WO2022154401A1 - Composition for diagnosing or predicting metabolic syndrome - Google Patents

Composition for diagnosing or predicting metabolic syndrome Download PDF

Info

Publication number
WO2022154401A1
WO2022154401A1 PCT/KR2022/000371 KR2022000371W WO2022154401A1 WO 2022154401 A1 WO2022154401 A1 WO 2022154401A1 KR 2022000371 W KR2022000371 W KR 2022000371W WO 2022154401 A1 WO2022154401 A1 WO 2022154401A1
Authority
WO
WIPO (PCT)
Prior art keywords
metabolic syndrome
seq
polynucleotide
single nucleotide
nucleotide polymorphism
Prior art date
Application number
PCT/KR2022/000371
Other languages
French (fr)
Korean (ko)
Inventor
이상후
김설아
김주훈
김예진
박지명
이경률
Original Assignee
주식회사 에스씨엘헬스케어
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 에스씨엘헬스케어 filed Critical 주식회사 에스씨엘헬스케어
Publication of WO2022154401A1 publication Critical patent/WO2022154401A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a composition for diagnosing or predicting metabolic syndrome, and more particularly, to a single nucleotide polymorphism (SNP) capable of predicting metabolic syndrome derived through a genome wide association study (GWAS).
  • SNP single nucleotide polymorphism
  • GWAS genome wide association study
  • metabolic syndrome Since metabolic syndrome was named by Reaven GM in 1988, metabolic syndrome has become a commonly encountered health problem in primary care. The prevalence of metabolic syndrome in the primary care is known to reach about 30%, and the prevalence increases as the age increases and the severity of obesity increases. The medical significance of the metabolic syndrome is revealed from the fact that the mortality rate from cardiovascular disease is higher in patients with metabolic syndrome than in those without metabolic syndrome. In Korea, the obese population is gradually increasing, and the prevalence of cardiovascular diseases such as high blood pressure, diabetes, and hyperlipidemia is rapidly increasing. Efforts are ongoing to manage the metabolic indicators of the body before. However, even if there are no symptoms or only one risk factor is present, metabolic syndrome is highly likely to develop chronic diseases such as high blood pressure, diabetes, hyperlipidemia, and obesity due to complex interactions, so management of complex metabolic factors is necessary. , is not being done properly.
  • the aforementioned metabolic syndrome affects the factors that lifestyle habits cause, and lifestyle interventions can delay and prevent the onset of metabolic syndrome.
  • exposure to cadmium was related to lipopolysaccharide and increased the morbidity of metabolic syndrome in 200 Korean adults.
  • pancreatic secretion was related to pancreatic secretion and an increase in insulin resistance due to a chronic increase in cadmium intake.
  • the relationship between heavy metals and metabolic syndrome was studied based on the 5th period of the 2014 National Health and Nutrition Examination Survey.
  • single nucleotide polymorphism of an individual gene means a genetic change or mutation that shows a difference in one nucleotide sequence (A, T, G, C) in the DNA nucleotide sequence. As it is a mutated part, it is mainly used for DNA fingerprint analysis.
  • single nucleotide polymorphism analysis the difference in basic metabolic ability inherent in individual genes can be taken into account, and complex metabolic syndrome can be managed more effectively.
  • the present inventors compared a patient group with metabolic syndrome and a normal control group through a genome wide association study (GWAS), selected SNPs related to metabolic syndrome, and compared the correlation between the selected SNPs and blood mercury levels once again,
  • GWAS genome wide association study
  • an object of the present invention is to provide a composition for predicting or diagnosing metabolic syndrome, including SNPs associated with metabolic syndrome and blood mercury levels.
  • Another object of the present invention is to provide a composition for predicting blood mercury levels, including SNPs associated with metabolic syndrome and blood mercury levels.
  • Another object of the present invention is to provide a method for diagnosing and treating metabolic syndrome using SNPs associated with blood heavy metal concentrations.
  • the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or in the polynucleotide represented by SEQ ID NO: 2, a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is C or A, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; a marker composition for predicting or diagnosing metabolic syndrome, including to provide.
  • the present invention includes an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2, for predicting or diagnosing metabolic syndrome A composition is provided.
  • the present invention also provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or a polynucleotide consisting of 10 to 100 consecutive DNA sequences including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2;
  • a marker composition for predicting blood mercury levels including; provides
  • the present invention provides an agent capable of detecting a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 2 for predicting blood mercury levels
  • an agent capable of detecting a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 2 for predicting blood mercury levels
  • a composition is provided.
  • the present invention also provides a kit for predicting or diagnosing metabolic syndrome comprising the composition for predicting or diagnosing metabolic syndrome.
  • the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2; Metabolism, including Provided is an informational method for predicting or diagnosing a syndrome.
  • the present invention provides a kit for predicting blood mercury level comprising the composition for predicting blood mercury level.
  • the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; It provides an informational method for estimating mercury levels.
  • the present invention includes the steps of (a) obtaining an assay sample from an individual, (b) in the assay sample of step (a), a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, polynucleotides consisting of 10 to 100 contiguous DNA sequences; or a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; detecting, (c) step (b) ) when the 101st base of the polynucleotide represented by SEQ ID NO: 1 is C; or when the 101st base of the polynucleotide represented by SEQ ID NO: 2 is A;
  • a method for diagnosing and treating metabolic syndrome comprising the steps of diagnosing metabolic syndrome, and (d) administering an
  • metabolic syndrome can be diagnosed or predicted, and blood mercury levels can be predicted, so that patients with metabolic syndrome due to mercury accumulation can be effectively diagnosed and managed. Based on these effects, the present invention can be widely used in the pharmaceutical industry and the like.
  • 1 is a diagram showing the P-values of SNPs and blood mercury levels selected to be associated with metabolic syndrome.
  • the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or in the polynucleotide represented by SEQ ID NO: 2, a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is C or A, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; a marker composition for predicting or diagnosing metabolic syndrome, including to provide.
  • single nucleotide polymorphism means that only a single base is different from among polymorphic sites in which two or more alleles exist at one locus .
  • the composition further comprises a polynucleotide consisting of 10 to 100 consecutive DNA sequences comprising a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 It is preferable to do
  • the marker composition of the present invention can more accurately predict or diagnose metabolic syndrome by further including.
  • the polynucleotide represented by any one selected from the group consisting of SEQ ID NOs: 1 to 3 refers to a polymorphic sequence including the SNP of a gene involved in metabolic syndrome, and is as shown in Table 1 below.
  • the SNP position is the 101st base.
  • the single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome due to blood mercury concentration It may be highly correlated.
  • the base of the single nucleotide polymorphism site is C, it may be predicted or diagnosed as metabolic syndrome, and preferably, it may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
  • the single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is C, the level of mercury in the blood is expected to be high.
  • the single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated.
  • metabolic syndrome preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated.
  • the base of the single nucleotide polymorphism site is A, it may be predicted or diagnosed as metabolic syndrome, and preferably may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
  • the single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is A, the level of mercury in the blood is expected to be high.
  • the single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated.
  • metabolic syndrome preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated.
  • the base of the single nucleotide polymorphism site is G, it may be predicted or diagnosed as metabolic syndrome, and preferably may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
  • the single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is G, the blood mercury level may be predicted to be high.
  • the metabolic syndrome may indicate any three or more symptoms selected from the group consisting of central obesity, hyperglycemia, hypertriglyceridemia, hyperlipidemia and hypertension, and the central obesity has a waist circumference of 90 cm in men
  • the hyperglycemia may be classified as hyperglycemia if the fasting blood glucose level is 100 mg/dL or more
  • the hyperlipidemia is the blood HDL-cholesterol level
  • a case of less than 40 mg/dL for men and less than 50 mg/dL for women may be classified as hyperlipidemia
  • the hypertriglyceridemia is classified as hypertriglyceridemia if the blood triglyceride level is 150 mg/dL or more.
  • the hypertension may be classified as hypertension when the systolic blood pressure is 130.85 mmHg or more and the diastolic blood pressure is 85 mmHg or more.
  • the metabolic syndrome may be caused by an increase in the concentration of heavy metals in the blood.
  • the heavy metal may be mercury, but is not limited thereto.
  • the present invention includes an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2 It provides a composition for predicting or diagnosing metabolic syndrome.
  • the composition may further include an agent capable of detecting a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3.
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A
  • the single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
  • the detectable agent may be a primer pair or probe capable of amplifying or detecting a polynucleotide including the single nucleotide polymorphism site.
  • the primer is a base sequence having a short free 3' hydroxyl group and can form a complementary template and base pair, and serves as a starting point for template strand copying.
  • the appropriate length of the primer may vary depending on the intended use, but generally consists of 15 to 30 bases.
  • the primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template.
  • a probe refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid as a hybridization probe.
  • the probe of the present invention is an allele-specific probe.
  • a polymorphic site exists in nucleic acid fragments derived from two individuals of the same species, and thus hybridizes to a DNA fragment derived from one member but derived from another member. There is no hybridization in one fragment. In this case, the hybridization conditions should be sufficiently stringent to show a significant difference in the hybridization intensity between alleles and to hybridize to only one of the alleles.
  • the probe may be a single-stranded, more preferably deoxyribonucleotide for maximum efficiency in hybridization, but is not limited thereto.
  • a sequence perfectly complementary to the sequence including the SNP may be used, but a substantially complementary sequence may be used within a range that does not interfere with specific hybridization.
  • the composition may further include one or more other component compositions, solutions or devices suitable for the analysis method.
  • the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or a polynucleotide consisting of 10 to 100 consecutive DNA sequences including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2;
  • a marker composition for predicting blood mercury levels including; provides
  • the composition may further include a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3.
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A
  • the single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
  • the present invention provides an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2 It provides a composition for predicting blood mercury levels, including.
  • an agent capable of detecting a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be further included.
  • the present invention provides a kit for predicting or diagnosing metabolic syndrome comprising the composition for predicting or diagnosing metabolic syndrome.
  • the present invention provides a kit for predicting blood mercury level comprising the composition for predicting blood mercury level.
  • the kit is a polymerase chain reaction (PCR) kit, a ligase chain reaction (LCR) kit, a Gap-LCR, a repair chain reaction kit, a transcription-mediated amplification (TMA) kit, an autologous self sustained sequence replication kit, selective amplification of target polynucleotide sequences kit, consensus sequence priming polymerase chain reaction (CP-PCR) kit, optional priming polymerase chain reaction (AP-PCR) kit, nucleic acid sequence-based amplification (NASBA) kit, strand displacement amplification kit, loop-mediated constant temperature amplification (LAMP) kit, multiplex PCR kit, dual Polymerase chain reaction (nested-PCR) kit, single tube nested-PCR kit, reverse transcription-polymerase chain reaction (RT-PCR) kit, inverse PCR kit , a real-time polymerase chain reaction (RT-PCR) kit, and a real-time polymerase chain reaction quantitative assay (RQ-PCR) kit may be at least one selected
  • the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2; Metabolism, including Provided is an informational method for predicting or diagnosing a syndrome.
  • the step (b) may further include the step of confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA, further comprising
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A
  • the single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
  • the sample of step (a) includes, without limitation, a biological sample derived from a subject to be diagnosed from which extraction of nucleic acid, particularly DNA, required for detecting a single nucleotide polymorphism site is possible, for example, tissues, cells, It may include, but is not limited to, samples such as whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.
  • the step of confirming the single nucleotide polymorphism means confirming the genotype of the single nucleotide polymorphism site in the isolated DNA, specifically, sequencing analysis using an automatic sequencing analyzer, pyrosequencing ( pyrosequencing), hybridization by microarray, PCR-RELP method (restriction fragment length polymorphism), PCR-SSCP method (single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), PCR-SSO method and dot hybridization method are combined ASO (allele specific oligonucleotide) hybridization method, TaqMan-PCR method, MALDI-TOF/MS method, RCA method (rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method, dot hybridization method It may be to confirm the genotype by analyzing it through a method such as.
  • the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; It provides an informational method for estimating mercury levels.
  • step (b) may further include confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA.
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C
  • the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A
  • the single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
  • the present invention provides a method for diagnosing and treating metabolic syndrome using a SNP associated with a blood heavy metal concentration.
  • the metabolic syndrome diagnosis and treatment method of the present invention comprises the steps of (a) obtaining an assay sample from an individual, (b) in the assay sample of step (a), in the polynucleotide represented by SEQ ID NO: 1, the 101st base is T or C.
  • polynucleotides consisting of 10 to 100 contiguous DNA sequences containing nucleotide polymorphisms; or a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; detecting, (c) step (b) ) when the 101st base of the polynucleotide represented by SEQ ID NO: 1 is C; or when the 101st base of the polynucleotide represented by SEQ ID NO: 2 is A; diagnosing the metabolic syndrome, and (d) administering to the subject diagnosed with the metabolic syndrome in step (c) an effective amount of a therapeutic agent for the metabolic syndrome.
  • step (b) comprises a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 in the analysis sample of step (a), 10 to 100 consecutive It is preferable to further detect a polynucleotide composed of a specific DNA sequence.
  • the therapeutic agent for metabolic syndrome refers to an agent for alleviating/treating symptoms of metabolic syndrome.
  • the metabolic syndrome therapeutic agent is pitavastatin, amlodipine besylate, losartan, carvedilol, lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, rosuvastatin, fenofibrate, gembuzil, bezafibrate, pravafenix, niacasetimi , diethylpropion, phentermine, mazindol, phendimetrazine, lorcaserin, liraglutide, nicotinic acid, and at least one selected from the group consisting of acipimox, but is not limited thereto.
  • the metabolic syndrome is preferably a metabolic syndrome caused by a heavy metal concentration in blood, but the scope of the present invention is not limited thereto.
  • Metabolic syndrome participants who consented to blood sampling were recruited from Hanaro Medical Center (Korea) according to guidelines. The collection protocol was ethically approved by the Clinical Research Institute in Seoul, and conformed to the principles of the Declaration of Helsinki. All participants were provided with information about blood tests using blood samples and SNP genotyping.
  • a blood triglyceride level of 150 mg/dL or higher was classified as hypertriglyceridemia.
  • a systolic blood pressure of 130.85 mmHg or higher and a diastolic blood pressure of 85 mmHg or higher were classified as hypertension.
  • DNA samples were obtained from 200 ⁇ l whole blood using the MagNA Pure 96 DNA and Viral NA SV Kit (Roche Life Science, USA) and the MagNA Pure 96 System (Roche Life Science, USA).
  • the extracted DNA samples were subjected to genotyping of 827,783 SNPs using GeneTitan TM Multi-Channel Instrument and KNIH biobank array v1.1 chip according to the manufacturer's instructions.
  • the CEL file, the result of genotyping, was converted into a PLINK input format file (ped format) using the Axiom Analysis Suite program. Samples that did not reach the cutoff criteria of DQC ⁇ 0.82 and call rate ⁇ 0.97 were re-genotyped using the KNIH Biobank Array v1.1 chip.
  • PLINK version 1.90 was used to analyze genotype ped files. In the metabolic syndrome group compared to the control group, only the case where the p-value was less than 0.05 was regarded as a significant SNP and further analysis was performed. For the selected SNPs, using the package of the R program, correlation analysis was performed with the blood concentration of mercury, and SNPs (p-value of less than or equal to 0.05) that were significantly correlated were selected once more.
  • SNPs with significant association were analyzed using the Ensembl API client (version 1.1.5 with Genome hg19). It is included in the mercury-related pathway gene, and as a result of Hardy-Weinberg equilibrium analysis, a SNP with a p-value of less than 0.05 was derived. For selected SNPs, association with blood mercury levels was analyzed using a linear regression modeling approach. Association analysis was performed on the properties using the R package software (version 3.5.3).
  • SNPs with a P value of less than 0.05 were gene annotated using a Python program.
  • the NDEx Integration Query (version 1.0) website was used, and the Harmonizome online version of the integrated genetic database was used for gene functional terminology analysis. Pathways with a p-value of less than 0.05 were considered significant.
  • Example 1.3 SNPs showing a specific high frequency in the metabolic syndrome patient group compared to the normal control group were selected.
  • the selected SNPs were annotated as in Example 1.4 to derive SNPs on genes related to blood mercury levels, and the association between the derived SNPs and blood mercury levels was analyzed. SNPs and blood mercury levels and P-values is shown in FIG. 1 .
  • the three SNPs show a specifically high frequency in patients with metabolic syndrome compared to normal controls, and by confirming the nucleotide sequence of the SNP of an individual, it is possible to predict or diagnose metabolic syndrome as well as information on blood mercury levels can also be checked. Furthermore, high blood mercury levels are mentioned as a major cause of metabolic syndrome, and may be used for predicting or diagnosing metabolic syndrome caused by mercury accumulation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a composition for diagnosing or predicting metabolic syndrome and, more specifically, to a single nucleotide polymorphism (SNP) which is derived through a genome wide association study (GWAS) and capable of predicting metabolic syndrome. By using an SNP marker according to the present invention, metabolic syndrome can be diagnosed or predicted, and blood mercury levels can be predicted, and thus, patients with metabolic syndrome due to mercury accumulation can be effectively diagnosed and managed. Based on these effects, the present invention can be widely used in the pharmaceutical industry and the like.

Description

대사증후군 진단 또는 예측용 조성물Composition for diagnosis or prediction of metabolic syndrome
본 발명은 대사증후군 진단 또는 예측용 조성물에 관한 것으로, 보다 상세하게는 GWAS(Genome wide association study)를 통해 도출한 대사증후군을 예측할 수 있는 단일염기 다형성(SNP, single nucleotide polymorphism)에 관한 것이다.The present invention relates to a composition for diagnosing or predicting metabolic syndrome, and more particularly, to a single nucleotide polymorphism (SNP) capable of predicting metabolic syndrome derived through a genome wide association study (GWAS).
1988년 Reaven GM에 의해 대사증후군(metabolic syndrome)이 명명된 이후, 대사증후군은 일차의료에서 흔하게 마주치는 건강 문제가 되었다. 상기 일차의료에서 대사증후군의 유병률은 약 30%에 달하는 것으로 알려져 있으며 연령이 높을수록, 비만의 정도가 심할수록 유병률이 증가되었다. 상기 대사증후군의 의학적 중요성은 대사증후군이 있는 경우가 대사증후군이 없는 경우에 비해 심혈관질환의 사망률이 높다는 사실로부터 드러난다. 국내에서도 비만 인구가 점차 증가하고 있고, 고혈압이나 당뇨, 고지혈증 등과 같은 심혈관 질환의 유병률이 급격하게 증가하고 있으므로, 심혈관 질환에 의한 사망률이 남녀에서 2위에 해당하는 점 등을 고려하여, 최근 대사증후군 발명 전에 신체 대사 지표를 관리하고자 하는 노력이 지속되고 있다. 그러나 증상이 없거나 혹은 한 가지 위험인자만 보유하고 있더라도, 대사증후군은 상호 복합적으로 작용하여 만성 질환인 고혈압이나 당뇨, 고지혈증, 비만을 발현한 가능성이 크므로, 복합적인 대사 관련 인자의 관리가 필요하나, 적절히 이루어지지 않고 있는 실정이다. Since metabolic syndrome was named by Reaven GM in 1988, metabolic syndrome has become a commonly encountered health problem in primary care. The prevalence of metabolic syndrome in the primary care is known to reach about 30%, and the prevalence increases as the age increases and the severity of obesity increases. The medical significance of the metabolic syndrome is revealed from the fact that the mortality rate from cardiovascular disease is higher in patients with metabolic syndrome than in those without metabolic syndrome. In Korea, the obese population is gradually increasing, and the prevalence of cardiovascular diseases such as high blood pressure, diabetes, and hyperlipidemia is rapidly increasing. Efforts are ongoing to manage the metabolic indicators of the body before. However, even if there are no symptoms or only one risk factor is present, metabolic syndrome is highly likely to develop chronic diseases such as high blood pressure, diabetes, hyperlipidemia, and obesity due to complex interactions, so management of complex metabolic factors is necessary. , is not being done properly.
앞에서 언급한 대사증후군은 생활습관이 유발하는 요인들에 영향을 주고, 생활습관의 중재가 대사증후군의 발병을 늦추며 예방할 수 있다고 밝히고 있다. 현재까지 중금속과 대사증후군과의 관련성을 연구한 자료들을 살펴보면 한국 성인 200여 명을 대상으로 하여 카드뮴에 대한 노출이 지질다당류와 연관성이 있으며 대사증후군의 이환율을 높인다는 연구결과가 있으며, 쥐를 대상으로 하여 만성적인 카드뮴 섭취증가에 의한 췌장 분비능 저하와 인슐린 저항성 증가를 밝힌 연구결과가 있다. 국내 연구로는 2014년 국민건강영양조사 5기를 바탕으로 하여 중금속과 대사증후군과의 관계를 연구한 것으로 여러 가지 인자들을 조정하여 적용한 결과 수은이 남녀 모두에서 대사증후군과 연관성이 있는 것으로 나타났다.The aforementioned metabolic syndrome affects the factors that lifestyle habits cause, and lifestyle interventions can delay and prevent the onset of metabolic syndrome. Looking at the data on the relationship between heavy metals and metabolic syndrome so far, there is a study that showed that exposure to cadmium was related to lipopolysaccharide and increased the morbidity of metabolic syndrome in 200 Korean adults. As a result, there is a study result that revealed a decrease in pancreatic secretion and an increase in insulin resistance due to a chronic increase in cadmium intake. As a domestic study, the relationship between heavy metals and metabolic syndrome was studied based on the 5th period of the 2014 National Health and Nutrition Examination Survey.
한편, 개인별 유전자의 단일염기다형성이란, DNA 염기서열에서 하나의 염기서열(A,T,G,C)의 차이를 보이는 유전적 변화 또는 변이를 의미하는 것으로, 단일 염기 다형현상은 각 개인마다 많은 변이를 보이는 부분이므로 DNA 지문 분석에 주로 이용된다. 단일염기다형성 분석을 이용하면 개인별 유전자에 내재되어 있는 기초적인 대사 능력의 차이를 고려할 수 있으므로, 복합적인 대사증후군을 보다 효과적으로 관리 가능하다.On the other hand, single nucleotide polymorphism of an individual gene means a genetic change or mutation that shows a difference in one nucleotide sequence (A, T, G, C) in the DNA nucleotide sequence. As it is a mutated part, it is mainly used for DNA fingerprint analysis. By using single nucleotide polymorphism analysis, the difference in basic metabolic ability inherent in individual genes can be taken into account, and complex metabolic syndrome can be managed more effectively.
이에 본 발명자들은 GWAS(Genome wide association study)를 통해 대사증후군을 나타내는 환자군과 정상 대조군을 비교하여, 대사증후군과 연관된 SNP를 선별하였으며, 선별된 SNP와 혈중 수은 수준과의 연관성을 다시 한 번 비교, 분석하여 유의미한 연관성이 있는 SNP를 최종 도출함으로써, 본 발명을 완성하였다. Accordingly, the present inventors compared a patient group with metabolic syndrome and a normal control group through a genome wide association study (GWAS), selected SNPs related to metabolic syndrome, and compared the correlation between the selected SNPs and blood mercury levels once again, The present invention was completed by finally deriving a meaningfully related SNP by analysis.
따라서, 본 발명의 목적은 대사증후군 및 혈중 수은 수준과 연관된 SNP를 포함하는, 대사증후군 예측 또는 진단용 조성물을 제공하는 것이다. Accordingly, an object of the present invention is to provide a composition for predicting or diagnosing metabolic syndrome, including SNPs associated with metabolic syndrome and blood mercury levels.
본 발명의 다른 목적은 대사증후군 및 혈중 수은 수준과 연관된 SNP를 포함하는, 혈중 수은 수준 예측용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for predicting blood mercury levels, including SNPs associated with metabolic syndrome and blood mercury levels.
본 발명의 또 다른 목적은 혈중 중금속 농도와 연관된 SNP를 이용한 대사 증후군 진단 및 치료방법을 제공하는 것이다.Another object of the present invention is to provide a method for diagnosing and treating metabolic syndrome using SNPs associated with blood heavy metal concentrations.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는 대사증후군 예측 또는 진단용 마커 조성물을 제공한다.In order to achieve the above object, the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or in the polynucleotide represented by SEQ ID NO: 2, a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is C or A, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; a marker composition for predicting or diagnosing metabolic syndrome, including to provide.
또한 본 발명은 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 포함하는, 대사증후군 예측 또는 진단용 조성물을 제공한다.In addition, the present invention includes an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2, for predicting or diagnosing metabolic syndrome A composition is provided.
또한 본 발명은 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는, 혈중 수은 수준 예측용 마커 조성물을 제공한다.The present invention also provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or a polynucleotide consisting of 10 to 100 consecutive DNA sequences including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; A marker composition for predicting blood mercury levels, including; provides
또한 본 발명은 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 포함하는, 혈중 수은 수준 예측용 조성물을 제공한다.In addition, the present invention provides an agent capable of detecting a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st nucleotide in a polynucleotide consisting of SEQ ID NO: 2 for predicting blood mercury levels A composition is provided.
또한 본 발명은 상기 대사증후군 예측 또는 진단용 조성물을 포함하는 대사증후군 예측 또는 진단용 키트를 제공한다.The present invention also provides a kit for predicting or diagnosing metabolic syndrome comprising the composition for predicting or diagnosing metabolic syndrome.
또한 본 발명은 (a) 시료에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 대사증후군 예측 또는 진단을 위한 정보제공 방법을 제공한다.In addition, the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2; Metabolism, including Provided is an informational method for predicting or diagnosing a syndrome.
또한 본 발명은 상기 혈중 수은 수준 예측용 조성물을 포함하는 혈중 수은 수준 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting blood mercury level comprising the composition for predicting blood mercury level.
또한 본 발명은 (a) 시료에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 혈중 수은 수준 예측을 위한 정보제공 방법을 제공한다.In addition, the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; It provides an informational method for estimating mercury levels.
또한 본 발명은 (a) 개체로부터 분석 시료를 얻는 단계, (b) 단계 (a)의 분석 시료에서 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 검출하는 단계, (c) 단계 (b)의 폴리뉴클레오티드가 서열번호 1로 표시되는 폴리뉴클레오티드의 101번째 염기가 C인 경우; 또는 서열번호 2로 표시되는 폴리뉴클레오티드의 101번째 염기가 A인 경우; 대사 증후군으로 진단하는 단계, 및 (d) 단계 (c)에서 대사 증후군으로 진단된 개체에 유효량의 대사 증후군 치료제를 투여하는 단계를 포함하는 대사 증후군 진단 및 치료방법을 제공한다.In addition, the present invention includes the steps of (a) obtaining an assay sample from an individual, (b) in the assay sample of step (a), a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, polynucleotides consisting of 10 to 100 contiguous DNA sequences; or a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; detecting, (c) step (b) ) when the 101st base of the polynucleotide represented by SEQ ID NO: 1 is C; or when the 101st base of the polynucleotide represented by SEQ ID NO: 2 is A; Provided is a method for diagnosing and treating metabolic syndrome, comprising the steps of diagnosing metabolic syndrome, and (d) administering an effective amount of a therapeutic agent for metabolic syndrome to the subject diagnosed with metabolic syndrome in step (c).
본 발명에 의해 도출된 SNP 마커를 이용하면, 대사증후군을 진단 또는 예측할 수 있으며, 혈중 수은 수준을 예측할 수 있어 수은 축적에 의한 대사증후군 환자를 효과적으로 진단, 관리할 수 있다. 이러한 효과를 기초로 본 발명은 의약업계 등에서 널리 활용될 수 있다.By using the SNP marker derived by the present invention, metabolic syndrome can be diagnosed or predicted, and blood mercury levels can be predicted, so that patients with metabolic syndrome due to mercury accumulation can be effectively diagnosed and managed. Based on these effects, the present invention can be widely used in the pharmaceutical industry and the like.
도 1은 대사증후군과 연관된 것으로 선별된 SNP와 혈중 수은 수준의 P-value를 나타낸 도이다.1 is a diagram showing the P-values of SNPs and blood mercury levels selected to be associated with metabolic syndrome.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명의 양태에 따르면, 본 발명은 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는 대사증후군 예측 또는 진단용 마커 조성물을 제공한다.According to an aspect of the present invention, the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or in the polynucleotide represented by SEQ ID NO: 2, a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is C or A, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; a marker composition for predicting or diagnosing metabolic syndrome, including to provide.
본 발명에 있어서, 단일염기 다형성(SNP, single nucleotide polymorphism)은 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자(allele)가 존재하는 다형성 부위(polymorphic site) 중에서, 단일 염기만이 다른 것을 말한다.In the present invention, single nucleotide polymorphism (SNP) means that only a single base is different from among polymorphic sites in which two or more alleles exist at one locus .
본 발명의 구체예에서, 상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 포함하는 것이 바람직하다. 본 발명의 마커 조성물은 더 포함하는 구성에 의해 대사증후군을 더 정확히 예측 또는 진단할 수 있다.In an embodiment of the present invention, the composition further comprises a polynucleotide consisting of 10 to 100 consecutive DNA sequences comprising a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 It is preferable to do The marker composition of the present invention can more accurately predict or diagnose metabolic syndrome by further including.
본 발명에서 서열번호 1 내지 3으로 이루어진 군에서 선택된 어느 하나로 표시되는 폴리뉴클레오티드는 대사증후군에 관여하는 유전자의 SNP를 포함하는 다형성 서열(polymorphic sequence)을 말하며, 하기 표 1에 기재된 바와 같다. 서열번호 1 내지 3으로 이루어진 군에서 선택된 어느 하나로 표시되는 폴리뉴클레오티드에서 SNP 위치는 101번째 염기이다.In the present invention, the polynucleotide represented by any one selected from the group consisting of SEQ ID NOs: 1 to 3 refers to a polymorphic sequence including the SNP of a gene involved in metabolic syndrome, and is as shown in Table 1 below. In the polynucleotide represented by any one selected from the group consisting of SEQ ID NOs: 1 to 3, the SNP position is the 101st base.
서열
번호order
number 		NCBI
refSNP IDNCBI
refSNP ID 		염기서열 (5'→3')base sequence (5'→3')
1One rs666647rs666647 CTCCATCCTCACGTTTGTGGTGGCTCTGTCCTGTCTTCTA
GGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCACAA
CCTGCAACTGTAAAACATAT
[T/C]
GGAAGAGTGAGTATGGTGACTGGGGGCACCATGGGCTGGG
AGTTAGAAAAGTCCAATCCAGGCCAGGTGCAGTGGCTCAC
GTCTGTAATCCCAGCACTTTCTCCATCCTCACGTTTGTGGTGGCTCTGTCCTGTCTTCTA
GGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCACAA
CCTGCAACTGTAAAACATAT
[T/C]
GGAAGAGTGAGTATGGTGACTGGGGGCACCATGGGCTGGG
AGTTAGAAAAGTCCAATCCAGGCCAGGTGCAGTGGCTCAC
GTCTGTAATCCCAGCACTTT
22 rs1805479rs1805479 CTCATGCTAGTTTGCATAGTTGCATTAAAAAGTCGTAGTT
CCAGGAAGCCTCTGGTCCTCTAATATCTTGCATAGGGATA
CCTTTCTAAGAAGGGTAATA
[C/A]
AGAGCAGATCCAGGACAGCGTTGGCTTCTGATTACCTCCC
TCCCTCCCTTCCTTCCTTCCTCTTTCCCCTCATACTCTCT
CCATCTGTCTCCTTCCTTCTCTCATGCTAGTTTGCATAGTTGCATTAAAAAAGTCGTAGTT
CCAGGAAGCCTCTGGTCCTCTAATATCTTGCATAGGGATA
CCTTTCTAAGAAGGGTAATA
[C/A]
AGAGCAGATCCAGGACAGCGTTGGCTTCTGATTACCTCCC
TCCCTCCCTTCCTTCCTTCCTCTTTCCCCTCATACTCTCT
CCATCTGTCTCCTTCCTTCT
33 rs666636rs666636 ATCTCCATCCTCACGTTTGTGGTGGCTCTGTCCTGTCTTC
TAGGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCAC
AACCTGCAACTGTAAAACAT
[A/G]
TTGGAAGAGTGAGTATGGTGACTGGGGGCACCATGGGCTG
GGAGTTAGAAAAGTCCAATCCAGGCCAGGTGCAGTGGCTC
ACGTCTGTAATCCCAGCACTATCTCCATCCTCACGTTTGTGGTGGCTCTGTCCTGTCTTC
TAGGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCAC
AACCTGCAACTGTAAAACAT
[A/G]
TTGGAAGAGTGAGTATGGTGACTGGGGGCACCATGGGCTG
GGAGTTAGAAAGTCCAATCCAGGCCAGGTGCAGTGGCTC
ACGTCTGTAATCCCAGCACT
본 발명에 있어서, 상기 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성은 대사증후군과 높은 상관관계가 있는 것일 수 있고, 바람직하게는 혈중 수은 농도에 의한 대사증후군과 높은 상관관계가 있는 것일 수 있다. 또한, 상기 단일염기 다형성 부위의 염기가 C인 경우, 대사증후군으로 예측 또는 진단되는 것 일 수 있으며, 바람직하게는 높은 혈중 수은 수준에 의한 대사증후군으로 예측 또는 진단되는 것 일 수 있다. In the present invention, the single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome due to blood mercury concentration It may be highly correlated. In addition, when the base of the single nucleotide polymorphism site is C, it may be predicted or diagnosed as metabolic syndrome, and preferably, it may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
본 발명에 있어서, 상기 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성은 혈중 수은 수준과 높은 상관관계가 있는 것일 수 있다. 더욱 바람직하게는, 상기 단일염기 다형성 부위의 염기가 C인 경우, 혈중 수은 수준이 높을 것으로 예측되는 것 일 수 있다.In the present invention, the single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is C, the level of mercury in the blood is expected to be high.
본 발명에 있어서, 상기 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성은 대사증후군과 높은 상관관계가 있는 것일 수 있고, 바람직하게는 혈중 수은 농도에 의한 대사증후군과 높은 상관관계가 있는 것일 수 있다. 또한, 상기 단일염기 다형성 부위의 염기가 A인 경우, 대사증후군으로 예측 또는 진단되는 것 일 수 있으며, 바람직하게는 높은 혈중 수은 수준에 의한 대사증후군으로 예측 또는 진단되는 것 일 수 있다.In the present invention, the single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated. In addition, when the base of the single nucleotide polymorphism site is A, it may be predicted or diagnosed as metabolic syndrome, and preferably may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
본 발명에 있어서, 상기 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성은 혈중 수은 수준과 높은 상관관계가 있는 것일 수 있다. 더욱 바람직하게는, 상기 단일염기 다형성 부위의 염기가 A인 경우, 혈중 수은 수준이 높을 것으로 예측되는 것 일 수 있다.In the present invention, the single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is A, the level of mercury in the blood is expected to be high.
본 발명에 있어서, 상기 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성은 대사증후군과 높은 상관관계가 있는 것일 수 있고, 바람직하게는 혈중 수은 농도에 의한 대사증후군과 높은 상관관계가 있는 것일 수 있다. 또한, 상기 단일염기 다형성 부위의 염기가 G인 경우, 대사증후군으로 예측 또는 진단되는 것 일 수 있으며, 바람직하게는 높은 혈중 수은 수준에 의한 대사증후군으로 예측 또는 진단되는 것 일 수 있다.In the present invention, the single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be highly correlated with metabolic syndrome, preferably, metabolic syndrome caused by blood mercury concentration It may be highly correlated. In addition, when the base of the single nucleotide polymorphism site is G, it may be predicted or diagnosed as metabolic syndrome, and preferably may be predicted or diagnosed as metabolic syndrome due to high blood mercury levels.
본 발명에 있어서, 상기 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성은 혈중 수은 수준과 높은 상관관계가 있는 것일 수 있다. 더욱 바람직하게는, 상기 단일염기 다형성 부위의 염기가 G인 경우, 혈중 수은 수준이 높을 것으로 예측되는 것 일 수 있다.In the present invention, the single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be highly correlated with blood mercury levels. More preferably, when the base of the single nucleotide polymorphism site is G, the blood mercury level may be predicted to be high.
본 발명의 구체예에서, 상기 대사증후군은 중심 비만, 고혈당증, 고중성지방혈증, 고지혈증 및 고혈압으로 이루어진 군에서 선택된 어느 셋 이상의 증상을 나타내는 것일 수 있으며, 상기 중심 비만은 허리 둘레가 남성의 경우 90cm 이상, 여성의 경우 85cm 이상인 경우를 중심 비만으로 분류하는 것 일 수 있고, 상기 고혈당증은 공복 혈당 수치가 100mg/dL 이상인 경우를 고혈당증으로 분류하는 것 일 수 있으며, 상기 고지혈증은 혈액 HDL-콜레스테롤 수치가 남성의 경우 40mg/dL 미만이고 여성의 경우 50mg/dL 미만인 경우를 고지혈증으로 분류하는 것 일 수 있고, 상기 고중성지방혈증은 혈중 중성 지방 수치가 150mg/dL 이상이면 고중성지방혈증으로 분류하는 것일 수 있으며, 상기 고혈압은 수축기 혈압이 130.85mmHg 이상이고 확장기 혈압이 85mmHg 이상인 경우를 고혈압으로 분류하는 것 일 수 있다.In an embodiment of the present invention, the metabolic syndrome may indicate any three or more symptoms selected from the group consisting of central obesity, hyperglycemia, hypertriglyceridemia, hyperlipidemia and hypertension, and the central obesity has a waist circumference of 90 cm in men Above, in the case of women, 85 cm or more may be classified as central obesity, and the hyperglycemia may be classified as hyperglycemia if the fasting blood glucose level is 100 mg/dL or more, and the hyperlipidemia is the blood HDL-cholesterol level A case of less than 40 mg/dL for men and less than 50 mg/dL for women may be classified as hyperlipidemia, and the hypertriglyceridemia is classified as hypertriglyceridemia if the blood triglyceride level is 150 mg/dL or more. The hypertension may be classified as hypertension when the systolic blood pressure is 130.85 mmHg or more and the diastolic blood pressure is 85 mmHg or more.
본 발명의 구체예에서, 상기 대사증후군은 혈중 중금속 농도 증가에 의한 것일 수 있다.In an embodiment of the present invention, the metabolic syndrome may be caused by an increase in the concentration of heavy metals in the blood.
본 발명의 바람직한 구체예에서, 상기 중금속은 수은일 수 있으나, 이에 제한되지 않는다.In a preferred embodiment of the present invention, the heavy metal may be mercury, but is not limited thereto.
본 발명의 다른 양태에 따르면, 본 발명은 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 포함하는, 대사증후군 예측 또는 진단용 조성물을 제공한다.According to another aspect of the present invention, the present invention includes an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2 It provides a composition for predicting or diagnosing metabolic syndrome.
본 발명의 구체예에서, 상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 더 포함하는 것일 수 있다. In an embodiment of the present invention, the composition may further include an agent capable of detecting a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3.
상기 본 발명의 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 T 또는 C일 수 있고, 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 C 또는 A일 수 있고, 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 A 또는 G일 수 있다.The single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C, and the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A, The single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
본 발명에 있어서, 검출할 수 있는 제제는 상기 단일염기 다형성 부위를 포함하는 폴리뉴클레오티드를 증폭 또는 검출할 수 있는 프라이머쌍 또는 프로브일 수 있다.In the present invention, the detectable agent may be a primer pair or probe capable of amplifying or detecting a polynucleotide including the single nucleotide polymorphism site.
본 발명에 있어서, 프라이머는 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기 서열로 상보적인 템플레이트(template)와 염기쌍 (base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 일반적으로 15 내지 30개의 염기로 구성된다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화할 정도로 충분히 상보적이어야 한다.In the present invention, the primer is a base sequence having a short free 3' hydroxyl group and can form a complementary template and base pair, and serves as a starting point for template strand copying. A short sequence that functions. The appropriate length of the primer may vary depending on the intended use, but generally consists of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template.
본 발명에 있어서, 프로브는 혼성화 프로브로서, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 본 발명의 프로브는 대립형질 특이적(allele-specific) 프로브로서, 같은 종의 두 개체로부터 유래한 핵산 단편 중에 다형성 부위가 존재하여, 한 구성원으로부터 유래한 DNA 단편에는 혼성화하나, 다른 구성원으로 부터 유래한 단편에는 혼성화하지 않는다. 이 경우 혼성화 조건은 대립형질 간의 혼성화 강도에 있어서 유의한 차이를 보여 대립형질 중 하나에만 혼성화되도록 충분히 엄격해야 한다. 바람직하게는 프로브는 혼성화에서의 최대 효율을 위하여 단일 가닥, 더 바람직하게는 디옥시리보뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. 상기 프로브는 상기 SNP를 포함하는 서열에 완전하게(perfectly) 상보적인 서열이 이용될 수 있으나, 특이적 혼성화를 방해하지 않는 범위 내에서 실질적으로(substantially) 상보적인 서열이 이용될 수도 있다.In the present invention, a probe refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid as a hybridization probe. The probe of the present invention is an allele-specific probe. A polymorphic site exists in nucleic acid fragments derived from two individuals of the same species, and thus hybridizes to a DNA fragment derived from one member but derived from another member. There is no hybridization in one fragment. In this case, the hybridization conditions should be sufficiently stringent to show a significant difference in the hybridization intensity between alleles and to hybridize to only one of the alleles. Preferably, the probe may be a single-stranded, more preferably deoxyribonucleotide for maximum efficiency in hybridization, but is not limited thereto. As the probe, a sequence perfectly complementary to the sequence including the SNP may be used, but a substantially complementary sequence may be used within a range that does not interfere with specific hybridization.
본 발명에 있어서, 상기 조성물은 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다.In the present invention, the composition may further include one or more other component compositions, solutions or devices suitable for the analysis method.
본 발명의 또 다른 양태에 따르면, 본 발명은 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는, 혈중 수은 수준 예측용 마커 조성물을 제공한다.According to another aspect of the present invention, the present invention provides a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; Or a polynucleotide consisting of 10 to 100 consecutive DNA sequences including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; A marker composition for predicting blood mercury levels, including; provides
본 발명의 구체예에서, 상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 포함할 수 있다.In an embodiment of the present invention, the composition may further include a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3.
상기 본 발명의 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 T 또는 C일 수 있고, 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 C 또는 A일 수 있고, 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 A 또는 G일 수 있다.The single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C, and the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A, The single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
본 발명의 또 다른 양태에 따르면, 본 발명은 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 포함하는, 혈중 수은 수준 예측용 조성물을 제공한다.According to another aspect of the present invention, the present invention provides an agent capable of detecting a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 1 or a single nucleotide polymorphism of the 101st base in a polynucleotide consisting of SEQ ID NO: 2 It provides a composition for predicting blood mercury levels, including.
본 발명의 구체예에서, 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 검출할 수 있는 제제를 더 포함할 수 있다.In an embodiment of the present invention, an agent capable of detecting a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 may be further included.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 대사증후군 예측 또는 진단용 조성물을 포함하는 대사증후군 예측 또는 진단용 키트를 제공한다. 또한 본 발명은 상기 혈중 수은 수준 예측용 조성물을 포함하는 혈중 수은 수준 예측용 키트를 제공한다.According to another aspect of the present invention, the present invention provides a kit for predicting or diagnosing metabolic syndrome comprising the composition for predicting or diagnosing metabolic syndrome. In addition, the present invention provides a kit for predicting blood mercury level comprising the composition for predicting blood mercury level.
본 발명에 있어서, 상기 키트는 중합효소 연쇄반응(PCR) 키트, 리가아제 연쇄 반응(LCR) 키트, Gap-LCR, 복구 연쇄반응(repair chain reaction) 키트, 전사-중재 증폭(TMA) 키트, 자가 유지 염기서열 복제(self sustained sequence replication) 키트, 표적 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences) 키트, 컨센서스 서열 프라이밍 중합효소 연쇄 반응(CP-PCR) 키트, 임의적 프라이밍 중합효소 연쇄 반응 (AP-PCR) 키트, 핵산 염기서열 기반 증폭(NASBA) 키트, 가닥 치환 증폭(strand displacement amplification) 키트, 고리-중재 항온성 증폭(LAMP) 키트, 다중 중합소연쇄반응(multiplex PCR) 키트, 이중 중합효소연쇄반응(nested-PCR) 키트, 단일 튜브 이중 중합효소연쇄반응(single tube nested-PCR) 키트, 역전사-중합효소연쇄반응(RT-PCR) 키트, 역중합효소연쇄반응(inverse PCR) 키트, 실시간 중합효소연쇄반응(RT-PCR) 키트, 및 실시간 중합효소연쇄반응 정량검사(RQ-PCR) 키트로 이루어진 군으로부터 선택된 1종 이상일 수 있으나, 이에 본 발명이 제한되는 것은 아니다.In the present invention, the kit is a polymerase chain reaction (PCR) kit, a ligase chain reaction (LCR) kit, a Gap-LCR, a repair chain reaction kit, a transcription-mediated amplification (TMA) kit, an autologous self sustained sequence replication kit, selective amplification of target polynucleotide sequences kit, consensus sequence priming polymerase chain reaction (CP-PCR) kit, optional priming polymerase chain reaction (AP-PCR) kit, nucleic acid sequence-based amplification (NASBA) kit, strand displacement amplification kit, loop-mediated constant temperature amplification (LAMP) kit, multiplex PCR kit, dual Polymerase chain reaction (nested-PCR) kit, single tube nested-PCR kit, reverse transcription-polymerase chain reaction (RT-PCR) kit, inverse PCR kit , a real-time polymerase chain reaction (RT-PCR) kit, and a real-time polymerase chain reaction quantitative assay (RQ-PCR) kit may be at least one selected from the group consisting of, but the present invention is not limited thereto.
본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 시료에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 대사증후군 예측 또는 진단을 위한 정보제공 방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2; Metabolism, including Provided is an informational method for predicting or diagnosing a syndrome.
본 발명의 구체예에서, 상기 (b) 단계는, 상기 분리된 DNA에서 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계를 더 포함하는 것일 수 있으며, 더 포함하는 구성에 의해 대사증후군을 더 정확히 예측 또는 진단하기 위한 정보를 제공할 수 있다.In an embodiment of the present invention, the step (b) may further include the step of confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA, further comprising By the configuration, it is possible to provide information for more accurately predicting or diagnosing the metabolic syndrome.
상기 본 발명의 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 T 또는 C일 수 있고, 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 C 또는 A일 수 있고, 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 A 또는 G일 수 있다.The single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C, and the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A, The single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
본 발명에 있어서, 상기 (a) 단계의 시료는 단일염기 다형성 부위를 검출하기 위해 필요한 핵산, 특히 DNA의 추출이 가능한 진단 대상 개체 유래의 생물학적 시료를 제한없이 포함하며, 예를 들어 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨 등의 시료 등을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the sample of step (a) includes, without limitation, a biological sample derived from a subject to be diagnosed from which extraction of nucleic acid, particularly DNA, required for detecting a single nucleotide polymorphism site is possible, for example, tissues, cells, It may include, but is not limited to, samples such as whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.
본 발명에 있어서, 단일염기 다형성을 확인하는 단계는, 분리된 DNA에서 단일염기 다형성 부위의 유전자형을 확인하는 것을 의미하며, 구체적으로 분리된 DNA를 자동염기서열분석기를 사용한 시퀀싱 분석, 파이로시퀀싱(pyrosequencing), 마이크로어레이에 의한 혼성화, PCR-RELP법(restriction fragment length polymorphism), PCR-SSCP법(single strand conformation polymorphism), PCR-SSO법(specific sequence oligonucleotide), PCR-SSO법과 도트 하이브리드화법을 조합한 ASO(allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA법(rolling circle amplification), HRM(high resolution melting)법, 프라이머 신장법, 서던 블롯 하이브리드화법, 도트 하이브리드화법 등의 방법을 통해 분석하여, 유전자형을 확인하는 것 일 수 있다.In the present invention, the step of confirming the single nucleotide polymorphism means confirming the genotype of the single nucleotide polymorphism site in the isolated DNA, specifically, sequencing analysis using an automatic sequencing analyzer, pyrosequencing ( pyrosequencing), hybridization by microarray, PCR-RELP method (restriction fragment length polymorphism), PCR-SSCP method (single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), PCR-SSO method and dot hybridization method are combined ASO (allele specific oligonucleotide) hybridization method, TaqMan-PCR method, MALDI-TOF/MS method, RCA method (rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method, dot hybridization method It may be to confirm the genotype by analyzing it through a method such as.
본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 시료에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 혈중 수은 수준 예측을 위한 정보제공 방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of (a) isolating DNA from a sample; And (b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; It provides an informational method for estimating mercury levels.
본 발명의 구체예에서, 상기 (b) 단계는, 상기 분리된 DNA에서 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계를 더 포함하는 것일 수 있다.In an embodiment of the present invention, step (b) may further include confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA.
상기 본 발명의 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 T 또는 C일 수 있고, 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 C 또는 A일 수 있고, 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성은 A 또는 G일 수 있다.The single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 of the present invention may be T or C, and the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2 may be C or A, The single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 may be A or G.
본 발명의 또 다른 양태에 따르면, 본 발명은 혈중 중금속 농도와 연관된 SNP를 이용한 대사 증후군 진단 및 치료방법을 제공한다. 본 발명의 대사 증후군 진단 및 치료방법은 (a) 개체로부터 분석 시료를 얻는 단계, (b) 단계 (a)의 분석 시료에서 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 검출하는 단계, (c) 단계 (b)의 폴리뉴클레오티드가 서열번호 1로 표시되는 폴리뉴클레오티드의 101번째 염기가 C인 경우; 또는 서열번호 2로 표시되는 폴리뉴클레오티드의 101번째 염기가 A인 경우; 대사 증후군으로 진단하는 단계, 및 (d) 단계 (c)에서 대사 증후군으로 진단된 개체에 유효량의 대사 증후군 치료제를 투여하는 단계를 포함한다.According to another aspect of the present invention, the present invention provides a method for diagnosing and treating metabolic syndrome using a SNP associated with a blood heavy metal concentration. The metabolic syndrome diagnosis and treatment method of the present invention comprises the steps of (a) obtaining an assay sample from an individual, (b) in the assay sample of step (a), in the polynucleotide represented by SEQ ID NO: 1, the 101st base is T or C. polynucleotides consisting of 10 to 100 contiguous DNA sequences containing nucleotide polymorphisms; or a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2; detecting, (c) step (b) ) when the 101st base of the polynucleotide represented by SEQ ID NO: 1 is C; or when the 101st base of the polynucleotide represented by SEQ ID NO: 2 is A; diagnosing the metabolic syndrome, and (d) administering to the subject diagnosed with the metabolic syndrome in step (c) an effective amount of a therapeutic agent for the metabolic syndrome.
본 발명의 구체예에서, 상기 단계 (b)는 단계 (a)의 분석 시료에서 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 검출하는 것이 바람직하다.In an embodiment of the present invention, step (b) comprises a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 in the analysis sample of step (a), 10 to 100 consecutive It is preferable to further detect a polynucleotide composed of a specific DNA sequence.
본 발명에 있어서, 대사 증후군 치료제는 대사 증후군의 증상을 경감/치료하기 위한 제제를 의미한다.In the present invention, the therapeutic agent for metabolic syndrome refers to an agent for alleviating/treating symptoms of metabolic syndrome.
본 발명의 구체예에서, 상기 대사 증후군 치료제는 pitavastatin, amlodipine besylate, losartan, carvedilol, lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, rosuvastatin, fenofibrate, gemfibrozil, bezafibrate, pravafenix, ezetimibe, niacin, probucol, orlistat, lorcaserin, diethylpropion, phentermine, mazindol, phendimetrazine, lorcaserin, liraglutide, nicotinic acid 및 acipimox로 이루어진 군에서 선택되는 1종 이상인 것이 바람직하나, 이에 제한되지 않는다.In an embodiment of the present invention, the metabolic syndrome therapeutic agent is pitavastatin, amlodipine besylate, losartan, carvedilol, lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, rosuvastatin, fenofibrate, gembuzil, bezafibrate, pravafenix, niacasetimi , diethylpropion, phentermine, mazindol, phendimetrazine, lorcaserin, liraglutide, nicotinic acid, and at least one selected from the group consisting of acipimox, but is not limited thereto.
본 발명의 구체예에서, 상기 대사 증후군은 혈중 중금속 농도에 의한 대사 증후군인 것이 바람직하나, 이에 본 발명의 범위가 제한되지 않는다.In an embodiment of the present invention, the metabolic syndrome is preferably a metabolic syndrome caused by a heavy metal concentration in blood, but the scope of the present invention is not limited thereto.
중복되는 내용은 본 명세서의 복잡성을 고려하여 생략하며, 본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.Duplicate content is omitted in consideration of the complexity of the present specification, and terms not defined otherwise in the present specification have the meanings commonly used in the technical field to which the present invention pertains.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.
실시예 1. 실험 방법Example 1. Experimental method
1.1 실험 참여자 모집1.1 Recruitment of experiment participants
채혈에 동의한 대사 증후군 참여자들은 가이드라인에 따라 하나로 의료원 (한국)에서 모집하였다. 수집 프로토콜은 서울의 임상 연구소로부터 윤리적 승인을 받았으며, 헬싱키 선언 원칙에 부합하였다. 모든 참가자에게 혈액 샘플을 사용한 혈액 검사 및 SNP 유전형 검사에 대한 정보를 제공하였다.Metabolic syndrome participants who consented to blood sampling were recruited from Hanaro Medical Center (Korea) according to guidelines. The collection protocol was ethically approved by the Clinical Research Institute in Seoul, and conformed to the principles of the Declaration of Helsinki. All participants were provided with information about blood tests using blood samples and SNP genotyping.
1.2 대사 증후군 참여자 선별1.2 Screening of participants with metabolic syndrome
건강 검진 참가자 중 18 세 이상의 남녀가 포함되었다. 중심 비만, 고혈당증, 고중성지방혈증, 고지혈증 및 고혈압 중 3 가지 이상을 만족하는 경우 대사 증후군으로 임상 진단하였다. 진단 기준은 최근 대한 가정의학회가 발간한 한국 성인의 대사 증후군 예방 및 치료 지침을 기반으로 정의된 대사 증후군의 5 가지 기준을 기반으로 하였다. 허리 둘레가 남성의 경우 90cm 이상, 여성의 경우 85cm 이상인 경우를 중심 비만으로 분류하였다. 공복 혈당 수치가 100mg/dL 이상인 경우, 고혈당증으로 분류하였다. 혈액 HDL-콜레스테롤 수치가 남성의 경우 40mg/dL 미만이고 여성의 경우 50mg/dL 미만인 경우, 고지혈증으로 분류하였다. 혈중 중성 지방 수치가 150mg/dL 이상이면 고중성지방혈증으로 분류하였다. 수축기 혈압이 130.85mmHg 이상이고 확장기 혈압이 85mmHg 이상인 경우, 고혈압으로 분류하였다.Men and women 18 years of age or older were included among the health screening participants. When three or more of central obesity, hyperglycemia, hypertriglyceridemia, hyperlipidemia and hypertension were satisfied, metabolic syndrome was clinically diagnosed. The diagnostic criteria were based on the five criteria of metabolic syndrome defined based on the guidelines for the prevention and treatment of metabolic syndrome in Korean adults recently published by the Korean Society of Family Medicine. A waist circumference of 90 cm or more for men and 85 cm or more for women was classified as central obesity. A fasting blood glucose level of 100 mg/dL or higher was classified as hyperglycemia. If the blood HDL-cholesterol level was less than 40 mg/dL for men and less than 50 mg/dL for women, it was classified as hyperlipidemia. A blood triglyceride level of 150 mg/dL or higher was classified as hypertriglyceridemia. A systolic blood pressure of 130.85 mmHg or higher and a diastolic blood pressure of 85 mmHg or higher were classified as hypertension.
1.3 전장 유전체 SNP 유전자형 분석(Genome wide SNP genotyping)1.3 Genome wide SNP genotyping
MagNA Pure 96 DNA and Viral NA SV Kit (Roche Life Science, USA)와 MagNA Pure 96 System (Roche Life Science, USA)을 사용하여 200μl의 전혈에서 DNA 샘플을 수득하였다. 추출된 DNA 샘플은 제조업체의 지침을 따라 GeneTitan ™ Multi-Channel Instrument와 KNIH biobank array v1.1 칩을 이용하여 827,783개의 SNP에 대한 유전자형 분석(genotyping)을 수행하였다. 유전자형 분석 결과인 CEL 파일은 Axiom Analysis Suite 프로그램을 사용하여 PLINK 입력 포맷 파일 (ped 포맷)로 변환하였다. 컷오프 기준인 DQC ≥ 0.82 및 호출 속도(call rate) ≥ 0.97에 도달하지 않은 샘플은 KNIH 바이오 뱅크 어레이 v1.1 칩을 사용하여 유전자형 분석을 다시 수행하였다. PLINK (버전 1.90)를 사용하여 유전자형 ped 파일을 분석하였다. 대조군 대비 대사증후군 그룹에서 p-value 가 0.05 이하로 나온 경우만 유의미한 SNP으로 보고 추가 분석을 진행하였다. 선별된 SNP들에 대해서 R 프로그램의 패키지를 이용하여 수은의 혈중 농도와 연관성 분석을 하여 유의미하게 연관성을 보이는 SNP(p-value 가 0.05 이하)을 한번 더 선별하였다. DNA samples were obtained from 200 μl whole blood using the MagNA Pure 96 DNA and Viral NA SV Kit (Roche Life Science, USA) and the MagNA Pure 96 System (Roche Life Science, USA). The extracted DNA samples were subjected to genotyping of 827,783 SNPs using GeneTitan ™ Multi-Channel Instrument and KNIH biobank array v1.1 chip according to the manufacturer's instructions. The CEL file, the result of genotyping, was converted into a PLINK input format file (ped format) using the Axiom Analysis Suite program. Samples that did not reach the cutoff criteria of DQC ≥ 0.82 and call rate ≥ 0.97 were re-genotyped using the KNIH Biobank Array v1.1 chip. PLINK (version 1.90) was used to analyze genotype ped files. In the metabolic syndrome group compared to the control group, only the case where the p-value was less than 0.05 was regarded as a significant SNP and further analysis was performed. For the selected SNPs, using the package of the R program, correlation analysis was performed with the blood concentration of mercury, and SNPs (p-value of less than or equal to 0.05) that were significantly correlated were selected once more.
1.4 SNP 연관성 산출1.4 SNP Association Calculation
유전자 주석 달기(gene symbole annotating)를 위해, Ensembl API 클라이언트 (Genome hg19가 포함된 버전 1.1.5)를 이용하여 유의미한 연관성이 있는 SNP를 분석하였다. 수은 관련 경로 유전자에 포함되며, 하디-바인베르크 평형 분석 결과 p-value가 0.05 미만인 SNP를 도출하였다. 선택된 SNP를 대상으로, 혈중 수은 수준과의 연관성을 선형 회귀 모델링 접근법을 사용하여 분석하였다. R 패키지 소프트웨어 (버전 3.5.3)를 사용하여 특성에 대해 연관성 분석을 수행하였다.For gene symbole annotating, SNPs with significant association were analyzed using the Ensembl API client (version 1.1.5 with Genome hg19). It is included in the mercury-related pathway gene, and as a result of Hardy-Weinberg equilibrium analysis, a SNP with a p-value of less than 0.05 was derived. For selected SNPs, association with blood mercury levels was analyzed using a linear regression modeling approach. Association analysis was performed on the properties using the R package software (version 3.5.3).
1.5 선택된 SNP의 경로 분석(pathway analysis)1.5 Pathway analysis of selected SNPs
기능적 용어(functional term)를 검색하기 위한 경로 분석(pathway analysis)을 수행하기 위해, P value 0.05 미만의 선별된 SNP에 대해 파이썬 프로그램을 사용하여 유전자 주석을 달았다. 경로 분석을 위해, NDEx 통합 쿼리 (버전 1.0) 웹 사이트를 사용하였고, Harmonizome 온라인 버전의 통합 유전 데이터베이스를 유전자 기능적 용어 분석에 사용하였다. P-value가 0.05 미만인 경로는 유의미한 경로로 간주하였다.To perform pathway analysis to search for functional terms, selected SNPs with a P value of less than 0.05 were gene annotated using a Python program. For pathway analysis, the NDEx Integration Query (version 1.0) website was used, and the Harmonizome online version of the integrated genetic database was used for gene functional terminology analysis. Pathways with a p-value of less than 0.05 were considered significant.
실시예 2. 대사 증후군 환자의 혈중 수은 수준 증가와 관련된 SNP 마커의 도출Example 2. Derivation of SNP Markers Associated with Increased Blood Mercury Levels in Patients with Metabolic Syndrome
실시예 1.3의 분석을 통해, 정상 대조군 대비 대사증후군 환자군에서 특이적으로 높은 빈도를 나타내는 SNP를 선별하였다. 선별된 SNP에 대하여 실시예 1.4와 같이 유전자 주석을 달아, 혈중 수은 수준과 관련된 유전자 상의 SNP를 도출하고, 도출된 SNP와 혈중 수은 수준과의 연관성을 분석하였으며, SNP와 혈중 수은 수준과 P-value를 도 1에 나타내었다. Through the analysis of Example 1.3, SNPs showing a specific high frequency in the metabolic syndrome patient group compared to the normal control group were selected. The selected SNPs were annotated as in Example 1.4 to derive SNPs on genes related to blood mercury levels, and the association between the derived SNPs and blood mercury levels was analyzed. SNPs and blood mercury levels and P-values is shown in FIG. 1 .
도 1에 나타낸 바와 같이, 3개의 SNP(rs666647, rs1805479, rs666636)가 혈중 수은 수준과 유의한 연관성이 있는 것을 확인하였다. As shown in FIG. 1 , it was confirmed that three SNPs (rs666647, rs1805479, rs666636) were significantly correlated with blood mercury levels.
상기 3개의 SNP는 정상 대조군 대비 대사증후군 환자에서 특이적으로 높은 빈도를 나타내는 것으로써, 개체의 상기 SNP의 염기서열을 확인함으로써 대사증후군을 예측 또는 진단할 수 있을 뿐만 아니라, 혈중 수은 수준에 대한 정보도 확인할 수 있다. 나아가, 높은 혈중 수은 수준은 대사증후군의 주요 원인으로 언급되고 있는바, 수은 축적에 의한 대사증후군을 예측 또는 진단하는 용도로 사용될 수 있다.The three SNPs show a specifically high frequency in patients with metabolic syndrome compared to normal controls, and by confirming the nucleotide sequence of the SNP of an individual, it is possible to predict or diagnose metabolic syndrome as well as information on blood mercury levels can also be checked. Furthermore, high blood mercury levels are mentioned as a major cause of metabolic syndrome, and may be used for predicting or diagnosing metabolic syndrome caused by mercury accumulation.
이상, 본 발명내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다.Above, a specific part of the present invention has been described in detail, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

Claims (21)

  1. 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; or
    서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는 대사증후군 예측 또는 진단용 마커 조성물.A marker composition for predicting or diagnosing metabolic syndrome, comprising a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is C or A in the polynucleotide represented by SEQ ID NO: 2.
  2. 제1항에 있어서,According to claim 1,
    상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 포함하는 것인, 대사증후군 예측 또는 진단용 마커 조성물.The composition further comprises a polynucleotide consisting of 10 to 100 consecutive DNA sequences comprising a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3, metabolic syndrome prediction or a diagnostic marker composition.
  3. 제1항에 있어서,According to claim 1,
    상기 대사증후군은 중심 비만, 고혈당증, 고중성지방혈증, 고지혈증 및 고혈압으로 이루어진 군에서 선택된 어느 셋 이상의 증상을 나타내는 것인, 대사증후군 예측 또는 진단용 마커 조성물.The metabolic syndrome is central obesity, hyperglycemia, hypertriglyceridemia, hyperlipidemia and hypertension to represent any three or more symptoms selected from the group consisting of, metabolic syndrome prediction or diagnostic marker composition.
  4. 제1항에 있어서,According to claim 1,
    상기 대사증후군은 혈중 중금속 농도 증가에 의한 것인, 대사증후군 예측 또는 진단용 마커 조성물.The metabolic syndrome is due to an increase in the concentration of heavy metals in the blood, a marker composition for predicting or diagnosing metabolic syndrome.
  5. 제4항에 있어서,5. The method of claim 4,
    상기 중금속은 수은인, 대사증후군 예측 또는 진단용 마커 조성물.The heavy metal is mercury, a marker composition for prediction or diagnosis of metabolic syndrome.
  6. 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 포함하는, 대사증후군 예측 또는 진단용 조성물.A composition for predicting or diagnosing metabolic syndrome, comprising an agent capable of detecting the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2.
  7. 제6항에 있어서,7. The method of claim 6,
    상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 더 포함하는 것인, 대사증후군 예측 또는 진단용 조성물.The composition further comprises an agent capable of detecting a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3, a composition for predicting or diagnosing metabolic syndrome.
  8. 서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; or
    서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 포함하는, 혈중 수은 수준 예측용 마커 조성물.In the polynucleotide represented by SEQ ID NO: 2, the polynucleotide comprising a single nucleotide polymorphism in which the 101st base is C or A, and a polynucleotide consisting of 10 to 100 consecutive DNA sequences; A marker composition for predicting blood mercury levels, including.
  9. 제8항에 있어서,9. The method of claim 8,
    상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 포함하는 것인, 혈중 수은 수준 예측용 마커 조성물.wherein the composition further comprises a polynucleotide consisting of 10 to 100 consecutive DNA sequences comprising a single nucleotide polymorphism wherein the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 A marker composition for prediction.
  10. 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 더 포함하는, 혈중 수은 수준 예측용 조성물.A composition for predicting mercury levels in blood, further comprising an agent capable of detecting the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 1 or the single nucleotide polymorphism of the 101st base in the polynucleotide consisting of SEQ ID NO: 2.
  11. 제10항에 있어서,11. The method of claim 10,
    상기 조성물은 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 검출할 수 있는 제제를 더 포함하는 것인, 혈중 수은 수준 예측용 조성물.Wherein the composition further comprises an agent capable of detecting a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3, the composition for predicting the level of mercury in blood.
  12. 제6항 또는 제7항의 조성물을 포함하는, 대사증후군 예측 또는 진단용 키트.A kit for predicting or diagnosing metabolic syndrome, comprising the composition of claim 6 or 7.
  13. (a) 시료에서 DNA를 분리하는 단계; 및(a) isolating DNA from the sample; and
    (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 대사증후군 예측 또는 진단을 위한 정보제공 방법.(b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; metabolic syndrome, including Methods of providing information for prediction or diagnosis.
  14. 제13항에 있어서,14. The method of claim 13,
    상기 (b) 단계는, 상기 분리된 DNA에서 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계를 더 포함하는 것인, 대사증후군 예측 또는 진단을 위한 정보제공 방법.The step (b) further comprises the step of confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA. Method for predicting or diagnosing metabolic syndrome.
  15. 제10항 또는 제11항의 조성물을 포함하는, 혈중 수은 수준 예측용 키트.A kit for predicting blood mercury levels, comprising the composition of claim 10 or 11.
  16. (a) 시료에서 DNA를 분리하는 단계; 및(a) isolating DNA from the sample; and
    (b) 상기 분리된 DNA에서 서열번호 1로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성 또는 서열번호 2로 이루어지는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계;를 포함하는, 혈중 수은 수준 예측을 위한 정보제공 방법.(b) confirming the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 1 in the isolated DNA or the single nucleotide polymorphism of the 101st nucleotide in the polynucleotide consisting of SEQ ID NO: 2; A method of providing information for level prediction.
  17. 제16항에 있어서,17. The method of claim 16,
    상기 (b) 단계는, 상기 분리된 DNA에서 서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기의 단일염기 다형성을 확인하는 단계를 더 포함하는 것인, 혈중 수은 수준 예측을 위한 정보제공 방법.The step (b) further comprises the step of confirming a single nucleotide polymorphism of the 101st base in the polynucleotide represented by SEQ ID NO: 3 in the isolated DNA. The method for predicting mercury levels in blood.
  18. (a) 개체로부터 분석 시료를 얻는 단계,(a) obtaining an assay sample from the subject;
    (b) 단계 (a)의 분석 시료에서(b) in the assay sample of step (a)
    서열번호 1로 표시되는 폴리뉴클레오티드에서 101번째 염기가 T 또는 C인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는a polynucleotide comprising a single nucleotide polymorphism in which the 101st base is T or C in the polynucleotide represented by SEQ ID NO: 1, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; or
    서열번호 2로 표시되는 폴리뉴클레오티드에서 101번째 염기가 C 또는 A인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드;를 검출하는 단계,In the polynucleotide represented by SEQ ID NO: 2, the 101st base is a polynucleotide comprising a single nucleotide polymorphism of C or A, a polynucleotide consisting of 10 to 100 consecutive DNA sequences; detecting;
    (c) 단계 (b)의 폴리뉴클레오티드가 서열번호 1로 표시되는 폴리뉴클레오티드의 101번째 염기가 C인 경우; 또는 서열번호 2로 표시되는 폴리뉴클레오티드의 101번째 염기가 A인 경우; 대사 증후군으로 진단하는 단계, 및(c) when the 101st base of the polynucleotide of step (b) is represented by SEQ ID NO: 1 is C; or when the 101st base of the polynucleotide represented by SEQ ID NO: 2 is A; diagnosing with metabolic syndrome, and
    (d) 단계 (c)에서 대사 증후군으로 진단된 개체에 유효량의 대사 증후군 치료제를 투여하는 단계를 포함하는 대사 증후군 진단 및 치료방법.(d) a method for diagnosing and treating metabolic syndrome, comprising administering an effective amount of a therapeutic agent for metabolic syndrome to the subject diagnosed with metabolic syndrome in step (c).
  19. 제18항에 있어서,19. The method of claim 18,
    상기 단계 (b)는 단계 (a)의 분석 시료에서The step (b) in the analysis sample of step (a)
    서열번호 3으로 표시되는 폴리뉴클레오티드에서 101번째 염기가 A 또는 G인 단일염기 다형성을 포함하는, 10 내지 100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드를 더 검출하는 것인, 대사 증후군 진단 및 치료방법.Method for diagnosing and treating metabolic syndrome, which further detects a polynucleotide consisting of 10 to 100 consecutive DNA sequences, including a single nucleotide polymorphism in which the 101st base is A or G in the polynucleotide represented by SEQ ID NO: 3 .
  20. 제18항에 있어서,19. The method of claim 18,
    상기 대사 증후군 치료제는 pitavastatin, amlodipine besylate, losartan, carvedilol, lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, rosuvastatin, fenofibrate, gemfibrozil, bezafibrate, pravafenix, ezetimibe, niacin, probucol, orlistat, lorcaserin, diethylpropion, phentermine, mazindol, phendimetrazine, lorcaserin, liraglutide, nicotinic acid 및 acipimox로 이루어진 군에서 선택되는 1종 이상인, 대사 증후군 진단 및 치료방법.The metabolic syndrome treatment is pitavastatin, amlodipine besylate, losartan, carvedilol, lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, rosuvastatin, fenofibrate, gemfibrozil, bezafibrate, pravafenix, ezetimibecol, orlistazatin, A method for diagnosing and treating metabolic syndrome, at least one selected from the group consisting of phendimetrazine, lorcaserin, liraglutide, nicotinic acid and acipimox.
  21. 제18항에 있어서,19. The method of claim 18,
    상기 대사 증후군은 혈중 중금속 농도에 의한 대사 증후군인, 대사 증후군 진단 및 치료방법.The metabolic syndrome is a metabolic syndrome due to the concentration of heavy metals in the blood, metabolic syndrome diagnosis and treatment method.
PCT/KR2022/000371 2021-01-13 2022-01-10 Composition for diagnosing or predicting metabolic syndrome WO2022154401A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210004787A KR102291727B1 (en) 2021-01-13 2021-01-13 Composition for diagnosing or predicting metabolic syndrome
KR10-2021-0004787 2021-01-13

Publications (1)

Publication Number Publication Date
WO2022154401A1 true WO2022154401A1 (en) 2022-07-21

Family

ID=77466581

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000371 WO2022154401A1 (en) 2021-01-13 2022-01-10 Composition for diagnosing or predicting metabolic syndrome

Country Status (2)

Country Link
KR (1) KR102291727B1 (en)
WO (1) WO2022154401A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102291727B1 (en) * 2021-01-13 2021-08-20 주식회사 에스씨엘헬스케어 Composition for diagnosing or predicting metabolic syndrome

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080067929A (en) * 2007-01-17 2008-07-22 전자부품연구원 A system for prediction and diagnosis of metabolic syndrome
KR101815692B1 (en) * 2016-07-25 2018-01-16 주식회사 고바이오랩 The human oral microbiota in diagnosis of metabolic syndrome
KR20190043449A (en) * 2017-10-18 2019-04-26 주식회사 엠디헬스케어 Method for diagnosis of metabolic syndrome using analysis of bacteria metagenome
KR20190115836A (en) * 2018-04-04 2019-10-14 연세대학교 산학협력단 A method and kit for assessing risk of metabolic syndrome using natural killer cell activity
KR102291727B1 (en) * 2021-01-13 2021-08-20 주식회사 에스씨엘헬스케어 Composition for diagnosing or predicting metabolic syndrome

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080067929A (en) * 2007-01-17 2008-07-22 전자부품연구원 A system for prediction and diagnosis of metabolic syndrome
KR101815692B1 (en) * 2016-07-25 2018-01-16 주식회사 고바이오랩 The human oral microbiota in diagnosis of metabolic syndrome
KR20190043449A (en) * 2017-10-18 2019-04-26 주식회사 엠디헬스케어 Method for diagnosis of metabolic syndrome using analysis of bacteria metagenome
KR20190115836A (en) * 2018-04-04 2019-10-14 연세대학교 산학협력단 A method and kit for assessing risk of metabolic syndrome using natural killer cell activity
KR102291727B1 (en) * 2021-01-13 2021-08-20 주식회사 에스씨엘헬스케어 Composition for diagnosing or predicting metabolic syndrome

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MOLEIRINHO ANA, CARNEIRO JOÃO, MATTHIESEN RUNE, SILVA RAQUEL M., AMORIM ANTÓNIO, AZEVEDO LUÍSA: "Gains, Losses and Changes of Function after Gene Duplication: Study of the Metallothionein Family", PLOS ONE, vol. 6, no. 4, 25 April 2011 (2011-04-25), pages 1 - 9, XP055951975, DOI: 10.1371/journal.pone.0018487 *

Also Published As

Publication number Publication date
KR102291727B1 (en) 2021-08-20

Similar Documents

Publication Publication Date Title
AU2010294193B2 (en) Methods for assessing liver pathologies
US20150337383A1 (en) Method of using foxo3a polymorphisms and haplotypes to predict and promote healthy aging and longevity
Huebner et al. Triallelic single nucleotide polymorphisms and genotyping error in genetic epidemiology studies: MDR1 (ABCB1) G2677/T/A as an example
US20100062447A1 (en) Methods for Identifying Cancer Risk
WO2022154401A1 (en) Composition for diagnosing or predicting metabolic syndrome
CN111560428B (en) Application of substance for detecting single nucleotide polymorphism of mitochondrial DNA rs3937033
Radvanszky et al. Uninterrupted CCTG tracts in the myotonic dystrophy type 2 associated locus
WO2022075627A1 (en) Composition for diagnosis or prediction of metabolic syndrome or group at high risk of expression of blood ceramide
CN111676283A (en) Application of mitochondrial DNA single nucleotide polymorphism related to occurrence of high altitude pulmonary edema
WO2013060005A1 (en) Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor
US20230033016A1 (en) Detection of hypermethylated genes for diagnosing gastric cancer
Nilsson et al. Simultaneous genotyping of the three lactose tolerance-linked polymorphisms LCT–13907C> G, LCT–13910C> T and LCT–13915T> G with Pyrosequencing™ technology
JP2008529524A (en) Method for diagnosing type 2 diabetes using multilocus marker, polynucleotide containing marker related to type 2 diabetes, microarray containing the same, and kit for diagnosing type 2 diabetes
WO2020060170A1 (en) Marker composition for diagnosis of atopic dermatitis and method, using same, for prediction or diagnosis of atopic dermatitis
Jiao et al. Toll‑like receptor 4 gene is associated with recurrent spontaneous miscarriage in Uygur and Han women in Xinjiang
WO2015111852A1 (en) Composition for predicting risk of thiopurine-induced leukopenia, containing single nucleotide polymorphism marker within nudt15 gene
WO2019225803A1 (en) Association between rnf213 single nucleotide polymorphism and risk of developing moyamoya disease in koreans
WO2022080882A1 (en) Snp as marker for predicting exacerbation of chronic kidney disease, and uses thereof
Kwon et al. Haplotype analysis of the myotonic dystrophy type 1 (DM1) locus in the Korean population
WO2020116838A1 (en) Composition and kit for predicting sensitivity to exercise and method using same
WO2020060211A1 (en) Genetic marker for predicting concentration of statin drug in blood
WO2020162663A1 (en) Single nucleotide polymorphism marker for precocious puberty diagnosis or treatment prognosis prediction, and use thereof
WO2018186680A1 (en) Composition comprising genomic dna-based long pcr primer set for diagnosing neurofibromatosis
CN110577992A (en) application of RXRA gene polymorphism in adverse reaction of antituberculotic drugs
KR20200066946A (en) Composition, kit for predicting weight control according to dietary habits, and method using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22739597

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22739597

Country of ref document: EP

Kind code of ref document: A1