WO2022152192A1

WO2022152192A1 - Enzyme involved in phage diaminopurine synthesis, and use thereof

Info

Publication number: WO2022152192A1
Application number: PCT/CN2022/071726
Authority: WO
Inventors: 张雁; 周彦; 仝杨
Original assignee: 天津大学
Priority date: 2021-01-14
Filing date: 2022-01-13
Publication date: 2022-07-21
Also published as: CN114836399A; CN114836399B; CN114836400A

Abstract

Provided are an enzyme involved in phage diaminopurine synthesis, and a use of the enzyme. The enzyme comprises 2-amino deoxyadenosine succinate (ADAS) synthetase, 2'-deoxyadenine-5'-triphosphate triphosphohydrolase (dATPase), dATP, and dGTP pyrophosphohydrolase.

Description

Enzymes involved in phage diaminopurine synthesis and their applications

Related applications

This application claims priority to Chinese Patent Application No. 202110045505.X filed on January 14, 2021, the entire contents of which are incorporated herein by reference for all purposes.

Field of Invention

The present application relates generally to the fields of biochemistry and molecular biology, and in particular, the present application discloses bacteriophages having a diaminopurine (also known as 2,6-diaminopurine, 2-aminoadenine, or Z base)-containing genome The Z base synthesis pathway, the enzymes involved and the applications of these enzymes.

Background of the Invention

Kirnos et al. reported in 1977 that adenine (A) was completely replaced by Z in the genome of cyanophage (cyanophage, abbreviated as Cp in this paper) S-2L (1), but the pathway for this combination of genes has not yet been revealed. . In view of the important potential value and application of Z base as a new type of base, the research on its synthesis pathway is of great significance for scientific research and industrial application.

SUMMARY OF THE INVENTION

In a first aspect, the present application provides a polypeptide having 2-aminodeoxyadenosuccinate (ADAS) synthase activity, capable of producing one or more of ATP, dATP, GTP, dGTP, and dGMP and Asp are substrates to catalyze the formation of 2-aminodeoxyadenosuccinate succinate, and compared with the GDxxKG catalytic motif of adenylate succinate synthase (PurA), the catalytic motif of the polypeptide is changed to GSxxKG , where x represents any amino acid residue.

Among the substrates of various 2-aminodeoxyadenosuccinate (ADAS) synthases identified in this application, dGMP and Asp are common substrates, and ATP, dATP, GTP, and dGTP are variable substrates. In this paper, the 2-aminodeoxyadenosuccinate (ADAS) synthase using ATP/dATP as substrate is called PurZ (PurZ was first identified), and the 2-aminodeoxyadenosuccinate (ADAS) synthase using GTP/dGTP as substrate The deoxyadenylate succinate (ADAS) synthase is called PurZ0 (PurZ0 was subdivided in subsequent studies where PurZ was identified).

In some embodiments, position 303 corresponding to SEQ ID NO:72 is changed by R when the polypeptide is aligned with the amino acid sequence of adenylate succinate synthase from E. coli (SEQ ID NO:72) for L.

In some embodiments, the polypeptide has T, N at position 306, F at position 307, and 309 corresponding to SEQ ID NO: 2 when aligned with the amino acid sequence set forth in SEQ ID NO: 2 bit N.

In some embodiments, the polypeptide comprises the sequence set forth in any one of SEQ ID NOs: 1-4, 9-69, 71, and 92-146, or SEQ ID NOs: 1-4, 9-69, 71 and a variant of the sequence shown in any one of 92-146 having one or more amino acid insertions, deletions and/or substitutions that retain 2-aminodeoxyadenosuccinate (ADAS) synthetase activity, or SEQ ID Fragments of the sequences set forth in any of NO: 1-4, 9-69, 71 and 92-146 that retain the catalytic motif.

In a second aspect, the present application provides a polypeptide, which has 2'-deoxyadenine 5'-triphosphate triphosphate hydrolase (dATPase) activity and can catalyze the hydrolysis of dATP to generate 2'-deoxyadenine (dA) , the polypeptide contains metal and ligand binding pockets.

In some embodiments, the polypeptide also catalyzes the hydrolysis of dADP and dAMP to 2'-deoxyadenine (dA).

In some embodiments, the polypeptide comprises Co ²⁺ as a divalent metal cofactor.

In some embodiments, the polypeptide comprises the sequence set forth in any one of SEQ ID NOs: 5-7 and 73-91, or the sequence set forth in any one of SEQ ID NOs: 5-7 and 73-91 A variant having one or more amino acid insertions, deletions and/or substitutions that retains dATPase activity, or a fragment of the sequence set forth in any of SEQ ID NOs: 5-7 and 73-91 that retains the catalytic motif.

In a third aspect, the application provides a polypeptide having dATP and dGTP pyrophosphohydrolase activities, capable of catalyzing the hydrolysis of dATP to dAMP and dGTP to dGMP, the polypeptide comprising a metal and ligand binding pocket.

In some embodiments, the polypeptide comprises the sequence set forth in SEQ ID NO: 8, or the sequence set forth in SEQ ID NO: 8 with one or more amino acid insertions, deletions and/or substitutions retained dATP and dGTP pyrophosphate A variant of hydrolase activity, or a fragment of the sequence set forth in SEQ ID NO:8 that retains the catalytic motif.

The polypeptides of the first to third aspects can all participate in the Z base synthesis pathway of phage, of which the polypeptide described in the first aspect is the most critical one.

In a fourth aspect, the present application provides nucleic acid molecules encoding the polypeptides of the first to third aspects.

In a fifth aspect, the present application provides a vector comprising the nucleic acid molecule of the fourth aspect.

In a sixth aspect, the present application provides a method for modifying a phage, comprising introducing a nucleic acid molecule encoding the polypeptide of the first aspect into the genome of the phage, and expressing the polypeptide of the first aspect by the phage.

In some embodiments, the method further comprises introducing into the genome of the bacteriophage a nucleic acid molecule encoding the polypeptide of the second aspect, expressing the polypeptide of the second aspect with the bacteriophage; and/or into the genome of the bacteriophage A nucleic acid molecule encoding the polypeptide of the third aspect is introduced, and the polypeptide of the third aspect is expressed by the phage.

In some embodiments, the method further comprises introducing a nucleic acid molecule encoding an adenosuccinate lyase (PurB) into the genome of the bacteriophage, expressing the adenosuccinate lyase (PurB) with the bacteriophage; and/or A nucleic acid molecule encoding GMP kinase (GK) is introduced into the genome of the phage to express GMP kinase (GK) from the phage.

In a seventh aspect, the present application provides a phage obtained by the method of the sixth aspect.

In an eighth aspect, the present application provides a host cell comprising the phage of the seventh aspect.

In some embodiments, the host cell is a bacterial cell.

In a ninth aspect, the application provides the phage of the seventh aspect or the host cell of the eighth aspect in diaminopurine deoxyribonucleotide (dZTP) synthesis, DNA synthesis, DNA origami, DNA-based data storage, Use in the preparation of antibacterials, bactericides or preservatives.

Brief Description of Drawings

Figure 1. Sequence and structural analysis of PurZ. A: Equivalent biosynthetic pathways of AMP and dZMP; B: Sequence similarity network of putative PurZ; C: Homology model of SbPurZ; D: NMP binding site in SbPurZ and EcPurA; E: NMP binding site Sequence ID; F: Purine-interacting residues in the NTP binding site of PurZ/EcPurA; G: Sequence ID of the NTP binding site; residue numbers from EcPurA and Cp/SbPurZ.

Figure 2. Substrate specificity of SbPurZ, ApdATPase and ApDUF550. A: substrate specificity of SbPurZ; B: complete reaction of SbPurZ, dGMP, ATP and Asp; C: reaction of Asp, dGMP and ATP, omitting SbPurZ; D: two-step reaction combining SbPurZ and EcPurB.

Figure 3. Putative biosynthetic pathways of phage-containing Z genomes. A: Genomic neighborhood of PurZ in phage; B: Biosynthetic pathway containing Z genome; C: Substrate specificity of ApdATPase; D: ApDUF550.

Figure 4. Validation of Z base incorporation in the genome of Acinetobacter phage SH-Ab 15497. LC-UV detection (A) and extracted ion chromatogram (B) of dZ in phage DNA hydrolyzates; Read Q score (C) and read identity of host, phage, ApPurZ containing A and Z PCR products and corresponding NGS sequences (D); cwDTW fraction distribution of host and phage reads (E); restriction enzyme digestion of phage genomic DNA (F); SspI digests A-containing ApPurZ PCR products but not Z-containing ApPurZ PCR products (G) .

Figure 5. Protein sequences of exemplary CpPurZ (PurA homolog) and CpdATPase used in the present application. Differences between the two CpPurZ sequences are underlined.

Figure 6. Multiple sequence alignment of five different PurZ and EcPurA. dGMP, ATP and Asp binding residues are highlighted in grey background, respectively. Mutation positions on SBPurZ constructed in this application are indicated by boxes.

Figure 7. The putative catalytic mechanism of SbPurZ. Atoms derived from dGMP, Asp and ATP are highlighted in different shades of gray, respectively.

Figure 8. Sequence similarity network of the PurA superfamily. Networks are shown with E-values of ^10–160 , where each node represents sequences with ≥85% sequence identity.

Figure 9. SDS-PAGE gel analysis of recombinant proteins purified in this application. Panels A-J show 4-20% SDS gels with molecular weight markers in

lane

1 and 1, 2, 4 μg of purified protein in

lanes

2, 3 and 4. ApdATPase is a fusion protein containing an N-terminal MBP.

Figure 10. PurZ enzyme activity assay. A: Time-dependent UV-Vis spectra of the SbPurZ assay; B-D: UV-Vis spectra of the ApPurZ, SpPurZ and VpPurZ assays; E: UV-Vis difference spectra of the SbPurZ assay, from each spectrum collected at different time points UV-Vis spectra at time 0 were subtracted; F: SbPurZ-catalyzed time-dependent phosphate release, detected using a phosphomolybdate assay. G: pH dependence of SbPurZ activity; H: Determination of the extinction coefficient (ε) of ADAS at 287 nm; I: ESI-MS detection of 6-phosphoryl-dGMP formation of SbPurZ in the absence of Asp (ie, negative control); J: Quantification of phosphate released in the complete SbPurZ reaction mixture and in the reaction mixture with Asp omitted; K: mass spectrometry analysis of pure dGMP, ATP and ADP; L: MS2 data of ADAS, dZMP and dGMP in Figure 2, B and D .

Figure 11. Enzyme kinetics analysis of PurZ. A: SbPurZ; B: SpPurZ; C: VpPurZ; D: ApPurZ; E: SbPurZ. In A-D, dGMP, ATP, and Asp were used as substrates, and in E, dIMP, ATP, Asp were used as substrates.

Figure 12. ESI-MS analysis of the Sp/ApPurZ-EcPurB-SeGK reaction. A: Complete reaction of SpPurZ, dGMP, ATP, Asp, EcPurB, and SeGK, showing formation of products dZDP and dZTP; B: Complete reaction of ApPurZ, dGMP, ATP, Asp, EcPurB, and SeGK, showing formation of products dZDP and dZTP.

Figure 13. Sequence and structural analysis of dATPases. A: Metal and dATP binding motifs in dATPase homologues; B: Homology model of CpdATPase docked to dATP. Bases and metal-binding residues are marked in grayscale, respectively.

Figure 14. ESI-MS detection of dA formation by CpdATPase and ApdATPase. A: ESI(+)m/z spectrum of dATP involved in CpdATPase reaction; B: ESI(+)m/z spectrum of dADP involved in CpdATPase reaction. C: ESI(+) m/z spectrum of dATP involved in ApdATPase reaction; D: ESI(+) m/z spectrum of dADP involved in ApdATPase reaction.

Figure 15. Enzymatic activity and enzyme kinetics determination of dATPase. A: Standard curves for phosphate, pyrophosphate and triphosphate. B: Metal-dependent colorimetric phosphate assay results of Cp/SpdATPase; C: Substrate specificity of Cp/SpdATPase; D-F: Kinetic constants of Cp/Sp/ApdATPase with dATP, dADP or dAMP as substrate.

Figure 16. Colorimetric phosphate assay of Cp/Sp/ApdATPase. A-C: Reaction of Cp/Sp/ApdATPase with dATP, dADP and dAMP, respectively.

Figure 17. Colorimetric and mass spectrometric characterization of ApDUF550-catalyzed reactions. A: 14-20% SDS gel results of purified ApDUF550, wherein lane 1 is the molecular weight marker, and lanes 2-4 are 1, 2, and 4 μg of purified ApDUF550; B: Metal-dependent colorimetric phosphate assay results of ApDUF550 ; C and D: ESI(-) m/z spectra of dATP and dGTP involved in the reaction catalyzed by ApDUF550 to form dAMP and dGMP, respectively; ApDUF550 was omitted for negative control.

Figure 18. ApPurZ PCR product with A and Z. A: UV-Vis spectrum of ApPurZ PCR product containing A and Z; B: Agarose gel analysis of ApPurZ PCR product containing A and Z.

Figure 19. LC-MS/MS detection of dZ and Z in Acinetobacter phage SH-Ab 15497 genomic DNA.

Figure 20. Changes in nanopore signal upon Z substitution. A: ApPurZ readings containing A match the expected signal; B: corresponding ApPurZ readings containing Z show significant signal change compared to the expected signal; C: When using ApPurZ readings containing Z as input data and containing A The A to Z modifications can be detected by Tombo (43) when the ApPurZ readings are used as reference data. The KS test uses the largest vertical difference between two cumulative distribution curves. The D-statistic describes the difference between two sets of data, with a larger D-statistic representing a larger probability of modified bases.

Figure 21. Distribution of cwDTW alignment scores for A- and Z-containing ApPurZ.

Figure 22. Restriction endonuclease digestion of phage genomic DNA and Z-containing PCR products. A: Restriction maps of Sau3AI and TaqI on the genome of Acinetobacter phage SH-Ab 15497; B and C: Restriction enzymes used to digest phage genomic DNA and Z-containing ApPurZ PCR product, respectively.

Figure 23. Substrate specificity of GpPurZ0. A: Substrate specificity of GpPurZ0; B: Absorbance at 220nm-340nm was detected in the whole reaction of GpPurZ0 every 20 minutes; C: GpPurZ0 colorimetric phosphate assay using GTP/dGTP as substrates, respectively.

Figure 24. Results of HPLC-MS detection of GpPurZ0 and EcPurB activities. A: GpPurZ0, reaction equation of PurB; B: Asp, dGMP and GTP reaction, omitting GpPurZ0; C: GpPurZ0, dGMP and GTP reaction, omitting Asp; D: GpPurZ0, dGMP, GTP and Asp complete reaction; E: Two-step reaction combining GpPurZ0 and EcPurB.

Figure 25. GpPurZ0 crystal structure elucidation. A: Overall structure of GpPurZ0; B: GpPurZ0 active center interacting amino acids and the electron cloud of the substrate GTP (hydrolyzed to GDP); C: Overall structure comparison of GpPurZ0 and VpPurZ (Vibrio phage phiVC8); D: GpPurZ0 and Active center comparison of the crystal structure of VpPurZ.

Figure 26. Expression plasmid construction of the eukaryotic yeast Z-genome. Left: The gene map of the two proteins, ApPurZ and dATPase, which were recombinantly cloned into plasmid pRS426 (pRS426-ApPurZ-dATPase); Right: The gene map of DUF550 was recombinantly cloned into plasmid pRS425 (pRS426-DUF550) .

Figure 27. Detection of dZ in yeast genomes induced to express two plasmids containing pRS426-ApPurZ-dATPase and pRS426-DUF550. Panel A: LC-UV detection of dZ in yeast genome; B ion chromatogram of extracted dZ. Sequence Brief Description

SEQ ID NO: 1 shows the 2-aminodeoxyadenosuccinate (ADAS) synthase of the Acinetobacter phage (Acinetobacter phage, abbreviated herein as Ap) SH-Ab 15497 identified and tested herein (abbreviated herein as PurZ) amino acid sequence.

SEQ ID NO: 2 shows the amino acid sequence of PurZ of the Sinobacteraceae bacterium (abbreviated herein as Sb) bacteriophage contigs identified and tested herein.

SEQ ID NO: 3 shows the amino acid sequence of PurZ of the Salmonella phage (Salmonella phage, abbreviated as Sp) identified and tested herein.

SEQ ID NO: 4 shows the amino acid sequence of PurZ of the Vibrio phage (abbreviated herein as Vp) identified and tested in the present application.

SEQ ID NO: 5 shows the amino acid sequence of the 2'-deoxyadenine 5'-triphosphate triphosphate hydrolase (abbreviated herein as dATPase) of the Acinetobacter phage (Ap) SH-Ab 15497 identified and tested herein.

SEQ ID NO: 6 shows the amino acid sequence of the dATPase of Salmonella phage (Sp) identified and tested herein.

SEQ ID NO: 7 shows the amino acid sequence of the dATPase of the cyanobacteriophage (Cp) identified and tested herein.

SEQ ID NO: 8 shows the amino acid sequence of the dATP and dGTP pyrophosphohydrolase (abbreviated herein as DUF550) of Acinetobacter phage (Ap) SH-Ab 15497 identified and tested herein.

SEQ ID NOs: 9-69 show the amino acid sequences of PurZ or PurZO from different bacteriophages identified in this application, and their database entry information is as follows:

SEQ ID NO: 70 shows the amino acid sequence corresponding to PurZ in the genome sequencing results of cyanobacteriophage (Cp) reported in 2003, GenBank_AX955019.1.

SEQ ID NO: 71 shows the amino acid sequence corresponding to PurZ in the genome sequencing results of cyanobacteriophage (Cp) reported in 2018, SRA_SRR8295598.

SEQ ID NO: 72 shows the amino acid sequence of adenylate succinate synthase (abbreviated herein as PurA) of Escherichia coli (abbreviated herein as Ec) used in the analysis, comparison and testing of the present application.

SEQ ID NOs: 73-91 show the amino acid sequences of dATPases from different bacteriophages identified in this application, and their database entry information is as follows:

The specific sequences of the 2-aminodeoxyadenosuccinate (ADAS) synthases identified in this application are shown in the table below, distinguishing between PurZ and PurZ0.

Detailed description of the invention

Unless otherwise indicated, terms used in this application have the meanings commonly understood by those skilled in the art.

Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numerical ranges include the numbers defining the range. Amino acids may be represented herein by either their commonly known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Likewise, nucleotides can be represented by generally accepted one-letter codes. The terms defined above are more fully defined by reference to the specification as a whole.

When describing the numbering of residue positions in an amino acid sequence alignment in this application, it refers to the numbering other than the first methionine (M). For example, for an amino acid sequence with methionine (M) at the first position, H10 refers to histidine (H) at position 10 after M.

As used herein, "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues as well as variants and synthetic and naturally occurring analogs thereof. Accordingly, these terms apply to naturally-occurring amino acid polymers and their naturally-occurring chemical derivatives, as well as to synthetic non-naturally-occurring amino acids (such as chemical analogs of the corresponding naturally-occurring amino acids) in which one or more amino acid residues are ) of amino acid polymers. Such derivatives include, for example, post-translational modifications and degradation products, including phosphorylated, glycosylated, oxidized, isomerized, carboxylated, and deaminated variants of polypeptide fragments.

The term "enzyme active center" as used herein refers to the part of the enzyme molecule that can directly bind to the substrate molecule and catalyze the chemical reaction of the substrate, and this part becomes the active center of the enzyme. It is generally believed that the active center is mainly composed of two functional sites: the first is the catalytic site, where the bond of the substrate is broken or a new bond is formed to undergo certain chemical changes; the second is the binding site, the substrate of the enzyme. The substance binds to the enzyme molecule by this site. The functional site is composed of a few amino acid residues that are relatively close in the three-dimensional structure of the enzyme molecule or some groups on these residues, which may be far apart in the primary structure, or even located on different peptide chains , but close to each other in spatial conformation through the coiling and folding of peptide chains; for enzymes that require coenzymes, coenzyme molecules (such as metal ions Zn ²⁺ and/or Mn ²⁺ ) or a certain part of the structure of coenzyme molecules are also functional part of the part.

The term "amino acid" as used herein refers to a compound in which a hydrogen atom on a carbon atom of a carboxylic acid is replaced by an amino group, and the amino acid molecule contains two functional groups, an amino group and a carboxyl group. It includes naturally occurring and non-naturally occurring amino acids as well as amino acid analogs and mimetics. Naturally occurring amino acids include the 20 (L)-amino acids used in protein biosynthesis as well as other amino acids such as 4-hydroxyproline, hydroxylysine, carboxylated Cystine, citrulline and ornithine. Non-naturally occurring amino acids include, for example, (D)-amino acids, norleucine, norvaline, p-fluorophenylalanine, ethylthionine, and the like, which are known to those skilled in the art. Amino acid analogs include modified forms of naturally and non-naturally occurring amino acids. Such modifications may include, for example, substitution of chemical groups and moieties on amino acids, or derivatization of amino acids. Amino acid mimetics include, for example, organic structures that exhibit functionally similar properties, such as the charge and charge space properties of amino acids. For example, an organic structure that mimics arginine (Arg or R) has a positively charged moiety located in a similar molecular space and having the same degree of mobility as the e-amino group of the side chain of a naturally occurring Arg amino acid. Mimics also include constrained structures to maintain optimal steric and charge interactions of amino acids or amino acid functional groups. One skilled in the art can determine what structures constitute functionally equivalent amino acid analogs and amino acid mimetics.

The term "isoenzyme" as used herein refers to an enzyme that catalyzes the same reaction in an organism but differs in molecular structure.

The term "nucleic acid" as used herein refers to mRNA, RNA, cRNA, eDNA or DNA, including single- and double-stranded forms of DNA. The term generally refers to polymeric forms of nucleotides that are at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.

The term "encoding" as used herein in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. Use codons to express the information that encodes the protein. A nucleic acid encoding a protein may contain untranslated sequences (eg, introns) located within the translation region of the nucleic acid or may lack such intervening untranslated sequences (eg, as in cDNA).

As used herein, "full-length sequence" in reference to a particular polynucleotide or the protein it encodes refers to the entire nucleic acid sequence or the entire amino acid sequence having native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of this particular protein.

The term "isolated" as used herein refers to a polypeptide or nucleic acid, or a biologically active portion thereof, that is substantially or essentially free of the proteins or nucleic acids that normally accompany or react with the protein or nucleic acid as found in its naturally occurring environment. components. Thus, when an isolated polypeptide or nucleic acid is produced by recombinant techniques, the isolated polypeptide or nucleic acid is substantially free of other cellular material or culture medium, or when chemically synthesized, the isolated polypeptide or nucleic acid is substantially free of chemical precursors or other chemicals . With respect to DNA, it is understood to be "isolated" unless otherwise specified or clear from the context to be present in a portion of the genome.

The term "expression vector" as used herein is a recombinant or synthetically produced nucleic acid construct having a series of specific nucleic acid elements that allow transcription of a specific nucleic acid in a host cell.

The term "host cell" as used herein refers to a cell that receives a foreign gene in transformation and transduction (infection). Host cells can be eukaryotic cells such as yeast cells or prokaryotic cells such as E. coli. In the context of host cells involving bacteriophages, host cells refer primarily to bacteria.

specific implementation

DNA modifications are different in form and function, but generally do not alter Watson-Crick base pairing. Diaminopurine (Z) is a unique exception because in cyanophages it completely replaces adenine and forms three hydrogen bonds with thymine. However, the biosynthesis, species distribution and importance of Z-containing genomes have not been fully explored. In the present application, a multi-enzyme system supporting the synthesis of Z-containing gene sets is reported. The inventors identified dozens of phages with these enzymes worldwide, and the inventors used LC-UV and mass spectrometry to further validate the inclusion of a representative example of these phages, Acinetobacter phage SH-Ab 15497. Z genome. One of the roles of Z-containing genomes is to confer evolutionary advantages on phages to evade host restriction endonuclease attack. The discovery of a Z-genome-containing biosynthetic pathway has enabled large-scale production of Z-DNA (ie, A is replaced by a Z in conventional DNA) for a variety of applications.

2-Aminodeoxyadenoylate succinate (ADAS) synthase, referred to in the present application as PurZ or PurZ0, is an enzyme identified and characterized for the first time by the inventors of the present application, and is a key enzyme involved in the synthesis of Z bases. PurZ or PurZ0 and PurA known in the art to participate in the synthesis of adenine (A) belong to a generalized homologue, and the reaction mechanism is similar (see A in Figure 1), but the difference in substrate specificity determines the reaction between the two. different. The catalytic motif of PurA has been characterized and revealed to be GDxxKG, for example, see positions 12-17 of EcPurA in Fig. 6, for all PurZ or PurZ0 identified in this application, the catalytic motif is changed to GSxxKG, according to the inventors Analyses, the replacement of the bulkier D by the smaller S can accommodate the additional 2-amino group of the substrate, resulting in different substrate selectivity and specificity. Therefore, GSxxKG was shown to be the catalytic motif of PurZ or PurZ0. In some embodiments, the catalytic motif of PurZ or PurZO is GSTGKG.

In some embodiments, the polypeptide corresponding to position 303 of SEQ ID NO:72 consists of R is changed to L.

Sequence alignment is a technique commonly used by those skilled in the art and there are conventional alignment tools (eg, BLASTn, BLASTp, BLASTx, etc.). Furthermore, due to the homolog family to which PurZ or PurZ0 and PurA belong, alignment of the two is also easily achieved. PurZ or PurZ0 is compared to PurA, for example, in EcPurA, position 303 is changed from R to aliphatic amino acid L, which is consistent with the fact that the substrate of PurZ or PurZ0 is deoxyribonucleotide (rather than ribonucleotide) .

In some embodiments, when the polypeptide is aligned with the amino acid sequence set forth in SEQ ID NO: 2 (SbPurZ), it has T corresponding to position 274, N at position 306, position 307 of SEQ ID NO: 2 F and 309 bits of N. The above sites are relatively important residues identified by the inventors as being able to exert some influence on the reactivity.

SEQ ID NO: 1-4 are examples of PurZ identified and tested in this application, and SEQ ID NO: 71 is the PurZ amino acid sequence of cyanobacterial phage. SEQ ID NOs: 9-69 and 92-146 are the PurZ or PurZ0 sequences of other phages obtained by the inventors in the known phage gene database according to sequence similarity and phylogenetic tree analysis. After comparative analysis, they have consistent catalytic motifs and important residues with the PurZ or PurZ0 examples identified and tested in this application, and are expected to have PurZ or PurZ0 functions.

The inventors have fully characterized the structure and function of PurZ or PurZ0, identified catalytic motifs and important residues, based on which insertions, deletions and/or substitutions of one or more amino acids in the non-catalytic and binding domains Not expected to affect PurZ or PurZ0 functionality. In some embodiments, the number of amino acid insertions, substitutions and/or deletions is 1-30, preferably 1-20, more preferably 1-10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions, substitutions and/or deletions.

Similarly, given knowledge of the catalytic motif and important residues, fragments resulting from appropriate truncations are expected to be functional.

In a second aspect, the present application provides a polypeptide, which has 2'-deoxyadenine 5'-triphosphate triphosphate hydrolase (dATPase) activity and can catalyze the hydrolysis of dATP to generate 2'-deoxyadenine (dA) , the polypeptide contains metal and ligand binding pockets. In some embodiments, the polypeptide also catalyzes the hydrolysis of dADP and dAMP to 2'-deoxyadenine (dA).

dATPase is another enzyme involved in Z genome biosynthesis discovered and identified by the inventors. Since the phage-infested host may produce the precursor dATP for the synthesis of A bases, one of the roles of dATPase includes promoting Z-containing gene group synthesis by specifically removing dATP and its precursor dADP, preventing the incorporation of A into the phage genome.

SEQ ID NOs: 5-7 are examples of dATPases identified and tested in this application. Likewise, the inventors have also characterized the catalytic mechanism of dATPase, on the basis of which variants and fragments with the same/similar dATPase function are expected. SEQ ID NOs: 73-91 are the dATPase sequences of other phages obtained by the inventors in the known phage gene database according to sequence similarity and phylogenetic tree analysis. After comparative analysis, they have consistent catalytic motifs and important residues with the dATPase examples identified and tested in this application, and are expected to have dATPase functions.

DUF550 is another enzyme involved in Z genome biosynthesis discovered and identified by the inventors. DUF550 can catalyze the hydrolysis of dGTP to dGMP, which is one of the substrates of PurZ or PurZ0, and the presence of DUF550 can increase the level of dZTP, while also depleting dATP to further promote the incorporation of Z.

SEQ ID NO: 8 is an example of DUF550 identified and tested herein. Likewise, the inventors have also characterized the catalytic mechanism of DUF550, and it is expected to obtain variants and fragments with the same/similar DUF550 function on this basis.

The polypeptides of the first to third aspects can all participate in the Z base synthesis pathway of phage, of which the polypeptide described in the first aspect is the most critical one. dATPase and DUF550 do not participate in the synthesis reaction and contribute to the synthesis of Z-containing gene groups.

Nucleic acid molecules that are coding sequences can be combined with other DNA sequences, such as promoters, polyadenylation signals, other restriction sites, multiple cloning sites, other coding segments, and the like.

Nucleic acids and fusions thereof can be prepared, manipulated and/or expressed using any of a variety of well-established techniques known and available in the art. For example, nucleic acid molecules encoding the polypeptides of the present application, or variants and fragments thereof, can be used in recombinant DNA molecules to direct expression of the polypeptides in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences encoding substantially identical or functionally equivalent amino acid sequences can also be used in the present application, and these sequences can be used to clone and express a given polypeptide.

In addition, the nucleic acid molecules of the present application can be engineered using methods well known in the art, including but not limited to cloning, processing, expression and/or alteration of activity of the gene product.

In some embodiments, nucleic acid molecules are produced by artificial synthesis, such as direct chemical synthesis or enzymatic synthesis.

In some embodiments, the nucleic acid molecule is produced by recombinant techniques.

In some embodiments, the nucleic acid molecule is an isolated nucleic acid molecule.

The nucleic acid molecule of the fourth aspect can be provided in a vector in the form of an expression cassette. The expression cassette may additionally contain a 5' leader sequence that acts to enhance translation. In preparing expression cassettes, various DNA fragments can be manipulated to provide DNA sequences in the appropriate orientation and, where appropriate, in the appropriate reading frame. To this end, linkers or linkers may be employed to join DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, and the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, re-substitutions such as transitions and transversions may be involved.

Phage engineering can be performed by those skilled in the art. For engineered phages that naturally contain a normal A-base genome, Z-base synthesis may be achieved through the introduction of PurZ or PurZ0.

As described above, engineering further introduction of dATPase and DUF550 can promote the synthesis of Z-containing genomes.

PurB and GK are required for gene assembly, but can also be provided by host bacteria.

In some embodiments, the host cell is a bacterial cell.

In a ninth aspect, the application provides the phage of the seventh aspect or the host cell of the eighth aspect in diaminopurine deoxyribonucleotide (dZTP) synthesis, DNA synthesis, DNA origami, DNA-based data storage, Use in the preparation of antibacterials, bactericides or preservatives. In the present application, the inventors report a Z-genome-containing biosynthetic system that can facilitate the production of Z-substituted DNA with potential subsequent use in a variety of emerging applications, such as DNA origami (23) and DNA-based data Archiving, which has great potential due to its high storage capacity (24). Introducing Z-genome-containing biosynthetic enzymes into engineered phages can expand their host range and potency, for example, which have been successfully used clinically and branched from multidrug-resistant A. baumannii (25) or abscesses Mycobacterium abscessus (26) infection for life-saving phage therapy, food preservation (27) and environmental protection purposes. Increasing base diversity has been a long-standing quest in the art (28-30), and the inventors' work shows that nature already provides such an approach. Considering the discovery of Z bases in meteorites, the inventors' work may be useful for interdisciplinary research on the origin of life and astrobiology (31).

Example

The following examples are illustrative only and are not intended to limit the scope of the embodiments of the present application or the scope of the appended claims.

Example 1. Identification, Characterization and Testing of PurZ

Materials and methods

Annotation of the cyanobacteriophage S-2L genome and identification of CpPurZ

The whole genome of cyanobacterial phage S-2L has been sequenced, and a related patent application was made in 2003 (NCBI accession number: AX955019, length: 45570bp, SEQ ID No. 70) (8), and the second generation was used in 2018 Resequencing was performed by sequencing technology (NGS) (NCBI accession number: SRR8295598, SEQ ID No. 71). NGS sequencing data was not assembled. Using SPAdes 3.14.0 (http://cab.spbu.ru/software/spades/), the inventors assembled NGS reads onto 44485 bp long scaffolds. The NGS genome sequence differs significantly from the previously patented genome sequence in a number of locations. To identify candidate genes involved in Z-containing genome biosynthesis, the inventors annotated two versions of the cyanobacterial phage S-2L genome using the FgenesV/FgenesV0 software from the SofiBerry platform (http://www.softberry.com/). In the patent application genome, the PurZ gene was identified from positions 15407-14232, the gene length was 1176bp, and it encoded 391aa protein. In the NGS genome, the PurZ gene was identified as starting at position 15122 and ending at position 16202, with a gene length of 1080 bp and encoding a protein of 359 aa. By aligning with other PurZ CDS, the inventors found that the difference between the two versions comes from the C-terminal indel, and the NGS version should be the correct version.

PurZ-containing contigs in metagenomes misannotated as bacterial origin may have phage origin

Three contigs containing PurZ (GenBank: SSEA01000061.1, QQVW01000181.1 and NHHH01000025.1, the corresponding PurZ are the three orange nodes in A in Fig. 2) were annotated in NCBI as bacterial origin, and they were subjected to BLASTp retrieve. The results showed that almost all encoded proteins were highly similar to phage sequences, such as phage terminators, capsids, tail fibers, tail loops, and floorplate proteins, suggesting that they were of phage rather than bacterial origin (Table 2).

Homology modeling of CpPurZ, SbPurZ, CpdATPase and molecular docking

HHPred (32) was used to discover templates for CpPurZ, SbPurZ and CpdATPase. Among the highest ranked structures, PDB 1CIB(EcPurA) (10) and 1MEZ(MmPurA) (33) were used as templates for modeling CpPurZ and SbPurZ, respectively, as these structures are related to all substrates/substrate mimics or products complex. Both models of PurZ bind three substrates: dGMP, ATP and Asp.

For CpdATPase, PDB:5TK7(34) was chosen as template to build the homology model of CpdATPase, PDB: ^5TK7 is a Co-dependent oxetanocin-A triphosphate/monophosphate phosphatase or dATP/dAMP phosphatase, which only Has 18% overall sequence identity but shares the same metal-binding residues as CpdATPase.

All structural models use Prime v.5.3 in

Built in Suite 2019-1. The model is then used for molecular docking and structural analysis. inventor in

Glide SP was used in Suite 2019-1 to dock the KEGG compound (35) (a metabolite library containing approximately 18,000 metabolites) to the IMP and GTP binding pockets in PurZ. The highest ranked ligands from the PurZ docking results indicate that the IMP site has a preference for nucleotides/deoxynucleotides with guanine bases, whereas the GTP site does not have a strong preference for bases. For CpdATPase, the inventors docked all nucleoside derivatives and dZTP from KEGG compounds to the substrate binding pocket. The ligand-binding pocket of CpdATPase is fairly open and can accommodate all common dNTPs.

During the course of this application, the crystal structures of VpPurZ in complex with one and two of the three substrates/substrate analogs were released in the Protein Data Bank (PDB: 6FM1 series). The overall fold and active site structure are similar to the inventors' homology model.

Sequence similarity network (SSN) of the PurA superfamily and the PurZ family

The SSN of the PurA superfamily (Pfam accession number: PF00709) was generated using the web-based tool EFI-EST ( https://efi.igb.illinois.edu/efi-est/)(36 ). SSNs were displayed by Cytoscape 3.7.0 (37) with e-values of ^10-160 , each node representing a set of sequences with >85% sequence identity. Seventy-six proteins (62 from phage, 12 from metagenome, and 2 from archaea) were putatively named PurZ. Their sequences were used to construct individual SSNs, shown with e-values of ^10-70 . During the course of this application, an additional 56 additional PurZ sequences were discovered, shown in Table 1.

Multiple sequence alignment of PurA and PurZ families

MAFFT version 7.450(38) was used to generate multiple sequence alignments of the PurA superfamily (Pfam: PF00709), the PurZ family, selected representative PurA/PurZ sequences and CpdATPase homologs. Based on multiple sequence alignments of PurA/PurZ sequences and dATPase sequences, key residues for ligand binding were used to generate sequence identity by WebLogo 3 (39).

The genomic background of PurZ

Using EFI-GNT (https://efi.igb.illinois.edu/efi-gnt/), Genome Neighborhood Networks (GNNs) were generated using SSNs of the PurZ family (40). 10 upstream and 10 downstream adjacent genes of PurZ were collected and analyzed. For noise filtering, the co-occurrence percentage was set to 5%.

Identification of restriction endonucleases in Acinetobacter baumannii

Twenty-six potential restriction endonucleases were collected from UniProt by searching for "restriction endonucleases" in Acinetobacter baumannii. To identify bona fide restriction endonucleases with high similarity to the characterized restriction endonucleases, Blastp was performed on the Swiss-Prot database. The results showed that 3 out of 26 restriction endonucleases were identified: A0A0B2XQW9, A0A3R9RVJ0 and A0A241ZGY5, of which A0A0B2XQW9 had 87.7% sequence identity with P00642 (EcoRI), and the cleavage site was G/AATTC; A0A3R9RVJ0 and P00640 (PstI) had 75.9% sequence identity, and the cleavage site was CTGCA/G; A0A241ZGY5 had 59.9% sequence identity with P33562 (BsuBI), and the cleavage site was CTGCA/G. EcoRI and PstI were selected for further studies.

Experimental Materials

LB medium was purchased from Oxoid Limited (Hampshire, UK). Ultrapure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). All protein purification chromatography experiments in

was performed on a pure FPLC system (GE Healthcare, USA). dZTP was purchased from Trilink (California, USA). Other nucleotides were purchased from Sigma-Aldrich.

Gene Synthesis and Cloning

Codon-optimized gene fragments for PurZ, dATase, EcPurB, SeGK, and ApDUF550 were synthesized by Genewiz Inc. (Suzhou, China) and inserted between the NdeI and BamHI restriction sites in pET-28a(+) for expression Protein with an N-terminal His ₆ tag. Using the Gibson assembly cloning protocol, CpPurZ, ApdATPase and ApDUF550 were also inserted into the SspI restriction site of the pET-28a(+)-HMT vector. The resulting plasmid tandem contains: His6-tag, maltose binding protein (MBP) and TEV protease cleavage site, followed by the construct of interest, confirmed by sequencing. The EcPurB (UniProt: POAB89) gene was amplified by PCR (forward primer CCAGAGCGGATCAGGAATGGAATTATCCTCACTGACCG; reverse primer CCAATTGAGATCTGCCATATGTTATTTCAGCTCATCAACCATCG) and inserted into pET-28a(+) vector using Gibson assembly to express the protein with an N-terminal His6 tag.

Expression and purification of PurZ, PurB, dATPase, SeGK and ApDUF550

E. coli BL21 (DE3) cells were transformed with plasmids encoding the PurZ, PurB, dATPase, SeGK and ApDUF550 genes and plated on LB agar supplemented with 50 μg/mL kanamycin. Transformants were grown in LB medium (300 mL) at 37°C in a shaking incubator at 220 rpm. When the _OD600 reached about 0.8, the temperature was lowered to 18°C and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM to induce the production of the protein of interest. After 16-20 hours, cells were harvested by centrifugation (6000 xg, 10 min at 4°C).

Cells were resuspended in 15 mL of lysis buffer (50 mM Tris-HCl, pH 8.0, 1 mM phenylmethanesulfonyl fluoride, 0.2 mg/mL lysozyme, 0.03% Triton X-100 and 0.02 mg/mL DNase I). The cell suspension was frozen in a -80°C freezer, then thawed, and incubated in a 25°C water bath for 30 minutes to allow cell lysis. 1.5 mL of 11% streptomycin sulfate (in water) was added to the cell lysate, followed by gentle mixing and centrifugation (20000 xg, 10 min at 4°C). The supernatant was filtered through a 0.22 μm filter and loaded onto a 5 mL TALON cobalt column pre-equilibrated with buffer A (20 mM HEPES (pH 7.5), 5 mM β-mercaptoethanol (BME) and 0.2 M KCl). The column was washed with 10 column volumes (CV) of buffer A, followed by protein elution with 5 CV of buffer A containing 150 mM imidazole. The eluate was dialyzed against 2 L of buffer B (20 mM HEPES (pH 7.5), 0.1 M KCl and 1 mM dithiothreitol) overnight to remove imidazole and then concentrated using a centrifugal concentrator (30 K MWCO; Millipore). The concentration of purified protein was calculated from absorbance at 280 nm using NANODROP ONE (Thermo SCIENTIFIC). Purified proteins with commercial protein markers (Genstar, Shenzhen) were detected on 4-20% SDS polyacrylamide gradient gels and visualized by Coomassie staining.

UV-Vis Spectrophotometric and Colorimetric Analysis of PurZ

A 50 μL reaction mixture containing 20 mM HEPES (pH 7.5), 2 mM dGMP, 1 mM ATP, 2 mM ^Mg2+ , 5 mM Asp-Na ⁺ and 5 μM Sb/Sp/Vp/ApPurZ was incubated at room temperature (RT) for 0-6 h. Absorbance from 220 to 340 nm was monitored using NANODROP ONE (Thermo SCIENTIFIC). Phosphate (13) was quantified using a colorimetric phosphomolybdate assay.

Substrate-specific colorimetric phosphate assay for SbPurZ

Contain 20 mM HEPES (pH 7.5), 2 mM dGMP (dImp, GMP or IMP), 1 mM ATP (GTP), 2 mM Mg ²⁺ , 5 mM Asp-Na ⁺ (without Asp-Na ⁺ as blank) and 5 μM SbPurZ 400 μL of the reaction mixture was incubated for 1 hour at room temperature. Phosphate (13) was quantified using a colorimetric phosphomolybdate assay.

ESI-MS/MS Analysis of SbPurZ-EcPurB Reaction

A 300 μL reaction mixture containing 20 mM Tris-HCl (pH 8.0), 1 mM dGMP, 0.5 mM ATP, 2 mM Mg ²⁺ , 5 mM Asp-Na ⁺ and 5 μM SbPurZ was incubated for 1 hour at room temperature. Two negative controls were additionally prepared omitting SbPurZ or Asp-Na ⁺ . The reaction was then applied to a centrifuge concentrator (3K MWCO; Millipore). ESI-MS/MS analysis of the flow through was performed using a Q Exactive ^™ HF/UltiMate ^™ 3000RSLCnano (Thermo Fisher) instrument. The sample loading volume was 5 μL, and the sample loading rate was 0.2 mL/min. The SbPurZ assay was additionally repeated with the inclusion of 5 μM of EcPurB.

Dependence of PurZ activity on substrate concentration

The absorbance at 287 nm of 200 μL of reaction mixture containing 50 mM HEPES (pH 8.5), 2 mM Mg ²⁺ , 0.2 mM in a 96-well plate was monitored using a Tecan M200 plate reader at 15 s intervals for 1-5 min at room temperature -1 μM of the PurZ enzyme (Sb/Sp/Vp/ApPurZ), fixed concentrations of two of the three substrates (5 mM Asp-Na ⁺ , 0.1 mM ATP, dGMP), and varied 500-0 μM of the third substrate Asp-Na ⁺ , 125-0 μM ATP or 60-0 μM dGMP.

Dependence of SbPurZ activity on dIMP, IMP and GMP concentrations

Absorbance at 290 nm (41) or 287 nm of 200 μL of reaction mixture in 96-well plate was monitored at 30 s intervals for 3-4 min at room temperature using a Tecan M200 plate reader, 200 μL of reaction mixture containing 50 mM HEPES (pH 8.5), 2 mM Mg ²⁺ , 5 mM Asp-Na ⁺ , 0.1 mM ATP, 100-0 μM dIMP, IMP or GMP and 5 μM SbPurZ wild-type or S15D mutant enzyme.

ESI-MS analysis of dATPase reactions

A 300 μL reaction mixture containing 10 mM Tris-HCl (pH 7.5), 1 mM dATP or 1 mM dADP, 0.5 mM Co ²⁺ and 0.1-2 μM Cp/ApdATPase was incubated for 1 hour at room temperature. Negative controls omitted Cp/ApdATPase. The reaction mixture was then incubated in a boiling water bath for 3 minutes and the precipitated protein was removed by centrifugation (18000 xg, 5 minutes). The supernatant was filtered and loaded onto an Agilent 6230 TOF LC/MS instrument (Agilent Technologies, CA, USA) for ESI-MS analysis without liquid chromatography. The sample loading volume was 5 μL, and the sample loading rate was 0.2 mL/min.

ESI-MS Analysis of ApDUF550 Reaction

A 300 μL reaction mixture containing 10 mM Tris-HCl (pH 7.5), 0.5 mM dATP or dGTP, 2 mM Co ²⁺ and 0.5 μM ApDUF550 was incubated for 0.5 h at room temperature. Negative controls omitted ApDUF550. The reaction mixture was then processed by centrifuge concentrator (3K MwCO; Millipore) to remove enzymes and loaded onto an Agilent 6230 TOF LC/MS instrument (Agilent Technologies, CA, USA) for ESI-MS without LC column analyze. The sample loading volume was 5 μL, and the sample loading rate was 0.2 mL/min.

dATPase substrate specificity

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 1 mM (d)NTP, 2 mM Mg ²⁺ , 2 mM Co ²⁺ , 0.2 μM Cp/Sp/ApdATPase and 0.3 μM yeast inorganic pyrophosphatase 1 (IPP1) was placed in Incubate for 1 h at room temperature. Triphosphates were quantified using a colorimetric phosphomolybdate assay (13, 42).

Colorimetric Pyrophosphate and Phosphate Assays for Cp/Sp/ApdATPase Reactions

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 0.5 mM dATP or dADP, 2 mM Mg ²⁺ , 2 mM Co ²⁺ , 0.2 μM Cp/Sp/ApdATPase and 0.3 μM inorganic pyrophosphatase 1 (IPP1) was added at room temperature Incubate for 1 h. Pyrophosphate (13) was quantified using a colorimetric phosphomolybdate assay. A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 0.5 mM dAMP, 2 mM Co ²⁺ and 1 μM Cp/Sp/ApdATPase was incubated for 1 hour at room temperature. Phosphate was quantified using a colorimetric phosphomolybdate assay (13, 42).

Dependence of dATPase activity on substrate concentration

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 600-0 μM dATP/dADP/dAMP, 2 mM Mg ²⁺ , 2 mM Co ²⁺ , 0.04-0.8 μM Cp/Sp/ApdATPase and 0.3 μM IPP1 was incubated at room temperature 0-10 minutes. Triphosphate, pyrophosphate, and phosphate were quantified using a colorimetric phosphomolybdate assay (13, 42).

Metal selectivity of dATPases

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 0.5 mM dAMP, 2 mM Co ²⁺ (or other divalent metal ions) and 1 μM Sp/CpdATPase was incubated for 1 hour at room temperature. Phosphate was quantified using a colorimetric phosphomolybdate assay (13, 42).

Site-directed mutagenesis of SbPurZ

Point mutations in the SbPurZ active site were introduced by site-directed mutagenesis and confirmed by sequencing. A 25 μL PCR reaction contained 50 ng pET28a(+)-SbPurZ plasmid as template, 0.4 μM forward and reverse primers (Table 6) and Fast Alteration DNA polymerase (KM101 from TIANGEN, Beijing, China). The PCR reaction mixture was digested with DpnI for 17 cycles to remove template and then transformed into FDM competent cells (TIANGEN). SbPurZ muteins were expressed and purified as described for wild-type PurZ.

Substrate specificity of ApDUF550

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 0.5 mM (d)NTP, 2 mM Mg ²⁺ , 2 mM Co ²⁺ , 0.2 μM ApDUF550 (no ApDUF550 added to the blank control) and 0.3 μM IPP1 was incubated at room temperature for 0.5 Hour. Pyrophosphate formation was quantified using a colorimetric phosphomolybdate assay (13).

Metal selectivity of ApDUF550

A 100 μL reaction mixture containing 10 mM HEPES (pH 7.5), 0.5 mM dATP, 2 mM Co (or other metal ions), 0.3 μM IPP1 ( ^{2 mM Mg 2+} ⁾ and 0.2 μM HMT-ApDUF550 was incubated for 0.5 h at room temperature . Pyrophosphate (13) was quantified using a colorimetric phosphomolybdate assay.

PCR amplification of ApPurZ DNA fragments using dATP or dZTP

The reaction system contains 20ng pET28a(+)-ApPurZ, 0.2mM dNTP(dATP) or 0.2mM dNTP(dZTP(Trilink N-2003-1)), 0.5μM forward primer (ATGAAGAAGGCGACCGTTATTT), 0.5μM reverse primer (TCAAGCAATGTTTGATGATTTGTTAT) , 1×Q5 reaction buffer, and 1 μL of Q5 DNA polymerase (NEB M0491L). Reactions were performed by thermal cycling on a T100 thermal cycler (BIO-RAD) including initial denaturation at 98°C for 30 seconds and 30 cycles (98°C for 10 seconds, 60°C for 15 seconds and 72°C for 30 seconds). PCR products were purified using the StarPrep Gel Extraction Kit (GenStar) following the manufacturer's instructions. Concentrations were then measured using NANODROP ONE (Thermo SCIENTIFIC) and purity assessed by agarose gel electrophoresis. 400ng of DNA was loaded on each lane of the agarose gel. Samples digested with restriction enzyme SspI (NEB R0132S) were also included in the gel analysis.

ESI-MS Analysis of Sp/ApPurZ-EcPurB-SeGK Reaction

A 300 μL reaction mixture containing 20 mM HEPES (pH 8.5), 1 mM dGMP, 1 mM ATP, 5 mM Mg ²⁺ , 5 mM Asp-Na ⁺ , 5 μM Sp/ApPurZ and 5 μM EcPurB was incubated at room temperature for 4 hours or 0.5 hours. The enzyme was removed from the reaction mixture by a centrifuge concentrator (3K MwCO; Millipore) and the product contained in the flow-through served as a substrate for SeGK. 5 μM SeGK, 1 mM ATP and 5 mM Mg ²⁺ were added and incubated for an additional 45 minutes at room temperature. The reaction mixture was reapplied to a centrifuge concentrator (3KMWCO; Millipore), retaining the protein. The flow through was then loaded onto an Agilent 6230TOF LC/MS instrument (Agilent Technologies, CA, USA) for ESI-MS analysis without a LC column. The sample loading volume was 5 μL, and the sample was loaded with water at a loading rate of 0.2 mL/min.

Extraction of genomic DNA from Acinetobacter phage SH-Ab15497

Acinetobacter bacteriophage SH-Ab15497 (10 ⁹ PFU/mL) of Acinetobacter baumannii strain 15497 in logarithmic growth phase (OD ₆₀₀ 0.6-0.8) was inoculated to LB soft agar overlay at a volume ratio of 1:4 ( 0.7% agar) in a 37°C incubator for 7-8 hours. Lysates were then collected in SM buffer (50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 8 mM MgSO ₄ and 0.1 g/L gelatin) and incubated overnight at 4°C in a 100 rpm shaker. Cell debris was removed by centrifugation at 10,000 xg, 4°C for 10 minutes using a centrifuge. The genomic DNA of phage SH-Ab 15497 was extracted using the lambda phage genomic DNA kit (Zoman Biotech, ZP317-1).

HPLC-UV spectroscopy and LC-MS/MS analysis of genomic DNA of Acinetobacter phage SH-Ab 15497

Genomic DNA from Acinetobacter phage SH-Ab 15497 was enzymatically digested under neutral conditions. Briefly, containing 5 μg phage genomic DNA or positive control (4 μg ApPurZ PCR product with Z) or negative control (4 μg ApPurZ PCR product with A), 2 μL DNase I (NEB0303AA), 0.008 units of phosphodiesterase I (Sigma) P3243), 2 μL of alkaline phosphatase (Takara 2120a) and 15 μL of a 150 μL mixture of 10× reaction buffer (500 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM MgCl ₂ and 10 mM ZnSO ₄ ) were incubated overnight at 37 °C, And applied to a centrifugal concentrator (3K MwCO; Millipore) for centrifugation. The flow through was analyzed using an Agilent 6420 Triple Quadrupole LC/MS instrument (Agilent Technologies, CA, USA). LC separations were performed on a Syncronis aQ (150 mm*4.6 mm, 3 μm) column at a flow rate of 0.5 mL/min, room temperature. 10 mM NH4AC (pH _4.6 ) in water (solvent A) and methanol (solvent B) was used as mobile phase. A gradient of 20-32% solvent B from 0-12 minutes was used. The sample loading volume was 10 μL and the UV detector was set at 260 nm. Standard compounds include commercially available deoxynucleosides (dA, dT, dC, and dG) and homemade dZ (dZTP hydrolyzate of alkaline phosphatase (Takara 2120a), incubated at 37°C for 1 hr, then centrifuged to retain the enzyme) . 2 μL of each standard compound (approximately 0.1 μg) was loaded. ESI-enzyme-digested phage genomic DNA samples (10 μL) were subjected to ESI-lysis using a Q Exactive ^™ HF/UltiMate ^™ 3000RSLCnano (Thermo Fisher) instrument equipped with the same LC column using the same elution protocol at a flow rate of 0.4 mL/min. MS/MS analysis. Mass detection was performed in positive electrospray ionization (ESI) mode.

Restriction endonuclease digestion of Acinetobacter phage SH-Ab 15497 genomic DNA and Z-containing ApPurZ DNA

Restriction endonuclease digestion was performed on 0.2-0.3 μg of phage genomic DNA or Z-containing ApPurZ PCR product in a 20 μL reaction mixture according to the manufacturer’s instructions.

Nanopore sequencing

A library of native DNA extracted from Acinetobacter phage SH-Ab 15497 and a Z/A-containing ApPurZ PCR product library was constructed with SQK-LSK109 (version 2019). The library was then loaded into a flow cell FLO-MIN106 (R9.4, Oxford Nanopore Technologies) with over 1100 active single wells. MinION Mk1B sequencer was used for sequencing. Guppy 3.2.10 integrated in MinKNOW 3.6.5 was used for base calling.

Nanopore sequencing data quality analysis

From the initially collected phage DNA sample of 200537 reads, the inventors assigned each read as either phage or host based on the BLASTn results (e-value cutoff: ^10-20 ). The results showed that 58611 reads were mapped to phage SH-Ab 15497 and 141926 reads were mapped to its host. Read identities are then calculated based on BLASTn alignments. Summary files for Guppy 3.2.10 get read Q-scores. The quality analysis of the sequencing data of the ApPurZ PCR products containing Z/A was calculated in the same way as for the phage samples.

Generate a mapping table of Z-containing hexamers

The raw signal for each read was extracted from the fast5 file via ont_fast5_api and long (longer than 100) low variance regions were removed. The corresponding NGS version of the phage DNA sequence used for each read was extracted from the BLASTn results above. The original signal was then aligned to the phage genomic DNA sequence using cwDTW (21). Based on the alignment, a cwDTW score (absolute difference between normalized original signal and normalized expected signal) was generated for each hexamer in the reads (21). Based on the cwDTW scores of the hexamers, the median normalized signal for each hexamer across all reads was extracted to generate a customized mapping table. The custom mapping table is then used by cwDTW to regenerate a new alignment file. By repeatedly going through the above process for 3 rounds, the cwDTW score distribution of the phage reads was similar to that of the host reads, indicating the validity of the final mapping table.

Results, Analysis and Discussion

Kirnos et al. in 1977 reported the complete replacement of A by Z in the genome of the cyanobacterial phage S-2L (1). When Z base pairs with T, three hydrogen bonds (1, 2) are formed. It differs from other types of nucleobase modifications (3) in the unique role of Z in altering Watson-Crick base pairing, including altering the physical, chemical, and mechanical properties of double-stranded DNA (2, 4-6). ). However, there has not been any report on the biochemical characterization of the enzymes required for the synthesis of Z-containing genomes. Understanding Z-genome-containing biosynthesis will help to study the distribution of Z-genome-containing species. Although the Z base (7) has been unequivocally identified in carbonaceous meteorites (hence the opinion that Z is an important source of organic compounds required for the emergence of life on early Earth), so far, phage S-2L is known to be in The only organism with a Z base in its genome, .

The inventors discovered and reported for the first time that in the purine biosynthesis pathway, the S-2L genome contains an open reading frame encoding a homologue of adenylate succinate synthase (PurA) (8), which Referred to in this application as PurZ (Figure 4). PurA and adenylate succinate lyase (PurB) are known to catalyze the conversion of inosine 5'-monophosphate (IMP) to adenosine 5'-monophosphate (AMP) in many organisms (Panel A in Figure 1) (9). The present application proposes and demonstrates that PurZ participates in a similar reaction to provide Z nucleotides (panel A in Figure 1).

To test the inventors' hypothesis, the inventors first used bioinformatics to analyze and identify PurZ of various phages, followed by recombinant production and characterization (panel B in Figure 1 and Table 1). A homology model was constructed for S-2L PurZ (CpPurZ) and its closest homologue, SbPurZ (Panel C in Figure 1 and Table 1). Then, the active site of PurZ was compared with that of Escherichia coli PurA (EcPurA) (10). PurA's substrates are IMP, guanosine 5'-triphosphate (GTP) and Asp, and PurA catalyzes the transfer of GTPγ-phosphate to IMP followed by displacement of phosphate with aspartate to form adenylate succinate (9) . The catalytic residue Asp13(D) in the PurA GDxxKG motif was replaced by a Ser(S) residue in PurZ (Figure 1, panels D and E, and Figure 6). Molecular modeling suggests that replacing Asp with a smaller Ser can accommodate the additional 2-amino group of the substrate (panel D in Fig. 1) and may also alter the catalytic mechanism (Fig. 7), since Asp is removed from the IMP in PurA Protons (9-11) were extracted. Multiple sequence alignment revealed that although Asp13 is highly conserved in PurA, the Asp→Ser substitution is a common feature in dozens of putative PurZ sequences (panel E in Fig. 1 and Figs. 6 and 8). In addition, the conserved R303 (EcPurA numbering) for hydrogen bonding with the 2'-hydroxyl group of IMP ribose was replaced by aliphatic Leu278/279 in Cp/SbPurZ (Fig. 1, E panel and Fig. 6), which is similar to the substrate Deoxyribonucleotides (rather than ribonucleotides) are compatible.

The inventors screened a variety of PurZ homologs, and selected four (Ap/Sp/Vp/SbPurZ, SEQ ID NOs: 1-4) (Figure 9, Figure 10 and Table 1), and identified them with 2'-deoxyguanosine. 5'-monophosphate (dGMP), adenine 5'-triphosphate (ATP) and Asp were used as substrates (panel A in Figure 1) to detect their enzymatic activities. The results were consistent with the inventors' homology model (D and F panels in Figure 1). Ap, Sp and VpPurZ were from phage isolates, and SbPurZ in metagenomic contigs should also be of phage origin (Table 2).

Incubation of PurZ with a saturating amount of substrate showed a time-dependent change in the absorption spectrum, indicating that the reaction occurred at the nucleobase. The UV-Vis difference spectrum obtained by subtracting the spectrum of the starting material from the spectrum of the product showed a maximum at 287 nm (AE panel in Fig. 10), which is consistent with dGMP (λ _max = 252 nm) (12) towards a similar 2- Conversion of amino-2'-deoxyadenosine 5'-monophosphate (dZMP) (λ _max = 247,280 nm) of species (2). During the reaction, the time-dependent increase in absorbance at 287 nm (ΔA ₂₈₇ ) was proportional to the release of phosphate, as demonstrated by colorimetric phosphomolybdate assays (FIG. 2A and FIG. 10F) (13).

Substitution of dGMP with guanosine 5'-monophosphate (GMP) or IMP or substitution of ATP with other ribonucleoside 5'-triphosphates (NTP) was not observed, confirming the substrate specificity of the reaction. When dIMP was used with ATP and Asp, the enzyme retained 38% activity (panel A in Figure 2). The optimum pH for the reaction was about 9.5 (Panel G in Figure 10). The Michaelis-Menten kinetics of PurZ was investigated using serial spectrophotometry monitoring of ΔA ₂₈₇ (panel H in Figure 10). The _kcat ranged from 2.3-16.5 min ^-1 for the four enzymes, and the KMs were 1.6-5.1 and 4.1-21.1 [mu] _M for dGMP and ATP, respectively (Figure 11 and Table 3). The apparent KM of dGMP is much lower than the previously reported intracellular concentration of dGMP in bacteria (about 50 _μM ) (14). The k _cat /KM of _dIMP was significantly (15-fold) lower than that of the physiological substrate _dGMP _.

The reaction intermediates and products of PurZ were confirmed by electrospray ionization tandem mass spectrometry (ESI-MS/MS, B-D in Figure 2 and I-L in Figure 10). Co-incubation of SbPurZ with dGMP, ATP and Asp resulted in two new peaks at m/z = 426 and 461, corresponding to adenine 5'-diphosphate (ADP) and 2-aminodeoxyadenosuccinate, respectively (ADAS) (B and C in Figure 2). Omitting Asp resulted in a new peak at m/z=426, which matched the mass of ADP and the putative reaction intermediate 6-phosphoryl-dGMP (I in Figure 10). In the absence of Asp, no phosphate release was detected, consistent with its capture in 6-phosphoryl-dGMP (Figure 10, J). A similar intermediate, 6-phosphoryl-IMP (10), was observed in a complex of structures of EcPurA crystallized in the presence of IMP, GTP and hadacidin.

Since cyanobacterial phage S-2L does not encode a homolog of PurB, the inventors hypothesized that the subsequent conversion of ADAS to dZMP is catalyzed by PurB from the host (A and B in Figure 3). Incubation of the SbPurZ reaction product with recombinant EcPurB (Fig. 9, E) resulted in the disappearance of the ADAS peak and the appearance of a new peak at m/z=345, corresponding to dZMP (Fig. 2, D), proving that bacterial PurB is in fact synthesized by dZMP ability.

To study substrate selectivity, the inventors performed mutagenesis of substrate-interacting residues in SbPurZ to the corresponding residues in EcPurA. All mutations impair PurZ activity to varying degrees (Table 4). Notably, the S15D mutation completely abolished the activity of SbPurZ, consistent with a role for S15 in accommodating the 2-amino group of dGMP (D in Figure 1). The _T274G mutant showed a 271-fold increase in KM for Asp, consistent with a role for T274 in Asp binding (Figure 7). The three-residue mutants N306T, F307K and N309D that interact with adenine in ATP resulted in an _89-450 -fold increase in KM for ATP (Table 4), while none of them were reactive with GTP. Similarly, none of the mutants showed activity against IMP. dZMP must be phosphorylated to form 2-amino-2'-deoxyadenosine 5'-triphosphate (dZTP), which can then be incorporated into the phage genome by a polymerase. This reaction was efficiently catalyzed by the Salmonella enterica GMP kinase (SeGK), suggesting that enzymes from the bacterial host can perform this function (Figure 3B, Figure 9J and Figure 12).

To investigate whether other enzymes are involved in Z-containing genome biosynthesis, the inventors examined the genomic environment of PurZ and identified a DNA polymerase, an HD domain-containing hydrolase-like enzyme and a DUF550 domain-containing protein (A in Figure 3).

HD domain enzymes (also referred to herein as dATPases) are present in the genomes of 20 PurZ-containing phages (Fig. 3, A). These HD domain enzymes have highly conserved metal and ligand binding pockets, but their sequences are highly diverse (Figure 3A and Figure 13). The inventors prepared recombinant Cp/Ap/Sp HD enzymes (SEQ ID NOs: 5-7) (FH in Figure 9). Although they share only 24-34% sequence identity (Fig. 3, A), all three enzymes exhibit 2'-deoxyadenine 5'-triphosphate triphosphate hydrolase (dATPase) activity that catalyzes 2'-deoxyadenine 5'-triphosphate (dATP) was hydrolyzed to 2'-deoxyadenine (dA) and triphosphate, and the highest activity was obtained when Co was used as a divalent metal ^cofactor (C in Figure 3, Figures 14-16, apparent k _cat = 0.5-5.2 s ^-1 , apparent KM = 6.5-74.8 _μM ). The apparent KM of _dATP is in the range of the previously reported intracellular dATP concentration in bacteria (15). The enzyme is highly specific for dATP with much lower hydrolytic activity for NTP and other dNTPs (C in Figure 3). The enzyme also catalyzes the hydrolysis of 2'-deoxyadenine 5'-diphosphate (dADP) and 2'-deoxyadenine 5'-monophosphate (dAMP) to dA, releasing pyrophosphate and phosphate, respectively (Figures 15, 16). ). Thus, dATPases can promote Z-containing gene group synthesis by specifically removing dATP and its precursor dADP from the host's nucleotide pool (16), thereby preventing the incorporation of A into the phage genome.

A DUF550 domain-containing protein is also of interest because it coexists with PurZ. Recombinant ApDUF550 (SEQ ID NO: 8) displays dATP and ^2' -deoxyguanosine 5'-triphosphate (dGTP) pyrophosphohydrolase activity, catalyzing the hydrolysis of dATP/dGTP to pyrophosphate and dAMP/dGMP, respectively, using Co ⁺ The highest activity was obtained as a divalent metal cofactor, with little or no activity against NTPs and pyrimidine dNTPs (D in Figure 3 and Figure 17). Thus, this DUF550-containing enzyme may act to provide dGMP as a PurZ substrate, increasing dZTP levels, while depleting dATP to further facilitate Z incorporation (Fig. 3B).

The identification of PurZ and other genes involved in dZTP biosynthesis and genome incorporation provides a basis for studying the occurrence of Z-containing genomes in nature. Predicted PurZ sequences included 60 sequences from phage isolates and 13 sequences from phage contigs in the metagenome (Figure 1B and Table 1). PurZ-containing phages mainly belong to the Podoviridae and Siphoviridae families (B in Figure 1). In the post-genomic era, where chemical determination of nucleotide content or base composition is no longer routine, the possibility that these phages contain modified purines in their DNA may be overlooked. The inventors of the present application developed a protocol to demonstrate the genomic incorporation of Z and selected one of the phages, the Acinetobacter phage SH-Ab 15497, for further study (17). Phage DNA was prepared and digested with a combination of DNase I, phosphodiesterase I, and alkaline phosphatase, followed by LC-UV spectrometry and LC-MS/MS analysis (Figure 4, A and B). PCR of ApPurZ with bacteriophage DNA and Z-DNA (positive control, using Q5 polymerase, dZTP instead of dATP in dNTP mix) compared to normal DNA (also referred to herein as A-DNA versus Z-DNA) product, Figure 18) of the digestion product had negligible amounts of dA (Figure 4, A). The UV peaks were quantified using the extinction coefficient to obtain the molar ratio of deoxynucleosides according to Chargraff's rule, the ratio of dZ to dT was 0.99, and the ratio of dC to dG was 1.05. Cationic masses matching the dZ nucleosides and Z bases were detected (B in Figure 4 and Figure 19). These results suggest that in the genome of SH-Ab15497, Z almost completely (and possibly completely) replaces A with T pairing, and that Z-containing genomes are not limited to cyanobacterial phage S-2L, and that the occurrence of Z-containing genomes is more likely than wider as previously understood.

Since phage DNA extracts will contain more or less varying amounts of host DNA fragments, the inventors performed nanopore sequencing of crude extracts to show the quality of phage reads (by Q-score, read identity and cwDTW Alignment fraction quantification) was similar in quality to the Z-DNA control, while the quality of the host reads was similar to that of normal DNA (C-E in Figure 4 and Figures 20, 21) (18-20). The nanopore signal was assigned approximately 100M reads each for phage and host DNA, which allowed the inventors to perform a statistical analysis of the data and conclude that phage DNA is virtually free of adenine, while Z is unlikely to be incorporated into host DNA .

Various phage DNA modifications function to avoid attack by host restriction enzymes (3). The genomic DNA of S-2L was reported to be resistant to most restriction enzymes (21, 22). To demonstrate the general applicability of this to Z-containing genomes, the inventors investigated the susceptibility of the genomic DNA and Z-PCR product of SH-Ab 15497 to restriction endonuclease digestion. The inventors observed that DNA containing Z substitutions from both sources was resistant to digestion by all enzymes containing one or more A's in the recognition site, including the two close homologues of the host's endogenous DNA restriction enzymes (EcoRI). and PstI). The only exception is TaqI, which is known to tolerate various DNA modifications (21). In contrast, both HaeIII and Sau96I recognized GC-only sequences and could readily digest phage DNA and Z-DNA controls (F and G in Figure 4, Figure 22, Table 5). Thus, one evolutionary advantage conferred by Z-containing genomes may be the ability to escape restriction enzyme digestion in a variety of bacteria. The inventors noted that no significant degradation was observed for phage DNA digested with Sau3AI, whereas for Sau3AI the phage DNA contained more than 200 recognition sites, which is clearly consistent with the complete replacement of A with Z in the phage genome (Figure 22). ). The inventors further confirmed that PurZ-containing phages are widely distributed on Earth (data not shown).

Table 1 Putative PurZ screened and characterized in this application (bold in italics indicates species tested).

"N/A": Not applicable

Table 3 Kinetic parameters of PurZ.

Example 2. Identification, Characterization and Testing of PurZO

Based on the 2-aminodeoxyadenosuccinate (ADAS) synthetase identified in Example 1, the inventors obtained more phage 2- A member of the aminodeoxyadenosuccinate (ADAS) synthetase family, including SEQ ID NOs: 9-69 and 92-146. After comparative analysis, they have consistent catalytic motifs and important residues with the PurZ examples identified and tested in Example 1, and are expected to have the same function. In addition, through further structural analysis, the inventors found that part of the ADAS synthase family members use GTP/dGTP as well as dGMP and Asp as reaction substrates, which is consistent with the exemplary PurZ in Example 1 with ATP/dATP and dGMP and Asp As reaction substrates are different, but the overall reaction route is very similar. To differentiate, the 2-aminodeoxyadenosuccinate (ADAS) synthase that uses ATP/dATP as substrate is called PurZ, and the 2-aminodeoxyadenosuccinate (ADAS) synthase that uses GTP/dGTP as substrate ( ADAS) synthase is called PurZ0.

In this example, GpPurZ0 (species: Gordonia phage Archimedes (Gordonia phage Archimedes), Uniprot ID: A0A7L7SI10, SEQ ID NO: 121)) was used as an example to characterize and test PurZ0.

The method of the substrate specificity test and the combination test with PurB is similar to that of Example 1 (except for the replacement of enzymes and variable substrates, other conditions are similar), and the results are shown in Figures 23 and 24, confirming that GpPurZ0 has a GTP/ The substrate specificity of dGTP as a substrate and the detection results of GpPurZ0 and EcPurB activity by HPLC-MS.

The crystal structure analysis method of GpPurZ0 is as follows:

For the crystallization of GpPurZ0 protein, the protein obtained from the TALON column was dialyzed in 2 L buffer [20 mM Tris·HCl, pH 7.5, 5 mM BME] for 3 hours, and then used a 10 mL Q Sepharose anion exchange column. Elute with a linear gradient of buffer containing 300 to 700 mM KCl. The protein containing the significant peak of GpPurZ0 was collected and concentrated to a final volume of 5 mL using a centrifugal concentrator (30K MWCO; Millipore). The protein solution was then injected into a Superdex 200 molecular sieve column (300 mL) pre-equilibrated with buffer [20 mM Tris·HCl, pH 7.5, 0.2 M KCl, 1 mM dithiothreitol] and eluted with buffer B. The gel filtration column was re-concentrated and buffer exchanged with storage buffer [10 mM HEPES/KOH, pH 7.4, 50 mM KCl, 1 mM Tris-(2-carboxyethyl)-phosphine hydrochloride]. The final concentration of protein was adjusted to 10 mg/mL. Preliminary screening of GpPurZ0 crystals was performed by the sitting drop method in a 96-well plate using a crystallization robotic system (Gryphon, Art Robbins). The optimal conditions to produce crystals were 1.26M ammonium sulfate and 0.2M lithium sulfate, 0.1M Tris pH 8.5 and 5mM GTP. Use a crystallization reagent plus 25% glycerol as a cryoprotectant and rapidly cool the crystals in liquid nitrogen. collected at SSRF 18U (Shanghai Synchrotron Radiation Light Source) with a resolution of

diffraction data. Data were processed using HKL3000 software. Molecular replacement was performed on PHENIX software using the crystal structure model created with the website PHYRE2. The structure was manually constructed using Coot software according to the electron cloud orientation, and further optimized in PHENIX software, which was then uploaded to the RCSB protein database (accession code 7VF6). The appendix table contains data collection and final optimized crystal structure data (Table 7). All structural maps were generated using UCSF Chimera (Figure 25).

Table 7. Data collection and optimization data statistics for GpPurZ0 crystals.

According to the sequence analysis, PurZ and PurZ0 are the same in the dGMP active site, both are GSxxKG (where x represents any amino acid residue, usually located at the 13-18 position of the amino acid sequence); but in ATP/dATP and GTP /dGTP active sites are different, specifically, the ATP/dATP active site of PurZ is NxxN/Q (where x represents any amino acid residue, usually located around position 300 in the amino acid sequence), PurZ0 GTP/ The active site of dGTP is T/SxxD (where x represents any amino acid residue, usually located before and after the 300th position of the amino acid sequence), and PurZ and PurZ0 can be distinguished according to the above structural properties.

Example 3. Yeast application test

The gene sequences of ApPurZ and dATPase (see Example 1) were recombinantly cloned into plasmid pRS426 (uracil-deficient) by the method of homologous recombination, and the gene sequence of DUF550 (see Example 1) was also cloned into the plasmid. on plasmid pRS425 (leucine deficient) (Figure 26). After the genes were sequenced correctly, the two plasmids were transformed into yeast and plated on yeast synthetic solid medium deficient in uracil and leucine. After confirming that the plasmid with the target gene was successfully transformed by PCR, a single colony was picked from it and cultured at 30°C until the OD600 reached 0.8. The galactose inducer was added to induce the overexpression of ApPurZ, dATPase and DUF550 proteins. After 18 hours (OD=3.5), the cells were collected by high-speed centrifugation, and the yeast genome was extracted. The extracted yeast genome was detected by high performance liquid chromatography coupled with mass spectrometry. Yeast genomes overexpressed by galactose-induced overexpression of the above three proteins produced dZ. By integration of the dZ UV chromatogram and quantitative calculation of the combined extinction coefficient, dZ replaced 20% of dA on the yeast genome (Figure 27). As shown in the results of FIG. 27 , in the genomic DNA of galactose-induced yeast cells, (dZ+dA):dT was about 0.85, and dZ:(dZ+dA) was about 0.2.

Exemplary embodiments of the various inventions of the present application have been described above, however, those skilled in the art can modify or improve the exemplary embodiments described in the present application without departing from the spirit and scope of the present application, The resulting variants or equivalents also fall within the scope of the present application.

references

1. M.D. Kirnos, I.Y. Khudyakov, N.I. Alexandrushkina, B.F. Vanyushin, 2-aminoadenine is an adenine substituting for a base in S-2L cyanophage DNA. Nature 270, 369-370 (1977).

2. I.Y.Khudyakov, M.D.Kirnos, N.I.Alexandrushkina, B.F.Vanyushin, Cyanophage S-2L contains DNA with 2,6-diaminopurine substituted for adenine. Virology 88, 8-18 (1978).

3. P. Weigele, E.A. Raleigh, Biosynthesis and function of modified bases in bacteria and their viruses. Chem. Rev. 116, 12655-12687 (2016).

4. C. Cheong, I. Tinoco, Jr., A. Chollet, Thermodynamic studies of base pairing involving 2, 6-diaminopurine. Nucleic Acids Res. 16, 5115-5122 (1988).

5. J. Sagi, E. Szakonyi, M. Voflickova, J. Kypr, Unusual contribution of 2-aminoadenine to the thermostability of DNA. J. Biomol. Struct. Dyn. 13, 1035-1041 (1996).

6. M. Cristofalo et al., Nanomechanics of Diaminopurine-Substituted DNA. Biophys. J. 116, 760-771 (2019).

7.M.P.Callahan et al., Carbonaceous meteorites contain a wide range of extraterrestrial nucleobases.Proc.Natl.Acad.Sci.U.S.A.108, 13995-13998 (2011).

8. P. Marliere, Patent WO2003093461. (2003).

9. R. B. Honzatko, H. J. Fromm, Structure-function studies of adenylosuccinate synthetase from Escherichia coli. Arch. Biochem. Biophys. 370, 1-8 (1999).

10. Z. Hou, M. Cashel, H. J. Fromm, R. B. Honzatko, Effects of the stringent response target the active site of Escherichia coli adenylosuccinate synthetase. J. Biol. Chem. 274, 17505-17510 (1999).

11. C. Kang, N. Sun, R. B. Honzatko, H. J. Fromm, Replacement of Asp333 with Asn by site-directed mutagenesis changes the substrate specificity of Escherichia coli adenylosuccinate synthetase from guanosine 5′-triphosphate to xanthosine 5′-triphosphate. J. Biol. Chem. 269, 24046-24049 (1994).

12. M.J. Cavaluzzi, P.N. Borer, Revised UV extinction coefficients for nucleoside-5′-monophosphates and unpaired DNA and RNA. Nucleic Acids Res. 32, e13 (2004).

13. G. Hua et al., Characterization of santalene synthases using an inorganic pyrophosphatase coupled colorimetric assay. Anal. Biochem. 547, 26-36 (2018).

14. B.D. Bennett et al., Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia coli. Nat. Chem. Biol. 5, 593-599 (2009).

15. B.R. Bochner, B.N. Ames, Complete analysis of cellular nucleotides by two-dimensional thin layer chromatography. J. Biol. Chem. 257, 9759-9769 (1982).

16. B.L. Greene et al., Ribonucleotide Reductases: Structure, Chemistry, and Metabolism Suggest New Therapeutic Targets. Annu. Rev. Biochem. 89, 45-75 (2020).

17. Y.Hua et al., Characterization and whole genome analysis of a novel bacteriophage SH-Ab 15497 again multidrug resistant Acinetobacater baummanii.Acta Biochim.Biophys.Sin.(Shanghai)51, 1079-1081(2019).

18. J.J.Kasianowicz, E.Brandin, D.Branton, D.W.Deamer, Characterization of individual polynucleotide molecules using a membrane channel.Proc.Natl.Acad.Sci.U.S.A.93, 13770-13773 (1996).

19. L. Xu, M. Seki, Recent advancements in the detection of base modifications using the Nanopore sequencer. J. Hum. Genet. 65, 25-33 (2020).

20. R. Han, Y. Li, X. Gao, S. Wang, An accurate and rapid continuous wavelet dynamic time warping algorithm for end-to-end mapping in ultra-long nanopore sequencing. Bioinformatics 34, i722-i731(2018 ).

21. M. Szekeres, A. V. Matveyev, Cleavage and sequence recognition of 2, 6-diaminopurine-containing DNA by site-specific endonucleases. FEBS Lett. 222, 89-94 (1987).

22. A. Chollet, E. Kawashima, DNA containing the base analogue 2-aminoadenine: preparation, use as hybridization probes and cleavage by restriction endonucleases. Nucleic Acids Res. 16, 305-317 (1988).

23. P.W. Rothemund, Folding DNA to create nanoscale shapes and patterns. Nature 440, 297-302 (2006).

24. L. Ceze, J. Nivala, K. Strauss, Molecular digital data storage using DNA. Nat. Rev. Genet. 20, 456-466 (2019).

25. R.T.Schooley et al., Development and use of personalized bacteriophage-based therapeutic cocktails to treat a patient with a disseminated resistant Acinetobacter baumannii infection. Antimicrob.Agents Chemother.61, e00954-17(2017).

26. R.M. Dedrick et al., Engineered bacteriophages for treatment of a patient with a disseminated drug-resistant Mycobacterium abscessus. Nat. Med. 25, 730-733 (2019)

27. Z. D. Moye, J. Woolston, A. Sulakvelidze, Bacteriophage Applications for Food Production and Processing. Viruses 10, 205 (2018).

28. Y. Zhang et al., A semi-synthetic organism that stores and retrieves increased genetic information. Nature 551, 644-647 (2017).

29. S. Hoshika et al., Hachimoji DNA and RNA: A genetic system with eight building blocks. Science 363, 884-887 (2019).

30. D.A. Malyshev et al., A semi-synthetic organism with an expanded genetic alphabet. Nature 509, 385-388 (2014).

31. J. Gollihar, M. Levy, A. D. Ellington, Many paths to the origin of life. Science 343, 259-260 (2014).

32. L. Zimmermann et al., A completely reimplemented MPI bioinformatics toolkit with a new HHpred server at its core. J. Mol. Biol. 430, 2237-2243 (2018).

33. C. V. Iancu, T. Borza, H. J. Fromm, R. B. Honzatko, Feedback inhibition and product complexes of recombinant mouse muscle adenylosuccinate synthetase. J. Biol. Chem. 277, 40536-40543 (2002).

34.J.Bridwell-Rabb, G.Kang, A.Zhong, H.W.Liu, C.L.Drennan, An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis.Proc.Natl.Acad.Sci.U.S.A.113, 13750-13755 ( 2016).

35. M. Kanehisa, S. Goto, S. Kawashima, A. Nakaya, The KEGG databases at GenomeNet. Nucleic Acids Res. 30, 42-46 (2002).

36. J.A. Gerlt et al., Enzyme function initiative-enzyme similarity tool (EFI-EST): A web tool for generating protein sequence similarity networks. Biochim. Biophys. Acta. 1854, 1019-1037 (2015).

37. P. Shannon et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498-2504 (2003).

38. K. Katoh, D. M. Standley, MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772-780 (2013).

39. G. E. Crooks, G. Hon, J. M. Chandonia, S. E. Brenner, WebLogo: a sequence logo generator. Genome Res. 14, 1188-1190 (2004).

40. J.A. Gerlt, Genomic Enzymology: Web tools for leveraging protein family sequence-function space and genome context to discover novel functions. Biochemistry 56, 4293-4308 (2017).

41. S. Mehrotra, H. Balaram, Kinetic characterization of adenylosuccinate synthetase from the thermophilic archaea Methanocaldococcus jannaschii. Biochemistry 46, 12821-12832 (2007).

42. G. Kohn et al., High inorganic triphosphatase activities in bacteria and mammalian cells: identification of the enzymes involved. PLoS One 7, e43879 (2012).

43. M. Stoiber et al., De novo identification of DNA modifications enabled by genome-guided nanopore signal processing. bioRxiv, 094672v2 (2017).

Claims

Polypeptide, which has 2-aminodeoxyadenylate succinate (ADAS) synthetase activity, and can use one or more of ATP, dATP, GTP, dGTP and dGMP and Asp as substrates to catalyze the formation of 2- aminodeoxyadenosuccinate, and the catalytic motif of the polypeptide is changed to GSxxKG compared to the GDxxKG catalytic motif of adenylate succinate synthase (PurA), where x represents any amino acid residue.
The polypeptide of claim 1, which corresponds to 303 of SEQ ID NO:72 when the polypeptide is aligned with the amino acid sequence of adenylate succinate synthase (SEQ ID NO:72) from Escherichia coli Bit changed from R to L.
The polypeptide of claim 1 or 2, wherein when the polypeptide is aligned with the amino acid sequence shown in SEQ ID NO: 2, it has T corresponding to position 274 of SEQ ID NO: 2, N at position 306, 307-bit F and 309-bit N.
The polypeptide of any one of claims 1-3, comprising the sequence set forth in any one of SEQ ID NOs: 1-4, 9-69, 71, and 92-146, or SEQ ID NO: Synthesis of 2-aminodeoxyadenoylate succinate (ADAS) retained with the sequence shown in any one of 1-4, 9-69, 71 and 92-146 having one or more amino acid insertions, deletions and/or substitutions Variants of enzymatic activity, or fragments of the sequences set forth in any of SEQ ID NOs: 1-4, 9-69, 71, and 92-146 that retain the catalytic motif.
A polypeptide having 2'-deoxyadenine 5'-triphosphate triphosphate hydrolase (dATPase) activity, capable of catalyzing the hydrolysis of dATP to generate 2'-deoxyadenine (dA), and preferably capable of catalyzing the hydrolysis of dADP and dAMP to generate 2 '-deoxyadenine (dA), the polypeptide contains metal and ligand binding pockets and preferably Co 2+ as a divalent metal cofactor.
The polypeptide of claim 5, comprising the sequence shown in any one of SEQ ID NOs: 5-7, or the sequence shown in any one of SEQ ID NOs: 5-7 and 73-91 having A variant of one or more amino acid insertions, deletions and/or substitutions that retains dATPase activity, or a fragment of the sequence set forth in any of SEQ ID NOs: 5-7 and 73-91 that retains the catalytic motif.
Polypeptides having dATP and dGTP pyrophosphohydrolase activity capable of catalyzing the hydrolysis of dATP to dAMP and dGTP to dGMP, comprising metal and ligand binding pockets and preferably Co as a divalent metal cofactor .
The polypeptide of claim 7 comprising the sequence set forth in SEQ ID NO: 8, or the sequence set forth in SEQ ID NO: 8 with one or more amino acid insertions, deletions and/or substitutions of retained dATP and A variant of dGTP pyrophosphohydrolase activity, or a fragment of the sequence set forth in SEQ ID NO:8 that retains the catalytic motif.
A nucleic acid molecule encoding the polypeptide of any one of claims 1-8.
A vector comprising the nucleic acid molecule of claim 9.
A method for engineering a bacteriophage, comprising introducing a nucleic acid molecule encoding the polypeptide of any one of claims 1-4 into the genome of the bacteriophage, and expressing the polypeptide of any one of claims 1-4 with the bacteriophage.
The method of claim 11, further comprising introducing into the genome of the bacteriophage a nucleic acid molecule encoding the polypeptide of any one of claims 5-6, to express any one of claims 5-6 with the bacteriophage and/or introducing into the genome of the bacteriophage a nucleic acid molecule encoding the polypeptide of any one of claims 7-8, so that the bacteriophage expresses any one of the claims 7-8 of polypeptides.
The method of claim 11 or 12, further comprising introducing into the genome of the bacteriophage a nucleic acid molecule encoding adenylsuccinate lyase (PurB), so that the bacteriophage expresses adenylsuccinate lyase (PurB). ); and/or introducing a nucleic acid molecule encoding a GMP kinase (GK) into the genome of the bacteriophage, so that the bacteriophage expresses the GMP kinase (GK).
Phage obtained by the method of any one of claims 11-13.
A host cell, such as a bacterial cell, comprising the phage of claim 14.
The bacteriophage of claim 14 or the host cell of claim 15 in diaminopurine deoxyribonucleotide (dZTP) synthesis, DNA synthesis, DNA origami, DNA-based data storage, antibacterial drug preparation, bactericide preparation or Use in the preparation of preservatives.