WO2022141939A1 - Vibrio parahaemolyticus standard strains containing specific molecular target, and detection and use thereof - Google Patents

Abstract

The present invention relates to the technical field of bioengineering, and in particular relates to three Vibrio parahaemolyticus standard strains which conform to domestic propagation laws and can be used as standard reference strains in different fields, such as food, medicines, and clinical examination. The deposit numbers thereof are respectively GDMCC 60870, GDMCC 60871 and GDMCC 60872. The three standard strains have typical physiological and biochemical characteristics, contain clear information such as sample sources, genetic backgrounds, drug resistance and virulence genes, and completely meet the requirements for standard strains in the aspects of food, medicines, clinical examinations, etc. The present invention further relates to a group of specific target genes for detecting and identifying the three above-mentioned standard strains and corresponding PCR products. Finally, further provided is a freeze-drying protective agent of Vibrio parahaemolyticus with a high survival rate and specificity, which can be used for long-term storage of the standard strains.

Description

Standard strain of Vibrio parahaemolyticus containing specific molecular target and its detection and application technical field

The invention belongs to the technical field of bioengineering, and in particular relates to a standard strain of Vibrio parahaemolyticus containing a specific molecular target and its detection and application.

Background technique

Vibrio parahaemolyticus (Vibrio parahaemolyticus) is a Gram-negative, halophilic bacterium and an important food-borne pathogenic bacterium in my country. Various aquatic economic animals such as oysters and various shellfish cause vibrio diseases such as skin ulcers in fish and erythropoiesis in shrimp, threatening the development of marine fisheries and aquaculture. At the same time, people eating food carrying pathogenic Vibrio parahaemolyticus often cause acute gastroenteritis, the main symptoms are nausea, vomiting, diarrhea, headache and low-grade fever, severe cases can lead to sepsis. Understanding the transmission rules and pathogenic evolution of this bacterium is the basis for effective prevention and control of food-borne diseases caused by this bacterium, and whether the appropriate standard strain is used determines the reliability of the research results.

At present, most of the standard strains used to study the evolutionary law and pathogenicity of the bacteria are clinically sourced from abroad, which cannot well reflect the spread of the bacteria in food. The detection rate of Vibrio parahaemolyticus in aquatic products has been at a high level, but there is a lack of representative isolates to study the genetic structure and transmission law of the bacteria in China.

So far, there is no lyophilized protective agent for the preparation of quantitative Vibrio parahaemolyticus quality control bacteria.

SUMMARY OF THE INVENTION

The purpose of the present invention is to overcome the deficiencies of the prior art, and to provide three standard strains of Vibrio parahaemolyticus and specific molecular targets and applications for detecting the standard strains. The Vibrio parahaemolyticus of the present invention is a strain isolated from aquatic products in China, the strain has typical physiological and biochemical characteristics of Vibrio parahaemolyticus, and can better reflect the genetic background of the bacteria in China.

To achieve the above object, the technical scheme adopted in the present invention is:

A group of standard strains of Vibrio parahaemolyticus, including Vibrio parahaemolyticus with deposit numbers GDMCC 60870, GDMCC 60871 and GDMCC 60872 respectively.

The present invention screened out 3 strains of Vibrio parahaemolyticus from domestic food in China, and these 3 strains of Vibrio parahaemolyticus carried special sequences and had specific molecular target sites, and the molecular target sequences were as shown in SEQ ID NO. .1 to 5. The inventors have preserved these Vibrio parahaemolyticus respectively, and the specific preservation information and source information are as follows:

[Corrected 11.06.2021 according to Rule 26]
Vibrio parahaemolyticus (Vibrio parahaemolyticus) VP2227C2 was isolated from fresh shrimp samples, and its classification name was Vibrio parahaemolyticus (Vibrio parahaemolyticus), which was deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, address: Building 59, Yard No. 100, Middle Xianlie Road, Guangzhou City, Guangdong Province, China, Postal Code: 510075, Deposit No. GDMCC 60870; Vibrio parahaemolyticus VPS179C3 was isolated from fresh shrimp samples, and its classification was named Arc parahaemolyticus Bacteria (Vibrio parahaemolyticus), has been deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, address: Building 59, Yard, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, China, zip code: 510075, preservation number GDMCC 60871; Vibrio parahaemolyticus 3630A3 is isolated from fresh shrimp samples, and its classification is named Vibrio parahaemolyticus, which has been preserved in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, Address: Building 59, Yard, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, China, Postal Code: 510075, Deposit No. GDMCC 60872.

Further, the Vibrio parahaemolyticus with the deposit number of GDMCC 60870 contains the nucleotide sequence shown in SEQ ID NOs: 1～3; the Vibrio parahaemolyticus with the deposit number of GDMCC 60871 contains as SEQ ID NO: 1～3 The nucleotide sequence shown in NO:4; the Vibrio parahaemolyticus with the deposit number of GDMCC 60872 contains the nucleotide sequence shown in SEQ ID NO:5.

Further, the Vibrio parahaemolyticus with the deposit number GDMCC 60870 carries the following virulence gene: trh; antibiotics resistant to it include: streptomycin, ampicillin and cefazolin.

Further, the Vibrio parahaemolyticus with the deposit number of GDMCC 60871 does not carry the hemolytic gene; the antibiotics it tolerates include: cefotaxime, ampicillin and cefazolin.

Further, the Vibrio parahaemolyticus with the deposit number of GDMCC 60872 does not carry the hemolytic gene; the antibiotics it tolerates include: cefotaxime, kanamycin, streptomycin and ampicillin.

The present invention also provides a set of strain-specific molecular target gene sequences for detecting and identifying each of the above-mentioned standard strains of Vibrio parahaemolyticus respectively, and the molecular targets include those shown in SEQ ID NO. 1-5 Nucleotide sequence.

Further, the nucleotide sequence molecular target shown in SEQ ID NO.1～3 is the specific sequence of Vibrio parahaemolyticus with deposit number GDMCC 60870; described as shown in SEQ ID NO.4 The nucleotide sequence molecular target is the specific sequence of Vibrio parahaemolyticus with deposit number GDMCC 60871; the nucleotide sequence molecular target shown in SEQ ID NO.5 is the parahaemolyticus parahaemolyticus with deposit number GDMCC 60872 Vibrio-specific sequences.

The present invention also provides a set of PCR amplification primers for respectively amplifying and detecting each of the above-mentioned specific molecular target gene sequences. PCR primers for amplification of the nucleotide sequence shown in SEQ ID NO: 1 include: an upstream primer shown in SEQ ID NO: 6 and a downstream primer shown in SEQ ID NO: 7; The PCR primers for amplification of the nucleotide sequence shown in: 2 include: the upstream primer shown in SEQ ID NO: 8 and the downstream primer shown in SEQ ID NO: 9; for the primer shown in SEQ ID NO: 3 PCR primers for nucleotide sequence amplification include upstream primers as shown in SEQ ID NO: 10 and downstream primers as shown in SEQ ID NO: 11; for amplification of nucleotide sequences as shown in SEQ ID NO: 4 The PCR primers include: upstream primers as shown in SEQ ID NO: 12 and downstream primers as shown in SEQ ID NO: 13; PCR primers for amplification of the nucleotide sequence as shown in SEQ ID NO: 5 include: An upstream primer as set forth in SEQ ID NO:14 and a downstream primer as set forth in SEQ ID NO:15.

The invention also provides a freeze-drying protective agent for Vibrio parahaemolyticus, comprising the following components in parts by weight: 0.1-10 parts of potassium lactate, 3-10 parts of skim milk powder, 0.1-1 part of sodium glycerophosphate, 1-5 parts of stachyose, 0.1-5 parts of bovine serum albumin.

The reason why the above components are selected in the present invention is that stachyose and sodium glycerophosphate have a polyhydroxy structure, which can form hydrogen bonds with the polar groups of bacterial proteins during the freezing or drying process to protect the cell membrane and protein structure and function. Integrity, skim milk powder and bovine serum albumin can be wrapped in the outer layer of bacterial cells to protect the bacterial cells, potassium lactate acts as an antioxidant, reduces the activity of cellular oxidase during the freeze-drying process and long-term storage, and prevents the oxidative deterioration of freeze-dried products.

Beneficial effects of the present invention:

(1) Vibrio parahaemolyticus VP2227C2, VPS179C3 and 3630A3 of the present invention have standard microscopic morphology and physiological and biochemical characteristics of Vibrio bacteria, and can be used to test the accuracy of Vibrio color plates. VP2227C2 carries the virulence gene tdh-/trh+, but its serotype is the rare O11; VPS179C3 does not carry the hemolytic gene, and the serotype is O1; 3630A3 does not carry the hemolytic gene, and the serotype is O2, because these three strains Vibrio parahaemolyticus has special significance in evolution. Compared with other standard strains of this species, it is a strain that can reflect the genetic background in China and can be used as a reference strain for scientific research.

(2) For the Vibrio parahaemolyticus of the present invention, the inventor provides a freeze-drying protective agent. The protective agent has the following advantages: good molding, beautiful appearance and good water solubility, can be completely dissolved within 1-2 seconds; freeze-drying survival rate can reach more than 60%; Its bacterial content remains within the same order of magnitude and can be used for long-term storage of quality control strains.

biological material preservation

[Corrected 11.06.2021 according to Rule 26]
A strain of Vibrio parahaemolyticus VP2227C2, which is classified as Vibrio parahaemolyticus, has been deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, address: Guangdong Province, China Building 59, No. 100 Xianlie Middle Road, Guangzhou City, postal code: 510075, preservation number: GDMCC 60870.

[Corrected 11.06.2021 according to Rule 26]
A strain of Vibrio parahaemolyticus VPS179C3, which is classified as Vibrio parahaemolyticus, has been deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, address: Guangdong Province, China Building 59, No. 100, Xianlie Middle Road, Guangzhou, Postal Code: 510075, preservation number: GDMCC 60871.

[Corrected 11.06.2021 according to Rule 26]
A strain (Vibrio parahaemolyticus) 3630A3, which is classified as Vibrio parahaemolyticus, has been deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, address: 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, China Building No. 59, No. 510075, postal code: GDMCC 60872.

Description of drawings

Figure 1 is a diagram of the colony morphology of the Vibrio parahaemolyticus VP2227C2 strain.

Figure 2. Colony morphology diagram of Vibrio parahaemolyticus VPS179C3 strain.

Figure 3. Colony morphology diagram of Vibrio parahaemolyticus 3630A3 strain.

Figure 4 is a morphological diagram of the microscopic observation of the Vibrio parahaemolyticus VP2227C2 strain.

Figure 5 is a morphological diagram of the microscopic observation of the Vibrio parahaemolyticus VPS179C3 strain.

Figure 6 is a morphological diagram of the microscopic observation of the Vibrio parahaemolyticus 3630A3 strain.

Figure 7 is a PCR amplification diagram of the unique gene fragment of Vibrio parahaemolyticus VP2227C2 strain.

Figure 8 is a PCR amplification diagram of the unique gene fragment of Vibrio parahaemolyticus VPS179C3 strain.

Figure 9 is a PCR amplification diagram of the unique gene fragment of Vibrio parahaemolyticus 3630A3 strain.

Figure 10 is a schematic diagram of the changes in the storage period of Vibrio parahaemolyticus quantitative quality control bacteria.

Detailed ways

In order to express the technical solutions of the present invention more clearly, the following further description is given in conjunction with specific embodiments, but cannot be used to limit the present invention, which are only some embodiments of the present invention.

Example 1 Isolation, identification and cultivation of standard strains of Vibrio parahaemolyticus

The collected fresh shrimp samples were thoroughly cut into pieces under sterile conditions, and 25 g of the samples were weighed into 225 mL of alkaline peptone water containing 3% sodium chloride, and continuously homogenized on a slap-type homogenizer for 2 min. into a 1:10 homogeneous dilution. Pipette 1ml of 1:10 dilution solution with a pipette, add it to a test tube containing 9ml of 3% sodium chloride alkaline peptone water, shake well, and prepare a 1:100 dilution solution. In addition, prepare 10 incremental dilutions according to the above operation. For each increment, use a 1ml sterilized pipette tip. For each dilution, inoculate three test tubes containing 9ml of 3% sodium chloride alkaline peptone water. The tube was inoculated with 1ml, placed in a 37°C incubator, and incubated for 8h-18h. In addition, the remaining mixed solution was placed in a 37°C incubator and incubated for 8h-18h.

Dip a loop with an inoculation loop from all the test tubes or enrichment solution showing growth, streak it on a TCBS plate, streak a plate with one test tube, and incubate at 37°C for 18h-24h. A typical Vibrio parahaemolyticus is a round, translucent, green colony with a smooth surface on TCBS, which is lightly touched with an inoculation ring, has a chewing gum-like texture, and is 2mm-3mm in diameter. After removing the TCBS plate from the incubator, the colonies should be picked as soon as possible (no more than 1 h). Pick suspicious colonies from each TCBS plate containing suspected colonies, streak them on Vibrio color plates, and culture at 37°C for 18h-24h. At the same time streak the 3% sodium chloride tryptone slant (TSA), and temporarily save the suspicious colonies.

Vibrio parahaemolyticus VP2227C2 (Fig. 1), VPS179C3 (Fig. 2), 3630A3 ( image 3). The target colonies were transferred from TSA to 3% sodium chloride tryptone soybean broth, and recovered at 37°C overnight. Under sterile conditions, the bacterial solution was added to a tube with a final concentration of 30% glycerol, stored in a -80°C refrigerator, and stored in a freeze-dried tube. The purified colonies can be identified in terms of morphological characteristics, physiology and biochemistry, serotype and molecular biology.

[Corrected 11.06.2021 according to Rule 26]
The Vibrio parahaemolyticus strains VP2227C2, VPS179C3 and 3630A3 of the present invention are preserved in the Guangdong Provincial Microbial Culture Collection Center, and the address is Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, China, postal code: 510075, and the preservation date is 2019-10-27, the deposit numbers are GDMCC 60870, GDMCC 60871, GDMCC 60872.

Embodiment 2 Vibrio parahaemolyticus standard strain analysis

1. Physiological and biochemical characteristics and serotype analysis

1.1 Stain microscopy

The suspicious colonies were smeared, gram stained, and the morphology was observed by microscopy. Vibrio parahaemolyticus is Gram-negative, rod-shaped, arc-shaped, oval-shaped, etc., without spores, with flagella.

As shown in Fig. 4, the Vibrio parahaemolyticus VP2227C2 strain was observed to contain flagella.

1.2 API 20E identification

Scrape the purple single colony from the Vibrio chromogenic plate, prepare it into a cell suspension with appropriate turbidity with physiological saline, and use API 20E biochemical identification reagent strip to identify.

1.3 Confirm O antigen

The O antigen of Vibrio parahaemolyticus VP2227C2, VPS179C3 and 3630A3 strains was confirmed by multiplex PCR. For primers and amplification methods, refer to previous literature reports. The 12 pairs of primers used were synthesized by Shanghai Sangon Biological Co., Ltd. (see Table 1 for primer sequences). The 12 pairs of primers were divided into two groups, O1, O2, O4, O5, O6 and O10 as group 1; O13, O7, O8, O9, O11 and O12 as group 2. The reaction system (25 μL) contained: 2×DS PCR mix, 12.5 μL; 0.5 μM upstream and downstream primers; ddH ₂ O, 9.5 μL and genomic DNA, 1 μL. 10μL of PCR product was loaded on 2.0% agarose gel for electrophoresis separation (120V, 40min), using 100pb DNA ladder Marker.

Table 1 Primer sequences and amplified fragments of Vibrio parahaemolyticus serotypes

2. Analysis of virulence factor carrying characteristics of standard strains of Vibrio parahaemolyticus

Bacterial genomic DNA extraction kit was used to extract genomic DNA, and the content and purity of genomic DNA were determined by Bio Spec-nanospectrophotometer spectrophotometer. Detection of tdh, trh gene using PCR amplification method. The primers are Tdh-F: CTGTCCCTTTTCCTGCCCCCG, Tdh-R: AGCCAGACACCGCTGCCATTG; Trh-F: ACCTTTTCCTTCTCCWGGKTCSG, Trh-R: CCGCTCTCATATGCYTCGACAKT, synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. Reaction system (25 μL): 2×Qiagen PCR Mix, 12.5 μL; primers 0.5 μM each; ddH ₂ O, 9.5 μL and DNA template 1 μL. The amplification conditions were as follows: 95°C: 5 min; 95°C, 1 min, 62°C, 1 min; 72°C, 1 min, 40 cycles; 72°C: 2 min. 10 μL of PCR product was loaded on 2.0% agarose gel for electrophoresis separation (120V, 35min). Vibrio parahaemolyticus ATCC17802 and ATCC33847 served as reference strains.

3. Analysis of drug susceptibility characteristics of standard strains of Vibrio parahaemolyticus

Vibrio parahaemolyticus VP2227C2, VPS179C3, 3630A3 strains were activated on TSA plates, diluted with normal saline and diluted to a final concentration of 1×10 ⁷ cfu/mL and spread on MH plates. The surface of the medium was incubated at 37°C for 24h. The size of the inhibition zone was measured with a vernier caliper, accurate to 0.01 mm. The selected antibiotics are as follows: ampicillin (AMP, 10 μg), azithromycin (AZM, 15 μg), cefazolin (KZ, 30 μg), cephalosporin (KF, 30 μg), chloramphenicol (C, 30 μg), ciprofloxacin Star (CIP, 5μg), gentamicin (CN, 10μg), kanamycin (KAN, 30μg), nalidixic acid (NA, 30μg), streptomycin (S, 10μg), sulfamethoxazole/formaldehyde Oxymethazine (SXT, 25 μg) and tetracycline (TET, 30 μg). Escherichia coli ATCC25922 and Vibrio parahaemolyticus ATCC17802 were used as quality control strains.

4. Multi-locus sequence (MLST) typing analysis of standard strains of Vibrio parahaemolyticus

The reference database (http://pubmlst.org/vparahaemolyticus/) was used for MLST typing of Vibrio parahaemolyticus. Primers for the seven housekeeping genes were synthesized by Shanghai Sangon Biological Co., Ltd. (Table 2). The PCR amplification program was as follows: 96°C, 1 min; 96°C, 1 min; 58°C, 1 min, 72°C: 1 min, 30 cycles; 72°C, extension 10 min. The amplified product was purified with a PCR purification kit (Qiagen, Genman), and the purified product was sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for sequence determination. The sequences were aligned in the MLST database to obtain the genotype number and ST type of the housekeeping gene.

Table 2 Vibrio parahaemolyticus MLST primer sequences

5. Characteristic sequence analysis of standard strains of Vibrio parahaemolyticus

The non-essential genes peculiar to VP2227C2, VPS179C3 and 3630A3 strains were mainly obtained according to the results of pan-genome analysis of Vibrio parahaemolyticus. A total of 233 representative strains of Vibrio parahaemolyticus (including VP2227C2, VPS179C3, 3630A3 strains) were selected for pan-genome analysis. The pan-genome was analyzed by the MP method in the prokaryotic Pan-Genomics Analysis Pipeline (PGAP), and the analysis results were processed by the local Perl script to obtain the core gene and non-core gene information of all strains.

The specific non-core gene protein sequences of VP2227C2, VPS179C3 and 3630A3 strains were extracted, and then aligned back to the total protein library of Vibrio parahaemolyticus and the NCBI non-redundant protein database (NR) by local Blast. The sequences that align to the known V. parahaemolyticus proteins were removed, and the rest were the genes specific to the VP2227C2, VPS179C3, and 3630A3 strains. The specificity of the unique gene was tested by PCR amplification in the VP2227C2, VPS179C3, 3630A3 strains and other paralysed strains.

Analysis results

1. Analysis results of VP2227C2 strain

The VP2227C2 strain was isolated from fresh prawns in Fuzhou, China, and its O antigen serotype was O11 serotype.

Identification information of VP2227C2 strain: Gram-negative bacilli and oxidase-positive. The identification strip type is API 20E, the identification code is 4156106, the identification coincidence rate is 99.9%, and the T value is 0.67. The relevant biochemical reaction results are shown in Table 3, and other supplementary biochemical reactions are shown in Table 4.

Table 3 Results of related biochemical reactions of VP2227C2 strain

Table 4 Results of other supplementary biochemical reactions of VP2227C2 strain

Table 5 MLST typing results of VP2227C2 strain

ST: New.

The VP2227C2 strain carries the trh gene, and the sequence is shown in SEQ ID No: 16.

virulence factor gene

>trh

SEQ ID No: 16

Multi-locus sequence (MLST) typing analysis showed that it belongs to a new ST type. At the same time, the strain also carries a unique gene island. The sequence is shown in SEQ ID No: 1 to SEQ ID No: 3. The gene island can be Amplification testing was performed with the following primers:

331_4168_F: CTGATGAAATAGATAAAGACCCACG(101, Tm: 59.6)

331_4168_R:GGGTTTTCCTCTAAGTACCAAGC(497, Tm: 58.7)

331_4187_F: TAACCCAGAAGAGTCCCCAACC(180, Tm: 62.0)

331_4187_R:CGTAAGATACCCCGCTAACAGC(751,Tm:61.0)

331_4199_F:CGAAAGCAACAAAACCCATC(398,Tm:58.2)

331_4199_R: TTCCTGCTCTGTTTGCTCCTA(982, Tm: 57.8)

The VP2227C2 strain can be grown in TBS and LB medium.

The VP2227C2 strain was resistant to streptomycin, ampicillin and cefazolin.

2. Analysis results of VPS179C3 strain

VPS179C3 strain was isolated from fresh shrimp in Taiyuan City, China, and its O antigen serotype is O1 serotype.

Identification information of VPS179C3 strain: Gram-negative bacilli and oxidase-positive. The identification strip type was API 20E, the identification code was 4346107, the identification coincidence rate was 99.9%, and the T value was 0.36. The relevant biochemical reaction results are shown in Table 6, and other supplementary biochemical reactions are shown in Table 7.

Table 6 Results of related biochemical reactions of VPS179C3 strain

Table 7 Results of other supplementary biochemical reactions of VPS179C3 strain

The VPS179C3 strain does not carry the hemolytic gene. Multi-locus sequence (MLST) typing analysis showed that it is ST2157, and this strain also carries a unique gene island, the sequence is shown in SEQ ID No: 4, the gene island can be amplified and tested by the following primers:

75_1871_F GTTCCGTTTGAATACGAAGGTT

75_1871_R CTATTCTGGGTTGGTTTAGTGAGG

This strain can be grown in TBS and LB medium.

The strain is resistant to cefotaxime, ampicillin and cefazolin.

Table 8 MLST typing results of VPS179C3

ST: 2157

3. Analysis results of strain 3630A3

Strain 3630A3 was isolated from fresh shrimp in Guiyang, China, and its O antigen serotype was O2 serotype.

3630A3 strain identification information: Gram-negative bacilli, oxidase-positive. The identification strip type is API 20E, the identification code is 4146106, the identification coincidence rate is 99.9%, and the T value is 0.5. The relevant biochemical reaction results are shown in Table 9, and other supplementary biochemical reactions are shown in Table 10.

Table 9 3630A3 strain related biochemical reaction results

Table 10 Results of other supplementary biochemical reactions of 3630A3 strain

The 3630A3 strain does not carry the hemolytic gene. Multi-locus sequence (MLST) typing analysis showed that it was ST525. At the same time, the strain also carried a unique gene island. The sequence is shown in SEQ ID No: 5. The gene island can be amplified and tested by the following primers:

V120-F GGGTTCGGAAAATGAATGATTTGA

V120-R AGCTAGATTGGGTAAAACCAGAGAG

This strain can be grown in TBS and LB medium.

The strain is resistant to cefotaxime, kanamycin, streptomycin and ampicillin.

Table 11 MLST typing results of 3630A3

ST: 525

Table 12 Specific genes of strains

(1) VP2227C2 signature sequence

SEQ ID No: 1

>331_4168

SEQ ID No: 2

>331_4187

SEQ ID No: 3

>331_4199

(2) VPS179C3 feature sequence

SEQ ID No: 4

>75_1871

(3) 3630A3 feature sequence

SEQ ID No: 5

>V120

Table 13 Gene island amplification primer sequences of the strains of the present invention

The present invention also provides a freeze-dried protective agent for quantitative preservation of the standard strain of Vibrio parahaemolyticus of the present invention. The components of the freeze-dried protective agent in different examples and comparative examples are shown in Table 14:

Table 14 Components of each group of lyoprotectants

group	potassium lactate	skim milk powder	Sodium Glycerophosphate	stachyose	bovine serum albumin
Example 3	3	10	0.1	5	5
Example 4	0.5	7	0.3	3	3
Example 5	1	9	0.2	4	0.5
Comparative Example 1	---	10	0.1	5	5
Comparative Example 2	3	10	---	5	5
Comparative Example 3	---	10	---	---	---

The protective agents of Examples 3 to 5 and Comparative Examples 1 to 3 will be used for freeze-dried bacterial species (GDMCC 60870), and the freeze-dried survival rate thereof will be measured. The specific method is as follows:

After the strains are recovered, they are placed in shake flasks and cultivated to the late logarithmic stage to the early stage of the stable stage. Select an appropriate amount of bacteria and add them to the protective agent, mix them evenly, and distribute them into vials, and take samples for dilution and counting. The former bacterial content A ₀ . Transfer the half-stoppered vial to the freeze dryer for pre-freezing, the pre-freezing temperature is -40 ° C, the time is 3 hours, the main drying is turned on, the time is 20-25 hours, and then the analysis and drying stage is entered, and the time is 6 -8 hours, end drying, press the plug under vacuum and remove the freeze dryer, perform automatic capping, ensure the complete vacuum state of the sample, and store at -20 ℃ low temperature. Take the lyophilized sample for dilution and counting, and the count result is the bacterial content A after lyophilization. The lyophilization survival rate is the percentage of A and A ₀ . The results are shown in Table 15:

Table 15 Comparison of lyophilized survival rates of lyophilized protective agents with different compositions

As can be seen from Table 15, the lyoprotectant of Example 4 is the best embodiment of the present invention.

The freeze-drying stability will be compared with the freeze-dried strains of the protective agents in Examples 3-5 and Comparative Examples 1-3, and the specific methods are as follows:

According to the above preparation method, different protective agents were used to prepare quantitative quality control bacteria, and they were stored at -20°C, and 3 bottles were extracted every month to check the bacterial content according to the aforementioned counting method. In order to better compare the effect of each protective agent in the long-term storage process, when preparing quantitative quality control bacteria, the number of viable cells before freeze-drying was calculated according to the freeze-drying survival rate of each protective agent. The bacterial content is about 2000cfu/bottle. The changes in bacterial content of the quantitative quality control bacteria prepared by each protective agent after 12 months of storage are shown in Figure 10 below.

As can be seen from Figure 10, after 12 months of storage, the bacterial content protected by the lyophilized protective agents of Examples 3 to 5 has no significant change, while the bacterial content protected by the lyophilized protective agents of Comparative Examples 1 to 3 is in 2 The bacterial content decreased significantly after one month, and the bacterial content was close to 0 after 12 months.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that, The technical solutions of the present invention may be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention.

Claims (10)

1. A specific molecular target for detecting Vibrio parahaemolyticus, characterized in that the molecular target comprises:

   (a) any one or several nucleotide sequences shown in SEQ ID NOs: 1 to 5; or,

   (b) The nucleotide sequence in (a) is substituted, deleted or added by one or several nucleotides and has more than 90% homology with the nucleotide in (a).
2. A primer for detecting a specific molecular target as claimed in claim 1, characterized in that,

   PCR primers for amplification of the nucleotide sequence shown in SEQ ID NO:1 include: an upstream primer shown in SEQ ID NO:6 and a downstream primer shown in SEQ ID NO:7;

   PCR primers for amplification of the nucleotide sequence shown in SEQ ID NO:2 include: an upstream primer shown in SEQ ID NO:8 and a downstream primer shown in SEQ ID NO:9;

   PCR primers for amplification of the nucleotide sequence set forth in SEQ ID NO:3 include the upstream primer set forth in SEQ ID NO:10 and the downstream primer set forth in SEQ ID NO:11.

   PCR primers for amplification of the nucleotide sequence shown in SEQ ID NO:4 include: an upstream primer shown in SEQ ID NO:12 and a downstream primer shown in SEQ ID NO:13;

   PCR primers for amplification of the nucleotide sequence set forth in SEQ ID NO:5 include: an upstream primer set forth in SEQ ID NO:14 and a downstream primer set forth in SEQ ID NO:15.
3. A kind of Vibrio parahaemolyticus (Vibrio parahaemolyticus) is characterized in that, is (a), (b) or (c):

   (a) Vibrio parahaemolyticus (Vibrio parahaemolyticus) VP2227C2, containing the nucleotide sequences shown in SEQ ID NOs: 1 to 3;

   (b) Vibrio parahaemolyticus VPS179C3, containing the nucleotide sequence shown in SEQ ID NO:4;

   (c) Vibrio parahaemolyticus 3630A3, containing the nucleotide sequence shown in SEQ ID NO:5.
4. Vibrio parahaemolyticus as claimed in claim 3, is characterized in that: described Vibrio parahaemolyticus (Vibrio parahaemolyticus) VP2227C2, its classification name is Vibrio parahaemolyticus (Vibrio parahaemolyticus), has been in On October 27, 2019, it was deposited in the Guangdong Provincial Microbial Culture Collection Center, and the preservation number is GDMCC 60870;

   The described Vibrio parahaemolyticus (Vibrio parahaemolyticus) VPS179C3, its classification is named Vibrio parahaemolyticus (Vibrio parahaemolyticus), has been deposited in the Guangdong Provincial Microbial Culture Collection Center on October 27, 2019, and the preservation number is GDMCC 60871 ;

   Described Vibrio parahaemolyticus (Vibrio parahaemolyticus) 3630A3, its classification is named Vibrio parahaemolyticus (Vibrio parahaemolyticus), has been deposited in the Guangdong Provincial Microorganism Culture Collection Center on October 27, 2019, and the preservation number is GDMCC 60872 .
5. Vibrio parahaemolyticus (Vibrio parahaemolyticus) as claimed in claim 4, is characterized in that, the Vibrio parahaemolyticus that described deposit number is GDMCC 60870 carries the virulence gene shown below: trh; Its serotype is O11 ; Antibiotics that it tolerates include: streptomycin, ampicillin, and cefazolin.
6. Vibrio parahaemolyticus as claimed in claim 4, is characterized in that, the Vibrio parahaemolyticus whose deposit number is GDMCC 60871 does not carry hemolytic gene, and its serotype is O1; Includes: cefotaxime, ampicillin, and cefazolin.
7. Vibrio parahaemolyticus (Vibrio parahaemolyticus) as claimed in claim 4, is characterized in that, the Vibrio parahaemolyticus that described preservation number is GDMCC 60872 does not carry hemolytic gene, and its serotype is O2; Includes: cefotaxime, kanamycin, streptomycin, and ampicillin.
8. The application of Vibrio parahaemolyticus as claimed in claim 3 in the antibiotic resistance of Vibrio parahaemolyticus.
9. The application of the Vibrio parahaemolyticus as claimed in claim 3 in improving the accuracy of testing the color plate of Vibrio parahaemolyticus.
10. A freeze-drying protective agent for Vibrio parahaemolyticus, characterized in that it comprises the following components in parts by weight: 0.1 to 10 parts of potassium lactate, 3 to 10 parts of skim milk powder, 0.1 to 1 part of sodium glycerophosphate, 1 to 10 parts of ~5 parts stachyose, 0.1-5 parts bovine serum albumin.

Images