WO2022154169A9 - Anticancer composition containing sp-fa conjugate as active ingredient - Google Patents

Anticancer composition containing sp-fa conjugate as active ingredient Download PDF

Info

Publication number
WO2022154169A9
WO2022154169A9 PCT/KR2021/003543 KR2021003543W WO2022154169A9 WO 2022154169 A9 WO2022154169 A9 WO 2022154169A9 KR 2021003543 W KR2021003543 W KR 2021003543W WO 2022154169 A9 WO2022154169 A9 WO 2022154169A9
Authority
WO
WIPO (PCT)
Prior art keywords
cells
conjugate
conjugates
present
cancer
Prior art date
Application number
PCT/KR2021/003543
Other languages
French (fr)
Korean (ko)
Other versions
WO2022154169A1 (en
Inventor
유상권
이대희
Original Assignee
주식회사 엔바이오스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엔바이오스 filed Critical 주식회사 엔바이오스
Publication of WO2022154169A1 publication Critical patent/WO2022154169A1/en
Publication of WO2022154169A9 publication Critical patent/WO2022154169A9/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A61K47/551—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds one of the codrug's components being a vitamin, e.g. niacinamide, vitamin B3, cobalamin, vitamin B12, folate, vitamin A or retinoic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/737—Sulfated polysaccharides, e.g. chondroitin sulfate, dermatan sulfate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to an anti-cancer composition, and more particularly, to prepare an SP-FA conjugate using SP and FA as raw materials, and the SP-FA conjugate reacts specifically to cancer cells having a folate receptor (FR) on the surface,
  • the present invention relates to a novel anticancer composition that is very useful as an anticancer agent because it can selectively remove cancer cells by activating natural killer cells (NK).
  • NK natural killer cells
  • FA Folic acid
  • FR folate receptor
  • FAs allow a variety of chemotherapeutic agents to readily form conjugates. It retains a high affinity for FR even after conjugation with a therapeutic agent. Unlike cancer cells, which have high expression rates of FRs, healthy cells have very low or undetectable expression rates of FRs. This means that FAs can be used as a potential means to express tumor-specific therapeutic carriers. Since ordinary anticancer drugs not only damage tumor cells but also damage healthy cells, the need for a therapeutic approach has recently been strongly raised in the treatment of target cancer.
  • the antitumor activity of FA-hapten conjugates may depend variously on heptene chemistry.
  • the design of FA-hapten conjugates can maximize binding to endogenous anti-hapten antibodies, enhancing their anticancer activity.
  • the sulfated polysaccharide (SP) derived from Codium fragile significantly activates natural killer cells (NK), increases the secretion of IFN- ⁇ and granzyme-B, and expresses NKp30. to enhance cytotoxicity to HeLa cells.
  • SP stimulates the production of nitric oxide (NO) and cytokines to strongly activate RAW264.7 cells, suggesting that they are potent immunostimulants.
  • the present invention is proposed to solve the above-mentioned problems of the prior art.
  • SP derived from C. fragile is covalently bonded to FA
  • SP-FA conjugates are prepared by FA content by esterification reaction
  • FR The cytotoxic effects of these conjugates on benign tumor cells were evaluated by examining NK cell activation. Therefore, the object of the present invention is to evaluate whether SP still retains the activating ability for NK cells after FA conjugation, and to determine the binding ability of these conjugates using FR-positive cancer cells so that macromolecular splicing can bind to surface receptors of cancer cells. It is to confirm the possibility as an anticancer agent by observing whether it exists.
  • An anti-cancer composition comprising a conjugate of folic acid (FA) and sulfated polysaccharide (SP) as an active ingredient.
  • the anti-cancer composition according to (1) above characterized in that it specifically reacts to cancer cells having folate receptors on its surface to activate natural killer cells (NK) to eliminate cancer cells.
  • NK natural killer cells
  • the conjugate prepares an SP solution and an FA solution so that the weight ratio of SP and FA is 1:0.1 to 1, respectively, and the SP solution is added to the FA solution at room temperature to 80 ° C.
  • An anti-cancer composition characterized in that produced by reacting dropwise for a period of time.
  • the present invention prepares an SP-FA conjugate using SP and FA as raw materials, and the SP-FA conjugate reacts specifically to cancer cells having a folate receptor (FR) on the surface to induce natural killer cells (NK) Activated to selectively remove cancer cells, it is possible to provide a novel composition that is very useful as an anticancer agent.
  • FR folate receptor
  • NK natural killer cells
  • Figure 3 is a proliferation test result of HeLa cells and NK cells according to an embodiment of the present invention.
  • NK cells 4 is a cytotoxicity test result of NK cells according to an embodiment of the present invention.
  • 5 is a quantitative analysis result of SP-FA conjugates treated with NK cells for HeLa cells according to an embodiment of the present invention.
  • FIG. 7 shows the results of activation experiments of p-p38, p-JNK, p-ERK 1/2, and p-NF-excellentB-p65 proteins in NK cells according to an embodiment of the present invention.
  • Figure 8 is the results of (i) CQ1 image and (ii) test of binding ability for SP, SP-FA conjugates according to an embodiment of the present invention.
  • the anticancer composition according to the present invention contains a conjugate of folic acid (FA) and sulfated polysaccharide (SP) (hereinafter referred to as "SP-FA conjugate”) as an active ingredient.
  • FA folic acid
  • SP sulfated polysaccharide
  • the conjugate is preferably formed by an esterification reaction between the carboxy group of FA and the hydroxy group of SP, as shown in Scheme 1 below.
  • the SP is preferably extracted and fractionated from C. fragile. More preferably, the fraction contains 67.4 ⁇ 0.6% of carbohydrates, 10.3 ⁇ 0.7% of sulfate, 2.4 ⁇ 0.1% of uric acid, and 14.7 ⁇ 0.1% of protein.
  • the esterification reaction is to prepare an SP solution and an FA solution so that the weight ratio of SP and FA as raw materials is 1:0.1 to 1, preferably 1:0.5, respectively, and the SP solution is added to the FA solution at room temperature to 80 ° C. It includes the process of reacting by adding dropwise for 6 to 24 hours.
  • the SP-FA conjugate prepared by the above process can selectively remove cancer cells by activating natural killer cells (NK) by specifically reacting to cancer cells having a folate receptor (FR) on the surface.
  • NK natural killer cells
  • FR folate receptor
  • the anti-cancer composition containing the SP-FA conjugate according to the present invention as an active ingredient is a pharmaceutical composition, and oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. are prepared according to conventional methods. , It can be formulated and used in the form of external preparations, suppositories and sterile injection solutions.
  • Carriers, excipients and diluents that may be included in the anticancer agent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose, etc. Alternatively, it is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include suspensions, solutions for oral use, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • a base for the suppository witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.
  • the preferred dosage of the SP-FA conjugate varies depending on the condition and body weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. In the case of the present invention, it is recommended to administer 0.0001 to 100 mg/kg per day, preferably 0.001 to 100 mg/kg, and may be administered once a day or divided several times.
  • the present invention includes a food composition containing the SP-FA conjugate as an active ingredient.
  • Foods to which the compound can be added include, for example, various foods, beverages, chewing gum, tea, vitamin complexes, health supplements, and the like.
  • the amount of the compound in the food or beverage is generally 0.1 to 20% by weight, preferably 1 to 15% by weight of the total food weight in the case of the composition of the present invention, the beverage composition based on 100 ml It may be added at a rate of 1 to 25 g, preferably 2 to 15 g.
  • the beverage composition of the present invention is not particularly limited in the liquid component except for containing the compounds as essential components in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as additional components like conventional beverages.
  • natural carbohydrates examples include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents thaumatin, stevia extract (eg rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. there is.
  • composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its Salts, organic acids, protective colloids, thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like may be contained.
  • compositions of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination.
  • the proportion of these additives is not critical, but is generally selected from the range of 0 to about 30 parts by weight per 100 parts by weight of the composition of the present invention.
  • C. fragile was collected from the Sokcho coast. The collected C. fragile was rinsed with tap water and dried at 60 °C. The dried material was pulverized into powder and stored at -20 °C.
  • RPMI1640, ⁇ -MEM, fetal bovine serum (FBS), penicillin/streptomycin and horse serum were purchased from Lonza Inc. (Walkersville, MD, USA).
  • Folic acid (FA), dicyclohexylcarbodiimide (DCC), 4-(dimethylamino)-pyridine (DMAP), fluorouracil (5-FU), dimethylsulfoxide (DMSO), lipopolysaccharide ( LPS) and grease reagents were purchased from Sigma Aldrich (St. Louis, MO, USA).
  • Fluorescein isothiocyanate was purchased from Nakarai Tesque (Kyoto, Japan), and WST-1(4-[3-(4-iodophenyl)-2-(4-nitrophenyl)- 2H-5-tetrazolio] -1, 3-benzene disulfonate) colorimetric analysis kit was purchased from Dozen Bio Inc. (Seoul, Korea).
  • Anti-toll-like receptor 2 (anti-TLR2), anti-TLR4, and anti-complement receptor 3 (anti-CR3) were purchased from Abcam (Cambridge, MA, USA).
  • C. fragile was pulverized using a grinder, and 25 g of the pulverized sample was treated with 99% ethanol. Then, the sample was centrifuged at 4000 rpm for 15 minutes and the residue was extracted with distilled water. The collected supernatant was concentrated by evaporation, and precipitated using ethanol (99%) to a final concentration of 70%. Then, the precipitate was dehydrated using 99% ethanol and acetone.
  • the crude polysaccharide in the sample thus obtained was composed of 54.6% of carbohydrate, 13.0% of sulfate, 1.4% of uric acid, and 15.7% of protein.
  • the primary sugar unit was galactose.
  • Crude polysaccharide was fractionated using an ion exchange chromatography system (DEAE Sepharose fast flow column (17-0709-01; GE Healthcare Biosciences AB, Uppsala, Sweden)). Three different fractions (F 1 , F 2 , and F 3 ) were collected in yields of 13.5 ⁇ 1.5, 45.7 ⁇ 0.4 and 40.4 ⁇ 1.3, respectively.
  • DEAE Sepharose fast flow column (17-0709-01; GE Healthcare Biosciences AB, Uppsala, Sweden
  • the major components of the three fractions were carbohydrate (F 1 ; 80.5 ⁇ 1.5, F 2 ; 67.4 ⁇ 0.6, and F 3 ; 44.1 ⁇ 2.3), sulfate (F 1 ; 3.2 ⁇ 0.4, F 2 ; 10.3 ⁇ 0.7, and F 3 ; 22.2 ⁇ 1.1), uric acid (F 1 ; 1.1 ⁇ 0.1, F 2 ; 2.4 ⁇ 0.1, and F 3 ; 4.2 ⁇ 0.2) and protein (F 1 ; 8.2 ⁇ 0.2).
  • Mw molecular weights
  • the molecular weights (Mw) of these fractions were 1041 ⁇ 41, 148 ⁇ 17 and 2017 ⁇ 50 ⁇ g/mol, respectively.
  • F 2 was selected for this experiment because of its high yield and strong immunostimulatory activity.
  • FA was conjugated via an esterification reaction between the carboxy group of FA and the hydroxyl group of SP.
  • 50 mg of SP was well dissolved in 5 ml of anhydrous DMSO.
  • 25 mg of FA, 25 mg of DCC, and 12.5 mg of DMAP were mixed well in a ratio of 1:1:0.5 in 3 ml of anhydrous DMSO in another tube.
  • the FA mixture was stirred for 30 minutes under a nitrogen atmosphere at 30° C. in the dark to activate the carboxy group of FA until the mixture was well dissolved.
  • the SP solution was added dropwise to the mixture at room temperature for 6 hours, at 50°C for 12 hours, and at 80°C for 24 hours, respectively.
  • NK-92 cells Natural killer cells
  • HeLa human cervical cancer cells
  • ATCC Rockville, MD, USA
  • NK-92 cells were cultured in ⁇ -MEM.
  • HeLa cells were cultured in RPMI640 medium containing 10% FBS and antibiotics. All cells were maintained at 37° C. in a humid atmosphere of 5% carbon dioxide.
  • NK-92 and HeLa cells (5 ⁇ 10 5 cells/mL) were cultured in a 96-well plate at 37° C. under a 5% carbon dioxide atmosphere for 24 hours, respectively. 50 ⁇ g/mL of SP and its conjugates were prepared for proliferation experiments. Control cells and SP-FA conjugate treated cells were cultured at 37°C for 24 hours. Cells were then centrifuged (1000 rpm, 5 minutes), and WST-1 solution was added to each well. Again, the cells were incubated for 4 hours at 37°C. The absorbance was read at 450 nm and the cell proliferation rate was calculated using Equation 1 below.
  • HeLa cells were used as target cells for cytotoxicity of NK cells.
  • NK cells were treated with SP and its conjugate (50 ⁇ g/mL), and then the activated NK cells were cultured on HeLa cells (3 ⁇ 10 4 cells/well) at a ratio of effector:target cells of 25:1. moved to Then, the cells were cultured at 37°C for 24 hours.
  • the cytotoxic effect was measured by the WST-1 assay, and the percentage of cytotoxicity was calculated using Equation 2 below.
  • NK cells (1 ⁇ 10 6 cells/well) were seeded in a 24-well plate and incubated with SP and its conjugate at 37° C. for 24 hours.
  • Total RNA was extracted from NK cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA).
  • cDNA was constructed using Superscript III RT (Invitrogen, Carlsbad, CA, USA) and oligo-(dT)20 primers.
  • Real-time PCR reaction was performed using a Light Cycle device (CFX connect Real-Time PCR) and Fast Start DNA Master TB Green II kit, and ⁇ -actin was used as an internal control.
  • the primer sequences used in this experiment are shown in Table 1.
  • Total cell extracts were separated on 10% SDS-polyacrylamide gels.
  • the isolated proteins were transferred to polyvinylidene fluoride (PVDF) and the membrane was subsequently incubated with specific antibodies, and the proteins were detected using a chemiluminescence (ECL) kit (Takara Bio, Seoul, Korea).
  • PVDF polyvinylidene fluoride
  • ECL chemiluminescence
  • FITC was used as a fluorescent reagent for the SP-FA conjugate. Approximately 50 mg of SP or SP-FA (10 w/v%) was dissolved in anhydrous DMSO at 50° C., and treated with 0.75 mg of FITC for 1 hour under agitation and nitrogen atmosphere in the dark. Then, the reaction mixture was dialyzed with distilled water (3500 Da), and the solution was centrifuged at 10,000 rpm for 10 minutes. The collected supernatant was dialyzed with distilled water until the FITC UV-vis absorption peak disappeared (3 days).
  • Cell binding/uptake capacity was measured using a chemofluorescence imaging method.
  • HeLa cells were treated with SP and its conjugate (200 ⁇ g/mL) for 6 hours.
  • FA b and FA a are the FA contents in the medium before and after treatment, respectively.
  • a confocal quantitative imaging cytometry system (CQ1, Yokogawa, Tokyo, Japan) was used.
  • HeLa cells (5 ⁇ 10 6 cells/mL) were cultured in a 96-well plate and treated with FITC-SP and its conjugate (6 ⁇ g/mL) for 2 hours. Binding ability was observed with the CQ1 system.
  • F 2 showed the strongest effect in activating RAW264.7 cells.
  • F 2 consists mostly of carbohydrates (67.4%), protein (14.7%), and sulfates (10.3%) and other uric acids (2.4%).
  • the monosaccharide composition of F 2 was found to include mannose (91.3%) and glucose (8.6%), and ⁇ -D-mannan, which has a 1->3 glycosidic bond with a sulfuric acid group at C-4, was the main GC-MS. and confirmed by 2D-NMR. Furthermore, F 2 of C.
  • Conjugation between SP and FA is due to an esterification reaction between the hydroxy group of SP and the ⁇ -carboxy group of FA using DCC as a coupling agent and DMAP as an acyl transfer catalyst.
  • Table 2 shows the SP-FA junctions (SP-FA-Low, SP-FA-Medium, SP-FA-High) with various contents of FA.
  • SP can significantly promote cytotoxicity to HeLa cells through proliferation of NK cells and expression of IPN- ⁇ , FasL, perforin, granzyme-B, and NKp30.
  • FA conjugation affects the ability of SP to activate NK cells.
  • Figure 3 shows the effect of SP, SP-FA-Low, SP-FA-Medium, and SP-FA-High on the proliferation of HeLa and NK cells.
  • Treatment with SP and SP-FA conjugates appeared to slightly improve cell proliferation without direct toxicity to both types of cells, suggesting that SP conjugates were not toxic to these cells.
  • NK cells and FR-positive cancer cells were treated at a ratio (E:T) of 25:1 between effector and target cells.
  • E:T ratio between effector and target cells.
  • HeLa in vivo co-culture system was used. NK cells alone exhibited 27.0% cytotoxicity against HeLa cells, implying that NK cells themselves directly cause cytotoxicity in target cancer cells. Cytotoxicity of NK cells was greatly increased after 20 min treatment with SP, SP-FA-Low, or SP-FA-Medium.
  • NKp46 and NKp30 are known to be expressed exclusively in NK cells. Therefore, they are the only NK-specific markers involved in the recognition and death of tumor cells.
  • the expression of NKp30 is highly increased after SP treatment in NK cells. However, when the sulfate group of SP was removed, the expression of NKp30 in NK cells was significantly reduced, suggesting that the sulfate group of SP is involved in the reaction between NK cells and SP.
  • NK cell cytotoxicity significantly increased: SP (36.4%-46.7%), SP-FA-Low (35.0%-42.8%), SP-FA-Medium (31.6%-40.9%), SP-FA-High (27.7%-37.5%). Furthermore, treatment for 6 hours did not show any additional increase in NK cell cytotoxicity. Although it is not clear whether NK cell cytotoxicity increases with treatment time, this result suggests a gradual increase in NK cell activation with treatment up to 6 hours. It is known that when activated by K562 cells (a hematoma cell line), they secrete chemokines within 1 hour followed by cytokines such as TNF- ⁇ and INF- ⁇ .
  • SP showed the highest level of cytotoxicity of NK cells.
  • a slight decrease in NK cell cytotoxicity was observed after treatment with SP-FA-Low conjugates.
  • SP-FA-Medium and SP-FA-High conjugates NK cell cytotoxicity was significantly reduced (FIG. 4).
  • the decrease in cytotoxicity of NK cells after treatment with FA conjugates appears to be related to the decrease in SP mass in the conjugates by FA substitution. As the FA substitution increased in the conjugate, the relative weight of SP decreased, which appears to result in lower NK cell activation and thereby reduced NK cell cytotoxicity.
  • NK cells The level of cytotoxicity of NK cells was confirmed by CQ1 assay. HeLa cells to which NK cells were not added served as a control. As a result of the analysis, a large number of viable cancer cells were observed (FIG. 5E). However, the number of viable cells was greatly reduced after 4 hours of incubation of SP and NK cells. As expected for SP-FA conjugates, the highest number of viable cancer cells was in cells treated with SP-FA-High (Fig. 5D). A more significant decrease in cell number was found in cells treated with SP-FA-Medium and SP-FA-Low conjugates (Fig. 5C and B), which is in good agreement with the NK cell cytotoxicity described above.
  • NK cells When NK cells are activated and more cytotoxic to tumor cells, they secrete several chemokines and cytokines, including IFN- ⁇ , IL-12, IL18, IL15, perforin, and granzyme-B. They also express various surface activated receptors such as NKp46, NKp30, and NKp44. In this experiment, it was observed that the mRNA expression levels of IFN- ⁇ , TNF- ⁇ , perforin, and granzyme-B were significantly up-regulated after treatment with SP or SP-FA conjugate (Fig. 6A-D).
  • NF-kB is an important transcription factor that regulates and activates the upstream enhancer of the perforin gene.
  • NK cell activating receptors are coupled to the JNK, ERK, and p38 phosphorylation pathways.
  • SP and its FA conjugate initiate phosphorylation of NF-kB, JNK, ERK, and p38, although phosphorylation of JNK and ERK is increased and phosphorylation of p38 and NF-kB is slightly decreased.
  • FA substitution has a slight effect on the activation pathway of NK cells, these results suggest that SP-FA conjugates can still stimulate NK cells via activation of NF-kB and MAPK pathways.
  • Figure 8 shows the cell binding ability of SP-FA conjugates based on FR-positive cancer cells (HeLa cells) determined by confocal fluorescence microscopy (blue circles are HeLa cell nuclei). In contrast, SP and its conjugates appear green by FITC fluorescent dye. According to FIG. 8, a small number of FITC-SP-FAs are randomly distributed in the wells, which is probably due to incomplete washing of the sample (FIG. 8A). However, FITC-SP-FA conjugates, especially SP-FA-Medium and SP-FA-High (Fig. 8 C and D), were usually observed near the nucleus. Green color coupled to the vicinity of the nucleus means that cellular uptake by HeLa cells has occurred.

Abstract

The present invention provides an anticancer composition comprising a conjugate of folic acid (FA) and sulfated polysaccharide (SP) as an active ingredient.

Description

SP-FA 접합체를 유효성분으로 함유하는 항암용 조성물Anti-cancer composition containing SP-FA conjugate as an active ingredient
본 발명은 항암용 조성물에 관한 것으로, 더욱 상세하게는 SP와 FA를 원료로 SP-FA 접합체를 제조하고, 상기 SP-FA 접합체는 엽산수용체(FR)를 표면에 갖는 암세포에 특이적으로 반응하여 자연살해세포(NK)를 활성화시켜 암세포를 선택적으로 제거할 수 있어 항암제로서 매우 유용한 항암용 신규 조성물에 관한 것이다.The present invention relates to an anti-cancer composition, and more particularly, to prepare an SP-FA conjugate using SP and FA as raw materials, and the SP-FA conjugate reacts specifically to cancer cells having a folate receptor (FR) on the surface, The present invention relates to a novel anticancer composition that is very useful as an anticancer agent because it can selectively remove cancer cells by activating natural killer cells (NK).
엽산(FA)은 폐, 난소, 신장, 자궁내막, 중피, 두경부, 및 뇌의 암세포에서 발현되는 엽산수용체(FR)를 타겟으로 하는 선택적 약물전달제를 위한 유망한 리간드이다. FA는 다양한 화학치료제가 쉽게 접합체를 형성하도록 한다. 심지어 치료제와 접합된 후에도 FR에 대한 높은 친화력을 유지한다. FR에 높은 발현율을 갖는 암세포와는 달리, 건강한 세포는 FR의 발현율이 매우 낮거나 혹은 검출되지 않는다. 이는 FA가 종양특이 치료적 담체를 발현하기 위한 잠재적 수단으로 사용되어질 수 있음을 의미한다. 보통의 항암제는 종양세포를 손상시킬 뿐만 아니라 건강한 세포도 손상시키기 때문에 타겟이 되는 암의 치료에 있어 최근에는 치료적인 접근의 필요성이 강하게 제기된다.Folic acid (FA) is a promising ligand for selective drug delivery agents targeting the folate receptor (FR) expressed in cancer cells of the lung, ovary, kidney, endometrium, mesothelium, head and neck, and brain. FAs allow a variety of chemotherapeutic agents to readily form conjugates. It retains a high affinity for FR even after conjugation with a therapeutic agent. Unlike cancer cells, which have high expression rates of FRs, healthy cells have very low or undetectable expression rates of FRs. This means that FAs can be used as a potential means to express tumor-specific therapeutic carriers. Since ordinary anticancer drugs not only damage tumor cells but also damage healthy cells, the need for a therapeutic approach has recently been strongly raised in the treatment of target cancer.
대두되는 암치료는 암세포를 인지하고 이와 싸우기 위한 면역시스템의 이동성을 포함한다. 생체내(in vivo)에서 생존과 번식을 위해서 암세포들은 어떻게든 일반적인 면역감시를 피하여야 한다. 여러 종양들이 비정상적인 단백질을 발현하고 있음에도 불구하고, 다른 종양 관련 항원들은 면역성이 약하고 대개 종양조직에서 풍부하게 발견되는 자가단백질이다. 이런 점에서 종양에 대한 면역성을 증진시키기 위해 FA는 햅텐에 공유결합하여 FA-햅텐 접합체를 형성하고 암 종괴 내 햅텐을 축적하는 수단으로 FR에 대한 높은 친화력을 이용하여 종양세포 표면에 전달된다. 그러므로, FA-햅텐 접합체는 암세포와 항햅텐 항체 사이의 다리로서 활약하기를 기대하며, 종양세포 표면에서 자가조직의 IgG를 노출시켜 항체 의존성 프로세스에 의해 파괴되도록 한다. 약동학내성에 의하면 이중특이 리간드의 생분포가 햅텐에 저항하는 숙주 면역과 항체들을 FR-양성 종양에 채용하는 리간드의 능력에 의존하여, 결과적으로 항종양 활성을 결정하게 된다.Emerging cancer treatments include the mobility of the immune system to recognize and fight cancer cells. In order to survive and reproduce in vivo, cancer cells must somehow evade general immune surveillance. Although many tumors express aberrant proteins, other tumor-associated antigens are self-proteins that are immunocompromised and are usually found abundantly in tumor tissue. In this respect, in order to enhance immunity against tumors, FA is covalently bound to haptens to form FA-hapten conjugates and is delivered to the surface of tumor cells using high affinity for FR as a means of accumulating haptens in cancer masses. Therefore, FA-hapten conjugates are expected to act as a bridge between cancer cells and anti-hapten antibodies, exposing autologous IgG on the tumor cell surface for destruction by an antibody-dependent process. Pharmacokinetic tolerance suggests that the biodistribution of bispecific ligands depends on host immunity to resist haptens and the ability of the ligands to recruit antibodies to FR-positive tumors, which in turn determines their antitumor activity.
FA-햅텐 접합체의 항종양능은 헵텐화학에 다양하게 의존할지도 모른다. FA-햅텐 접합체의 디자인은 내생 항햅텐 항체에 결합을 최대화할 수 있어 항암활성을 증진시킨다.The antitumor activity of FA-hapten conjugates may depend variously on heptene chemistry. The design of FA-hapten conjugates can maximize binding to endogenous anti-hapten antibodies, enhancing their anticancer activity.
본 발명자의 실험에 의하면, 청각(Codium fragile)에서 유래된 분획된 황산화다당류(SP)는 현저히 자연살해세포(NK)들을 활성화시키고 IFN-γ와 그랜자임-B 분비의 증가 및 NKp30의 발현을 증진시켜 HeLa 세포들에 대한 세포독성을 증진시킨다. 뿐만 아니라, SP는 일산화질소(NO)와 사이토카인의 생산을 촉진하여 RAW264.7 세포를 강하게 활성화시키는데 이는 이들이 강력한 면역자극제임을 암시한다. 버섯, 시리얼, 효모, 해초와 같은 다양한 소스로부터 얻어진 다당류가 면역증진능력이 있다는 사실에도 불구하고, 면역세포활성화 다당류에 대한 FA-다당류 접합체와 FR을 이용한 암세포 표면에 이러한 접합체의 결합능력의 영향에 대하여는 보고되지 않고 있다. 만일 FA-다당류가 암세포 표면에서의 FR에 대한 높은 친화력을 가지고 종괴에 접합체가 농축되어 있다면, 접합체는 종양세포가 보다 면역을 잘 형성하고 종괴 부위에서 면역세포활성을 증진하도록 유도하여 결과적으로 항암활성을 증진할 가능성이 있게 된다.According to the experiment of the present inventors, the sulfated polysaccharide (SP) derived from Codium fragile significantly activates natural killer cells (NK), increases the secretion of IFN-γ and granzyme-B, and expresses NKp30. to enhance cytotoxicity to HeLa cells. In addition, SP stimulates the production of nitric oxide (NO) and cytokines to strongly activate RAW264.7 cells, suggesting that they are potent immunostimulants. Despite the fact that polysaccharides obtained from various sources, such as mushrooms, cereals, yeast, and seaweed, have immune-enhancing abilities, the effect of FA-polysaccharide conjugates on immune cell-activating polysaccharides and the binding ability of these conjugates to the surface of cancer cells using FR was investigated. is not reported on. If the FA-polysaccharide has a high affinity for FR on the surface of cancer cells and the conjugate is concentrated in the mass, the conjugate induces tumor cells to form immunity better and enhances immune cell activity at the tumor site, resulting in anticancer activity. has the potential to promote
본 발명은 전술한 종래 기술의 문제점을 해결하기 위하여 제안된 것으로, 이를 위해 C. fragile로부터 유래된 SP를 FA에 공유결합하고, 에스테르화 반응에 의한 FA 함량별로 SP-FA 접합체를 준비하고, FR 양성 종양세포에 대한 이들 접합체의 세포독성학적 영향을 NK 세포활성화를 조사하는 것에 의해 평가하고자 한다. 이에 본 발명의 목적은 SP가 FA 접합 후에도 NK세포에 대한 활성화능을 여전히 보유하는지를 평가하고, FR 양성 암세포를 이용하여 이들 접합체의 결합능력을 결정하여 거대분자 접합이 암세포의 표면 수용체에 결합할 수 있는지를 관찰하여 항암제로서의 가능성을 확인하고자 함에 있다.The present invention is proposed to solve the above-mentioned problems of the prior art. To this end, SP derived from C. fragile is covalently bonded to FA, SP-FA conjugates are prepared by FA content by esterification reaction, and FR The cytotoxic effects of these conjugates on benign tumor cells were evaluated by examining NK cell activation. Therefore, the object of the present invention is to evaluate whether SP still retains the activating ability for NK cells after FA conjugation, and to determine the binding ability of these conjugates using FR-positive cancer cells so that macromolecular splicing can bind to surface receptors of cancer cells. It is to confirm the possibility as an anticancer agent by observing whether it exists.
본 발명의 해결하고자 하는 과제는 이상에서 언급한 것으로 제한되지 않으며, 언급되지 않은 또 다른 해결하고자 하는 과제는 아래의 기재로부터 본 발명이 속하는 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.The problem to be solved by the present invention is not limited to those mentioned above, and another problem to be solved that is not mentioned will be clearly understood by those skilled in the art from the description below.
상기한 바와 같은 본 발명의 기술적 과제는 다음과 같은 수단에 의해 달성되어진다.The technical problem of the present invention as described above is achieved by the following means.
(1) 엽산(FA)과 황산화다당류(SP)의 접합체를 유효성분으로 포함하는 항암용 조성물.(1) An anti-cancer composition comprising a conjugate of folic acid (FA) and sulfated polysaccharide (SP) as an active ingredient.
(2) 상기 (1)에 있어서, 엽산수용체를 표면에 갖는 암세포에 특이적으로 반응하여 자연살해세포(NK)를 활성화시켜 암세포를 제거하는 것을 특징으로 하는 항암용 조성물.(2) The anti-cancer composition according to (1) above, characterized in that it specifically reacts to cancer cells having folate receptors on its surface to activate natural killer cells (NK) to eliminate cancer cells.
(3) 상기 (1)에 있어서, 상기 접합체는 FA의 카르복시기와 SP의 하이드록시기 사이의 에스테르화 반응에 의해 형성된 것을 특징으로 하는 항암용 조성물.(3) The anticancer composition according to (1) above, wherein the conjugate is formed by an esterification reaction between the carboxy group of FA and the hydroxyl group of SP.
(4) 상기 (1)에 있어서, 상기 SP는 C. fragile로부터 추출 및 분획된 것임을 특징으로 하는 항암제.(4) The anticancer agent according to (1) above, wherein the SP is extracted and fractionated from C. fragile.
(5) 상기 (4)에 있어서, 상기 분획물은 탄수화물 67.4±0.6%, 황산염 10.3±0.7, 요산 2.4±0.1, 및 단백질 14.7±0.1를 포함하는 것을 특징으로 하는 항용 조성물.(5) The antibiotic composition according to (4) above, wherein the fraction contains carbohydrates 67.4±0.6%, sulfates 10.3±0.7, uric acids 2.4±0.1, and proteins 14.7±0.1.
(6) 상기 (1)에 있어서, 상기 접합체는 SP와 FA를 중량비 1:0.1~1이 되도록 각각 SP 용액과 FA 용액을 준비하고, 상기 SP 용액을 FA 용액에 상온~80℃에서 6~24 시간 동안 적하하여 반응시켜 생성된 것을 특징으로 하는 항암용 조성물.(6) In the above (1), the conjugate prepares an SP solution and an FA solution so that the weight ratio of SP and FA is 1:0.1 to 1, respectively, and the SP solution is added to the FA solution at room temperature to 80 ° C. An anti-cancer composition, characterized in that produced by reacting dropwise for a period of time.
상술한 바와 같이 본 발명은 SP와 FA를 원료로 SP-FA 접합체를 제조하고, 상기 SP-FA 접합체는 엽산수용체(FR)를 표면에 갖는 암세포에 특이적으로 반응하여 자연살해세포(NK)를 활성화시켜 암세포를 선택적으로 제거할 수 있어 항암제로서 매우 유용한 신규 조성물을 제공할 수 있다.As described above, the present invention prepares an SP-FA conjugate using SP and FA as raw materials, and the SP-FA conjugate reacts specifically to cancer cells having a folate receptor (FR) on the surface to induce natural killer cells (NK) Activated to selectively remove cancer cells, it is possible to provide a novel composition that is very useful as an anticancer agent.
도 1은 본 발명 실시예에 따른 FT-IR 분석결과이다.1 is a FT-IR analysis result according to an embodiment of the present invention.
도 2는 본 발명 실시예에 따른 1H NMR 분광분석결과이다.2 is a 1 H NMR spectroscopic analysis result according to an embodiment of the present invention.
도 3은 본 발명 실시예에 따른 HeLa 세포와 NK 세포의 증식 실험결과이다.Figure 3 is a proliferation test result of HeLa cells and NK cells according to an embodiment of the present invention.
도 4는 본 발명 실시예에 따른 NK 세포의 세포독성 실험결과이다.4 is a cytotoxicity test result of NK cells according to an embodiment of the present invention.
도 5는 본 발명 실시예에 따른 HeLa 세포에 대한 NK 세포로 처리된 SP-FA 접합체의 정량분석결과이다.5 is a quantitative analysis result of SP-FA conjugates treated with NK cells for HeLa cells according to an embodiment of the present invention.
도 6은 본 발명 실시예에 따른 케모카인과 사이토카인의 mRNA 발현에 대한 SP, SP-FA-Low, SP-FA-Medium 및 SP-FA-High의 영향의 실험결과이다.6 is an experimental result of the effect of SP, SP-FA-Low, SP-FA-Medium and SP-FA-High on mRNA expression of chemokines and cytokines according to an embodiment of the present invention.
도 7은 본 발명 실시예에 따른 NK 세포에서 p-p38, p-JNK, p-ERK 1/2, p-NF-кB-p65 단백질의 활성화 실험결과이다.7 shows the results of activation experiments of p-p38, p-JNK, p-ERK 1/2, and p-NF-кB-p65 proteins in NK cells according to an embodiment of the present invention.
도 8은 본 발명 실시예에 따른 SP, SP-FA 접합체에 대한 (i) CQ1 이미지와 (ii) 결합능력을 실험한 결과이다.Figure 8 is the results of (i) CQ1 image and (ii) test of binding ability for SP, SP-FA conjugates according to an embodiment of the present invention.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 첨부되는 도면과 함께 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있으며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.Advantages and features of the present invention, and methods of achieving them, will become clear with reference to the detailed description of the following embodiments taken in conjunction with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but may be implemented in various different forms, and only these embodiments make the disclosure of the present invention complete, and common knowledge in the art to which the present invention belongs. It is provided to completely inform the person who has the scope of the invention, and the present invention is only defined by the scope of the claims.
본 발명의 실시예들을 설명함에 있어서 공지 기능 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 것이다. 그리고 후술되는 용어들은 본 발명의 실시예에서의 기능을 고려하여 정의된 용어들로서 이는 사용자, 운용자의 의도 또는 관례 등에 따라 달라질 수 있다. 그러므로 그 정의는 본 명세서 전반에 걸친 내용을 토대로 내려져야 할 것이다. In describing the embodiments of the present invention, if it is determined that a detailed description of a known function or configuration may unnecessarily obscure the subject matter of the present invention, the detailed description will be omitted. In addition, terms to be described later are terms defined in consideration of functions in the embodiment of the present invention, which may vary according to the intention or custom of a user or operator. Therefore, the definition should be made based on the contents throughout this specification.
이하, 첨부된 도면들을 참조하여 본 발명의 실시예에 대해 살펴보기로 한다.Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings.
본 발명에 따른 항암용 조성물은 엽산(FA)과 황산화다당류(SP)의 접합체(이하, 「SP-FA 접합체」라 한다)를 유효성분으로 포함한다.The anticancer composition according to the present invention contains a conjugate of folic acid (FA) and sulfated polysaccharide (SP) (hereinafter referred to as "SP-FA conjugate") as an active ingredient.
상기 접합체는 바람직하게는 하기 반응식 1에서와 같이, FA의 카르복시기와 SP의 하이드록시기 사이의 에스테르화 반응에 의해 형성된다.The conjugate is preferably formed by an esterification reaction between the carboxy group of FA and the hydroxy group of SP, as shown in Scheme 1 below.
[반응식 1][Scheme 1]
[규칙 제91조에 의한 정정 10.11.2022]　
Figure WO-DOC-PAGE-
[Correction under Rule 91 10.11.2022]
Figure WO-DOC-PAGE-
본 발명에서 상기 SP는 바람직하게는 C. fragile로부터 추출 및 분획된 것이다. 보다 바람직하게는 상기 분획물은 탄수화물 67.4±0.6%, 황산염 10.3±0.7%, 요산 2.4±0.1%, 및 단백질 14.7±0.1%를 포함하는 것으로 한다. In the present invention, the SP is preferably extracted and fractionated from C. fragile. More preferably, the fraction contains 67.4±0.6% of carbohydrates, 10.3±0.7% of sulfate, 2.4±0.1% of uric acid, and 14.7±0.1% of protein.
본 발명에서 상기 에스테르 반응은 원료인 SP와 FA를 중량비 1:0.1~1, 바람직하게는 1:0.5가 되도록 각각 SP 용액과 FA 용액을 준비하고, 상기 SP 용액을 FA 용액에 상온~80℃에서 6~24 시간 동안 적하하여 반응시키는 과정을 포함한다.In the present invention, the esterification reaction is to prepare an SP solution and an FA solution so that the weight ratio of SP and FA as raw materials is 1:0.1 to 1, preferably 1:0.5, respectively, and the SP solution is added to the FA solution at room temperature to 80 ° C. It includes the process of reacting by adding dropwise for 6 to 24 hours.
상기와 같은 과정에 의해 제조되는 SP-FA 접합체는 엽산수용체(FR)를 표면에 갖는 암세포에 특이적으로 반응하여 자연살해세포(NK)를 활성화시켜 암세포를 선택적으로 제거할 수 있다.The SP-FA conjugate prepared by the above process can selectively remove cancer cells by activating natural killer cells (NK) by specifically reacting to cancer cells having a folate receptor (FR) on the surface.
본 발명에 따른 SP-FA 접합체를 유효성분으로 함유하는 항암용 조성물은 약제학적 조성물이며, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.The anti-cancer composition containing the SP-FA conjugate according to the present invention as an active ingredient is a pharmaceutical composition, and oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. are prepared according to conventional methods. , It can be formulated and used in the form of external preparations, suppositories and sterile injection solutions.
상기 항암제에 포함될 수 있는 담체, 부형제 및 희석제로는 락토오즈, 덱스트로오즈, 수크로오스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸셀룰로즈, 미정질 셀룰로스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.Carriers, excipients and diluents that may be included in the anticancer agent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose, etc. Alternatively, it is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, solutions for oral use, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.
본 발명에서 SP-FA 접합체의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 경우 1일 0.0001 내지 100mg/kg으로, 바람직하게는 0.001 내지 100mg/kg으로 투여하는 것이 좋으며, 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수 있다.In the present invention, the preferred dosage of the SP-FA conjugate varies depending on the condition and body weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. In the case of the present invention, it is recommended to administer 0.0001 to 100 mg/kg per day, preferably 0.001 to 100 mg/kg, and may be administered once a day or divided several times.
또한, 본 발명은 상기 SP-FA 접합체를 유효성분으로 함유하는 식품조성물을 포함한다. 상기 화합물을 첨가할 수 있는 식품으로는, 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강보조 식품류 등이 있다. 이 때, 식품 또는 음료 중의 상기 화합물의 양은 일반적으로 본 발명의 조성물의 경우는 전체 식품 중량의 0.1 내지 20 중량%, 바람직하게는 1 내지 15 중량%로 가할 수 있으며, 음료 조성물에는 100 ㎖를 기준으로 1 내지 25 g, 바람직하게는 2 내지 15 g의 비율로 가할 수 있다. 본 발명의 음료 조성물은 지시된 비율로 필수 성분으로서 상기 화합물들을 함유하는 외에는 액체성분에는 특별한 제한은 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리스리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등), 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.In addition, the present invention includes a food composition containing the SP-FA conjugate as an active ingredient. Foods to which the compound can be added include, for example, various foods, beverages, chewing gum, tea, vitamin complexes, health supplements, and the like. At this time, the amount of the compound in the food or beverage is generally 0.1 to 20% by weight, preferably 1 to 15% by weight of the total food weight in the case of the composition of the present invention, the beverage composition based on 100 ml It may be added at a rate of 1 to 25 g, preferably 2 to 15 g. The beverage composition of the present invention is not particularly limited in the liquid component except for containing the compounds as essential components in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as additional components like conventional beverages. Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (thaumatin, stevia extract (eg rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. there is.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드, 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its Salts, organic acids, protective colloids, thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like may be contained.
그 밖에 본 발명의 조성물들은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부당 0 내지 약 30 중량부의 범위에서 선택되는 것이 일반적이다.In addition, the compositions of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected from the range of 0 to about 30 parts by weight per 100 parts by weight of the composition of the present invention.
이하 본 발명의 내용을 실시예를 참조하여 보다 구체적으로 설명하고자 하나, 이들 실시예는 본 발명의 이해를 돕기 위해 제시된 것일 뿐 본 발명의 권리범위가 이에 한정되는 것으로 해석되어져서는 아니될 것이다.Hereinafter, the content of the present invention will be described in more detail with reference to examples, but these examples are only presented to aid understanding of the present invention and should not be construed as limiting the scope of the present invention thereto.
[실시예] [Example]
[실험방법][Test method]
1. 재료 및 시약1. Materials and Reagents
C. fragile은 속초해안에서 수거하였다. 수거된 C. fragile은 수돗물로 헹구고 60℃에서 건조하였다. 건조된 재료를 분쇄하여 분말화하고 -20℃에 저장하였다. RPMI1640, α-MEM, 소태아혈청(FBS), 페니실린/스트렙토마이신 및 말혈청을 론자사(워커스빌, MD, 미국)로부터 구입하였다. 엽산(FA), 다이시클로헥실카보다이이미드(DCC), 4-(다이메틸아미노)-피리딘(DMAP), 플루오로우라실(5-FU), 다이메틸설폭사이드(DMSO), 리포폴리사카라이드(LPS) 및 그리스 시약은 시그마 알드리치사(세인트루이스, MO, 미국)로부터 구입하였다. 플루오레세인이소치오시아네이트(FITC)는 나카라이테스크(교토, 일본)로부터 구입하였고, WST-1(4-[3-(4-아이오도페닐)-2-(4-나이트로페닐)-2H-5-테트라졸리오]-1, 3-벤젠 다이설포네이트) 비색분석키트는 도젠바이오사(서울, 한국)로부터 구입하였다. 항toll 유사 수용체 2(anti-TLR2), 항TLR4 및 항보체 수용체 3(anti-CR3)은 Abcam사(캠브리지, MA, 미국)로부터 구입하였다. C. fragile was collected from the Sokcho coast. The collected C. fragile was rinsed with tap water and dried at 60 °C. The dried material was pulverized into powder and stored at -20 °C. RPMI1640, α-MEM, fetal bovine serum (FBS), penicillin/streptomycin and horse serum were purchased from Lonza Inc. (Walkersville, MD, USA). Folic acid (FA), dicyclohexylcarbodiimide (DCC), 4-(dimethylamino)-pyridine (DMAP), fluorouracil (5-FU), dimethylsulfoxide (DMSO), lipopolysaccharide ( LPS) and grease reagents were purchased from Sigma Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC) was purchased from Nakarai Tesque (Kyoto, Japan), and WST-1(4-[3-(4-iodophenyl)-2-(4-nitrophenyl)- 2H-5-tetrazolio] -1, 3-benzene disulfonate) colorimetric analysis kit was purchased from Dozen Bio Inc. (Seoul, Korea). Anti-toll-like receptor 2 (anti-TLR2), anti-TLR4, and anti-complement receptor 3 (anti-CR3) were purchased from Abcam (Cambridge, MA, USA).
2. 다당류의 추출 및 분획2. Extraction and fractionation of polysaccharides
C. fragile을 분쇄기를 이용해 분쇄하고, 분쇄된 샘플 25g을 99% 에탄올로 처리하였다. 이후 샘플을 4000rpm하에 15분 동안 원심분리하고 잔사를 증류수로 추출하였다. 수거된 상징액을 증발농축하고, 에탄올(99%)를 이용하여 침전시켜 최종 농도 70%가 되도록 하였다. 그런 다음, 침전물을 에탄올 99%와 아세톤을 이용하여 탈수하였다. 이를 통해 얻어진 샘플내 조다당류는 분석결과 탄수화물 54.6%, 황산염 13.0%, 요산 1.4%, 및 단백질 15.7%로 이루어졌다. 1차 당 단위는 갈락토오스였다. 조다당류는 이온교환크로마토그래피 시스템(DEAE 세파로스 패스트 플로우 칼럼(17-0709-01; GE 헬스케어 바이오사이언스 AB, 웁살라, 스웨덴))을 이용하여 분획하였다. 3개의 다른 분획(F1, F2, 및 F3)이 13.5±1.5, 45.7±0.4 및 40.4±1.3의 수율로 각각 수거되었다. 3개 분획(F1, F2, 및 F3)의 주요성분들은 탄수화물(F1; 80.5±1.5, F2; 67.4±0.6, 및 F3; 44.1±2.3), 황산염(F1; 3.2±0.4, F2; 10.3±0.7, 및 F3; 22.2±1.1), 요산(F1; 1.1±0.1, F2; 2.4±0.1, 및 F3; 4.2±0.2) 및 단백질(F1; 8.2±0.0, F2; 14.7±0.1, 및 F3; 3.0±0.1) 이었다. 이들 분획물의 분자량(Mw)은 각각 1041±41, 148±17 및 2017±50×g/mol이었다. 이들 중에서 F2가 높은 수율과 강한 면역자극활성을 보여 본 실험에 선정되었다.C. fragile was pulverized using a grinder, and 25 g of the pulverized sample was treated with 99% ethanol. Then, the sample was centrifuged at 4000 rpm for 15 minutes and the residue was extracted with distilled water. The collected supernatant was concentrated by evaporation, and precipitated using ethanol (99%) to a final concentration of 70%. Then, the precipitate was dehydrated using 99% ethanol and acetone. As a result of analysis, the crude polysaccharide in the sample thus obtained was composed of 54.6% of carbohydrate, 13.0% of sulfate, 1.4% of uric acid, and 15.7% of protein. The primary sugar unit was galactose. Crude polysaccharide was fractionated using an ion exchange chromatography system (DEAE Sepharose fast flow column (17-0709-01; GE Healthcare Biosciences AB, Uppsala, Sweden)). Three different fractions (F 1 , F 2 , and F 3 ) were collected in yields of 13.5±1.5, 45.7±0.4 and 40.4±1.3, respectively. The major components of the three fractions (F 1 , F 2 , and F 3 ) were carbohydrate (F 1 ; 80.5±1.5, F 2 ; 67.4±0.6, and F 3 ; 44.1±2.3), sulfate (F 1 ; 3.2± 0.4, F 2 ; 10.3±0.7, and F 3 ; 22.2±1.1), uric acid (F 1 ; 1.1±0.1, F 2 ; 2.4±0.1, and F 3 ; 4.2±0.2) and protein (F 1 ; 8.2± 0.2). 0.0, F 2 ; 14.7±0.1, and F 3 ; 3.0±0.1). The molecular weights (Mw) of these fractions were 1041±41, 148±17 and 2017±50×g/mol, respectively. Among them, F 2 was selected for this experiment because of its high yield and strong immunostimulatory activity.
3. SP-FA 접합체의 합성 및 특성3. Synthesis and Characterization of SP-FA Conjugates
FA는 FA의 카르복시기와 SP의 하이드록시기 사이의 에스테르화 반응을 경유하여 접합되었다. 먼저 SP 50mg을 5ml의 무수 DMSO에 잘 녹였다. FA 25mg, DCC 25mg, 및 DMAP 12.5mg을 다른 튜브내의 무수 DMSO 3ml에서 1:1:0.5의 비율로 잘 혼합하였다. FA 혼합물은 혼합물이 잘 용해될 때까지 FA의 카르복시기를 활성화하기 위해 암조건에서 30℃로 질소 분위기하에 30분간 교반하였다. SP용액을 상온에서 6시간, 50℃에서 12시간, 및 80℃에서 24시간 동안 혼합물에 각각 적하하였다. 반응을 종료한 후에 침전물(부산물, 다이사이클로헥실유레아(DCU))을 원심분리하여 제거하고 상징액을 인삼염 완충액(pH 7.4)으로 3일간 그리고 증류수로 2일간 35℃에서 투석하였다(분자량 컷오프: 3500Da). 투석과정에서 여분의 미반응의 FA를 10,000rpm으로 10분간 원심분리하여 제거하였다. 마지막으로 SP-FA 접합체를 동결건조하여 추가 실험에 활용하였다. 접합체에서의 FA 함량은 UV-스펙트로포토미터(JASCO사, 도쿄, 일본)로 363nm 파장에서 측정하였다. FA 함량을 기반으로 세 그룹 즉, SP-FA-Low, SP-FA-Medium, 및 SP-FA-High로 분류하였다. 이들 합성 폴리머들은 FT-IR 및 1H NMR 분광분석기를 이용하여 특성화하였다.FA was conjugated via an esterification reaction between the carboxy group of FA and the hydroxyl group of SP. First, 50 mg of SP was well dissolved in 5 ml of anhydrous DMSO. 25 mg of FA, 25 mg of DCC, and 12.5 mg of DMAP were mixed well in a ratio of 1:1:0.5 in 3 ml of anhydrous DMSO in another tube. The FA mixture was stirred for 30 minutes under a nitrogen atmosphere at 30° C. in the dark to activate the carboxy group of FA until the mixture was well dissolved. The SP solution was added dropwise to the mixture at room temperature for 6 hours, at 50°C for 12 hours, and at 80°C for 24 hours, respectively. After the reaction was completed, the precipitate (by-product, dicyclohexylurea (DCU)) was removed by centrifugation, and the supernatant was dialyzed with ginseng salt buffer (pH 7.4) for 3 days and distilled water for 2 days at 35 ° C. (molecular weight cutoff: 3500 Da ). During the dialysis process, excess unreacted FA was removed by centrifugation at 10,000 rpm for 10 minutes. Finally, the SP-FA conjugate was lyophilized and used for further experiments. FA content in the conjugate was measured at a wavelength of 363 nm with a UV-spectrophotometer (JASCO, Tokyo, Japan). Based on the FA content, three groups were classified: SP-FA-Low, SP-FA-Medium, and SP-FA-High. These synthetic polymers were characterized using FT-IR and 1 H NMR spectroscopy.
4. 세포배양 및 유지4. Cell culture and maintenance
자연살해세포(NK-92세포) 및 인간 자궁경부암 세포(HeLa)를 ATCC(록크빌, MD, 미국)로부터 구입하였다. NK-92세포들은 α-MEM에 배양하였다. HeLa 세포는 10% FBS 및 항생제를 함유한 RPMI640 배지에서 배양하였다. 모든 세포들은 37℃, 5% 이산화탄소의 습한 분위기 조건하에 유지되었다.Natural killer cells (NK-92 cells) and human cervical cancer cells (HeLa) were purchased from ATCC (Rockville, MD, USA). NK-92 cells were cultured in α-MEM. HeLa cells were cultured in RPMI640 medium containing 10% FBS and antibiotics. All cells were maintained at 37° C. in a humid atmosphere of 5% carbon dioxide.
5. NK 세포 및 HeLa 세포 증식5. NK cell and HeLa cell proliferation
NK-92와 HeLa 세포(5ㅧ105 세포/mL)를 96웰 플레이트에서 37℃, 5% 이산화탄소 분위기하에 24시간 동안 각각 배양하였다. 50㎍/mL의 SP와 이의 접합체를 증식실험을 위해 준비하였다. 대조구와 SP-FA 접합체 처리 세포를 37℃하에 24시간 동안 배양하였다. 그런 다음 세포들을 원심분리(1000rpm, 5분)하고, 각 웰에 WST-1 용액을 첨가하였다. 다시, 세포들을 37℃하에 4시간 동안 배양하였다. 흡광도는 450nm에서 읽고 세포증식율은 하기 식 1을 이용하여 산출하였다.NK-92 and HeLa cells (5×10 5 cells/mL) were cultured in a 96-well plate at 37° C. under a 5% carbon dioxide atmosphere for 24 hours, respectively. 50 μg/mL of SP and its conjugates were prepared for proliferation experiments. Control cells and SP-FA conjugate treated cells were cultured at 37°C for 24 hours. Cells were then centrifuged (1000 rpm, 5 minutes), and WST-1 solution was added to each well. Again, the cells were incubated for 4 hours at 37°C. The absorbance was read at 450 nm and the cell proliferation rate was calculated using Equation 1 below.
식 (1)
Figure PCTKR2021003543-appb-I000002
Equation (1)
Figure PCTKR2021003543-appb-I000002
6. 독성검사6. Toxicity test
본 실험에서 HeLa 세포들은 NK세포의 세포독성용 타겟 세포들로 사용되었다. NK 세포들은 SP와 이의 접합체(50㎍/mL)로 처리되고, 그런 다음 활성화된 NK세포들을 이펙터:타겟세포의 비가 25:1로 하여 HeLa 세포들(3×104 cells/웰)의 배양플레이트에 옮겼다. 이후, 세포들을 37℃에서 24시간 동안 배양하였다. 세포독성효과는 WST-1 검정으로 측정하고 세포독성의 백분율은 하기 식 2를 이용하여 계산하였다.In this experiment, HeLa cells were used as target cells for cytotoxicity of NK cells. NK cells were treated with SP and its conjugate (50 μg/mL), and then the activated NK cells were cultured on HeLa cells (3×10 4 cells/well) at a ratio of effector:target cells of 25:1. moved to Then, the cells were cultured at 37°C for 24 hours. The cytotoxic effect was measured by the WST-1 assay, and the percentage of cytotoxicity was calculated using Equation 2 below.
(식 2) 세포독성 %=
Figure PCTKR2021003543-appb-I000003
(Formula 2) Cytotoxicity %=
Figure PCTKR2021003543-appb-I000003
나아가, 세포독성은 CQ1 이미지로부터 얻어진 살아있는 세포를 계수하는 것으로 확인되었다.Furthermore, cytotoxicity was confirmed by counting live cells obtained from CQ1 images.
7. mRNA 발현(실시간 PCR)의 정량검사7. Quantitative test of mRNA expression (real-time PCR)
NK세포들(1×106 cells/웰)을 24 웰플레이트에 분주하고 SP와 이의 접합체와 함께 37℃에서 24시간 동안 배양하였다. TRIzol 시약(인비트로젠, 칼스바드, CA, 미국)을 이용하여 NK세포들로부터 총 RNA를 추출하였다. Superscript Ⅲ RT(인비트로젠, 칼스바드, CA, 미국)와 올리고-(dT)20 프라이머를 이용하여 cDNA를 구축하였다. 실시간 PCR 반응은 Light Cycle 장치(CFX connect Real-Time PCR)와 Fast Start DNA Master TB Green Ⅱ 키트를 이용하여 수행하고, β액틴을 내부 대조로 사용하였다. 본 실험에서 사용된 프라이머 서열은 표 1에 나타내었다.NK cells (1×10 6 cells/well) were seeded in a 24-well plate and incubated with SP and its conjugate at 37° C. for 24 hours. Total RNA was extracted from NK cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was constructed using Superscript III RT (Invitrogen, Carlsbad, CA, USA) and oligo-(dT)20 primers. Real-time PCR reaction was performed using a Light Cycle device (CFX connect Real-Time PCR) and Fast Start DNA Master TB Green II kit, and β-actin was used as an internal control. The primer sequences used in this experiment are shown in Table 1.
유전자gene 프라이머 서열(5’→3’)Primer sequence (5'→3')
INF-γINF-γ 포워드(SQ#1)Forward (SQ#1) GATGCTCTTCGACCTCGAAACAGCAT GATGCTCTTCGACCTCGAAACAGCAT
리버스(SQ#2)Reverse (SQ#2) ATGAAATATACAAGTTATAATCTTGGCTTT ATGAAATATACAAGTTATAATCTTGGCTTT
그랜자임-BGranzyme-B 포워드(SQ#3)Forward (SQ#3) AGATCGAAAGTGCGAATCTGA AGATCGAAAGTGCGAATCTGA
리버스(SQ#4)Reverse (SQ#4) TTCGTCCATAGGAGACAATGC TTCGTCCATAGGAGACAATGC
퍼포린perforin 포워드(SQ#5)Forward (SQ#5) AGTCCTCCACCTCGTTGTCCGTGA AGTCCTCCACCTCGTTGTCCGTGA
리버스(SQ#6)Reverse (SQ#6) AAAGTCAGCTCCACTGAAGCTGTG AAAGTCAGCTCCACTGAAGCTGTG
NKG2DNKG2D 포워드(SQ#7)Forward (SQ#7) GACTTCACCAGTTTAAGTAAATC GACTTCACCAGTTTAAGTAAATC
리버스(SQ#8)Reverse (SQ#8) CTGGGAGATGAGTGAATTTCATA CTGGGAGATGAGTGAATTTCATA
FasLFasL 포워드(SQ#9)Forward (SQ#9) CCAGAGAGAGCTCAGATACGTTGAC CCAGAGAGAGCTCAGATACGTTGAC
리버스(SQ#10)Reverse (SQ#10) ATGTTTCAGCTCTTCCACCTACAGA ATGTTTCAGCTCTTCCACCTACAGA
NKp30NKp30 포워드(SQ#11)Forward (SQ#11) TGAGATTCGTACCCTGGAAGG TGAGATTCGTACCCTGGAAGG
리버스(SQ#12)Reverse (SQ#12) CACTCTGCACACGTAGATGCT CACTCTGCACACGTAGATGCT
NKp44NKp44 포워드(SQ#13)Forward (SQ#13) TCCAAGGCTCAGGTACTTCAA TCCAAGGCTCAGGTACTTCAA
리버스(SQ#14)Reverse (SQ#14) GATTGTGAATCGAGAGGTCCA GATTTGAATCGAGAGGTCCA
8. 웨스턴블롯 분석8. Western blot analysis
총 세포추출물을 10% SDS-폴리아크릴아마이드젤상에서 분리하였다. 분리된 단백질들을 폴리비닐리덴 플루오라이드(PVDF)에 옮기고 계속하여 막을 특이 항체로 인큐베이션하고, 단백질을 화학발광(ECL) 키트(다카라 바이오사, 서울, 한국)를 이용하여 검출하였다. Total cell extracts were separated on 10% SDS-polyacrylamide gels. The isolated proteins were transferred to polyvinylidene fluoride (PVDF) and the membrane was subsequently incubated with specific antibodies, and the proteins were detected using a chemiluminescence (ECL) kit (Takara Bio, Seoul, Korea).
9. SP-FA 접합체의 FITC 표지9. FITC labeling of SP-FA conjugates
본 실험에서 FITC를 SP-FA접합체를 위한 형광시약으로 사용하였다. 대략 50mg의 SP 혹은 SP-FA(10w/v%)를 50℃에서 무수 DMSO에 용해하고, 교반 및 질소분위기의 암조건에서 1시간 동안 0.75mg의 FITC로 처리하였다. 이후, 반응혼합물을 증류수로 투석(3500 Da)하고, 용액을 10,000rpm으로 10분 동안 원심분리하였다. 수거된 상징액을 FITC UV-vis 흡수피크가 없어질 때까지(3일) 증류수로 투석하였다.In this experiment, FITC was used as a fluorescent reagent for the SP-FA conjugate. Approximately 50 mg of SP or SP-FA (10 w/v%) was dissolved in anhydrous DMSO at 50° C., and treated with 0.75 mg of FITC for 1 hour under agitation and nitrogen atmosphere in the dark. Then, the reaction mixture was dialyzed with distilled water (3500 Da), and the solution was centrifuged at 10,000 rpm for 10 minutes. The collected supernatant was dialyzed with distilled water until the FITC UV-vis absorption peak disappeared (3 days).
10. 세포 결합/흡수 검정10. Cell binding/uptake assay
세포 결합/흡수 능력은 화학형광이미지법을 이용하여 측정하였다. 세포 결합/흡수의 정량화를 위해 HeLa 세포들을 SP와 이의 접합체(200㎍/mL)로 6시간 동안 처리하였다. FA함량의 존재는 UV 분광분석기로 λ=363nm에서 측정하였다. 결합능력은 하기 식 3으로 계산하였다.Cell binding/uptake capacity was measured using a chemofluorescence imaging method. For quantification of cell binding/uptake, HeLa cells were treated with SP and its conjugate (200 μg/mL) for 6 hours. The presence of FA content was measured at λ=363 nm by UV spectroscopy. Binding ability was calculated by the following formula 3.
(식 3) FA 결합=FAb-FAa (Equation 3) FA binding = FA b -FA a
상기 식에서 FAb와 FAa는 각각 처리 전과 후의 배지내의 FA 함량이다. 형광이미지를 얻기 위해 공초점정량영상세포분석시스템(CQ1, 요코가와, 도쿄, 일본)을 이용하였다. HeLa 세포(5×106 cells/mL)를 96-웰플레이트에 배양하고 FITC-SP와 이의 접합체(6㎍/mL)로 2시간 동안 처리하였다. 결합능력은 CQ1 시스템으로 관찰하였다. In the above formula, FA b and FA a are the FA contents in the medium before and after treatment, respectively. To obtain fluorescence images, a confocal quantitative imaging cytometry system (CQ1, Yokogawa, Tokyo, Japan) was used. HeLa cells (5×10 6 cells/mL) were cultured in a 96-well plate and treated with FITC-SP and its conjugate (6 μg/mL) for 2 hours. Binding ability was observed with the CQ1 system.
[실험결과][Experiment result]
1. SP-FA접합체의 합성 및 특성1. Synthesis and Characterization of SP-FA Conjugates
앞의 실험에서, C. fragile에서 황산화다당류를 추출하고 3개의 분획 F1, F2, 및 F3으로 분획하였다. 이 중, F2는 RAW264.7 세포를 활성화시킴에 있어 가장 강력한 효과를 보였다. F2는 대개 탄수화물(67.4%), 단백질(14.7%), 및 황산염(10.3%)과 기타 요산(2.4%)으로 구성된다. F2의 단당류 조성은 만노스(91.3%)와 포도당(8.6%)을 포함하는 것으로 나타났고, C-4에 황산기를 갖는 1->3글리코시딕 결합이 주인 β-D-만난이 GC-MS와 2D-NMR에 의해 확인되었다. 나아가 C. fragile의 F2는 NK 세포 활성화 및 NKp30, FasL, IFN-γ, 퍼포린 및 그랜자임-B의 발현을 통해 HeLa 세포에 대한 세포독성을 증가시킨다. 활성은 F2의 단백질 및 황산염을 제거한 후 유의적으로 대식세포와 NK세포 모두에게서 감소하였고, 이는 단백질과 황산염이 세포활성을 위해 필수불가결한 것임을 암시한다.In the previous experiment, sulfated polysaccharide was extracted from C. fragile and fractionated into three fractions F 1 , F 2 , and F 3 . Among them, F 2 showed the strongest effect in activating RAW264.7 cells. F 2 consists mostly of carbohydrates (67.4%), protein (14.7%), and sulfates (10.3%) and other uric acids (2.4%). The monosaccharide composition of F 2 was found to include mannose (91.3%) and glucose (8.6%), and β-D-mannan, which has a 1->3 glycosidic bond with a sulfuric acid group at C-4, was the main GC-MS. and confirmed by 2D-NMR. Furthermore, F 2 of C. fragile increases cytotoxicity to HeLa cells through NK cell activation and expression of NKp30, FasL, IFN-γ, perforin and granzyme-B. The activity was significantly decreased in both macrophages and NK cells after removal of F 2 protein and sulfate, suggesting that protein and sulfate are indispensable for cellular activity.
SP와 FA의 접합은 커플링제로 DCC와 아실전이촉매로서 DMAP를 사용하는, SP의 하이드록시기와 FA의 γ-카르복시기의 에스테르화 반응에 기인한다.Conjugation between SP and FA is due to an esterification reaction between the hydroxy group of SP and the γ-carboxy group of FA using DCC as a coupling agent and DMAP as an acyl transfer catalyst.
표 2는 다양한 함량의 FA를 갖는 SP-FA 접합(SP-FA-Low, SP-FA-Medium, SP-FA-High)을 보여준다. Table 2 shows the SP-FA junctions (SP-FA-Low, SP-FA-Medium, SP-FA-High) with various contents of FA.
SP:FA(mg)SP:FA (mg) DCC:DMAP(mg)DCC:DMAP (mg) 시간(h)time (h) 온도(℃)Temperature (℃) FA 함량(%)FA content (%)
SP:FALow SP:FA Low 50:2550:25 25:12.525:12.5 66 실온room temperature 18.6±0.218.6±0.2
SP:FAMedium SP:FA Medium 50:2550:25 25:12.525:12.5 1212 5050 33.2±0.233.2±0.2
SP:FAHigh SP:FA High 50:2550:25 25:12.525:12.5 2424 8080 56.8±0.156.8±0.1
이들 접합은 다른 반응시간과 온도를 적용하여 얻어진 것이다. 반응시간(6-24시간)과 온도(80℃까지)의 증가로 FA 함량은 18.6%~32.2% 및 56.8%로 유의적으로 증가하였고, 이는 반응시간과 온도가 SP-FA 접합체의 형성에서 주요 인자임을 입증하는 것이다. 도 1에 나타낸 바와 같이, 1697 cm-1에서의 날카로운 밴드가 FA의 γ-카르복시기의 특징적인 흡수피크를 보여주었다. 동시에, 1697 cm-1에서의 피크는 SP-FA 접합체에서 사라진 반면, 새로운 피크가 1736 cm-1부위에서 나타났으며, 이는 다당류의 알콜기와 FA의 카르복시기에 의해 형성된 에스테르기의 C=O 신축 진동피크에 대응한다. 이들 FT-IR 결과는 SP의 하이드록시기와 FA의 γ-카르복시기 사이에 에스테르화반응이 일어났음을 알려주며, 이는 SP-FA의 성공적인 형성을 암시한다. 접합체는 1H NMR 분광분석을 통해 추가적으로 확인되었다. 도 2A에 나타낸 바와 같이, 11.2와 12.2ppm(γ와 α-카르복시기의 양성자), 8.61ppm(피페라진의 1H), 7.63ppm(페닐린의 2H), 6.61(페닐린의 2H) 및 1.8과 2.0ppm(메킬렌기의 양성자)이 FA로부터 얻어졌다. 도 2B에서 3.0~5.5ppm에서의 피크들은 SP의 아노머 및 고리 양성자에 기인한다. 앞에서 SP의 구조적 특징은 용매로 D2O를 이용한 NMR분석을 이용하여 검사하였다. 본 실험에서, SP와 FA 및 SP-FA 스펙트럼을 비교하기 위해, FA가 D2O에 용해되지 않기 때문에 용매를 DMSO로 변경하였다. SP에서의 보다 복잡한 잔류 신호의 관찰은 다른 용매로 인한 것일 수 있다. 그러므로, FA와 결합된 만노스의 위치를 결정하는 것은 어렵다. 도 2C에 의하면, 1.8 및 2.0ppm 뿐만 아니라 8.61ppm, 7.63ppm, 및 6.61ppm에서 약한 신호를 나타냈으며, 이는 FA가 성공적으로 SP에 결합되었음을 의미한다.These junctions were obtained by applying different reaction times and temperatures. As the reaction time (6-24 hours) and temperature (up to 80 °C) increased, the FA content increased significantly from 18.6% to 32.2% and 56.8%, indicating that the reaction time and temperature were the main factors in the formation of SP-FA conjugates. It is to prove that it is a factor. As shown in Figure 1, a sharp band at 1697 cm -1 showed a characteristic absorption peak of the γ-carboxy group of FA. At the same time, the peak at 1697 cm -1 disappeared in the SP-FA conjugate, while a new peak appeared at the 1736 cm -1 site, indicating the C=O stretching vibration of the ester group formed by the alcohol group of the polysaccharide and the carboxyl group of FA. corresponding to the peak. These FT-IR results indicate that an esterification reaction occurred between the hydroxyl group of SP and the γ-carboxy group of FA, suggesting the successful formation of SP-FA. The conjugate was further confirmed by 1 H NMR spectroscopy. As shown in Figure 2A, 11.2 and 12.2 ppm (γ and α-carboxy group protons), 8.61 ppm (piperazine 1 H), 7.63 ppm (phenyline 2H), 6.61 (phenyline 2H) and 1.8 and 2.0 ppm (methylene group protons) was obtained from FA. Peaks at 3.0-5.5 ppm in Fig. 2B are attributed to the anomeric and ring protons of SP. Above, the structural characteristics of SP were examined using NMR analysis using D 2 O as a solvent. In this experiment, to compare SP and FA and SP-FA spectra, the solvent was changed to DMSO because FA is not soluble in D 2 O. Observation of more complex residual signals in SP may be due to other solvents. Therefore, it is difficult to determine the position of mannose bound to FA. According to Fig. 2C, weak signals were shown at 8.61 ppm, 7.63 ppm, and 6.61 ppm as well as 1.8 and 2.0 ppm, indicating that FA was successfully bound to SP.
2. NK 세포 활성에 대한 SP-FA 접합체의 영향2. Effect of SP-FA conjugates on NK cell activity
SP는 NK세포의 증식과 IPN-γ, FasL, 퍼포린, 그랜자임-B, 및 NKp30의 발현을 통해 HeLa 세포에 대한 세포독성을 현저히 촉진할 수 있다. 본 실험에서 FA 접합이 NK 세포 활성화에 대한 SP의 능력에 영향을 미치는지 여부를 조사하였다. 도 3은 SP, SP-FA-Low, SP-FA-Medium, 및 SP-FA-High의 HeLa와 NK 세포의 증식에 대한 영향을 보여준다. SP와 SP-FA 접합체의 처리(100㎍/mL)는 두 종류의 세포에 직접적인 독성을 보이지 않고 세포증식을 약간 개선하는 것으로 나타나는데, 이는 SP 접합체가 이들 세포에 독성을 보이지 않았음을 암시한다.SP can significantly promote cytotoxicity to HeLa cells through proliferation of NK cells and expression of IPN-γ, FasL, perforin, granzyme-B, and NKp30. In this experiment, we investigated whether FA conjugation affects the ability of SP to activate NK cells. Figure 3 shows the effect of SP, SP-FA-Low, SP-FA-Medium, and SP-FA-High on the proliferation of HeLa and NK cells. Treatment with SP and SP-FA conjugates (100 μg/mL) appeared to slightly improve cell proliferation without direct toxicity to both types of cells, suggesting that SP conjugates were not toxic to these cells.
NK 세포의 세포독성에 대한 SP-FA(Low, Medium, 및 High) 처리의 영향을 결정하기 위해 이펙터와 타겟세포의 비(E:T)가 25:1이 되도록 하여 NK세포와 FR-양성 암세포(HeLa)의 생체내 공배양 시스템을 이용하였다. NK세포는 단독으로 HeLa 세포에 대하여 27.0%의 세포독성을 나타내었으며, 이는 NK 세포들이 스스로 타겟 암세포에서 세포독성을 직접적으로 일으키는 것을 암시한다. NK 세포의 세포독성은 SP, SP-FA-Low, 혹은 SP-FA-Medium으로 20분 처리한 후에 매우 증가하였다. 지금까지 밝혀진 수용체들을 트리거하는 주요 인간 NK 세포들은 NKG2D, CD16, 및 NKp46, NKp44, 및 NKp30과 같은 자연세포독성 수용체들(NCRs)을 포함한다. 이들 수용체들 중에서 NKp46과 NKp30이 독보적으로 NK세포에서만 발현되는 것으로 알려져 있다. 따라서 이들은 종양세포들의 인지와 사멸에 관여하는 유일한 NK 특이적 마커들인 것이다. NKp30의 발현은 NK세포에서 SP처리 후에 매우 증가하는 양상을 보인다. 하지만, SP의 황산기를 제거하였을 때, NK세포에서 NKp30의 발현은 현저하게 줄어들었으며, 이는 SP의 황산기가 NK세포와 SP 사이의 반응에 관하여는 것을 암시한다.To determine the effect of SP-FA (Low, Medium, and High) treatment on the cytotoxicity of NK cells, NK cells and FR-positive cancer cells were treated at a ratio (E:T) of 25:1 between effector and target cells. (HeLa) in vivo co-culture system was used. NK cells alone exhibited 27.0% cytotoxicity against HeLa cells, implying that NK cells themselves directly cause cytotoxicity in target cancer cells. Cytotoxicity of NK cells was greatly increased after 20 min treatment with SP, SP-FA-Low, or SP-FA-Medium. The major human NK cell triggering receptors identified so far include NKG2D, CD16, and natural cytotoxic receptors (NCRs) such as NKp46, NKp44, and NKp30. Among these receptors, NKp46 and NKp30 are known to be expressed exclusively in NK cells. Therefore, they are the only NK-specific markers involved in the recognition and death of tumor cells. The expression of NKp30 is highly increased after SP treatment in NK cells. However, when the sulfate group of SP was removed, the expression of NKp30 in NK cells was significantly reduced, suggesting that the sulfate group of SP is involved in the reaction between NK cells and SP.
20분에서 4시간까지의 처리시간의 증가로 NK세포의 세포독성은 현저하게 증가하였다: SP(36.4%-46.7%), SP-FA-Low(35.0%-42.8%), SP-FA-Medium(31.6%-40.9%), SP-FA-High(27.7%-37.5%). 나아가 6시간의 처리는 NK세포의 세포독성의 추가적인 증가를 보이지 않았다. 비록 NK 세포의 세포독성이 처리시간에 따라 증가하는지는 명확하지 않으나, 이 결과는 6시간까지의 처리로 NK 세포 활성화가 점진적으로 증가함을 암시한다. K562세포(혈액암세포주)에 의해 활성화되었을 때, 이들은 1시간 안에 케모카인을 분비하고 뒤이어 TNF-α와 INF-γ와 같은 사이토카인이 분비되는 것으로 알려져 있다. 본 실험에 의하면, NK세포로부터 분비된 사이토카인의 최고 수준은 6시간 배양 이후로 밝혀졌다. 이들 결과는 본 실험에서 6시간까지의 처리로 NK 세포의 세포독성을 증가시키는 것과 연관되는 것으로 보인다. 따라서, NK세포로부터 케모카인과 사이토카인의 분비는 SP와 SP-FA 접합체의 처리 후 6시간에서 최대가 되는 것으로 나타났으며, 이는 처리시간에 따라 NK세포의 세포독성이 점차 증가하는 결과를 보인 것이다.As the treatment time increased from 20 minutes to 4 hours, NK cell cytotoxicity significantly increased: SP (36.4%-46.7%), SP-FA-Low (35.0%-42.8%), SP-FA-Medium (31.6%-40.9%), SP-FA-High (27.7%-37.5%). Furthermore, treatment for 6 hours did not show any additional increase in NK cell cytotoxicity. Although it is not clear whether NK cell cytotoxicity increases with treatment time, this result suggests a gradual increase in NK cell activation with treatment up to 6 hours. It is known that when activated by K562 cells (a hematoma cell line), they secrete chemokines within 1 hour followed by cytokines such as TNF-α and INF-γ. According to this experiment, the highest level of cytokine secreted from NK cells was found after 6 hours of culture. These results appear to be associated with increased cytotoxicity of NK cells with treatment up to 6 hours in this experiment. Therefore, the secretion of chemokines and cytokines from NK cells was found to be maximal at 6 hours after the treatment of SP and SP-FA conjugates, which showed that the cytotoxicity of NK cells gradually increased with the treatment time. .
다양한 샘플 중에서 SP는 NK 세포의 세포독성의 최고수준을 보였다. SP-FA-Low 접합체의 처리 후에 NK 세포의 세포독성은 약간 감소하는 것이 관찰되었다. SP-FA-Medium과 SP-FA-High 접합체의 처리 결과 NK 세포의 세포독성은 현저히 감소되었다(도 4). FA 접합체로 처리한 후 NK 세포의 세포독성의 감소는 FA 치환에 의한 접합체에서의 SP 질량의 감소와 관련된 것으로 보인다. 접합체에서 FA 치환이 증가할수록 SP의 상대중량은 감소하였고, 이는 보다 낮은 NK 세포활성화와 이에 의한 NK 세포의 세포독성의 감소를 일으키는 것으로 보여진다.Among the various samples, SP showed the highest level of cytotoxicity of NK cells. A slight decrease in NK cell cytotoxicity was observed after treatment with SP-FA-Low conjugates. As a result of treatment with SP-FA-Medium and SP-FA-High conjugates, NK cell cytotoxicity was significantly reduced (FIG. 4). The decrease in cytotoxicity of NK cells after treatment with FA conjugates appears to be related to the decrease in SP mass in the conjugates by FA substitution. As the FA substitution increased in the conjugate, the relative weight of SP decreased, which appears to result in lower NK cell activation and thereby reduced NK cell cytotoxicity.
NK 세포의 세포독성의 수준은 CQ1분석에 의해 확인되었다. NK 세포가 첨가되지 않은 HeLa 세포들은 대조구로 제공되었다. 분석결과, 많은 수의 살아있는 암세포가 관찰되었다(도 5E). 하지만, 살아있는 세포의 수는 SP와 NK세포의 4시간 배양 후 매우 감소하였다. SP-FA 접합체에 대하여 기대했던 바와 같이, 살아있는 암세포의 가장 많은 수는 SP-FA-High로 처리된 세포에서였다(도 5D). 세포수에서의 보다 유의적인 감소는 SP-FA-Medium과 SP-FA-Low 접합체로 처리된 세포에서 발견되었으며(도 5C와 B), 이는 앞의 NK 세포의 세포독성과 잘 일치함을 보여준다. NK 세포들이 활성화되어 종양세포들에 보다 세포독성을 갖는 경우에 이들은 IFN-γ, IL-12, IL18, IL15, 퍼포린, 및 그랜자임-B를 포함하는 여러 케모카인과 사이토카인을 분비한다. 이들은 또한 NKp46, NKp30, 및 NKp44와 같은 다양한 표면활성화 수용체를 발현한다. 본 실험에서, IFN-γ와 TNF-α, 퍼포린, 및 그랜자임-B의 mRNA 발현수준이 SP나 SP-FA 접합체에 의한 처리 후 현저히 상향조절되는 것이 관찰되었다(도 6A-D). 뿐만 아니라, SP나 SP-FA 접합체로 처리 후 표면활성화 수용체(NKG2D, NKp30, 및 NKp44)의 mRNA의 현저한 상향조절이 관찰되었으며, 이는 NK 세포의 세포독성결과와 잘 일치함을 보여준다(도 6E, F 및 G).The level of cytotoxicity of NK cells was confirmed by CQ1 assay. HeLa cells to which NK cells were not added served as a control. As a result of the analysis, a large number of viable cancer cells were observed (FIG. 5E). However, the number of viable cells was greatly reduced after 4 hours of incubation of SP and NK cells. As expected for SP-FA conjugates, the highest number of viable cancer cells was in cells treated with SP-FA-High (Fig. 5D). A more significant decrease in cell number was found in cells treated with SP-FA-Medium and SP-FA-Low conjugates (Fig. 5C and B), which is in good agreement with the NK cell cytotoxicity described above. When NK cells are activated and more cytotoxic to tumor cells, they secrete several chemokines and cytokines, including IFN-γ, IL-12, IL18, IL15, perforin, and granzyme-B. They also express various surface activated receptors such as NKp46, NKp30, and NKp44. In this experiment, it was observed that the mRNA expression levels of IFN-γ, TNF-α, perforin, and granzyme-B were significantly up-regulated after treatment with SP or SP-FA conjugate (Fig. 6A-D). In addition, significant upregulation of mRNAs of surface-activated receptors (NKG2D, NKp30, and NKp44) was observed after treatment with SP or SP-FA conjugates, which is in good agreement with the cytotoxicity results of NK cells (Fig. 6E, F and G).
NF-kB는 퍼포린 유전자의 업스트림 인핸서를 조절 및 활성화하는 중요한 전사인자이다. 뿐만 아니라, NK 세포의 활성화 수용체들은 JNK, ERK, 및 p38 인산화 경로와 결합된다. 도 7에서 보는 바와 같이, SP와 이의 FA 접합체는 JNK와 ERK의 인산화는 증가시키고 p38과 NF-kB의 인산화는 약간 감소시키는 것에도 불구하고 NF-kB, JNK, ERK, 및 p38의 인산화를 개시한다. FA 치환이 NK 세포들의 활성화 경로에 약간의 영향을 미친다하더라도, 이들 결과는 SP-FA 접합체가 여전히 NF-kB 및 MAPK 경로의 활성화를 경유하여 NK 세포들을 자극할 수 있음을 암시한다.NF-kB is an important transcription factor that regulates and activates the upstream enhancer of the perforin gene. In addition, NK cell activating receptors are coupled to the JNK, ERK, and p38 phosphorylation pathways. As shown in FIG. 7, SP and its FA conjugate initiate phosphorylation of NF-kB, JNK, ERK, and p38, although phosphorylation of JNK and ERK is increased and phosphorylation of p38 and NF-kB is slightly decreased. do. Although FA substitution has a slight effect on the activation pathway of NK cells, these results suggest that SP-FA conjugates can still stimulate NK cells via activation of NF-kB and MAPK pathways.
3. SP-FA 접합의 세포결합능력3. Cell binding ability of SP-FA conjugation
도 8은 공초점형광현미경(푸른색 원은 HeLa 세포의 핵)으로 결정된 FR 양성 암세포(HeLa 세포)에 기초한 SP-FA 접합체의 세포결합능력을 보여준다. 이와는 달리, SP와 이의 접합체들은 FITC 형광염료에 의한 초록색으로 나타난다. 도 8에 의하면 적은 수의 FITC-SP-FA가 웰에서 무작위 분포를 보이는데, 이는 아마도 샘플을 불완전하게 세척한 것에 기인된 것으로 본다(도 8A). 하지만 FITC-SP-FA 접합체 특히 SP-FA-Medium과 SP-FA-High(도 8 C 및 D)는 대개 핵부근에서 관찰된다. 핵부근에 결합된 초록색은 HeLa 세포에 의한 세포흡수가 발생했음을 의미한다. FR에 대한 유리 FA의 높은 친화도가 일반적으로 약물이 FA에 결합되는 것에 의해 면역이 발휘되지 못하며, 이에 의해 FR 양성 암세포에 선택적으로 국부화가 가능한 저분자 약물의 합성을 가능하게 하는 것으로 알려져 있다. 하지만 FA와 결합한 고분자 폴리머가 FR양성 세포에서 세포내 흡수가 가능한지는 여전히 불명확하다고 한다. 도 8에서와 같이, FA가 결합된 고분자 다당류 SP(Mw=148,000Da)는 FR 양성 암세포내로 받아들여지는 것은 가능한 것으로 보였다.Figure 8 shows the cell binding ability of SP-FA conjugates based on FR-positive cancer cells (HeLa cells) determined by confocal fluorescence microscopy (blue circles are HeLa cell nuclei). In contrast, SP and its conjugates appear green by FITC fluorescent dye. According to FIG. 8, a small number of FITC-SP-FAs are randomly distributed in the wells, which is probably due to incomplete washing of the sample (FIG. 8A). However, FITC-SP-FA conjugates, especially SP-FA-Medium and SP-FA-High (Fig. 8 C and D), were usually observed near the nucleus. Green color coupled to the vicinity of the nucleus means that cellular uptake by HeLa cells has occurred. It is known that the high affinity of free FAs for FRs makes it possible to synthesize small-molecule drugs that are not generally immune to drugs bound to FAs, and thereby selectively localize to FR-positive cancer cells. However, it is still unclear whether FA-bound polymers are capable of intracellular uptake in FR-positive cells. As shown in FIG. 8, it seemed possible that FA-bound polysaccharide SP (Mw = 148,000 Da) could be taken up into FR-positive cancer cells.
HeLa 세포 처리 전과 후의 SP-FA 접합체의 용액내 FA의 농도를 측정하여 FA 치환과 세포흡수 사이의 관계를 조사하였다. 도 8에서와 같이, 세 개의 모든 접합체들은 HeLa 세포처리 후에 FA 농도가 감소하는 것으로 나타났다. FA 농도의 가장 현저한 차이는 SP-FA-High에서 발견되었으며, 이는 이 접합체가 가장 현저하게 흡수가 잘 이루어지는 것을 의미한다. 이러한 결과들은 공초점형광현미경의 분석결과와 잘 일치한다. 그러므로, FA치환이 증가할수록 SP-FA 접합체의 보다 현저한 양이 세포내로 국부화되어질 수 있다. 이러한 결과들은 SP-FA 접합체들이 FR 양성 종양세포에 대한 타겟화된 전달 후보들로서 사용될 수 있음을 암시한다.The relationship between FA substitution and cellular uptake was investigated by measuring the concentration of FA in the solution of the SP-FA conjugate before and after HeLa cell treatment. As shown in Figure 8, all three conjugates showed a decrease in FA concentration after treatment with HeLa cells. The most significant difference in FA concentration was found for SP-FA-High, indicating that this conjugate was most significantly absorbed. These results agree well with the analysis results of confocal fluorescence microscopy. Therefore, as FA substitution increases, more significant amounts of SP-FA conjugates can be localized into cells. These results suggest that SP-FA conjugates can be used as targeted delivery candidates to FR-positive tumor cells.
4. 결론4. Conclusion
본 실험에서, SP와 FA는 3개의 다른 FA 함량으로 접합되었다. 이들 접합체들은 NK 세포들을 강력하게 활성화하여 HeLa 세포에 대한 세포독성 활성을 나타내었다. IFN-γ, TNF-α, 퍼포린, 그랜자임-B, NKG2D, NKp30 및 NKp44는 SP-FA 접합체의 처리에 의해 현저히 상향조절되었으며, 이는 세포독성 효과를 확인해준다. 더욱이, 결합능력 실험에서는 FR에 의한 HeLa 세포의 타겟팅 능력을 보여주었다. 결국, 본 실험의 결과는 SP-FA 접합체들은 적은 독성으로 FR이 과발현된 암세포에 대한 화학치료요법을 위한 약물을 선택적으로 전달하는데 사용될 수 있음을 암시한다.In this experiment, SP and FA were conjugated with three different FA contents. These conjugates strongly activated NK cells and exhibited cytotoxic activity against HeLa cells. IFN-γ, TNF-α, perforin, granzyme-B, NKG2D, NKp30 and NKp44 were markedly upregulated by treatment of SP-FA conjugates, confirming the cytotoxic effect. Moreover, binding ability experiments showed the targeting ability of HeLa cells by FR. In conclusion, the results of this experiment suggest that SP-FA conjugates can be used to selectively deliver drugs for chemotherapy to FR-overexpressed cancer cells with little toxicity.
이상의 설명은 본 발명의 기술 사상을 예시적으로 설명한 것에 불과한 것으로서, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자라면 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 다양한 수정 및 변형이 가능할 것이다. 따라서, 본 발명에 개시된 실시예들은 본 발명의 기술 사상을 한정하기 위한 것이 아니라 설명하기 위한 것이고, 이러한 실시예에 의하여 본 발명의 기술 사상의 범위가 한정되는 것은 아니다. 본 발명의 보호 범위는 아래의 청구범위에 의하여 해석되어야 하며, 그와 동등한 범위 내에 있는 모든 기술사상은 본 발명의 권리범위에 포함되는 것으로 해석되어야 할 것이다.The above description is merely an example of the technical idea of the present invention, and various modifications and variations can be made to those skilled in the art without departing from the essential characteristics of the present invention. Therefore, the embodiments disclosed in the present invention are not intended to limit the technical idea of the present invention, but to explain, and the scope of the technical idea of the present invention is not limited by these embodiments. The protection scope of the present invention should be construed according to the claims below, and all technical ideas within the scope equivalent thereto should be construed as being included in the scope of the present invention.
<110> GANGNEUNG-WONJU NATIONAL UNIVERSITY INDUSTRY ACADEMY COOPERATION GROUP<110> GANGNEUNG-WONJU NATIONAL UNIVERSITY INDUSTRY ACADEMY COOPERATION GROUP
<120> Anti cancer composition comprising SP-FA conjugates as active ingredient<120> Anti cancer composition comprising SP-FA conjugates as active ingredient
<130> SP1222<130> SP1222
<160> 14<160> 14
<170> KoPatentIn 3.0<170> KoPatentIn 3.0
<210> 1<210> 1
<211> 26<211> 26
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 1<400> 1
gatgctcttc gacctcgaaa cagcat 26gatgctcttc gacctcgaaa cagcat 26
<210> 2<210> 2
<211> 30<211> 30
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 2<400> 2
atgaaatata caagttataa tcttggcttt 30atgaaatata caagttataa tcttggcttt 30
<210> 3<210> 3
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 3<400> 3
agatcgaaag tgcgaatctg a 21agatcgaaag tgcgaatctg a 21
<210> 4<210> 4
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 4<400> 4
ttcgtccata ggagacaatg c 21ttcgtccata ggagacaatg c 21
<210> 5<210> 5
<211> 24<211> 24
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 5<400> 5
agtcctccac ctcgttgtcc gtga 24agtcctccac ctcgttgtcc gtga 24
<210> 6<210> 6
<211> 24<211> 24
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 6<400> 6
aaagtcagct ccactgaagc tgtg 24aaagtcagct ccactgaagc tgtg 24
<210> 7<210> 7
<211> 23<211> 23
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 7<400> 7
gacttcacca gtttaagtaa atc 23gacttcacca gtttaagtaa atc 23
<210> 8<210> 8
<211> 23<211> 23
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 8<400> 8
ctgggagatg agtgaatttc ata 23ctgggagatg agtgaatttc ata 23
<210> 9<210> 9
<211> 25<211> 25
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 9<400> 9
ccagagagag ctcagatacg ttgac 25ccagagagag ctcagatacg ttgac 25
<210> 10<210> 10
<211> 25<211> 25
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 10<400> 10
atgtttcagc tcttccacct acaga 25atgtttcagc tcttccacct acaga 25
<210> 11<210> 11
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 11<400> 11
tgagattcgt accctggaag g 21tgagattcgt accctggaag g 21
<210> 12<210> 12
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 12<400> 12
cactctgcac acgtagatgc t 21cactctgcac acgtagatgc t 21
<210> 13<210> 13
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Forward primer<223> forward primer
<400> 13<400> 13
tccaaggctc aggtacttca a 21tccaaggctc aggtacttca a 21
<210> 14<210> 14
<211> 21<211> 21
<212> DNA<212> DNA
<213> Artificial Sequence<213> artificial sequence
<220><220>
<223> Reverse primer<223> Reverse primer
<400> 14<400> 14
gattgtgaat cgagaggtcc a 21gattgtgaat cgagaggtcc a 21

Claims (6)

  1. 엽산(FA)과 황산화다당류(SP)의 접합체를 유효성분으로 포함하는 항암용 조성물.An anti-cancer composition comprising a conjugate of folic acid (FA) and sulfated polysaccharide (SP) as an active ingredient.
  2. 제 1항에 있어서, 엽산수용체를 표면에 갖는 암세포에 특이적으로 반응하여 자연살해세포(NK)를 활성화시켜 암세포를 제거하는 것을 특징으로 하는 항암용 조성물.The anticancer composition according to claim 1, which specifically reacts to cancer cells having a folate receptor on the surface to activate natural killer cells (NK) to remove cancer cells.
  3. 제 1항에 있어서, 상기 접합체는 FA의 카르복시기와 SP의 하이드록시기 사이의 에스테르화 반응에 의해 형성된 것을 특징으로 하는 항암용 조성물.The anticancer composition according to claim 1, wherein the conjugate is formed by an esterification reaction between the carboxyl group of FA and the hydroxyl group of SP.
  4. 제 1항에 있어서, 상기 SP는 C. fragile로부터 추출 및 분획된 것임을 특징으로 하는 항암제.The anticancer agent according to claim 1, wherein the SP is extracted and fractionated from C. fragile.
  5. 제 4항에 있어서, 상기 분획물은 탄수화물 67.4±0.6%, 황산염 10.3±0.7, 요산 2.4±0.1, 및 단백질 14.7±0.1를 포함하는 것을 특징으로 하는 항암용 조성물.The anticancer composition according to claim 4, wherein the fraction contains 67.4±0.6% of carbohydrates, 10.3±0.7 of sulfate, 2.4±0.1 of uric acid, and 14.7±0.1 of protein.
  6. 제 1항에 있어서, 상기 접합체는 SP와 FA를 중량비 1:0.1~1이 되도록 각각 SP 용액과 FA 용액을 준비하고, 상기 SP 용액을 FA 용액에 상온~80℃에서 6~24 시간 동안 적하하여 반응시켜 생성된 것을 특징으로 하는 항암용 조성물.The method of claim 1, wherein the conjugate is prepared by preparing an SP solution and an FA solution so that the weight ratio of SP and FA is 1: 0.1 to 1, and adding the SP solution dropwise to the FA solution at room temperature to 80 ° C. for 6 to 24 hours An anti-cancer composition, characterized in that produced by reacting.
PCT/KR2021/003543 2021-01-14 2021-03-23 Anticancer composition containing sp-fa conjugate as active ingredient WO2022154169A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210005217A KR102619293B1 (en) 2021-01-14 2021-01-14 Anti cancer composition comprising SP-FA conjugates as active ingredient
KR10-2021-0005217 2021-01-14

Publications (2)

Publication Number Publication Date
WO2022154169A1 WO2022154169A1 (en) 2022-07-21
WO2022154169A9 true WO2022154169A9 (en) 2023-01-12

Family

ID=82447411

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003543 WO2022154169A1 (en) 2021-01-14 2021-03-23 Anticancer composition containing sp-fa conjugate as active ingredient

Country Status (2)

Country Link
KR (1) KR102619293B1 (en)
WO (1) WO2022154169A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1095472C (en) * 2000-04-17 2002-12-04 上海复康医药科技发展有限公司 Folica acid-polysaccharide composite and its preparation and medical composition with the composite as active component
US10517961B2 (en) * 2015-09-25 2019-12-31 ZY Therapeutics, Inc. Drug formulation based on particulates comprising polysaccharide-vitamin conjugate

Also Published As

Publication number Publication date
KR20220102826A (en) 2022-07-21
WO2022154169A1 (en) 2022-07-21
KR102619293B1 (en) 2023-12-29

Similar Documents

Publication Publication Date Title
WO2012148247A2 (en) Pharmaceutical composition containing oleanolic acid acetate as an active ingredient for preventing or treating tlr- or il-6-mediated diseases
WO2017022962A1 (en) Composition for preventing or treating immune disease, comprising ripk inhibitor as active ingredient
WO2019098699A1 (en) Composition for preventing or treating neurodegenerative diseases, containing diterpene-based compound
WO2016080796A2 (en) Pharmaceutical composition, containing sesquiterpene compound, for preventing or treating stat3-mediated diseases, and use thereof
WO2019221453A1 (en) Composition, comprising tussilagone compound isolated from tussilago farfara l. extract, for prevention and treatment of cancer and use thereof
WO2022154169A9 (en) Anticancer composition containing sp-fa conjugate as active ingredient
WO2017061840A1 (en) Method for preparing herbal composition having increased fat-soluble polyphenol content, herbal composition prepared thereby and use thereof
WO2016010340A1 (en) Composition for preventing and treating inflammation or allergic diseases, containing gynura procumbens extract as active ingredient, and use thereof
WO2020032365A1 (en) Composition, comprising ginsenoside compound, for preventing or treating inflammasome-mediated inflammatory disease
WO2017034244A1 (en) Peptide having effect of preventing or treating central nervous system diseases and pharmaceutical composition for preventing and treating central nervous system diseases, containing same as active ingredient
WO2018106002A1 (en) Composition for preventing and treating male infertility, containing compound combination comprising flavonoid derivative and iridoid derivative as active ingredient, and use thereof
WO2018221922A1 (en) Composition for preventing and treating muscle-related diseases, containing coptidis rhizoma extract, and use thereof
WO2018105998A1 (en) Composition for preventing and treating male infertility, containing flavonoid derivative compound as active ingredient, and use thereof
WO2021194281A1 (en) Tars derived from akkermansia muciniphila or fragment thereof, and use thereof
WO2018105999A1 (en) Composition for preventing and treating male infertility, containing iridoid derivative compound as active ingredient, and use thereof
WO2016204493A1 (en) A novel compound (ks 513) isolated from pseudolysimachion rotundum var. subintegrum, the composition comprising the same as an active ingredient for preventing or treating allergy disease, inflammatory disease, asthma or chronic obstructive pulmonary disease and the use thereof
WO2023003193A1 (en) Composition including paeoniflorin for prevention or treatment of cachexia and muscle loss
WO2010143825A2 (en) Anti-arthritic agent using cyathula officinalis
WO2015076475A1 (en) Composition containing hgf protein or gene thereof for preventing or treating erectile dysfunction and use thereof
WO2013191342A1 (en) Method for preparing purified product and fraction from saururus chinensis without toxic material, and composition comprising the purified product as active ingredient for treating and preventing asthma and allergic diseases
WO2020256397A1 (en) Composition for preventing or treating muscular diseases, containing, as active ingredient, glycyrrhiza uralensis extract or compound isolated therefrom
WO2013111924A1 (en) Novel compound derived from ishige foliacea, and use thereof
WO2015102448A1 (en) Hybrid anticancer prodrug simultaneously producing cinnamaldehyde and quinone methide and method for preparing same
WO2021145675A1 (en) Cell-derived vesicles comprising target protein and method for producing same
WO2020197352A1 (en) Aptamer specifically binding to cancer stem cells, and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21919798

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21919798

Country of ref document: EP

Kind code of ref document: A1