While A-B transitions are characterized by decreased K27ac at promoters and gene suppression, B-A is accompanied by increased K27ac at promoters and enhancers, enhancer-promoter interactions, and transcriptional induction. Gene suppression has functional consequences, as it affects many conventional infection-induced genes activated by STAT1/2 and IRF3 transcription factors. Suppression is likely a result of viral antagonism. Gene activation is the result of signal-induced transactivation and indicates that many cellular genes escape viral suppression during infection. One prominent example is a subset of inflammatory genes whose expression is driven by infection-activated transcription factor NF-KB. The proteins encoded by these genes are potent pro-inflammatory molecules and present systemically with high levels in severe COVID-19 patients (Del Valle et al., 2020; Moore and June, 2020). The selective and concerted induction of inflammatory genes provides the rationale for using epigenetic inhibitors to suppress their induction and establish a global anti-inflammatory state (Marazzi et al., 2018).

Inflammatory gene suppression therapy

The inventors show that the host enzyme TOPI promotes transcriptional activation of pro- inflammatory genes during SARS-CoV-2 infection. The inventors then demonstrate that TOPI inhibition limits the expression of inflammatory genes in the lungs of infected animals. Most importantly, TOPI inhibition decreases morbidity and morbidity in infected mice. The therapeutic effect can be achieved by drug administration 4-5 days following infection. The inventors showed that TOPI inhibition suppressed inflammation and reduced disease pathology in the lung using two doses of TOPI inhibition therapy with TPT at 2 mg/kg intraperitoneally. This equates to a 5- fold reduction from typical chemotherapeutic anti-cancer doses in rodent models (Guichard et al., 2001; Houghton et al., 1995; Nemati et al., 2010).

The suppression of inflammation in vivo is most likely the result of not only a dampened epithelial response but also neutrophil/monocytic cell activation and response. Based on these experiments and gene signature analyses of specific cell types, the inventors posit that TPT suppresses inducible transcriptional programs in both infected and bystander cells. Dampening highly inducible genes and sparing housekeeper genes is a typical feature of epigenetic inhibitors that act on signal-induced genes, which aside from the requirement of cofactors for their activation have unifying genomic features like high burst rates conferred by many regulatory enhancers (Chen et al., 2019; Fukaya et al., 2016; Marazzi et al., 2018; Senecal et al., 2014; Zabidi et al., 2015).

Lethal inflammation in severe COVID-19 has been associated with the dysregulation of multiple inflammatory genes, including IL-6, IL-1, and IL- 10. However, many of the current strategies proposed to treat severe COVID-19, such as anti -IL-6 (e.g., tocilizumab and sarilumab) or anti -IL- 1 (e.g., anakinra) inhibitors, are directed against single inflammatory mediators and specific gene expression programs. The effects of such drugs may be undermined by alternative gene activation pathways driven by other cytokines/transcription factors. In contrast, TPT functions to broadly dampen inflammatory gene expression programs, regardless of the cell or activation pathways. Inhibition of systemic inflammation using the glucocorticoid dexamethasone has been shown to provide survival benefit to severe COVID-19 patients, suggesting that this is indeed a viable strategy. That being said, it is important to note that TPT and glucocorticoids have different molecular targets and exert anti-inflammatory effects via different molecular mechanisms of action.

Finally, TPT and other TOPI inhibitors like irinotecan are widely available and FDA approved. Irinotecan is in the World Health Organization (WHO) list of essential medicines. They are inexpensive, and generic formulations exist throughout the world, making them easily accessible for immediate use. Overall, these results suggest that repurposing of TOPI inhibitor could be a valuable strategy to treat severe COVID-19.

EXAMPLE 2 - Combination Therapies for Treating SARS-CoV-2 Infection

The inventors next tested the efficacy of a combination of topotecan and remdesivir in treating SARS-CoV-2 in a hamster model of SARS-CoV-2 infection. Six hamsters were infected with 10⁵ TCIDso SARS-CoV-2 intranasal on day 0. Body weight and clinical signs were monitored daily, and nasal washes performed on days 0, 1, 3, and 5. Three hamsters were necropsied on days 3 and 5 post infection with samples of lung and blood taken. The groups of hamsters were treated as follows:

1. Treatment with Remdesivir alone (15 mg/kg; IP). Starting at day -1, once daily through day 4.

2. Treatment with Topotecan alone (1 mg/kg; IP). Starting at day +1, once daily through day 4.

3. Treatment with Remdesivir and Topotecan (same doses as above). Topotecan treatment was on day 1 and 2 post infection, Remdesivir treatment on day 3 and 4 post infection.

The Topotecan and Topotecan/Remdesivir treated animals also showed reduced lung lesions (Figure 12), specifically on Day 5 p.i.: Topotecan and Topotecan/Remdesivir treated animals had significantly less lung lesions when compared to Remdesivir or Mock-treated animals. Similarly, the treated animals showed smaller lung/body weight ratios when compared to Remdesivir or Mock-treated animals (Figure 12). This indicated less lung inflammation and lung disease. Less virus was shed by treated animals. On Day 3 p.i., treatment with Topotecan alone led to significant less virus shedding when compared to the other 3 treatment groups. On Day 5 p.i., treatment with remdesivir alone led to significant reduction of nasal shedding when compared to the other 3 treatment groups. Treatment with Topotecan alone is worse than the combination treatment with Topotecan/ Remdesivir (Figure 13). On Day 5 p.i., treatment with Remdesivir alone, combination of Topotecan/Remdesivir or mock-treatment led to significant reduction of virus loads in the lungs. Treatment with Topotecan alone did not reduce lung viral loads which are significantly higher than the other 3 treatment groups (Figure 13).

Treatment of SARS-CoV-2-infected hamsters with Topotecan alone post infection was shown to limit lung inflammation/pneumonia but led to increased viral replication and virus dissemination, suggesting that anti-inflammatory treatment may be followed by antiviral treatment (to suppress viral rebound). Treatment of SARS-CoV-2-infected hamsters with Remdesivir alone before infection limited virus shedding but not inflammation in the lung. Treatment of SARS-CoV-2-infected hamsters with a combination therapy of Topotecan and Remdesivir post infection did not lead to increased virus replication and at the same time limited lung inflammation. Without wishing to be bound by theory, it is suggested that the results shown herein are due to suppression of inflammation by TPT (or another anti-inflammatory therapeutic) followed by antiviral intervention with Remdesivir (or any other molecules that inhibit viral replication).

List of embodiments

The following is a non-limiting list of embodiments contemplated by the present invention.

1. A method for treating lung inflammation caused by a viral infection, the method comprising: administering a therapeutically effective amount of at least one compound that inhibits topoisomerase I activity; and administering a therapeutically effective amount of at least one anti-viral therapeutic.

2. The method of item 1, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of chemical and biological inhibitors and combinations thereof. 3. The method of any one of items 1 or 2, wherein the chemical inhibitors are selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof.

4. The method of any one of items 1 or 2, wherein the biological inhibitors are selected from the group consisting of: silencing or interfering nucleic acids specific to and/or capable of binding topoisomerase I; transcriptional regulators of topoisomerase I; translational regulators of topoisomerase I; and and post-translational regulators of topoisomerase I.

5. The method of any one of items 1-4, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of aptamers capable of binding an aptamer that binds to topoisomerase I or a nucleic acid encoding topoisomerase I.

6. The method of item 4, wherein the translational or post-translational regulator of topoisomerase I phosphorylates or dephosphorylates topoisomerase I.

7. The method of any one of items 1-6, wherein the viral infection is a coronaviral infection.

8. The method of item 7, wherein the coronaviral infection is a SARS-CoV-2 infection.

9. The method of any one of items 1-8, wherein the method includes co-admini strati on of at least one other therapeutic agent to aid in treating the lung inflammation.

10. The method of items 9, wherein the at least one co-administered therapeutic agent is selected from the group consisting of: therapeutic agents that block inflammation; one or more anti-tumor antibodies or antibodies directed at a pathogenic antigen or allergen; other immunomodulatory treatments; one or more bromodomain inhibitors; and one or more antibiotics, anti-fungal drugs, anti-parasitic drugs, or anti -protozoal drugs; and any combination thereof.

11. The method of any one of items 1-10, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of viral infection.

12. The method of any one of items 1-10, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of coronavirus.

13. The method of item 3, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

14. The method of any of items 1-13, wherein the at least one anti-viral therapeutic comprises remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

15. The method of any one of items 1-14, wherein the compound that inhibits Topi activity is administered before the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered.

16. The method of item 15, wherein the compound that inhibits Topi activity is administered in more than one dose.

17. The method of item 15 or 16, wherein the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered in more than one dose.

18. A method for treating lung inflammation caused by a viral infection, the method comprising: administering a therapeutically effective amount of a pharmaceutical composition comprising at least one compound that inhibits topoisomerase I activity; and administering a therapeutically effective amount of at least one anti-viral therapeutic.

19. The method of item 18, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of chemical and biological inhibitors and combinations thereof.

20. The method of any one of items 18 or 19, wherein the chemical inhibitors are selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof.

21. The method of any one of items 18 or 19, wherein the biological inhibitors are selected from the group consisting of: silencing or interfering nucleic acids and/or proteins or peptides specific to and/or capable of binding topoisomerase I; transcriptional regulators of topoisomerase I; translational regulators of topoisomerase I; and post-translational regulators of topoisomerase I.

22. The method of any one of items 18-21, wherein the at least one compound that inhibits topoisomerase I activity is an aptamer that binds to topoisomerase I or a nucleic acid encoding topoisomerase I.

23. The method of item 22, wherein the translational or post-translational regulator of topoisomerase I phosphorylates or dephosphorylates topoisomerase I.

24. The method of item 20, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

25. The method of any one of items 18-24, wherein the viral infection is a coronaviral infection.

26. The method of item 25, wherein the coronaviral infection is a SARS-CoV-2 infection.

27. The method of any one of items 18-26, wherein the method includes co-administration of at least one other therapeutic agent to aid in treating the lung inflammation. 28. The method of item 27, wherein the at least one co-administered therapeutic agent is selected from the group consisting of: therapeutic agents that block inflammation; one or more anti-tumor antibodies or antibodies directed at a pathogenic antigen or allergen; other immunomodulatory treatments; one or more bromodomain inhibitors; and one or more antibiotics, anti-fungal drugs, anti-parasitic drugs, or anti -protozoal drugs; and any combination thereof.

29. The method of any one of items 18-28, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of viral infection.

30. The method of any one of items 18-28, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of coronavirus.

31. The method of any one of items 19-30, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

32. The method of any one of items 18-31, wherein the at least one anti-viral therapeutic comprises remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

33. The method of any one of items 18-32, wherein the compound that inhibits Topi activity is topotecan.

34. The method of any one of items 18-33, wherein the compound that inhibits Topi activity is administered before the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered. 35. The method of item 34, wherein the compound that inhibits Topi activity is administered in more than one dose.

36. The method of item 34 or 35, wherein the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic is administered in more than one dose.

References

Amanat F., Stadlbauer D., Strohmeier S., Nguyen T.H.O., Chromikova V., McMahon M., Jiang K., Arunkumar G.A., Jurczyszak D., Polanco J. A serological assay to detect SARS-CoV-2 seroconversion in humans. Nat. Med. 2020;26: 1033-1036.

Amemiya H.M., Kundaje A., Boyle A.P. The ENCODE Blacklist: Identification of Problematic Regions of the Genome. Sci. Rep. 2019;9:9354.

Andre T., Louvet C., Maindrault-Goebel F., Couteau C., Mabro M., Lotz J.P., Gilles-Amar V., Krulik M., Carola E., Izrael V., de Gramont A. CPT-11 (irinotecan) addition to bimonthly, high- dose leucovorin and bolus and continuous-infusion 5 -fluorouracil (FOLFIRI) for pretreated metastatic colorectal cancer. GERCOR. Eur. J. Cancer. 1999;35: 1343-1347.

Banerjee A., Nasir J.A., Budylowski P., Yip L., Aftanas P., Christie N., Ghalami A., Baid K., Raphenya A.R., Hirota J. A. Isolation, Sequence, Infectivity, and Replication Kinetics of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg. Infect. Dis. 2020;26:2054-2063.

Banerjee A.K., Blanco M.R., Bruce E. A., Honson D.D., Chen L.M., Chow A., Bhat P., Ollikainen N., Quinodoz S.A., Loney C. SARS-CoV-2 Disrupts Splicing, Translation, and Protein Trafficking to Suppress Host Defenses. Cell. 2020;183: 1325-1339. e21.

Bao L., Deng W., Huang B., Gao H., Liu J., Ren L., Wei Q., Yu P., Xu Y., Qi F. The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature. 2020;583:830-833.

Blanco-Melo D., Nilsson-Pay ant B.E., Liu W.C., Uhl S., Hoagland D., Moller R., Jordan T.X., Oishi K., Panis M., Sachs D. Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell. 2020;181 : 1036-1045. e9. Bost P., Giladi A., Liu Y., Bendjelal Y., Xu G., David E., Blecher-Gonen R., Cohen M., Medaglia C., Li H. Host-Viral Infection Maps Reveal Signatures of Severe COVID-19 Patients. Cell. 2020;181:1475-1488. e!2.

Cairns J., Freire-Pritchett P., Wingett S.W., Varnai C., Dimond A., Plagnol V., Zerbino D., Schoenfelder S., Javierre B.M., Osborne C. CHICAGO: robust detection of DNA looping interactions in Capture Hi-C data. Genome Biol. 2016;17: 127.

Channappanavar R., Perlman S. Pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology. Semin. Immunopathol. 2017;39:529-539.

Channappanavar R., Fehr A.R., Vijay R., Mack M., Zhao J., Meyerholz D.K., Perlman S. Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage Responses Cause Lethal Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe. 2016;19:181-193.

Channappanavar R., Fehr A.R., Zheng J., Wohlford-Lenane C., Abrahante J.E., Mack M., Sompallae R., McCray P.B., Jr., Meyerholz D.K., Perlman S. IFN-I response timing relative to virus replication determines MERS coronavirus infection outcomes. J. Clin. Invest. 2019;129:3625-3639.

Chen L.F., Lin Y.T., Gallegos D.A., Hazlett M.F., Gomez-Schiavon M., Yang M.G., Kalmeta B., Zhou A.S., Holtzman L., Gersbach C. A. Enhancer Histone Acetylation Modulates Transcriptional Bursting Dynamics of Neuronal Activity-Inducible Genes. Cell Rep. 2019;26: 1174-1188. e5.

Cheung C. Y., Poon L.L., Ng I.H., Luk W., Sia S.F., Wu M.H., Chan K.H., Yuen K. Y., Gordon S., Guan Y., Peiris J.S. Cytokine responses in severe acute respiratory syndrome coronavirus-infected macrophages in vitro: possible relevance to pathogenesis. J. Virol. 2005;79:7819-7826.

Daniloski Z., Jordan T.X., Wessels H.H., Hoagland D.A., Kasela S., Legut M., Maniatis S., Mimitou E.P., Lu L., Geller E. Identification of Required Host Factors for SARS-CoV-2 Infection in Human Cells. Cell. 2021;184:92-105. el6.

Del Valle D.M., Kim-Schulze S., Huang H.H., Beckmann N.D., Nirenberg S., Wang B., Lavin Y., Swartz T.H., Madduri D., Stock A. An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat. Med. 2020;26: 1636-1643. Dobin A., Davis C.A., Schlesinger F., Drenkow J., Zaleski C., Jha S., Batut P., Chaisson M., Gingeras T.R. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29: 15-21.

Fukaya T., Lim B., Levine M. Enhancer Control of Transcriptional Bursting. Cell. 2016; 166:358- 368.

Giamarellos-Bourboulis E. J., Netea M.G., Rovina N., Akinosoglou K., Antoniadou A., Antonakos N., Damoraki G., Gkavogianni T., Adami M.E., Katsaounou P. Complex Immune Dysregulation in COVID-19 Patients with Severe Respiratory Failure. Cell Host Microbe. 2020;27:992-1000. e3.

Gordon D.E., Jang G.M., Bouhaddou M., Xu J., Obernier K., White K.M., O’Meara M.J., Rezelj V.V., Guo J.Z., Swaney D.L. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature. 2020;583:459-468.

Grajales-Reyes G.E., Colonna M. Interferon responses in viral pneumonias. Science. 2020;369:626-627.

Guichard S., Montazeri A., Chatelut E., Hennebelle I., Bugat R., Canal P. Schedule-dependent activity of topotecan in OVCAR-3 ovarian carcinoma xenograft: pharmacokinetic and pharmacodynamic evaluation. Clin. Cancer Res. 2001;7:3222-3228.

Heinz S., Benner C., Spann N., Bertolino E., Lin Y.C., Laslo P., Cheng J.X., Murre C., Singh H., Glass C.K. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell. 2010;38:576-589.

Heinz S., Texari L., Hayes M.G.B., Urbanowski M., Chang M.W., Givarkes N., Rialdi A., White K.M., Albrecht R.A., Pache L. Transcription Elongation Can Affect Genome 3D Structure. Cell. 2018;174: 1522-1536. el522.

Hermine O., Mariette X., Tharaux P.L., Resche-Rigon M., Porcher R., Ravaud P., CORIMUNO- 19 Collaborative Group Effect of Tocilizumab vs Usual Care in Adults Hospitalized With COVID- 19 and Moderate or Severe Pneumonia: A Randomized Clinical Trial. JAMA Intern. Med. 2021;181 :32-40.

Ho J.S. et al., Topoisomerase 1 inhibition therapy protects against SARS-CoV-2-induced inflammation and death in animal models. bioRxiv. 2020 Dec l;2020. Ho J.S. et al., Topoisomerase 1 inhibition therapy protects against SARS-CoV-2-induced lethal inflammation. Cell. 2021 May 13;184(10):2618-2632.

Houghton P.J., Cheshire P.J., Hallman J.D., 2nd, Lutz L., Friedman H.S., Danks M.K., Houghton J.A. Efficacy of topoisomerase I inhibitors, topotecan and irinotecan, administered at low dose levels in protracted schedules to mice bearing xenografts of human tumors. Cancer Chemother. Pharmacol. 1995;36:393-403.

Huang C., Wang Y., Li X., Ren L., Zhao J., Hu Y., Zhang L., Fan G., Xu J., Gu X. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395:497-506.

Imai M., Iwatsuki-Horimoto K., Hatta M., Loeber S., Halfmann P.J., Nakajima N., Watanabe T., Ujie M., Takahashi K., Ito M. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc. Natl. Acad. Sci. USA. 2020;117: 16587-16595.

Kollmannsberger C., Mross K., Jakob A., Kanz L., Bokemeyer C. Topotecan - A novel topoisomerase I inhibitor: pharmacology and clinical experience. Oncology. 1999;56: 1-12.

Korotkevich G., Sukhov V., Sergushichev A. Fast gene set enrichment analysis. bioRxiv. 2019:060012.

Lambert S.A., Yang A.W.H., Sasse A., Cowley G., Albu M., Caddick M.X., Morris Q.D., Weirauch M.T., Hughes T.R. Similarity regression predicts evolution of transcription factor sequence specificity. Nat. Genet. 2019;51 :981-989.

Langmead B., Salzberg S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012;9:357-359.

Law C.W., Chen Y., Shi W., Smyth G.K. voom: Precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 2014;15:R29.

Lee S., Channappanavar R., Kanneganti T.D. Coronaviruses: Innate Immunity, Inflammasome Activation, Inflammatory Cell Death, and Cytokines. Trends Immunol. 2020;41 : 1083-1099.

Lei X., Dong X., Ma R., Wang W., Xiao X., Tian Z., Wang C., Wang Y., Li L., Ren L. Activation and evasion of type I interferon responses by SARS-CoV-2. Nat. Commun. 2020;l l :3810. Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R., 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078-2079.

Liao Y., Smyth G.K., Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30:923-930.

Liao M., Liu Y., Yuan J., Wen Y., Xu G., Zhao J., Cheng L., Li J., Wang X., Wang F. Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19. Nat. Med. 2020;26:842- 844.

Lin Y.C., Benner C., Mansson R., Heinz S., Miyazaki K., Miyazaki M., Chandra V., Bossen C., Glass C.K., Murre C. Global changes in the nuclear positioning of genes and intra- and interdomain genomic interactions that orchestrate B cell fate. Nat. Immunol. 2012;13: 1196-1204.

Liu X., Hong T., Parameswaran S., Ernst K., Marazzi I., Weirauch M.T., Fuxman Bass II. Human Virus Transcriptional Regulators. Cell. 2020;182:24-37.

Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.

Lucas C., Wong P., Klein J., Castro T.B.R., Silva J., Sundaram M., Ellingson M.K., Mao T., Oh J.E., Israelow B., Yale IMPACT Team Longitudinal analyses reveal immunological misfiring in severe COVID-19. Nature. 2020;584:463-469.

Marazzi I., Ho J.S., Kim J., Manicassamy B., Dewell S., Albrecht R.A., Seibert C.W., Schaefer U., Jeffrey K.L., Prinjha R.K. Suppression of the antiviral response by an influenza histone mimic. Nature. 2012;483:428-433.

Marazzi I., Greenbaum B.D., Low D.H.P., Guccione E. Chromatin dependencies in cancer and inflammation. Nat. Rev. Mol. Cell Biol. 2018;19:245-261.

Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads.

EMBnet.j oumal . 2011 ; 17 : 3. Mathijssen R.H., van Alphen R.J., Verweij J., Loos W.J., Nooter K., Stoter G., Sparreboom A. Clinical pharmacokinetics and metabolism of irinotecan (CPT-11) Clin. Cancer Res. 2001;7:2182- 2194.

McGinnis C.S., Murrow L.M., Gartner Z. J. DoubletFinder: Doublet Detection in Single-Cell RNA Sequencing Data Using Artificial Nearest Neighbors. Cell Syst. 2019;8:329-337. e4.

Merad M., Martin J.C. Pathological inflammation in patients with COVID-19: a key role for monocytes and macrophages. Nat. Rev. Immunol. 2020;20:355-362.

Miller M.S., Rialdi A., Ho J.S., Tilove M., Martinez-Gil L., Moshkina N.P., Peralta Z., Noel J., Melegari C., Maestre A.M. Senataxin suppresses the antiviral transcriptional response and controls viral biogenesis. Nat. Immunol. 2015;16:485-494.

Moore J.B., June C.H. Cytokine release syndrome in severe COVID-19. Science. 2020;368:473- 474.

Munoz-Fontela C., Dowling W.E., Funnell S.G.P., Gsell P.S., Riveros-Balta A.X., Albrecht R.A., Andersen H., Baric R.S., Carroll M.W., Cavaleri M. Animal models for COVID-19. Nature. 2020;586:509-515.

Nagano T., Lubling Y., Vamai C., Dudley C., Leung W., Baran Y., Mendelson Cohen N., Wingett S., Fraser P., Tanay A. Cell-cycle dynamics of chromosomal organization at single-cell resolution. Nature. 2017;547:61-67.

Nemati F., Daniel C., Arvelo F., Legrier M.E., Froget B., Livartowski A., Assayag F., Bourgeois Y., Poupon M.F., Decaudin D. Clinical relevance of human cancer xenografts as a tool for preclinical assessment: example of in-vivo evaluation of topotecan-based chemotherapy in a panel of human small-cell lung cancer xenografts. Anticancer Drugs. 2010;21 :25-32.

Nicodeme E., Jeffrey K.L., Schaefer U., Beinke S., Dewell S., Chung C.W., Chandwani R., Marazzi I., Wilson P., Coste H. Suppression of inflammation by a synthetic histone mimic. Nature. 2010;468: 1119-1123. Nienhold R., Ciani Y., Koelzer V.H., Tzankov A., Haslbauer J.D., Menter T., Schwab N., Henkel M., Frank A., Zsikla V. Two distinct immunopathological profiles in autopsy lungs of COVID-19. Nat. Commun. 2020; 11 :5086.

Pedregosa F., Varoquaux G., Gramfort A., Michel V., Thirion B., Grisel O., Blondel M., Prettenhofer P., Weiss R., Dubourg V. Scikit-learn: Machine Learning in Python. J. Mach. Learn. Res. 2011;12:2825-2830.

Quinlan A.R., Hall I.M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26:841-842.

Rao S.S.P., Huang S.C., Glenn St Hilaire B., Engreitz J.M., Perez E.M., Kieffer-Kwon K.R., Sanborn A.L., Johnstone S.E., Bascom G.D., Bochkov I.D. Cohesin Loss Eliminates All Loop Domains. Cell. 2017; 171 :305-320.e24.

Rialdi A., Campisi L., Zhao N., Lagda A.C., Pietzsch C., Ho J.S.Y., Martinez-Gil L., Fenouil R., Chen X., Edwards M. Topoisomerase 1 inhibition suppresses inflammatory genes and protects from death by inflammation. Science. 2016;352:aad7993.

Ritchie M.E., Phipson B., Wu D., Hu Y., Law C.W., Shi W., Smyth G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47.

Rowinsky E.K., Grochow L.B., Hendricks C.B., Ettinger D.S., Forastiere A. A., Hurowitz L.A., McGuire W.P., Sartorius S.E., Lubejko B.G., Kaufmann S.H. Phase I and pharmacologic study of topotecan: a novel topoisomerase I inhibitor. J. Clin. Oncol. 1992;10:647-656.

Salvarani C., Dolci G., Massari M., Merlo D.F., Cavuto S., Savoldi L., Bruzzi P., Boni F., Braglia L., Turra C. Effect of Tocilizumab vs Standard Care on Clinical Worsening in Patients Hospitalized With COVID-19 Pneumonia: A Randomized Clinical Trial. JAMA Intern. Med. 2021;181 :24-31.

Schoenfelder S., Furlan-Magaril M., Mifsud B., Tavares-Cadete F., Sugar R., Javierre B.M., Nagano T., Katsman Y., Sakthidevi M., Wingett S.W. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 2015;25:582-597. Schwarzer W., Abdennur N., Goloborodko A., Pekowska A., Fudenberg G., Loe-Mie Y., Fonseca N.A., Huber W., Haering C.H., Mirny L., Spitz F. Two independent modes of chromatin organization revealed by cohesin removal. Nature. 2017;551 :51-56.

Senecal A., Munsky B., Proux F., Ly N., Braye F.E., Zimmer C., Mueller F., Darzacq X. Transcription factors modulate c-Fos transcriptional bursts. Cell Rep. 2014;8:75-83.

Sia S.F., Yan L.M., Chin A.W.H., Fung K., Choy K.T., Wong A.Y.L., Kaewpreedee P., Perera R.A.P.M., Poon L.L.M., Nicholls J.M. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature. 2020;583:834-838.

Siddiqi H.K., Mehra M.R. COVID-19 illness in native and immunosuppressed states: A clinical- therapeutic staging proposal. J. Heart Lung Transplant. 2020;39:405-407.

Stuart T., Butler A., Hoffman P., Hafemeister C., Papalexi E., Mauck W.M., 3rd, Hao Y., Stoeckius M., Smibert P., Satija R. Comprehensive Integration of Single-Cell Data. Cell. 2019;177: 1888-1902. el821.

Subramanian A., Tamayo P., Mootha V.K., Mukherjee S., Ebert B.L., Gillette M.A., Paulovich A., Pomeroy S.L., Golub T.R., Lander E.S., Mesirov J.P. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA. 2005;102: 15545-15550.

Tang Y., Liu J., Zhang D., Xu Z., Ji J., Wen C. Cytokine Storm in COVID-19: The Current Evidence and Treatment Strategies. Front. Immunol. 2020; 11 : 1708. von Pawel J., Schiller J.H., Shepherd F.A., Fields S.Z., Kleisbauer J.P., Chrysson N.G., Stewart D.J., Clark P. I., Palmer M.C., Depierre A. Topotecan versus cyclophosphamide, doxorubicin, and vincristine for the treatment of recurrent small-cell lung cancer. J. Clin. Oncol. 1999;17:658-667.

WHO REACT (Rapid Evidence Appraisal for COVID-19 Therapies) Working Group. Sterne J.A.C., Murthy S., Diaz J.V., Slutsky A.S., Villar J., Angus D.C., Annane D., Azevedo L.C.P., Berwanger O. Association Between Administration of Systemic Corticosteroids and Mortality Among Critically Ill Patients With COVID-19: a Meta-analysis. JAMA. 2020;324:1330-1341. Wingett S., Ewels P., Furlan-Magaril M., Nagano T., Schoenfelder S., Fraser P., Andrews S.

HiCUP: pipeline for mapping and processing Hi-C data. FlOOORes. 2015;4: 1310.

Winkler E.S., Bailey A.L., Kafai N.M., Nair S., McCune B.T., Yu J., Fox J.M., Chen R.E., Earnest J.T., Keeler S.P. SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function. Nat. Immunol. 2020;21 : 1327-1335.

Wong C.K., Lam C.W., Wu A.K., Ip W.K., Lee N.L., Chan I.H., Lit L.C., Hui D.S., Chan M.H., Chung S.S., Sung J.J. Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clin. Exp. Immunol. 2004;136:95-103.

Yu G., Wang L.G., Han Y., He Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16:284-287.

Zabidi M.A., Arnold C.D., Schemhuber K., Pagani M., Rath M., Frank O., Stark A. Enhancercore-promoter specificity separates developmental and housekeeping gene regulation. Nature. 2015;518:556-559.

Zhang Y., Liu T., Meyer C.A., Eeckhoute J., Johnson D.S., Bernstein B.E., Nusbaum C., Myers R.M., Brown M., Li W., Liu X.S. Model-based analysis of ChlP-Seq (MACS) Genome Biol. 2008;9:R137.

Zhou F., Yu T., Du R., Fan G., Liu Y., Liu Z., Xiang J., Wang Y., Song B., Gu X. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet. 2020;395:1054-1062.

Zhou Y., Fu B., Zheng X., Wang D., Zhao C., Qi Y., Sun R., Tian Z., Xu X., Wei H. Pathogenic T-cells and inflammatory monocytes incite inflammatory storms in severe COVID-19 patients. Natl. Sci. Rev. 2020;7:998-1002.

* * *

While several possible embodiments are disclosed above, embodiments of the present invention are not so limited. These exemplary embodiments are not intended to be exhaustive or to unnecessarily limit the scope of the invention, but instead were chosen and described in order to explain the principles of the present invention so that others skilled in the art may practice the invention. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims. Further, the terminology employed herein is used for the purpose of describing exemplary embodiments only and the terminology is not intended to be limiting since the scope of the various embodiments of the present invention will be limited only by the appended claims and equivalents thereof. The scope of the invention is therefore indicated by the following claims, rather than the foregoing description and abovediscussed embodiments, and all changes that come within the meaning and range of equivalents thereof are intended to be embraced therein.

All patents, applications, publications, test methods, literature, and other materials cited herein are hereby incorporated by reference in their entirety as if physically present in this specification.

Claims

CLAIMS What is claimed is:

1. A method for treating lung inflammation caused by a viral infection, the method comprising: administering a therapeutically effective amount of at least one compound that inhibits topoisomerase I activity; and administering a therapeutically effective amount of at least one anti-viral therapeutic.

2. The method of claim 1, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of chemical and biological inhibitors and combinations thereof.

3. The method of any one of claims 1 or 2, wherein the chemical inhibitors are selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof.

4. The method of any one of claims 1 or 2, wherein the biological inhibitors are selected from the group consisting of: silencing or interfering nucleic acids specific to and/or capable of binding topoisomerase I; transcriptional regulators of topoisomerase I; translational regulators of topoisomerase I; and and post-translational regulators of topoisomerase I.

5. The method of any one of claims 1-4, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of aptamers capable of binding an aptamer that binds to topoisomerase I or a nucleic acid encoding topoisomerase I.

6. The method of claim 4, wherein the translational or post-translational regulator of topoisomerase I phosphorylates or dephosphorylates topoisomerase I.

7. The method of any one of claims 1-6, wherein the viral infection is a coronaviral infection.

8. The method of claim 7, wherein the coronaviral infection is a SARS-CoV-2 infection.

9. The method of any one of claims 1-8, wherein the method includes co-administration of at least one other therapeutic agent to aid in treating the lung inflammation.

10. The method of claim 9, wherein the at least one co-administered therapeutic agent is selected from the group consisting of: therapeutic agents that block inflammation; one or more anti-tumor antibodies or antibodies directed at a pathogenic antigen or allergen; other immunomodulatory treatments; one or more bromodomain inhibitors; and one or more antibiotics, anti-fungal drugs, anti-parasitic drugs, or anti -protozoal drugs; and any combination thereof.

11. The method of any one of claims 1-10, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of viral infection.

12. The method of any one of claims 1-10, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of coronavirus.

13. The method of claim 3, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

14. The method of any of claims 1-13, wherein the at least one anti-viral therapeutic comprises remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

15. The method of any one of claims 1-14, wherein the compound that inhibits Topi activity is administered before the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered.

16. The method of claim 15, wherein the compound that inhibits Topi activity is administered in more than one dose.

17. The method of claim 15 or 16, wherein the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered in more than one dose.

18. A method for treating lung inflammation caused by a viral infection, the method comprising: administering a therapeutically effective amount of a pharmaceutical composition comprising at least one compound that inhibits topoisomerase I activity; and administering a therapeutically effective amount of at least one anti-viral therapeutic.

19. The method of claim 18, wherein the at least one compound that inhibits topoisomerase I activity is selected from the group consisting of chemical and biological inhibitors and combinations thereof.

20. The method of any one of claims 18 or 19, wherein the chemical inhibitors are selected from the group consisting of camptothecin, topotecan, irinotecan, plant-derived phenols, indenoisoquinolines and lamellarin D and derivatives thereof.

21. The method of any one of claims 18 or 19, wherein the biological inhibitors are selected from the group consisting of: silencing or interfering nucleic acids and/or proteins or peptides specific to and/or capable of binding topoisomerase I; transcriptional regulators of topoisomerase I; translational regulators of topoisomerase I; and post-translational regulators of topoisomerase I.

22. The method of any one of claims 18-21, wherein the at least one compound that inhibits topoisomerase I activity is an aptamer that binds to topoisomerase I or a nucleic acid encoding topoisomerase I.

23. The method of claim 22, wherein the translational or post-translational regulator of topoisomerase I phosphorylates or dephosphorylates topoisomerase I.

24. The method of claim 20, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

25. The method of any one of claims 18-24, wherein the viral infection is a coronaviral infection.

26. The method of claim 25, wherein the coronaviral infection is a SARS-CoV-2 infection.

27. The method of any one of claims 18-26, wherein the method includes co-administration of at least one other therapeutic agent to aid in treating the lung inflammation.

28. The method of claim 27, wherein the at least one co-administered therapeutic agent is selected from the group consisting of: therapeutic agents that block inflammation; one or more anti-tumor antibodies or antibodies directed at a pathogenic antigen or allergen; other immunomodulatory treatments; one or more bromodomain inhibitors; and one or more antibiotics, anti-fungal drugs, anti-parasitic drugs, or anti -protozoal drugs; and any combination thereof.

29. The method of any one of claims 18-28, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of viral infection.

30. The method of any one of claims 18-28, wherein the therapeutically effective amount of the at least one compound that inhibits topoisomerase I activity and/or the at least one anti-viral therapeutic is determined by the type of coronavirus.

31. The method of any one of claims 19-30, wherein the chemical inhibitors are selected from the group consisting of indenoisoquinolines and derivatives thereof.

32. The method of any one of claims 18-31, wherein the at least one anti-viral therapeutic therapeutic comprises remdesivir, molnupiravir, paxlovid, and/or ritonavir or derivatives, variants, modifications or improvements thereof.

33. The method of any one of claims 18-32, wherein the compound that inhibits Topi activity is topotecan.

34. The method of any one of claims 18-33, wherein the compound that inhibits Topi activity is administered before the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered.

35. The method of claim 34, wherein the compound that inhibits Topi activity is administered in more than one dose.

36. The method of claim 34 or 35, wherein the at least one anti-viral therapeutic and/or the at least one co-administered therapeutic agent is administered in more than one dose.