WO2022140667A2 - Method for treating crohn's disease - Google Patents

Method for treating crohn's disease Download PDF

Info

Publication number
WO2022140667A2
WO2022140667A2 PCT/US2021/065075 US2021065075W WO2022140667A2 WO 2022140667 A2 WO2022140667 A2 WO 2022140667A2 US 2021065075 W US2021065075 W US 2021065075W WO 2022140667 A2 WO2022140667 A2 WO 2022140667A2
Authority
WO
WIPO (PCT)
Prior art keywords
subject
gpl30
inhibitor
tnf
disease
Prior art date
Application number
PCT/US2021/065075
Other languages
French (fr)
Other versions
WO2022140667A3 (en
Inventor
Judy H. Cho
Shikha NAYAR
Original Assignee
Icahn School Of Medicine At Mount Sinai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icahn School Of Medicine At Mount Sinai filed Critical Icahn School Of Medicine At Mount Sinai
Publication of WO2022140667A2 publication Critical patent/WO2022140667A2/en
Publication of WO2022140667A3 publication Critical patent/WO2022140667A3/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/06—Gastro-intestinal diseases
    • G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present specification relates to methods of treating Crohn’s disease.
  • the present specification relates to methods, compositions, diagnostic gene panels, and kits for treating Crohn’s disease by administering a glycoprotein 130 (gpl30) inhibitor (e.g., apeledoxifene) to a subject having Crohn’s disease, and in some embodiments, to subjects identified as non-responders to standard-of-care treatment (e.g., anti-TNF treatment or ustekinumab).
  • gpl30 glycoprotein 130
  • Crohn’s disease is a chronic inflammatory intestinal disorder that affects the gastrointestinal tract. Symptoms of Crohn’s disease include abdominal pain, diarrhea, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and fatigue. The disease is also often characterized by aberrant healing and stricturing complications. The exact causes of Crohn’s disease are not currently known, but it is thought to be caused by some combination of environmental, immune, and bacterial factors. It is also thought that there are genetic components that may contribute to onset of the disease, with Crohn’s disease often occurring in genetically susceptible subjects.
  • Anti-TNF drugs are also effective treatments for the management of Crohn's disease but treatment failure is common in subjects who are or who become after a period of time non-responsive to anti-TNF agent.
  • the genetic basis for drug non-responsiveness and to Crohn’s in general is not entirely understood.
  • it has been reported that increases in intravasating monocytes correlate with non-responsiveness to anti- TNF treatment (Martin, J. C. et al. Single-Cell Analysis of Crohn’s Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell. 2019, 178, 1493-1508.e20).
  • the present disclosure shows in part that loss of NOD2 function leads to aberrant activated fibroblast and macrophage homeostasis by direct ex vivo analyses of Crohn’s disease patients carrying N0D2 risk alleles. This was further validated via altered in vitro differentiation of CD14+PBMCs from N0D2 carriers to produce collagen-high expressing cells, and in vivo zebrafish models of DS S -intestinal injury and nod2 deficiency. The observed enrichment of STAT3 regulation and gpl30-ligands IL11, IL6, and OSM in activated fibroblasts and macrophages supports that the blockade of gpl30 could rescue the activated program.
  • the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof.
  • the method comprises administering to a subject a therapeutically effective amount of a gpl30 inhibitor, e.g., apeledoxifene or apeledoxifene derivative.
  • a gpl30 inhibitor e.g., apeledoxifene or apeledoxifene derivative.
  • administering a gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in a subject (e.g., wtl; ILH tgfbla; cxcl!3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof).
  • the disclosure relates to a method of modulating expression of a transcriptional profile (e.g., a profile comprising a transcriptional regulator selected from: WT1; STAT3; TWIST1; CEBPB; or a combination thereof) in a subject by administering a therapeutically effective amount of a gpl30 inhibitor, e.g., apeledoxifene or apeledoxifene derivative.
  • a transcriptional profile results from cross-talk between myeloid and stromal cells.
  • expression of a transcriptional profile is modulated to prevent activation of fibroblasts and/or inflammatory macrophages.
  • Example 1 it has been discovered that the anti-TNF non-responder phenotype may be recognized based on detection of the gene signature of Table 1 in Example 1.
  • Example 1 it is demonstrated that gpl30 inhibition with apeldoxifene ameliorates pathogenic transcriptional activation of myeloid and stromal cells of the genes of Table 1, which represents a transcriptional signature (observed in non-responders even before anti-TNF treatment institution) that can be identified prior to treatment with a gpl30 inhibitor.
  • This transcriptional signature may be probed and detected to identify not only anti-TNF non- responders, but also ustekinumab non-responders, thereby identifying suitable candidates for treatment with a gpl30 inhibitor (e.g., apeledoxifene) which causes the dampening of the transcriptional signature thereby also restoration of such treated subjects to anti-TNF and/or ustekinumab treatment.
  • a gpl30 inhibitor e.g., ciprofene
  • the disclosure relates to a method of restoring sensitivity of a subject (e.g., a subject having a transcriptional profile associated with anti-TNF resistance) to a standard-of-care Crohn’s disease treatment, e.g., treatment with an anti-TNF agent or with ustekinumab (e.g., STELARA®).
  • a subject e.g., a subject having a transcriptional profile associated with anti-TNF resistance
  • a standard-of-care Crohn’s disease treatment e.g., treatment with an anti-TNF agent or with ustekinumab (e.g., STELARA®).
  • restoring sensitivity in a subject can be achieved by administering a therapeutically effective amount of apeledoxifene to a subject to decrease expression of activated fibroblast transcripts (e.g., wtl illl; tgfbla; cxcl!3; mmp9; pdpn; chi3ll; pdgfrd) in a subject.
  • activated fibroblast transcripts e.g., wtl illl; tgfbla; cxcl!3; mmp9; pdpn; chi3ll; pdgfrd
  • a transcriptional profile results from cross-talk between myeloid and stromal cells.
  • the disclosure also provides a metho gene signature useful for identifying subjects who would not respond to standard of care treatments for Crohn’s disease (e.g., anti-TNF therapies, and anti-IL12p40/IL23R therapies such as ustekinumab) is also described herein.
  • the disclosure relates to a method for identifying a Crohn’s disease subject in need of treatment.
  • identifying such a subject can be achieved by taking a sample from a subject and evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a N0D2 risk allele carrier (e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9).
  • a N0D2 risk allele carrier e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
  • the method further comprises administering a gpl30 inhibitor to a subject.
  • the disclosure relates to a method for identifying and treating a Crohn’s disease subject in need of treatment.
  • identifying such a subject can be achieved by a) taking a sample from the subject; b) evaluating a sample for one or more increased activated fibroblast or macrophage signatures characteristic of a N0D2 risk allele carrier (e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9); and c) administering a gpl30 inhibitor to a subject.
  • a N0D2 risk allele carrier e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9
  • the disclosure relates to a composition comprising a gpl30 inhibitor and an anti-TNF agent.
  • a composition comprises a therapeutically effective amount of a gpl30 inhibitor and an anti-TNF agent.
  • a composition comprises one or more pharmaceutically acceptable excipients.
  • kits for treating or for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease comprises a gpl30 inhibitor and an anti-TNF agent.
  • a kit for diagnosing such subjects comprises reagents for performing any of the methods described herein and a gpl30 inhibitor.
  • a kit comprises any of the compositions disclosed herein.
  • the disclosure relates to a method of treating Crohn’s disease in a subject.
  • treating Crohn’s disease in a subject is accomplished by administering any of the compositions disclosed herein to a subject.
  • the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof, the method comprising:
  • a gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • a gp!30 inhibitor is apeledoxifene, having the structure: certain embodiments, a gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of apeledoxifene.
  • a subject is an anti-TNF non-responder (e.g., a primary anti- TNF non-responder or a secondary anti-TNF non-responder), or at risk for being an anti-TNF non-responder (e.g., at risk for being a primary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder).
  • the subject is an anti- IE12p40/IE23R therapy (e.g., ustekinumab) non-responder, or at risk for being an anti- IE12p40/IE23R therapy non-responder.
  • administering a gpl30 inhibitor to a subject prevents collagen secretion or activation; prevents intestinal length shortening; or decreases gpl30 target gene activation in a subject.
  • any of the methods described herein further comprise administering to the subject an anti-TNF therapy or an anti-IE12p40/IE23R therapy along with apeledoxifene.
  • FIGs. 1A-1H show that inflamed ileal CD14+PDGFRA+ cells and scRNASeq orthologies implicate key roles for myeloid- stromal clusters with inflammation and injury.
  • IB shows the percentage of COL1A1+ single-positive, PDGFRA+ single-positive, CD14+ single-positive, and CD14+PDGFRA+ double-positive cells of total activated fibroblasts (1367 cells total) in inflamed ileum.
  • Uniform Manifold Approximation and Projection shows joint clustering of 28 unique clusters between intestinal cells from zebrafish and human ileal CD lamina intestinal cells.
  • FIG. 1G is a dot plot showing markers commonly expressed between homologous zebrafish and human clusters.
  • FIGs. 2A-2F show that NOD2 deficiency assessed direct ex-vivo, in vitro, and in vivo establish an activated fibroblast signature, implicating IL11 and WT1.
  • 2B is a schematic of CD14+ CD16- PBMCs isolated from healthy NOD2 carriers and non-carriers, followed by differentiation assay (top). Representative images of myeloid (MPEG1: Macrophage Expressed 1) expression evenly distributed along the cell surface and stromal (MFAP4: Microfibrillar Associated Protein 4, COL5A1: Type V Collagen, COL1A1; Type I Collagen) expression localized to spindle edges as assessed by immunofluorescence (bottom).
  • MPEG1 Macrophage Expressed 1
  • MFAP4 Microfibrillar Associated Protein 4
  • COL5A1 Type V Collagen, COL1A1; Type I Collagen
  • FIG. 2C shows COL1A1 secreted by unstimulated, 0.5 pg/mL Lipid A, 2.5 pg/mL Pam3Cys, or 1 pg/mL MDP- stimulated PBMCs (pg/mL) as measured via Luminex.
  • MDP muramyl dipeptide
  • FIG. 2E is a schematic of nod2 sa21011 mutant from Zebrafish Sanger Mutation Project: C>T single nucleotide polymorphism leads to early truncation of Nod2 zebrafish protein and nod2 lll ‘'‘' l3/lll ‘'‘' 13 CRISPR-knockout zebrafish line generated, showing a 4 amino acid deletion (left); timeline of IX and 2X MDP stimulation of zebrafish larvae (right).
  • FIG. 2F provides RT-PCR data showing relative gene expression 24 hours and 48 hours after 1 pg/mL MDP-treated zebrafish nod2 +/+ , nod2 +/sa21011 or no 2 sa21011/sa21011 larvae.
  • FIGs. 3A-3I show that single and recurrent DSS injury defines NOD2-dependent effects on gene expression and mesenchymal clusters, with myeloid and stromal pathway analyses implicating STAT3.
  • 3C shows relative gene expression 24 hours post IX DSS and 2X DSS injury of nod2 +/+ , nod2 +/mss13 or n od2 mssl3/mss13 zebrafish larvae.
  • FIG. 3D depicts UMAP showing joint clustering of stromal and myeloid populations from untreated and DSS-treated zebrafish larval intestines, in the nod2 +/+ and no ⁇ TM ⁇ 133 TM 813 backgrounds.
  • FIG. 3E is a heatmap showing single-cell expression of the top 5 representative marker genes per cluster (rows) in each cluster (columns). Expression is Unique Molecular Identifier (UMI) counts.
  • FIG. 3F shows violin plots for given genes significantly upregulated upon DSS-treatment in nod2 +/+ and nO d2 mssl3/mss13 background zebrafish larvae, as seen by scRNAseq expression.
  • FIG. 3G depicts feature plots to show localized expression of key transcripts in nod2 mss13 mutant larvae from scRNA seqmyeloid and stromal populations (log normalized expression).
  • FIG. 3H shows percentage of stromal and myeloid populations out of total larval intestinal cells sequenced comparing cells from nod2 +/+ and nod2 mss13 -DSS treated larvae.
  • FIG. 31 shows circos plots revealing transcription factors WT1 and STAT3, from ingenuity pathway analysis, upstream of gene signature enriched in activated fibroblasts and inflammatory macrophages from N0D2 risk allele carriers vs. wildtype carriers in scRNAseq ileal dataset.
  • FIGs. 4A-4I show that gpl30 inhibition rescues key members of the aberrant myeloid- stromal niche.
  • FIG. 4A is a schematic of gpl30 signaling. IL6R and IL11R must dimerize with gpl30 to elicit downstream signaling. OSMR and LIFR contain intracellular signaling subunits, but also dimerize with gpl30 to signal. Bazedoxifene specifically competes with receptor ligands (IL6, IL11, OSM, LIF) for gpl30 to inhibit signaling.
  • FIG. 4A is a schematic of gpl30 signaling.
  • IL6R and IL11R must dimerize with gpl30 to elicit downstream signaling.
  • OSMR and LIFR contain intracellular signaling subunits, but also dimerize with gpl30 to signal.
  • Bazedoxifene specifically competes with receptor ligands (IL6, IL11, OSM, LIF) for
  • FIG. 4B shows log2 microarray expression data from Arijs el al., 2009 dataset, showing expression of gpl30-associated genes in anti-TNF (Infliximab) treated patients. Bars labeled “A” indicate Infliximab responders (before and after treatment), and bars labeled “B” indicate Infliximab non-responders (before and after treatment).
  • FIG. 4C shows secretion of key proteins from CD14+ PBMCs differentiated from OX N0D2 carriers vs. 2X N0D2 mutation carriers as measured via Luminex (pg/mL).
  • FIG. 4D shows feature plots of apeledoxifene target genes in stromal and myeloid cells in scRNAseq of DSS-treated intestinal larvae (log normalized expression).
  • FIG. 4E shows violin plots for given genes significantly upregulated upon DSS-treatment, or down-regulated by DSS and BZA co-treatment (log normalized expression). Asterisks indicate genes that were significantly down-regulated only in the nod2 mss13 larvae.
  • FIG. 4F shows percentage of stromal and myeloid populations out of total larval intestinal cells sequences, comparing cells from DSS-treated larvae and DSS + BZA co-treated larvae. Asterisks indicate populations that were reduced only in the nod2 mss13 larvae.
  • FIG. 4H shows larval intestine length measured after 0.075% DSS, or 10 pM BZA + 0.075% DSS treatment 24 hours post-lX and 2X treatments, data are mean ⁇ SEM. *P ⁇ 0.05; **P ⁇ 0.01 (paired Wilcoxon signed rank test).
  • FIG. 41 provides RT-PCR data showing relative gene expression 24 hours post IX DSS+BZA and 2X DSS+ BZA co-treatment vs.
  • FIG. 5 shows a proposed model for Crohn’s disease pathogenesis and treatment pathways. Model to show proposed mechanism of Crohn’s disease pathophysiology under specific genetic and cellular constraints.
  • N0D2 risk allele carriers develop aberrant fibroblast-macrophage homeostasis and differentiation over time.
  • CD patients increase production of antibodies (ASCA, CBir) to contain infection caused by increased bacterial load and elevate inflammatory mediators (cytokines and chemokines such as IL11, CXCL13, 1L6, CCL2, OSM). Patients carrying N0D2 risk alleles will upregulate a specific pathogenic activated fibroblast and macrophage signature with disease development.
  • ASCA antibodies
  • CBir cytokines and chemokines
  • IL11, CXCL13, 1L6, CCL2, OSM inflammatory mediators
  • Patients carrying N0D2 risk alleles will upregulate a specific pathogenic activated fibroblast and macrophage signature with disease development.
  • FIG. 6A-6I show single-cell RNA seq from human CD ileum and DSS-injured zebrafish intestinal larvae.
  • FIG. 6A is a heatmap showing relative expression values of genes (columns) across myeloid and stromal cell sub
  • FIG. 6C shows gene ontology analysis from the upregulated gene set in activated fibroblasts from the inflamed ileum. The number of genes per biological process is shown in parentheses. Processes are ranked from top to bottom in decreasing order of -log(p-value).
  • FIG. 6F depicts thickness sections from involved CD strictured sections showing expression of WT1, PDGFRA and CD 14 in specified cells.
  • FIG. 6G provides RT-PCR data of relative gene expression of zebrafishspecific myeloid genes 24h post IX DSS-treatment of zebrafish nod2 +/+ and nod2 sa21011 ' larvae, comparing intestinal vs. carcass expression.
  • n 3 biological replicates (3 clutches, 10- 15 larvae per genotype per clutch), data are mean ⁇ SEM. *P ⁇ 0.05; **P ⁇ 0.01 (paired Student’s /-test).
  • FIG. 6H shows scRNAseq of uninjured and DSS-treated zebrafish larval intestines from nod2 +/+ and nod2 mss13 backgrounds.
  • UMAP shows joint clustering of 30,069 cells revealing 32 unique clusters (top). The top 5 representative markers for each cluster are shown (rows) (bottom).
  • FIG. 61 depicts a UMAP showing separation of clusters between human-zebrafish species integration via scRNAseq (top); the top 3 representative markers for each cluster are shown (rows) (bottom).
  • Row names are gene names, and columns are designated cell types, Expression is UMI counts per gene per cell.
  • FIGs. 7A-7F show that NOD2 deficiency enhances collagen-high expressing cell differentiation from CD 14+ monocytes.
  • FIG. 7A shows morphological quantification of CD14+ CD16- PBMC differentiation from N0D2 WT/WT or N0D2 MT/MT cells, upon stimulation with 2.5 pg/mL Pam3Cys, 0.5 pg/mL Lipid A, and 1 pg/mL MDP via ImageJ. Classification of categories is as follows: spindle: 0-0.29, intermediate: 0.3-0.64, round: 0.65-1.
  • FIG. 7B shows representative morphological images of “spindle”, “intermediate”, and “round” cells in NOD2 WT, IX and 2X carriers unstimulated or treated with 1 pg/mL MDP, or 0.5 pg/mL Lipid A, or 2.5 pg/m Pam3Cys.
  • FIG. 7B shows representative morphological images of “spindle”, “intermediate”, and “round” cells in NOD2 WT, IX and 2X carriers unstimulated or treated with 1 pg/mL MDP, or 0.5 pg/mL Lipid A, or 2.5 pg/m Pam3Cys.
  • FIG. 7C shows the quantification of confocal staining of MPEG1, MFAP4 and COL5A1 in N0D2 WT CD14+ differentiated cells. Data are mean ⁇ SEM of corrected cellular fluorescence as measured by integrated density via ImageJ. ***P ⁇ 0.001; (2-way ANOVA test).
  • FIG. 7D is a schematic of CD14+ CD16- PBMCs isolated from healthy N0D2 carriers and non-carriers, followed by differentiation assay (left).
  • FIG. 1 pg/mL muramyl dipeptide (MDP)-treated CD14+CD16- PBMCs after 2 weeks of differentiation from N0D2 WIYWT or N0D2 MT/MT carriers, relative to unstimulated cells. n 5 biological replicates (right), data are mean ⁇ SEM.
  • 7F shows secreted protein amount (pg/mL), as measured by Luminex, from unstimulated, 0.5 pg/mL Lipid A, 2.5 pg/mL Pam3Cys, or 1 pg/mL MDP- stimulated PBMCs as measured via Luminex.
  • FIGs. 8A-8E show staining of key fibrotic protein deposition in zebrafish larvae and human ileal stricture resections.
  • FIG. 8A shows Nod2 expression as assessed by western blotting to show loss of protein levels in nod2 sa21011 and nod2 mss13 CRISPR mutant zebrafish larvae. Larvae were untreated and protein was collected at 6 days post fertilization.
  • FIG. 8B shows a UMAP of myeloid and stromal clusters from joint clustering of zebrafish scRNAseq larval cells, grouped by nod2 +/+ , and nod2 mss13 genotypes.
  • FIG. 8A shows Nod2 expression as assessed by western blotting to show loss of protein levels in nod2 sa21011 and nod2 mss13 CRISPR mutant zebrafish larvae. Larvae were untreated and protein was collected at 6 days post fertilization.
  • FIG. 8B shows a
  • FIG. 8C shows N0D2 mutation information of patients in ileal CD cohort, used for differential expression analysis between activated and non-activated fibroblast and macrophage clusters.
  • FIG. 8D shows transcription factors from Ingenuity Pathway Analysis upstream of genes enriched in activated fibroblasts and inflammatory macrophages from N0D2 risk allele vs. wildtype carriers. P-values were determined by IPA analysis for transcription factor regulation of genes in differential expression analysis.
  • FIG. 8E depicts feature plots to show localized expression of key transcripts in nod2 WT/WT larvae from scRNA seq myeloid and stromal populations (log normalized expression). [0033] FIGs.
  • FIG. 9A-9I show that gpl30 blockade by apeledoxifene ameliorates fibrosis signaling and poses a supplemental approach to anti-TNF therapy.
  • FIG. 9A shows log2 microarray expression data from Arijs et al., 2009 dataset, showing expression of activated fibroblast-associated genes in anti-TNF (Infliximab) treated patients. Bars labeled “A” indicate Infliximab responders (before and after treatment), and bars labeled “B” indicate Infliximab non-responders (before and after treatment), data are mean ⁇ SEM. *P ⁇ 0.05; **P ⁇ 0.01, ***P ⁇ 0.001, ****P ⁇ 0.0001 (paired Student’s /-test). FIG.
  • 9B shows morphological quantification of CD14+ CD16- PBMCs differentiation from NOD2 W1/W1 or N0D2 MT/MT , unstimulated, stimulated with 0.5 pg/mL MDP alone, or co-stimulated with 0.5 pg/mL MDP + 1 pM Bazedoxifene.
  • FIG. 9C shows secreted protein amount (pg/mL), as measured by Luminex, from unstimulated, 0.5ug/mL MDP, 0.5ug/mL MDP + luM Bazedoxifene, or 0.5ug/mL MDP + 0.05ug/mL a-gpl30 -stimulated PBMCs as measured via Luminex.
  • n 2 carriers for each genotype, data are mean ⁇ SEM.
  • FIG. 9D shows larval intestinal length of 2X-DSS or DSS + BZA co-treated nod2 +/+ , nod2 +/ ⁇ , and nod2' / ' fish.
  • FIG. 9E shows percentage of stromal and myeloid populations out of total larval intestinal cells sequenced, comparing cells from DSS- treated larvae and DSS + BZA co-treated larvae. Dashed boxes indicate cell populations that were down-regulated only in nod2' / ' DSS-treated larvae.
  • FIG. 9F provides RT-PCR data of relative gene expression 24 hours post- IX DSS + BZA and 2X DSS + BZA co-treatment of nod2 +/+ , nod2 +/ ⁇ or nod2' / ' zebrafish larvae.
  • FIG. 9G shows violin plots for given genes significantly upregulated upon DSS -treatment, or down-regulated by DSS and BZA co-treatment in nod2 mss13 larvae (log normalized expression).
  • FIG. 9H shows violin plots for given genes significantly upregulated upon DSS -treatment, or down-regulated by DSS and BZA co-treatment in nod2' / ' larvae (log normalized expression).
  • 91 depicts hematoxylin and eosin staining of DSS and DSS+ BZA-co-treated nod2 +/+ and noddTM ⁇ 13 zebrafish larvae.
  • FIGs. 10A-10F show that treatment with apeledoxifene during and after injury ameliorates myeloid- stromal activation.
  • FIG. 10B provides a schematic to illustrate treatment and genotype groups of zebrafish larval intestines processed for single-cell RNA sequencing (scRNAseq). 0.075% DSS and lOuM BZA was used in each case. scRNAseq was performed using the 10X Genomics platform.
  • FIG. 10C provides a Uniform Manifold Approximation and Projection (UMAP) to show joint clustering of 11,104 stromal and myeloid cells (from a total of 45,324 immune, epithelial, and stromal cells), revealing 18 unique clusters of myeloid and stromal subpopulations.
  • UMAP Uniform Manifold Approximation and Projection
  • FIG. 10D shows the percent of cells (total number of cells per cluster in a sample/total number of cells per sample) contributed to each cluster by treatment group. Dotted boxes are shown to highlight cell populations that contracted upon BZA treatment (during or post injury).
  • FIG. 10F provides a heatmap illustrating the top six unique transcription factors expressed by fibroblast and endothelial cell populations (rows). Expression is log normalized.
  • FIGs. 11A-11F show that gpl30 and associated expression on PDGFRAhi fibroblasts, inflammatory monocytes, and CD36hi endothelial cells reveals druggable subpopulations.
  • FIG. 11A provides a heatmap illustrating an activated myeloid-stromal panel of genes in residential fibroblasts and activated fibroblasts (PDGFRAhi and PDPNhi) (rows). Numbers (in parentheses) indicate proposed lineage trajectory of populations. Expression is log normalized.
  • FIG. 11B provides a table to show the top upstream regulators from Ingenuity Pathway Analysis upstream of genes enriched in PDGFRAhi vs PDPNhi activated fibroblasts.
  • FIG. 11D provides a feature plot to illustrate gpl30 (adt_CD130) protein expression.
  • FIG. HE provides ridge plots to show RNA (top, IL6ST) vs.
  • FIG. HF provides a scatter plot to show concordance between PDPN and PDGFRA protein expression (top left), PDPN and gpl30 protein expression (top right), PDGFRA and gpl30 protein expression (bottom left), and CXCR5 and gpl30 expression (bottom right).
  • FIGs. 12A-12H show identification of a broad molecular signature, found both in tissue and in PBMCs, that identifies anti-TNF and Ustekinumab failure, and can be ameliorated with Bazedoxifene treatment.
  • Genes are those upregulated in mucosal biopsies from anti-TNF non-responding Crohn’s disease patients from Arijs et al., 2009 before treatment institution. Genes highlighted represent those enriched in classical and non-classical monocytes, and in platelets, that are also conserved in ileal CD tissue. FIG.
  • FIG. 12C provides a dotplot to show gene expression of significantly upregulated genes from Arijs et al., 2009 anti-TNF non-responders, in zebrafish larvae untreated or treated with 2X DSS or 2X DSS + BZA (expression is log-normalized).
  • FIG. 12D shows percentage of tnfrsfla+ expressing and tnfrsf lb+ expressing cells (total number of gene+ cells per cluster in a sample/total number of cells per sample) from scRNAseq of zebrafish larvae untreated, treated with DSS and/or BZA. Data are mean ⁇ s.e.m. *P ⁇ 0.05, **P ⁇ 0.01. FIG.
  • FIG. 12E shows principal component (PC) analysis of the significantly upregulated genes from Arijs et al., 2009 before anti-TNF treatment institution in patients recovered, not recovered, and those who developed inflammation from the ustekinumab-treated patients in the UNITI trial (top; UNITI 1 cohort, bottom; UNITI 2 cohort).
  • FIG. 12F provides a timeline showing Crohn’s disease “patient 13” (ref. pl3 from Martin et al., 2019) treatment and disease trajectory from 2017 to 2021. Green check mark indicates treatment success and reduced mucosal inflammation after Ustekinumab treatment (top). Cell percentages in “patient 13” ileum and PBMCs from scRNAseq results.
  • FIG. 12H shows gene expression fold change in treated relative to untreated patients.
  • FIG. 13 shows identification of a gene panel to predict potential apeledoxifene success in anti-TNF non-responders.
  • Data from Arjis et al., 2009 was examined, and 126 genes were found to be upregulated in anti-TNF non-responders before treatment started. Previous data showed gpl30 and activated fibroblast genes in anti-TNF responders after treatment.
  • FIG. 14 provides further data showing identification of a gene panel to predict potential apeledoxifene success in anti-TNF non-responders. Many of these genes are expressed in inflammatory macrophages, activated fibroblasts, lymphatics, and CD36+ endothelial cells, highlighting the importance of the myeloid- stromal interaction, and also the perivascular niche.
  • FIG. 15 provides further data showing identification of a gene panel to predict potential apeledoxifene success in anti-TNF non-responders.
  • Some of the non-responder genes in the blood of ileal CD patients can be identified, implicating monocytes (classical and non-classical) and platelets.
  • FIG. 16 shows data from a case study of a patient (“pl 3”) who failed anti-TNF therapy but responded to ustekinumab. Implicated populations include activated DCs, DC1, and inflammatory macrophages in tissue samples (left), and plasmablasts, pDCs, B cells, eDCs, and classical monocytes in PBMCs (right).
  • FIG. 17 provides a schematic showing the hypothesized role of dendritic cells (DCs) in treatment response and non-response.
  • DCs dendritic cells
  • FIG. 19 shows RT-PCR gene expression timing of treatment with apeledoxifene in vivo. Co-treatment and post-DSS treatment with apeledoxifene reduce fibrotic and gpl30- family member induction most effectively.
  • FIG. 20 shows takeaways from single-cell RNA sequencing dataset. Joint clustering of 45,324 cells from untreated, DSS-treated, DSS + apeledoxifene co-treated, and DSS followed by apeledoxifene resolved 26 unique cell clusters (epithelial, innate immune, and stromal).
  • FIG. 21 provides additional data showing takeaways from single-cell RNA sequencing dataset related to timing of apeledoxifene in vivo. Key cell populations expand with DSS treatment and subsequently contract with DSS + apeledoxifene co-treatment. Cotreatment effects are more pronounced than post-treatment effects.
  • FIG. 22 shows identification of a gene panel to predict apeledoxifene success in anti- TNF non-responders.
  • Many of the anti-TNF non-response genes (before treatment in Arijs et al., 2009) are downregulated with DSS + apeledoxifene co-treatment, suggesting that elevation of this signature can be ameliorated by apeledoxifene treatment.
  • These effects are observed with some genes in DSS + apeledoxifene post-treatment, but effects are most pronounced with co-treatment.
  • FIG. 23 provides scatter plots to show unspliced and spliced proportions of mRNA expression per gene per cell from Crohn’s disease CDstromal scRNAseq dataset.
  • Dotted line indicates steady state ratio, where RNA velocity is indicated (z.e., how much an observation deviates from that steady-state line). Positive velocity indicates a gene is upregulated, which also indicates a higher un spliced: spliced ratio.
  • PDPN, IL6ST, and IL6 are all activated and have a positive velocity among stromal cells.
  • IL6ST gpl30
  • the present disclosure relates to the discovery that loss of NOD2 function leads to aberrant activated fibroblast and macrophage homeostasis.
  • the inventors have discovered that cross-talk between stromal and myeloid cells results in a transcriptional profile associated with resistance to anti-TNF therapies, which are frequently used in the treatment of Crohn’s disease.
  • gpl30 inhibitors such as apeldoxifene
  • These therapeutics agents are additionally capable of restoring sensitivity to anti-TNF agents in anti-TNF non-responder patients.
  • Example 1 it has been discovered that the anti-TNF non-responder phenotype may be recognized based on detection of the gene signature of Table 1 in Example 1.
  • Example 1 it is demonstrated that gpl30 inhibition with apeledoxifene ameliorates pathogenic transcriptional activation of myeloid and stromal cells of the genes of Table 1, which represents a transcriptional signature (observed in non-responders even before anti-TNF treatment institution) that can be identified prior to treatment with a gpl30 inhibitor.
  • This transcriptional signature may be probed and detected to identify not only anti-TNF non- responders, but also ustekinumab non-responders, thereby identifying suitable candidates for treatment with a gpl30 inhibitor (e.g., apeledoxifene) which causes the dampening of the transcriptional signature thereby also restoration of such treated subjects to anti-TNF and/or ustekinumab treatment.
  • a gpl30 inhibitor e.g., ciprofene
  • the present disclosure provides methods, compositions, and kits for using gpl30 inhibitors as a means for treating Crohn’s disease, and for identifying anti-TNF and/or ustekinumab non-responding patients who would benefit from treatment with a gpl30 inhibitor. Accordingly, provided herein are methods for treating Crohn’s disease using gpl30 inhibitors. Also provided herein are methods for restoring sensitivity to anti-TNF and/or ustekinumab therapies in anti-TNF and/or ustekinumab non-responder subjects and methods for identifying such subjects. Further provided herein are kits and compositions for treating Crohn’s disease using a gpl30 inhibitor. In some embodiments, the gpl30 inhibitor is apeledoxifene.
  • terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise.
  • nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art.
  • the methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present disclosure unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein.
  • Crohn’s disease is a chronic inflammatory disorder that affects the gastrointestinal tract. It is considered an inflammatory bowel disease (IBD) (e.g., an inflammatory condition of the colon and small intestine). Symptoms of Crohn’s disease may include, but are not limited to, abdominal pain, diarrhea, blood in stool, mouth sores, reduced appetite, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and fatigue.
  • IBD inflammatory bowel disease
  • Crohn’s disease While definitive cause(s) of Crohn’s disease are presently poorly understood it is thought to be caused, at least in part, by environmental (e.g., diet, stress, external factors), immune, and bacterial factors, and is further believed to have a genetic component (as the disease is often observed in, or tends to run in, families) which may make subject more susceptible to the disease.
  • the disease afflicts men and women nearly equally and while it can occur (e.g., present) at any age, it is most prevalently observed (e.g., diagnosed) in adolescents and adults in the age group of 15 - 35 years of age.
  • Other risk factors that are believed to be associated with Crohn’s disease are, without limitation, ethnicity, cigarette use (e.g., tobacco use/inhalation), and nonsteroidal anti-inflammatory medication use.
  • Crohn’s disease the immune system will often act aberrantly and initiate a response to harmless or beneficial bacteria present in a subject. This response often creates or triggers inflammation in the subject which can, among other things, lead to ulceration of an affected tissue (e.g., gastrointestinal tissue) and or thickening of the tissue.
  • an affected tissue e.g., gastrointestinal tissue
  • Other complications of Crohn’s disease include, without limitation, bowel obstruction, ulcers, fistulas, fissures, malnutrition, and colon cancer, as well as further complications that may come with the treatment of Crohn’s disease or any of the symptoms thereof.
  • the treatments for Crohn’s disease often are aimed at managing the symptoms through non- surgical interventions.
  • Medications for example, without limitation, may be anti-inflammatory drugs/compositions, immunomodulators, antibiotics, and/or biologies.
  • surgical intervention may be used to treat a subject with Crohn’s disease. It is estimated that approximately 75% of subjects diagnosed with Crohn’s disease will ultimately require surgery at some point in their life to treat the disease. Surgery often will be used to remove damaged portions of the affected tissue (e.g., gastrointestinal tract) and/or repair other damaged tissue.
  • a “subject” to which administration is contemplated refers to a human (z.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g., young adult, middle-aged adult, or senior adult)) or non-human animal.
  • the non-human animal is a mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey), commercially relevant mammal (e.g., cattle, pig, horse, sheep, goat, cat, or dog), or bird (e.g., commercially relevant bird, such as chicken, duck, goose, or turkey)).
  • primate e.g., cynomolgus monkey or rhesus monkey
  • commercially relevant mammal e.g., cattle, pig, horse, sheep, goat, cat, or dog
  • bird e.g., commercially relevant bird, such as
  • the non-human animal is a fish, reptile, or amphibian.
  • the non- human animal may be a male or female at any stage of development.
  • the non-human animal may be a transgenic animal or a genetically engineered animal.
  • the term “patient” refers to a human subject in need of treatment of a disease.
  • a subject is human.
  • a patient is human.
  • a subject or patient “in need” of treatment of a disease or disorder includes, without limitation, those who exhibit any risk factors or symptoms of a disease or disorder. Such risk factors or symptoms may be, for example and without limitation, any of those associated with Crohn’s disease as discussed herein.
  • a subject in need of treatment is one who exhibits characteristics of an anti- TNF non-responder, as discussed herein.
  • an anti-TNF non-responder which is a term of art, generally known to refer to a subject who does not initially benefit from anti- TNF therapy or treatment for Crohn’s disease or who has a lessened benefit or no benefit resulting from the anti-TNF therapy or treatment after some duration of time following the initial anti-TNF therapy or treatment.
  • Anti-TNF therapies include small molecules (e.g., thalidomide, lenalidomide, and pomalidomide), as well as monoclonal antibodies.
  • an anti-TNF non-responder is a primary anti-TNF non-responder.
  • Primary anti-TNF non-responders are known in the art and generally referred to as subjects who do not benefit from anti-TNF therapy for Crohn’s disease at any point, e.g., they do not experience a benefit upon the first, or any subsequent, treatment received.
  • an anti-TNF non-responder is a secondary anti-TNF non-responder.
  • Secondary anti-TNF non-responders are known in the art and generally referred to as subjects who initially benefit from anti-TNF therapy for Crohn’s disease when such therapy is initiated, but subsequently lose response while treatment is continued (for example, without limitation, subjects who show or experience a benefit upon the first treatment, but do not show or experience a benefit upon subsequent treatments, or as great a benefit as the first treatment).
  • a subject may also be termed an anti-IL12p40/IL23R therapy non-responder, referring to a subject who does not benefit from treatments targeting IL12p40/IL23R, such as ustekinumab.
  • treatment refers to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease described herein (e.g., Crohn’s disease).
  • treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed (e.g., prophylactically (as may be further described herein) or upon suspicion or risk of disease).
  • treatment may be administered in the absence of signs or symptoms of the disease.
  • treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of a history of symptoms). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence.
  • the terms “prevent,” “preventing,” and “prevention” refer to a prophylactic treatment of a subject who is not and was not diagnosed (as of the time of treatment, or upon which the treatment was predicated) with a disease or other condition but is at risk of developing, or suspected of having, the disease or other condition (or developing it again).
  • the subject is at a higher risk of developing the disease or at a higher risk of regression of the disease than an average healthy member of a population.
  • a subject may be at higher risk of disease if they exhibit any risk factors or symptoms of the disease.
  • risk factors or symptoms may be, for example and without limitation, any of those associated with Crohn’s disease as discussed herein.
  • risk factors or symptoms include genetic characteristics, abdominal pain, diarrhea, blood in stool, mouth sores, reduced appetite, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and/or fatigue.
  • administer refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a compound described herein (e.g., a gpl30 inhibitor such as apeledoxifene or a derivative thereof), or a composition thereof, in or on a subject.
  • a compound described herein e.g., a gpl30 inhibitor such as apeledoxifene or a derivative thereof
  • a composition thereof in or on a subject.
  • a “therapeutically effective amount” of a compound described herein is an amount sufficient to provide a therapeutic benefit in the treatment of a condition (e.g., Crohn’s disease) or to delay or minimize one or more symptoms associated with the condition.
  • a therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of the condition.
  • the term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms, signs, or causes of the condition, and/or enhances the therapeutic efficacy of another therapeutic agent.
  • a therapeutically effective amount is an amount sufficient for inhibition of gpl30. In certain embodiments, a therapeutically effective amount is an amount sufficient for treating Crohn’s disease. In certain embodiments, a therapeutically effective amount is an amount sufficient for inhibition of gpl30 and treating Crohn’s disease.
  • an effective amount of a compound for administration one or more times a day to a 70 kilogram (kg) adult human comprises about 0.0001 milligrams (mg) to about 3000 mg, about 0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg, about 0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg, of a compound per unit dosage form.
  • the terms “signature,” “gene signature,” and “gene expression signature” refer to a single or combined group of genes in a cell with a uniquely characteristic pattern of gene expression.
  • a characteristic pattern of gene expression may occur as a result of a disease or disorder (e.g., Crohn’s disease). Such a characteristic pattern may also occur as a result of the development of resistance to a treatment for a disease or disorder (e.g., resistance to anti-TNF therapies exhibited by anti-TNF non-responder subjects, as discussed herein).
  • Gene signatures may be used for prognostic, diagnostic, and predictive applications (e.g., such signatures may be used to predict the survival or prognosis of an individual with a disease, or for differentiation between subtypes of a disease). Gene signatures may be observed in any cell type. In some embodiments, gene signatures are observed in fibroblasts (for example, activated fibroblasts). In some embodiments, gene signatures are observed in macrophages (for example, inflammatory macrophages). In certain embodiments, a gene signature comprises a transcriptional profile. A transcriptional profile is a profile of expressed gene products in a given transcriptome. A specific transcriptional profile may be associated with a specific disease or disorder (e.g., Crohn’s disease). A specific transcriptional profile may also be associated with the development of resistance to a specific treatment for a disease or disorder (e.g., resistance to anti-TNF therapies exhibited by anti-TNF non- responder subjects, as discussed herein).
  • a gene signature comprises increased or decreased expression relative to a control sample of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more) genes selected from the group consisting of: TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTH
  • a “gpl30 inhibitor” is an inhibitor of glycoprotein 130.
  • Gpl30 is a transmembrane protein and a cytokine receptor within the IE-6 receptor family. It contains a WSXWS amino acid motif, which plays a role in ensuring correct protein folding and ligand binding.
  • Gpl30 is composed of five fibronectin type-III domains and one immunoglobulin-like C2-type domain in its extracellular portion.
  • Members of the IL-6, IL-11, OSMR, and LIFR families of receptors complex with gpl30 for signal transduction following cytokine engagement.
  • gpl30 After complexing with other proteins, gpl30 is phosphorylated on tyrosine residues, leading to association with JAK/Tyk tyrosine kinases and STAT protein transcription factors (e.g., STAT-3) and activation of downstream genes. Activation of downstream genes (e.g., STAT-3) results cell survival, pro-inflammatory/fibrotic cytokines, and pathogenic T cell activation, among other effects.
  • the effects of downstream signaling of gpl30 may be associated with development or worsening of the symptoms of a disease (e.g., Crohn’s disease) as discussed herein.
  • OSMR signaling plays a role in anti-TNF nonresponse, as discussed herein;
  • IL11 signaling plays a key role in fibrosis; and
  • IL6 signaling plays a key role in immune cell activation and proliferation.
  • STAT3 also plays a central role in regulating genes enriched in N0D2 risk allele carriers, as discussed herein.
  • Gpl30 inhibitors specifically compete with receptor ligands (e.g., IL6, IL11, OSM, and LIF) for gpl30 to inhibit signaling. As discussed herein, gpl30 inhibitors may also inhibit downstream effects associated with gpl30 signaling (e.g., effects associated with Crohn’s disease symptoms and/or resistance to anti-TNF therapy as discussed herein).
  • a gp!30 inhibitor is apeldoxifene, having the structure:
  • a gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of apeledoxifene.
  • a gpl30 inhibitor is apeledoxifene.
  • a gpl30 inhibitor is a derivative of apeledoxifene.
  • the term “inhibit” or “inhibition” in the context of an enzyme refers to a reduction in the activity of the enzyme.
  • the term refers to a reduction of the level of activation or signaling activity, e.g., gpl30 activity, to a level that is statistically significantly lower than an initial level, which may, for example, be a baseline level of activity.
  • a baseline activity level may be established by measuring (e.g., assessing, quantifying, observing) the activity level in a subject without treatment or prior to treatment, or may established from a group of subjects without treatment or prior to treatment. Additionally, a baseline activity level may be established through evaluation of measurements in a database, through analysis of subject histories, or any other means known or acceptable in the art.
  • “inhibit” or “inhibition” refers to a reduction (as compared to a baseline activity level, and as shall be understood when referring to a “reduction” herein) of the level of enzyme activity, e.g., gpl30 activity, to a level that is less than 75%, less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1%, less than 0.01%, less than 0.001%, or less than 0.0001% of an initial level, which may, for example, be a baseline level of activity.
  • pharmaceutically acceptable salt refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference.
  • Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases.
  • Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid or with organic acids, such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods known in the art such as ion exchange.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid
  • organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods known in the art such as ion exchange.
  • salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate
  • Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N + (CI-4 alkyl)4- salts.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
  • prodrug refers to a compound that has cleavable groups and becomes, by solvolysis or under physiological conditions, one of the compounds described herein (e.g., a gpl30 inhibitor such as apeledoxifene or a derivative thereof), which are pharmaceutically active in vivo.
  • a gpl30 inhibitor such as a gpl30 inhibitor
  • Such examples include, but are not limited to, choline ester derivatives and the like, and N- alkylmorpholine esters and the like.
  • Other derivatives of the compounds described herein have activity in both their acid and acid derivative forms, but in the acid sensitive form often offers advantages of solubility, tissue compatibility, or delayed release in the mammalian organism (see, Bundgard, H., Design of Prodrugs, pp.
  • Prodrugs include acid derivatives well-known to practitioners of the art, such as, for example, esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides. Simple aliphatic or aromatic esters, amides, and anhydrides derived from acidic groups pendant on the compounds described herein are particular prodrugs. In some cases, it is desirable to prepare double ester type prodrugs such as (acyloxy)alkyl esters or ((alkoxycarbonyl)oxy)alkylesters.
  • Ci-Cs alkyl, C2-C8 alkenyl, C2- Cs alkynyl, aryl, C7-C12 substituted aryl, and C7-C12 arylalkyl esters of the compounds described herein may be preferred.
  • the terms “tautomers” and “tautomeric” refer to two or more interconvertible compounds resulting from at least one formal migration of a hydrogen atom and at least one change in valency (e.g., a single bond to a double bond, a triple bond to a single bond, or vice versa). The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH.
  • Tautomerizations (z.e., the reaction providing a tautomeric pair) may be catalyzed by acid or base.
  • Exemplary tautomerizations include keto-to-enol, amide-to-imide, lactam-to-lactim, enamine-to-imine, and enamine-to-(a different enamine) tautomerizations.
  • An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light. Enantiomers are designated as dextrorotatory or levorotatory (z.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either an individual enantiomer or as a mixture thereof.
  • a mixture containing equal proportions of the enantiomers is called a “racemic mixture.”
  • Compounds described herein e.g., gpl30 inhibitors such as apeldoxifene or a derivative thereof
  • the compounds described herein can be in the form of an individual enantiomer, diastereomer, or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer.
  • polymorph refers to a crystalline form of a compound (or a salt, hydrate, or solvate thereof). All polymorphs have the same elemental composition. Different crystalline forms usually have different X-ray diffraction patterns, infrared spectra, melting points, density, hardness, crystal shape, optical and electrical properties, stability, and solubility. Recrystallization solvent, rate of crystallization, storage temperature, and other factors may cause one crystal form to dominate. Various polymorphs of a compound can be prepared by crystallization under different conditions.
  • co-crystal refers to a crystalline structure comprising at least two different components (e.g., a compound disclosed herein, such as a gpl30 inhibitor, and an acid), wherein each of the components is independently an atom, ion, or molecule. In certain embodiments, none of the components is a solvent. In certain embodiments, at least one of the components is a solvent.
  • a co-crystal of a compound disclosed herein and an acid is different from a salt formed from a compound disclosed herein and the acid.
  • a compound disclosed herein is complexed with the acid in a way that proton transfer (e.g., a complete proton transfer) from the acid to a compound disclosed herein easily occurs at room temperature.
  • a compound disclosed herein is complexed with the acid in a way that proton transfer from the acid to a compound disclosed herein does not easily occur at room temperature.
  • Cocrystals may be useful to improve the properties (e.g., solubility, stability, and ease of formulation) of a compound disclosed herein.
  • solvate refers to forms of the compound, or a salt thereof, that are associated with a solvent, usually by a solvolysis reaction. This physical association may include hydrogen bonding.
  • solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like.
  • the compounds described herein e.g., gpl30 inhibitors such as apeldoxifene or a derivative thereof
  • Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non- stoichiometric solvates.
  • the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid.
  • “Solvate” encompasses both solution-phase and isolatable solvates.
  • Representative solvates include hydrates, ethanolates, and methanolates.
  • hydrate refers to a compound that is associated with water.
  • the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R x H2O, wherein R is the compound, and x is a number greater than 0.
  • a given compound may form more than one type of hydrate, including, e.g., monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R O.5 H2O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R-2 H2O) and hexahydrates (R-6 H2O)).
  • monohydrates x is 1
  • lower hydrates x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R O.5 H2O)
  • polyhydrates x is a number greater than 1, e.g., dihydrates (R-2 H2O) and hexahydrates (R-6 H2O)
  • a apeledoxifene derivative in reference to apeledoxifene refers to any structural analog of apeledoxifene. A person of ordinary skill in the art would understand how to design and make such derivatives. Some apeledoxifene derivatives are also known in the art, including, for example, those described in Chen, S. el al. In Vitro and in Silico Analyses of the Inhibition of Human Aldehyde Oxidase by Bazedoxifene, Lasofoxifene, and Structural Analogues. J. Pharmacol. Exp. Ther. 2019, 371(1 ), 75-86, which is incorporated herein by reference. In some embodiments, a apeledoxifene derivative is lasofoxifene.
  • a bazedoxifene derivative is raloxifene. In some embodiments, a apeledoxifene derivative is des(l-azepanyl)ethylbazedoxifene. In some embodiments, a apeledoxifene derivative is apeledoxifene A-oxidc.
  • the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof.
  • the method comprises administering to a subject a therapeutically effective amount of a gpl30 inhibitor.
  • administering a gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in a subject (e.g., wtl ; IL11-, tgfbla-, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof).
  • administering the gpl30 inhibitor decreases expression of wtl.
  • administering the gpl30 inhibitor decreases expression of IL11. In some embodiments, administering the gpl30 inhibitor decreases expression of tgfbla. In some embodiments, administering the gpl30 inhibitor decreases expression of cxcll3. In some embodiments, administering the gpl30 inhibitor decreases expression of mmp9. In some embodiments, administering the gpl30 inhibitor decreases expression of pdpn. In some embodiments, administering the gpl30 inhibitor decreases expression of chi3ll. In some embodiments, administering the gpl30 inhibitor decreases expression of pdgfra.
  • the disclosure relates to a method of modulating expression of a transcriptional profile, which is known as the profile of expressed gene products in a given transcriptome in relation to a disease or disorder (e.g., a profile comprising one or more transcriptional regulators selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof) in a subject by administering a therapeutically effective amount of a gpl30 inhibitor.
  • a transcriptional profile results from cross-talk between myeloid and stromal cells.
  • expression of a transcriptional profile is modulated to prevent activation of fibroblasts and/or inflammatory macrophages.
  • a transcriptional profile is modulated by inhibiting expression of one or more transcriptional regulators. In some embodiments, a transcriptional profile is modulated by promoting one or more transcriptional regulators. In some embodiments, a transcriptional profile is modulated by inhibiting expression of one or more transcriptional regulators and promoting one or more transcriptional regulators. In some embodiments, a transcriptional regulator is WT1. In some embodiments, a transcriptional regulator is STAT3. In some embodiments, a transcriptional regulator is TWIST 1. In some embodiments, a transcriptional regulator is CEBPB. In some embodiments, the gpl30 inhibitor is apeledoxifene or a derivative thereof.
  • the disclosure relates to a method of restoring sensitivity of a subject (e.g., a subject having a transcriptional profile associated with anti-TNF resistance) to anti- TNF agents.
  • restoring sensitivity in a subject can be achieved by administering a therapeutically effective amount of a gpl30 inhibitor (e.g., apeledoxifene) to a subject to decrease expression of activated fibroblast transcripts (e.g., wtl ; IL11 1 , tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or combination thereof) in a subject.
  • a gpl30 inhibitor e.g., a gpl30 inhibitor
  • activated fibroblast transcripts e.g., wtl ; IL11 1 , tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdg
  • a transcriptional profile results from cross-talk between myeloid and stromal cells.
  • the activated fibroblast transcript is wtl. In some embodiments, the activated fibroblast transcript is IL11. In some embodiments, the activated fibroblast transcript is tgfbla. In some embodiments, the activated fibroblast transcript is cxcll3. In some embodiments, the activated fibroblast transcript is mmp9. In some embodiments, the activated fibroblast transcript is pdpn. In some embodiments, the activated fibroblast transcript is chi3ll . In some embodiments, the activated fibroblast transcript is pdgfra. In some embodiments, a gpl30 inhibitor is apeledoxifene or a derivative thereof.
  • the disclosure relates to a method for identifying a Crohn’s disease subject in need of treatment.
  • identifying such a subject can be achieved by taking a sample from the subject and evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier (e.g., one or more signatures selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9).
  • a signature may be expression of a gene (e.g., gene product).
  • a signature may be expression of one or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST 1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly two, or two or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly three, or three or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly four, or four or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly five, or five or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly six, or six or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly seven, or seven or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly eight, or eight or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly nine, or nine or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of exactly ten, or ten or more of WTl, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of WT1.
  • a signature may be expression of all eleven of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
  • a signature may be expression of WT1.
  • a signature may be expression of IL11.
  • a signature may be expression of PDPN.
  • a signature may be expression of CHI3L1.
  • a signature may be expression of IL6.
  • a signature may be expression of OSM.
  • a signature may be expression of STAT3.
  • a signature may be expression of TWIST 1.
  • a signature may be expression of CEBPB. In some embodiments, a signature may be expression of CXCL13. In some embodiments, a signature may be expression of MMP9. In certain embodiments, the method further comprises administering a gpl30 inhibitor to the subject. In some embodiments, the gpl30 inhibitor is apeledoxifene or a derivative thereof.
  • a sample may be any sample from a subject.
  • a subject for example, without limitation, blood, skin, tissue, hair, saliva, bodily fluid, cells, or any other biological component from which the skilled artisan may ascertain, using techniques known and readily available in the art, the parameter being evaluated (e.g., enzyme activity, signaling activity, protein or nucleic acid expression, etc).
  • an evaluation shall refer to any analysis done to ascertain (e.g.. assess for presence or absence, quantify, establish the quality of (for example, compare for mutations or other aberrant property as compared to a wild-type or native version of the sample), or measure) a property of a sample.
  • the property may be of those stipulated herein, or of those which are readily apparent as related thereto by the skilled artisan.
  • the disclosure relates to a method for identifying and treating a Crohn’s disease subject in need of treatment.
  • identifying such a subject can be achieved by a) taking a sample from the subject; b) evaluating a sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier (e.g., one or more signatures selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9); and c) administering a gpl30 inhibitor to a subject.
  • a NOD2 risk allele carrier e.g., one or more signatures selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9
  • a signature may be expression of a gene (e.g., gene product).
  • a signature may be expression of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof.
  • a signature may be expression of WT1.
  • a signature may be expression of IL11.
  • a signature may be expression of PDPN.
  • a signature may be expression of CHI3L1.
  • a signature may be expression of IL6.
  • a signature may be expression of OSM.
  • a signature may be expression of STAT3. In some embodiments, a signature may be expression of TWIST 1. In some embodiments, a signature may be expression of CEBPB. In some embodiments, a signature may be expression of CXCL13. In some embodiments, a signature may be expression of MMP9. In some embodiments, the gpl30 inhibitor is apeledoxifene or a derivative thereof. [0086] In another aspect, the disclosure relates to a method of treating Crohn’s disease in a subject. In some embodiments, treating Crohn’s disease in a subject is accomplished by administering any of the compositions disclosed herein to the subject.
  • the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof, the method comprising: (i) evaluating a sample taken from the subject for a gene signature comprising increased or decreased expression relative to a control sample of one or more genes (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more of the genes) selected from the group consisting of TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL
  • the method further comprises administering a therapeutically effective amount of an anti-TNF therapy to the subject along with the gpl30 inhibitor. In some embodiments, the method further comprises administering a therapeutically effective amount of an anti-IL12p40/IL23R therapy (e.g., ustekinumab) to the subject along with the gpl30 inhibitor.
  • an anti-IL12p40/IL23R therapy e.g., ustekinumab
  • the control sample is a sample taken from an anti-TNF nonresponder subject. In some embodiments, the control sample is a sample taken from an anti- IL12p40/IL23R non-responder subject. In some embodiments, the control sample is a sample taken from a healthy subject who does not have Crohn’s disease. In some embodiments, the subject has not been administered an anti-TNF therapy or an anti-IL12p40/IL23R therapy previously. In some embodiments, the presence of the gene signature in the sample taken from the subject indicates that the subject is an anti-TNF non-responder and/or an anti- IL12p40/IL23R non-responder. In some embodiments, administering the gpl30 inhibitor to the subject restores expression levels of the one or more genes in the gene signature to the levels observed in the control sample.
  • a gpl30 inhibitor may be a selective estrogen receptor modulator (SERM).
  • a gpl30 inhibitor may be bazedoxifene.
  • a gpl30 inhibitor may be a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, cocrystal, solvate, hydrate, or derivative of apeledoxifene.
  • a subject is an anti-TNF non-responder (e.g., a primary anti-TNF non-responder or a secondary anti-TNF non-responder), or at risk for being an anti-TNF non-responder (e.g., at risk for being a primary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder).
  • administering a gpl30 inhibitor to a subject prevents collagen secretion or activation; prevents intestinal length shortening; or decreases gpl30 target gene activation in the subject.
  • any of the methods as described herein further comprise administering an anti-TNF treatment or therapy in conjunction with the administration of a gpl30 inhibitor.
  • the anti-TNF treatment or therapy is administered contemporaneously with the administration of the gpl30 inhibitor.
  • the anti-TNF treatment or therapy is administered prior to the administration of the gpl30 inhibitor.
  • the anti-TNF treatment or therapy is administered subsequent to the administration of the gpl30 inhibitor.
  • the anti-TNF therapy or treatment is formulated into a composition with a gpl30 inhibitor.
  • a gpl30 inhibitor used in conjunction with an anti-TNF therapy is apeledoxifene or a derivative thereof.
  • a gpl30 inhibitor is administered at least 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) time to a subject.
  • 1 e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more
  • a gpl30 inhibitor in any of the methods as described herein, is administered more than 1 time (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) to a subject.
  • a gpl30 inhibitor is administered hourly, daily, weekly, monthly, yearly, or any interval therein (e.g., twice a day, every other day, bi-weekly, bi-monthly, every 3 days, every 10 days, and all intervals envisioned by the skilled artisan).
  • an anti-TNF treatment or therapy is administered at least 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) time to a subject.
  • 1 e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more
  • an anti-TNF treatment or therapy is administered more than 1 time (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) to a subject.
  • an anti-TNF treatment or therapy is administered hourly, daily, weekly, monthly, yearly, or any interval therein (e.g., twice a day, every other day, biweekly, bi-monthly, every 3 days, every 10 days, and all intervals envisioned by the skilled artisan).
  • an anti-TNF treatment or therapy is administered on the same schedule and/or at the same interval as a gpl30 inhibitor. In some embodiments, an anti-TNF treatment or therapy is administered on a different schedule and/or at a different interval from a gpl30 inhibitor.
  • a compound described herein e.g., a gpl30 inhibitor such as apeledoxifene or a derivative thereof
  • the effective amount is a therapeutically effective amount.
  • the effective amount is an amount effective for treating Crohn’s disease in a subject in need thereof.
  • the effective amount is an amount effective for preventing Crohn’s disease in a subject in need thereof.
  • the effective amount is an amount effective for reducing the risk of developing Crohn’s disease in a subject in need thereof.
  • the effective amount is an amount effective for inhibiting the activity of gpl30 in a subject or cell.
  • the composition contains a second therapeutic agent (e.g., an anti-TNF agent).
  • an anti-TNF agent is a small molecule.
  • an anti-TNF agent is thalidomide.
  • an anti-TNF agent is lenalidomide.
  • an anti-TNF agent is pomalidomide.
  • an anti-TNF agent is a monoclonal antibody.
  • compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include bringing the compound(s) described herein (z.e., the “active ingredient(s)”) into association with a carrier or excipient, and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping, and/or packaging the product into a desired single- or multi-dose unit.
  • Compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a “unit dose” is a discrete amount of the composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage, such as one -half or one-third of such a dosage.
  • Relative amounts of the active ingredient(s), the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition described herein will vary, depending upon the identity, size, and/or condition of the subject treated, and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 100% (w/w) active ingredient(s).
  • compositions include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils.
  • Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweetening, flavoring, and perfuming agents may also be present in the composition.
  • the compounds and compositions provided herein can be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • enteral e.g., oral
  • parenteral intravenous, intramuscular, intra-arterial, intramedullary
  • intrathecal subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal
  • topical as by powders, ointments, creams, and/or drops
  • mucosal nasal,
  • Specifically contemplated routes are oral administration, intravenous administration (e.g., systemic intravenous injection), regional administration via blood and/or lymph supply, and/or direct administration to an affected site.
  • intravenous administration e.g., systemic intravenous injection
  • regional administration via blood and/or lymph supply e.g., via blood and/or lymph supply
  • direct administration e.g., direct administration to an affected site.
  • the most appropriate route of administration will depend upon a variety of factors, including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and/or the condition of the subject (e.g., whether the subject is able to tolerate oral administration).
  • the disclosure relates to a composition comprising a gpl30 inhibitor and an anti-TNF agent.
  • the composition comprises a therapeutically effective amount of the gpl30 inhibitor and the anti-TNF agent.
  • the composition comprises one or more pharmaceutically acceptable excipients.
  • the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • the gpl30 inhibitor is apeledoxifene.
  • the gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of apeledoxifene.
  • kits e.g., pharmaceutical packs.
  • the kits provided may comprise a composition or compound described herein and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container).
  • a container e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container.
  • provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of a composition or compound described herein.
  • the composition or compound described herein provided in the first container and the second container are combined to form one unit dosage form.
  • kits including a first container comprising compound(s) or composition(s) described herein.
  • the kits are useful for treating a disease (e.g., Crohn’s disease) in a subject in need thereof.
  • the kits are useful for preventing a disease (e.g., Crohn’s disease) in a subject in need thereof.
  • the kits are useful for reducing the risk of developing a disease (e.g., Crohn’s disease) in a subject in need thereof.
  • the kits are useful for inhibiting the activity of gp 130 in a subject or cell.
  • kits described herein further includes instructions for using the kit.
  • a kit described herein may also include information as required by a regulatory agency such as the U.S. Food and Drug Administration (FDA).
  • the information included in the kits is prescribing information.
  • a kit described herein may include one or more additional pharmaceutical agents described herein as a separate composition.
  • kits for treating or for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease comprises a gpl30 inhibitor and an anti-TNF agent.
  • a kit for diagnosing such subjects comprises reagents for performing any of the methods described herein and a gpl30 inhibitor.
  • a kit comprises any of the compositions disclosed herein.
  • Cross-talk between activated macrophages and fibroblasts is increasingly understood to drive susceptibility and complications of Crohn’s disease (CD) 3 , which most commonly affects the terminal ileum.
  • Design principles of stable macrophage-fibroblast systems have been reported, involving growth factors (e.g. CSF1, PDGFs) and autocrine and paracrine feedback loops 7 . Perturbations to stable systems can include genetic variation, especially major effect genes associated to human disease.
  • N0D2 alleles The highest effect risk alleles in European ancestry Crohn’s disease are loss-of-function N0D2 alleles, which are associated with an earlier age of onset, and increased risk for fibrostenotic complications 6,8 ; however mechanisms by which NOD2 loss drives fibrostenotic complications have not yet been fully elucidated. N0D2 genotype status has thus far not been reported to correlate with response to anti-TNF, the major agent used to treat moderate to severe Crohn’s disease 9,10 ; however major clinical factors, such as the timing of anti-TNF introduction 6,11 , may confound retrospective, observational studies.
  • anti-TNF non-response module includes IgG producing plasmablasts and activated T cells, the majority of transcripts in the model are expressed in activated macrophages and fibroblasts 3 .
  • Example 1 Inflamed ileal CD14+PDGFRA + pathogenic cells contribute to myeloid- stromal crosstalk
  • tissue resident macrophages in the gut are constantly replenished from peripheral blood monocytes 12 , and similar gene expression is observed between blood monocytes and tissue macrophages (FIG. 1A).
  • the activated fibroblast cluster is characterized by increased expression of PDPN, CHI3L1, MMP3, IL11 and WT1, with none of these genes highly expressed in peripheral blood mononuclear cells (PBMCs) or in the uninflamed tissue (FIG. 1A; FIG. 6A).
  • Abundantly expressed collagens, such as COL5A1 and COL1A1 are observed in both activated and non-activated tissue fibroblasts, with COL1A1 demonstrating relative induction in the activated fibroblast cluster.
  • Example 2 N0D2 deficiency enhances an activated fibroblast and inflammatory macrophase signature
  • N0D2 can sense bacterial components in fibroblasts during infection 18 and that N0D2, RIPK2 and XIAP are observed in activated fibroblast clusters within inflamed ileum (FIGs. 1A and 6B), it was hypothesized that the Crohn’s disease-associated N0D2 loss-of-function alleles drive aberrant differentiation and function of newly recruited CD 14+ PBMCs, resulting in relative induction of activated collagen-high expressing cells compared to classical macrophages 19 . These activated cells secrete chemokines and monokines, which in turn recruit additional CD 14+ PBMCs to the inflamed tissue.
  • the top 200 genes were selected that are differentially expressed between activated and non-activated scRNAseq clusters to develop “activated fibroblast” and “inflammatory macrophage” signature scores from terminal ileal bulk RNASeq for patients in the inception, pre-treatment pediatric RISK cohort 12 (see Methods).
  • fibroblast transcripts are upregulated when one or more copies of nod2 are lost upon stages of recovery in MDP-mediated injury. While in nod2 +/+ fish these transcripts recover to baseline during recovery phases, recovery was not achieved in nod2 +/sa21011 or nO d2 sa21011/sa21011 backgrounds after single or repetitive injury (FIG. 2F). Of note, pro-fibrotic transcription factor wtl remains elevated in no 2 sa21011/sa21011 larvae with repetitive MDP injury, indicating sustained upstream transcriptional activation. [0111] To more broadly test mechanisms and timing of repair and fibrotic responses, treated zebrafish larvae were treated with one and two doses of DSS.
  • transcripts were specifically expressed in wtl hl stromal cells, pdgfra hl stromal cells, mesothelial cells, and activated macrophages (FIG. 3G and FIG. 8E), and an expansion of these populations was observed in DSS-treated nod2 mss13 larvae vs. nod2 +/+ larvae (FIG. 3H). These results together reveal key transcripts and cell populations that are elevated in injury upon loss of Nod2 at the single-cell level.
  • Example 4 gpl30 inhibitor apeledoxifene ameliorates pathogenic stromal-myeloid activation
  • gpl30 IL6ST
  • FIG. 4A A blockade of the common cytokine receptor subunit, gpl30 (IL6ST)
  • BZA is a small molecule gpl30 inhibitor which has recently been repurposed to treat colorectal and pancreatic cancers in preclinical models 33-35 .
  • the Arijs d al. dataset which compares the bulk mucosal intestinal transcriptome before and after anti-TNF treatment 36 , was analyzed. Comparing post-treatment gene expression along the gpl30 pathway, marked induction of IL11, OSM, IL6, and IL6R was observed in treatment refractory patients compared to patients who responded to anti-TNF treatment (FIG. 4B); similar patterns were observed with CHI3L1 and PDPN. N0D2 expression decreased significantly in TNF responders, but not in non-responders, reflecting the induction of N0D2 transcript levels in activated macrophages (FIG. 9A).
  • TWIST1 is a key transcriptional inducer of activated fibroblasts 37 , it regulates genes differentially expressed by N0D2 risk allele carriers, and its expression is decreased with apeledoxifene treatment in livers from mice fed high fat diets 38 .
  • CD14+ PBMCs were differentiated from N0D2 wildtype or N0D2 homozygote risk allele carriers in the presence of MDP alone or MDP co-treated with apeledoxifene for 2 weeks.
  • Significant reduction in CXCL13, MMP3, and IL6 secretion was observed in co-treated PBMCs differentiated from N0D2 MT/MT carriers, as well as a reversion of spindle-cell morphology to round cell morphology (FIG. 4Cand FIG. 9B).
  • gpl30 (il6st) expression in the zebrafish scRNAseq stromal cell clusters was inspected, which revealed its broad expression in all subtypes present transmurally (FIG. 4D).
  • DSS + BZA co-treated larvae demonstrated significant reduction in key activated transcripts compared to DSS-treated larvae, with a significant reduction in cebpb, mmp9 and pdgfra in the nod2 mss13 background only (FIG. 4E and FIG. 9G-9H).
  • Activated transcripts such as IL11, OSM, WT1, PDPN, CXCL13, and CCL2 orchestrate autocrine and paracrine crosstalk between newly recruited monocytes and activated fibroblasts of the diseased ileum.
  • WT1 is a transcription factor that has been implicated in myofibroblast transformation in fibrotic lung disease 39 and in mesothelial and fibroblastic stromal cells in homeostasis and disease 40,41 .
  • WT1 is enriched in the CD14+PDGFRA+ subset of activated fibroblasts, enhanced in the in vitro and in vivo systems under NOD2-deficient backgrounds, and serves as an upstream transcriptional regulator of genes enriched in activated macrophages and fibroblasts from N0D2 risk allele carriers.
  • upstream transcriptional regulators of AOD2 w/ -associatcd genes STAT3 was highly significant in both cell types.
  • PGE2 production from PDGFRA+PTGS2+ mesenchymal cells have been implicated in intestinal tumorigenesis via epithelial PTGER4 44 ; neoplasia is an uncommon, but dreaded complication of long-standing IBD.
  • Therapeutic approaches targeting IL6 and IL11 in CD have been reported in clinical trials, but have not advanced toward approval of clinical use 45,46 .
  • a potential advantage of using apeledoxifene in anti-TNF refractory CD patients is the simultaneous targeting of both myeloid and stromal arms of the pathogenic module.
  • Foss of response in patients who initially responded to anti-TNF treatment may reflect the cumulative effects of dysregulated NOD2 function and altered fibroblast-macrophage interactions and differentiation states over time.
  • combination therapies targeting distinct pathways such as with adoxifene, will likely be required to substantially improve outcomes. Future combination efforts will require safety and efficacy studies, guided by genetically-driven patient selection, and interval transcriptome analyses at disease presentation, after treatment, and with disease progression.
  • RNA isolation (1) Cells/zebrafish larval intestines were homogenized in 1000 pF Trizol and vigorously vortexed. RNA isolation was performed using chloroform isolation (Qiagen), and the final pellet was resuspended in 20 pF RNase-free water. RNA was heated to 70°C before cDNA synthesis to disrupt any secondary structures.
  • RNA isolation (2) for ⁇ 500,000 cells in a sample, the Invitrogen RN Aqueous Micro Kit (AM1931) was used to isolate RNA. Cells after CD14+ differentiation were scraped and homogenized immediately in 200 pF of lysis buffer (provided in kit). RNA isolation was performed via column methods as described in the protocol, briefly with 2 wash buffer steps, and an elution phase. The final column wash was resuspended in 20 pF RNase free water. RNA was heated to 70°C before cDNA synthesis to disrupt any secondary structures. cDNA was synthesized using Fife Technologies SuperScript III First-Strand Synthesis SuperMix (18080400) for qRT-PCR.
  • RNA Up to 1 pg of RNA was run per sample per reaction and the final volume of cDNA generated was 20 pF.
  • an additional Lithium Chloride purification step 48 was performed to inhibit interference with PCR amplification.
  • Applied Biosystems reagents and machinery were used in all qRT-PCR reactions. Briefly, using the Power Sybr Green PCR Master Mix (Life Technologies, #4368577) 1 pL of cDNA concentrate was used in a 20 pL qPCR reaction. 500 nm of forward and reverse primers were used in each reaction. Plates were spun at 200 x g for 1 minute before loading into the One-Step PCR thermocycler. The following conditions were used to run samples: 96°C heat for 15 minutes, 96°C, 72°C, 54°C (X40), 54°C, 96°C. Ct values from duplicated reactions were averaged and 2-Ct(target)/2-Ct(reference) method was used to calculate expression, with rpl32 serving as reference genes for human cells and zebrafish larvae.
  • genotype and treatment both served as independent variables, values were first normalized to genotype, then to treatment, to calculate fold change.
  • nucleic acid sequences are described 5' to 3'.
  • Single-cell suspensions were prepared from 20-30 mucosal biopsies per resection as previously described 3 .
  • Cell suspensions from both tissues were subject to CD 14+ magnetic selection, using the Miltenyi Biotec CD14 negative selection kit (#130-091-153).
  • CD14+ cells (unstained at this point) were then washed and incubated with Miltenyi anti-biotin CD140a (PDGFRa) antibody (#130-115-335) for 10 minutes in the dark at 4°C. After washing, cells were incubated with anti-biotin microbeads for 15 minutes at 4°C and run through magnetic separation columns. Positive and negative fractions from each separation were pulled down, cells were counted, and cells were dissociated in Trizol for RNA isolation.
  • PDGFRa Miltenyi anti-biotin CD140a
  • PBMCs were isolated using the BD Vacutainer CPT Mononuclear Cell Preparation Tube-Sodium Heparin (BD Biosciences) and centrifuged for 20 minutes at 1800 x g at room temperature, with brakes off. PBMC were collected at the interphase and were subject to CD 14+ separation (Miltenyi CD 14+ negative selection kit). Final CD 14+ cell suspensions were resuspended in DMEM + 20% HI-FBS.
  • Cells were then incubated in secondary antibodies (1:5000, goat anti-rabbit or anti-mouse Alexafluor 568/388, Abeam) for 1 hour at room temperature.
  • Cells were washed and mounted with DAPI-mounting medium (EMS; #17984-24) and imaged either using EVOS upright microscope, or with the ZEISS LSM 800 Airyscan confocal microscope. All images were quantified using ImageJ via the Corrected Total Cell Fluorescence method.
  • IHC was performed using VENTANA DISCOVERY ULTRA from Roche. This system allows for automated baking, deparaffinization and cell conditioning. Semiautomatic dual staining was performed sequentially using WT1 at a 1:25 dilution (abeam ab89901) during 60 min. As secondary antibody Discovery OMNIMap anti-rabbit-HRP from Roche (760-4310) was used and the signal was obtained using Discovery ChromoMap DAB RUO from Roche (760-2513) (brown signal).
  • PDGFRA Thermofisher TA804956
  • secondary antibody Discovery OMNIMap anti-mouse- NP from Roche (760-4816)
  • Discovery Purple Kit Discovery Purple Kit (760-229) (purple signal). Tissues were counterstained with Hematoxylin to visualize the nuclei.
  • 58 pmol crRNA (sequences below), 58 pmol FP-labeled tracrRNA (Sigma), and 6.75 pmol Cas9 protein were combined and allowed to complex for 30 minutes on ice prior to injection.
  • AB WT zebrafish embryos were injected with 4 nL of injection mix per embryo at the one- to four- cell stage. Embryos were screened for the presence of fluorescent gRNA at 2-3hpf. 5dpf larvae were collected for gDNA extraction.
  • a region of genomic DNA containing the intended CRISPR target site was amplified by PCR. PCR products were purified using Qiaquick PCR Purification Kit (Qiagen). The EnGen® Mutation Detection Kit (NEB) was used to identify mosaicism for nod2 mutations. Once T7 digest indicated the presence of CRISPR-Cas9-induced mutations, injected fish were added to system and raised to adulthood.
  • Taqman genotyping protocol (96-well plate; 25 pL reaction) was followed and plates were run on the Viia7 Applied Biosystems Taqman genotyping system.
  • a 10 mg/mL working stock of Muramyl Dipeptide (MDP, InvivoGen #53678-77-6) was diluted to 1 pg/mL for all treatments. No more than 20 larvae at 5dpf were placed in 1.5 mL Eppendorf tubes and incubated with 1 pg/mL MDP in 1 mL egg water with the cap open, in a 37°C incubator for 1 hour. Larvae were rinsed and moved to fresh egg water in a petri dish for rescue. Larvae were collected for further experimental use (intestinal dissections, followed by genotyping and RNA extractions) at 1 hour, 24 hours, and 48 hours post removal of MDP, during the rescue phases. A second 1-hour incubation of MDP was conducted at 8dpf, and similar timepoints were collected post recovery.
  • MDP Muramyl Dipeptide
  • Bazedoxifene (BZA) concentrations (Selleck Chemicals #S2128) were titrated to obtain an optimal concentration of 10 pM. (adaptation from prior murine studies 33 , decrease in pSTAT3 upon treatment, and no toxicity to zebrafish larvae). Bazedoxifene was either administered alone or with 0.075% DSS co-treatment to nod2 WT, +/- or -I- larvae at 5dpf (IX) and 8dpf (2X), by emulsion in 15 mL egg water. 24 hours after each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 hours after removal of DSS and/or BZA. STAT3-inhibitor treatment of zebrafish larvae
  • S3I-201 (Sigma-Aldrich SML0330-5MG) STAT3 -inhibitor concentrations were titrated to obtain an optimal concentration of 20 p M.
  • S3I-201 was either administered alone, or with 10 pM BZA co-treatment to nod2 WT, +/- or -I- larvae at 5dpf (IX) by emulsion in 15 mL egg water. 24 hours after each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 hours after removal of DSS and/or BZA.
  • Protein lysates were prepared from 5dpf zebrafish larvae. Twenty larvae were homogenized in lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, 2 mM EDTA, 10% glycerol and protease inhibitors), by manual homogenization, followed by sonication. All lysates were centrifuged in a 1:5 volume of sample buffer (2% SDS, 5% 2- mercaptoethanol final concentration). Samples were boiled to 96°C for 5 minutes before loading into Mini-Protean TGX 4-15% gels (Bio-Rad), and western blotted.
  • Membranes were blocked for 45 minutes in 5% BSA in TBST (0.1% Tween 20). Membranes were probed with a custom anti-zebrafish nod2 antibody, raised in rabbit (1:500, Pocono Rabbit Farm) or antizebrafish phospho-STAT3 antibody (1:500, MBL #D 128-3), and anti-tubulin antibody (1:2000, Cell Signaling #2148) in 5% BSA in TBST, at 4°C overnight. Membranes were washed and incubated in HRP-conjugated secondary antibody (1:5000 goat anti-rabbit, and 1:5000 goat anti-mouse).
  • Immunoblots were developed with SuperSignal West Pico (Life Technologies) and were visualized by chemiluminscence using standard film developing processes. Band intensities were quantified through ImageJ; fold change was normalized first to tubulin, and then to no treatment controls.
  • IX or 2X- untreated, DSS-treated or DSS+BZA co-treated zebrafish larvae were fixed in 4% PFA for 24 hours at 4°C. Larvae were then embedded in the Mount Sinai Biorepository and Pathology Core. Paraffin sections are cut at 4 pm using a Leica RM2125 RTS manual rotary microtome. The sections are placed on de-ionized water heated to a temperature of 40°C using the Fisher Tissue Prep Flotation Bath, Model 134. Sections are picked up using StatLab Colorview Adhesion slides and placed in a 60°C oven for 30 minutes. After removing from the oven, they are cooled and placed on the Leica Autostainer XL for H&E staining. [0146] Quantification of leukocytes were performed in ImageJ by measuring number of leukocytes in a 1.5x3.5mm square area of the anterior intestine.
  • Sections were stained with IL11 antibody (1:150, Thermo Fischer #PA5-36544 or isotype control IgG rabbit antibody 1:1, Thermo Fisher #08-6199), overnight at 4°C and then with 1:250 goat anti-rabbit Alexa Fluor 488 (for-ILl 1 non-fluorescently labeled) or Alex Fluor 647- conjugated Phalloidin antibody (1:250, Thermo Fisher, #A22287) for 1.5 hours in the dark at room temperature. Sections were mounted with Pro Long Gold Antifade Mountant with 4',6-diamidino-2-phenylindole (DAPI; Life Technologies) and imaged using a Leica SP5 DMI at 20X and 40X.
  • DAPI Pro Long Gold Antifade Mountant with 4',6-diamidino-2-phenylindole
  • Raw BCL (raw base call) files generated from Illumina were demultiplexed using cellranger-v4.0.0 which uses bcl2fastq pipeline, into single cell fastq files.
  • FASTQs were then aligned to an Ensembl GRCzl 1 zebrafish genome and transcript count matrices were generated using default parameters in cellranger count.
  • the raw (unfiltered) output matrices were then used for the clustering and downstream analysis in Seurat-v3.1. Density plots for UMI, number of genes, and mitochondrial percentages were analyzed for each sample. Data was filtered to include cells with >200 UMIs and 250>genes per cell>4000. Clustering was performed using the R package ‘Seurat Version 3.1’.
  • Samples were individually normalized, and the 200 most variable genes were identified for each sample. Integration of all zebrafish samples was performed using “FindlntegrationAnchors”, ensuring appropriate metadata annotation for each sample (genotype, treatment, stage). The data was scaled in Seurat, and dimensionality reduction was then performed; the first 18 principal components were used to generate clustering, with a resolution of 0.8. Cluster marker genes were identified using the “FindAllMarkers” function.
  • RNA-seq data collected from RISK consortium terminal ileum biopsies (PMIDs: 25003194, 28259484, 30692607) was normalized (median-of-ratios) using DESeq2 (PMID: 25516281) based on calculated size factors.
  • PCs principal components
  • Example 5 A treatment-naive blood and tissue signature highlights gp!30 inhibition as an alternative for anti-TNF refractory/ Crohn’s disease patients
  • Anti-TNF therapy remains the most efficacious therapeutic treatment strategy for the majority of patients with moderate-to- severe Crohn’s disease, yet it shows no clinical benefit in -40% of patients.
  • Cellular and molecular mechanisms of pathogenic activation in Crohn’s disease have highlighted the importance of cellular niches and cellular communication between activated immune and stromal cells, such as inflammatory macrophages and activated fibroblasts.
  • gpl30 inhibition may be a beneficial complementary target in CD patients who carry elevated transcriptional signatures.
  • This signature also significantly separates responders and non-responders to ustekinumab treatment and, importantly, can be dampened with apeledoxifene treatment in vivo in a larval zebrafish model of CD and in vitro in a CD 14+ PBMC differentiation system.
  • scRNAseq of zebrafish larvae treated with DSS alone, DSS + BZA, and DSS followed by BZA revealed 18 unique clusters of stromal and myeloid cells. Fibroblast, macrophage, and lymphatic (endothelial; enteric neurons) populations expanded upon DSS treatment and, importantly, contracted with BZA treatment given during and after injury. The effects were most pronounced when BZA was given during injury.
  • Stromal cells from CD ileal scRNAseq can be subclustered to further reveal specialized activated subsets (notably PDGFRAhi vs. PDPNhi fibroblasts). These cell types can be transcriptionally segregated by unique signatures of transcription factors.
  • a trajectory of activation was observed among fibroblast subsets from CD ileal patients: residential fibroblasts; PDGFRAhi activated fibroblasts (inflamed tissue only); PDPNhi activated fibroblasts (inflamed tissue only). DEG analysis between PDGFRAhi vs.
  • PDPNhi fibroblasts reveals a) upstream regulation by members along the gpl30 family axis for PDGFRAhi fibroblasts, and b) upstream regulation by GPCR, and growth factors (including platelet-derived) for PDPNhi fibroblasts, indicating that these are distinct activated subsets.
  • the advance on IE6ST + CD130 expression (CfTEseq) reveals fibroblast populations, but also ACKR1+ activated endothelial cells with gpl30 expression.
  • PDGFRA protein expression has the highest correlation with gpl30 protein expression (again supporting that PDGFRA and PDPN activated fibroblasts are distinct). This has important implications for directed targeting on the right cell subset.
  • BZA treatment of zebrafish larvae was either administered alone, before, in combination with, or after 0.075% DSS cotreatment to nod2+!+, nod2+! ⁇ or nod2-l- larvae at 5 dpf (lx) and 8 dpf (2x), by emulsion in 15 ml egg water. After 24 h of each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 h after removal of DSS and/or BZA.
  • CITE sequencing of Crohn’s disease ileal tissue Following singe-cell isolation and suspension from inflamed and uninflamed matched resection samples of one CD ileal patient (Martin et al., 2021), cell suspensions were split and barcoded using “hashing antibodies” beta-2-microglobulin and CD298 and conjugated to “hash-tag” oligonucleotides (HTOs).
  • RNA-seq data collected from biopsies by the UNITI cohort were normalized (median-of-ratios) using DESeq on the basis of calculated size factors. Differential expression was performed between non-responders and responders pre-anti TNF treatment in patient data published in Arijs et al., 2009.
  • the 126 significantly upregulated genes were used to calculate the first 10 principal components across each of the UNITI1 and UNITE patient samples, and each component was tested along with sex in a logistic regression model to identify relationships between pre-treatment non-response genes principal component scores and disease recurrence and inflammation.
  • Embodiment 1 A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
  • gpl30 glycoprotein 130
  • Embodiment 2 The method of embodiment 1, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • Embodiment 3 The method of embodiment 1 or 2, wherein the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • Embodiment 4 The method of any one of embodiments 1-3, wherein the subject is a primary anti-TNF non-responder or at risk for being a primary anti-TNF non-responder.
  • Embodiment 5 The method of any one of embodiments 1-3, wherein the subject is a secondary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder.
  • Embodiment 6 The method of any one of embodiments 1-5, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject.
  • Embodiment 7 The method of any one of embodiments 1-6, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
  • Embodiment 8 The method of any one of embodiments 1-7, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject.
  • Embodiment 9 The method of any one of embodiments 1-8, wherein administering the gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in the subject.
  • Embodiment 10 The method of embodiment 9, wherein the activated fibroblast transcript is selected from: wtl ; ILi , tgfbla, cxcl!3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
  • Embodiment 11 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is wtl .
  • Embodiment 12 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is IL11.
  • Embodiment 13 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is tgfbla.
  • Embodiment 14 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is cxcll3.
  • Embodiment 15 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is mmp9.
  • Embodiment 16 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is pdpn.
  • Embodiment 17 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is chi3ll .
  • Embodiment 18 The method of embodiment 9 or 10, wherein the activated fibroblast transcript is pdgfra.
  • Embodiment 19 A method of modulating expression of a transcriptional profile resulting from cross-talk between myeloid and stromal cells in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
  • a glycoprotein 130 (gpl30) inhibitor gpl30
  • Embodiment 20 The method of embodiment 19, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • Embodiment 21 The method of embodiment 19 or 20, wherein the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • Embodiment 22 The method of any one of embodiments 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of fibroblasts.
  • Embodiment 23 The method of any one of embodiments 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of inflammatory macrophages.
  • Embodiment 24 The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof.
  • a transcriptional regulator selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof.
  • Embodiment 25 The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is WT1.
  • Embodiment 26 The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is STAT3.
  • Embodiment 27 The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is TWIST 1.
  • Embodiment 28 The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is CEBPB.
  • Embodiment 29 A method of restoring sensitivity to anti-TNF agents in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of apeledoxifene and an anti-TNF agent, wherein the anti-TNF non- responder subject has a transcriptional profile comprising markers associated with anti-TNF resistance.
  • Embodiment 30 The method of embodiment 29, wherein the transcriptional profile results from cross-talk between myeloid and stromal cells.
  • Embodiment 31 The method of embodiment 29 or 30, wherein the subject is a primary anti-TNF non-responder or at risk for being a primary anti-TNF non-responder.
  • Embodiment 32 The method of embodiment 29 or 30, wherein the subject is a secondary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder.
  • Embodiment 33 The method of any one of embodiments 29-32, wherein administering apeledoxifene and the anti-TNF agent prevents collagen secretion or activation in the subject.
  • Embodiment 34 The method of any one of embodiments 29-33, wherein administering apeledoxifene and the anti-TNF agent prevents intestinal length shortening in the subject.
  • Embodiment 35 The method of any one of embodiments 29-34, wherein administering apeledoxifene and the anti-TNF agent decreases gpl30 target gene activation in the subject.
  • Embodiment 36 The method of any one of embodiments 29-35, wherein administering apeledoxifene and the anti-TNF agent decreases expression of activated fibroblast transcripts in the subject.
  • Embodiment 37 The method of embodiment 36, wherein the activated fibroblast transcript is selected from: wtl ; IL11 tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
  • Embodiment 38 The method of embodiment 36, wherein the activated fibroblast transcript is wtl .
  • Embodiment 39 The method of embodiment 36, wherein the activated fibroblast transcript is IL11.
  • Embodiment 40 The method of embodiment 36, wherein the activated fibroblast transcript is tgfbla.
  • Embodiment 41 The method of embodiment 36, wherein the activated fibroblast transcript is cxcll3.
  • Embodiment 42 Embodiment 1. The method of embodiment 36, wherein the activated fibroblast transcript is mmp9.
  • Embodiment 43 The method of embodiment 36, wherein the activated fibroblast transcript is pdpn.
  • Embodiment 44 The method of embodiment 36, wherein the activated fibroblast transcript is chi3ll .
  • Embodiment 45 The method of embodiment 36, wherein the activated fibroblast transcript is pdgfra.
  • Embodiment 46 A method for identifying a Crohn’s disease subject in need of treatment, the method comprising: (a) taking a sample from a subject; and (b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier.
  • Embodiment 47 The method of embodiment 46, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
  • Embodiment 48 The method of embodiment 46 or 47, further comprising administering a gpl30 inhibitor.
  • Embodiment 49 The method of embodiment 48, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • Embodiment 50 The method of embodiment 48 or 49, wherein the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • Embodiment 51 A method for identifying and treating Crohn’s disease in a subject in need of treatment, the method comprising: (a) taking a sample from a subject; (b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier; and (c) administering a gpl30 inhibitor to the subject.
  • Embodiment 52 The method of embodiment 51, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
  • Embodiment 53 The method of embodiment 51 or 52, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • Embodiment 54 The method of any one of embodiments 51-53, wherein the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • Embodiment 55 A composition comprising a gpl30 inhibitor and an anti-TNF agent.
  • Embodiment 56 The composition of embodiment 55, wherein the gpl30 inhibitor is apeledoxifine.
  • Embodiment 57 The composition of embodiment 56, wherein the composition comprises a therapeutically effective amount of apeledoxifine and an anti-TNF agent.
  • Embodiment 58 The composition of any one of embodiments 55-57, wherein the composition further comprises one or more pharmaceutically acceptable excipients.
  • Embodiment 59 A kit for treating subjects having, at risk of having, or suspected of having Crohn’s disease, comprising: (a) a gpl30 inhibitor; and (b) an anti-TNF agent.
  • Embodiment 60 A kit for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease, comprising: (a) reagents for performing any of the methods of embodiments 46-50; and (b) a gpl30 inhibitor.
  • Embodiment 61 The kit of embodiment 59 or 60, wherein the gpl30 inhibitor is apeledoxifene.
  • Embodiment 62 A kit comprising the composition of any one of embodiments 55- 58.
  • Embodiment 63 A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject the composition of any one of embodiments 55-58.
  • Embodiment 64 The method of any one of embodiments 1-54, wherein the subject is an anti-IL12p40/IL23R therapy non-responder, or at risk for being an anti-IL12p40/IL23R therapy non-responder.
  • Embodiment 65 The method of embodiment 64, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
  • Embodiment 66 The method of any one of embodiments 1-54, 64, or 65 further comprising administering to the subject an anti-TNF therapy or an anti-IL12p40/IL23R therapy.
  • Embodiment 67 A method of treating Crohn’s disease in a subject in need thereof, the method comprising:
  • Embodiment 68 (ii) administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor if the presence of the gene signature is observed in the sample taken from the subject.
  • Embodiment 68 The method of embodiment 67 further comprising administering a therapeutically effective amount of an anti-TNF therapy to the subject along with the gpl30 inhibitor.
  • Embodiment 69 The method of embodiment 67 or 68 further comprising administering a therapeutically effective amount of an anti-IL12p40/IL23R therapy to the subject along with the gpl30 inhibitor.
  • Embodiment 70 The method of embodiment 69, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
  • Embodiment 71 The method of any one of embodiments 67-70, wherein the control sample is a sample taken from an anti-TNF non-responder subject.
  • Embodiment 72 The method of any one of embodiments 67-71, wherein the control sample is a sample taken from an anti-IL12p40/IL23R non-responder subject.
  • Embodiment 73 The method of any one of embodiments 67-72, wherein the subject has not been administered an anti-TNF therapy or an anti-IL12p40/IL23R therapy previously.
  • Embodiment 74 The method of any one of embodiments 67-73, wherein the presence of the gene signature in the sample taken from the subject indicates that the subject is an anti-TNF non-responder and/or an anti-IL12p40/IL23R non-responder.
  • Embodiment 75 The method of any one of embodiments 67-74, wherein the control sample is a sample taken from a healthy subject who does not have Crohn’s disease.
  • Embodiment 76 The method of any one of embodiments 67-75, wherein the sample taken from the subject is a tissue sample.
  • Embodiment 77 The method of any one of embodiments 67-75, wherein the sample taken from the subject is a blood sample.
  • Embodiment 78 The method of any one of embodiments 67-77, wherein the gene signature comprises increased or decreased expression relative to the control sample of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more of the genes.
  • Embodiment 79 The method of any one of embodiments 67-78, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • Embodiment 80 The method of any one of embodiments 67-79, wherein the gpl30 inhibitor is apeledoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
  • Embodiment 81 The method of any one of embodiments 67-80, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject.
  • Embodiment 82 The method of any one of embodiments 67-81, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
  • Embodiment 83 The method of any one of embodiments 67-82, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject.
  • Embodiment 84 The method of any one of embodiments 67-83, wherein administering the gpl30 inhibitor to the subject restores expression levels of the one or more genes in the gene signature to the levels observed in the control sample.
  • articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
  • the disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process.
  • the disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
  • the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim.
  • any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.
  • elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the disclosure, or embodiments of the disclosure, is/are referred to as comprising particular elements and/or features, certain embodiments of the disclosure or embodiments of the disclosure consist, or consist essentially of, such elements and/or features.
  • Girardin, S. E. et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278, 8869-8872 (2003).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Pathology (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

Provided herein are methods for treating Crohn's disease using gp130 inhibitors. Also provided herein are methods for restoring sensitivity to anti-TNF therapies in anti-TNF non-responder subjects and methods for identifying such subjects. Further provided herein are kits and compositions for treating Crohn's disease using a gpl30 inhibitor. In some embodiments, the gp130 inhibitor is bazedoxifene.

Description

METHOD FOR TREATING CROHN'S DISEASE
RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application, U.S.S.N. 63/157,574, filed March 5, 2021, and U.S. Provisional Application, U.S.S.N. 63/130,035, filed December 23, 2020, each of which is incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under DK106593, DK123758 & DK062422 awarded by National Institute of Health. The government has certain rights in the invention.
FIELD
[0003] The present specification relates to methods of treating Crohn’s disease. In particular, the present specification relates to methods, compositions, diagnostic gene panels, and kits for treating Crohn’s disease by administering a glycoprotein 130 (gpl30) inhibitor (e.g., bazedoxifene) to a subject having Crohn’s disease, and in some embodiments, to subjects identified as non-responders to standard-of-care treatment (e.g., anti-TNF treatment or ustekinumab).
BACKGROUND
[0004] Crohn’s disease (CD) is a chronic inflammatory intestinal disorder that affects the gastrointestinal tract. Symptoms of Crohn’s disease include abdominal pain, diarrhea, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and fatigue. The disease is also often characterized by aberrant healing and stricturing complications. The exact causes of Crohn’s disease are not currently known, but it is thought to be caused by some combination of environmental, immune, and bacterial factors. It is also thought that there are genetic components that may contribute to onset of the disease, with Crohn’s disease often occurring in genetically susceptible subjects.
[0005] While the precise root cause of Crohn’s disease is unknown, it is thought that crosstalk between activated myeloid and stromal cells is important in the pathogenicity of Crohn’s disease (Kugathasan, S. et al. Prediction of complicated disease course for children newly diagnosed with Crohn’s disease: a multicentre inception cohort study. Lancet Land. Engl. 2017, 389, 1710-1718; West, N. R. et al. Oncostatin M drives intestinal inflammation and predicts response to tumor necrosis factor-neutralizing therapy in patients with inflammatory bowel disease. Nat. Med. 2017, 23, 579-589).
[0006] There are also limited treatment options for Crohn’s disease. The main therapeutic objectives are the reduction of signs and symptoms, the induction and maintenance of remission and, most importantly, the prevention of disease progression and complications. For example, sulfasalazine and other 5-aminosalidyl acid agents, antibiotics such as metronidazole and ciprofloxacin, corticosteroids, immunosuppressants such as azathioprine and 6-mercaptopurine have proven useful in inducing remission and / or maintaining Crohn’s disease. However, many of these pharmaceuticals are only moderately effective, and are associated with difficult and unwanted side effects.
[0007] Anti-TNF drugs are also effective treatments for the management of Crohn's disease but treatment failure is common in subjects who are or who become after a period of time non-responsive to anti-TNF agent. The genetic basis for drug non-responsiveness and to Crohn’s in general is not entirely understood. By some accounts, however, it has been reported that increases in intravasating monocytes correlate with non-responsiveness to anti- TNF treatment (Martin, J. C. et al. Single-Cell Analysis of Crohn’s Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell. 2019, 178, 1493-1508.e20). In addition, it has been reported that risk alleles resulting in one or more loss-of-function mutations in NOD2 confer the highest risk to susceptibility to Crohn’s disease (Ogura, Y. et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature. 2001, 411, 603-606; Hugot, J. P. et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature. 2001, 411, 599-603). Such mutations increase the risk for stricturing (Lesage, S. et al.
CARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease. Am. J. Hum. Genet. 2002, 70, 845-857). However, the mechanisms underlying NOD2-pathogenicity and salvage pathways in anti-TNF refractory patients remain largely uncharacterized.
[0008] Therefore, there is a clear need for alternative treatments for Crohn’s disease and/or options which mitigate non-responsiveness to current treatments, such as with anti-TNF therapy. SUMMARY
[0009] The present disclosure shows in part that loss of NOD2 function leads to aberrant activated fibroblast and macrophage homeostasis by direct ex vivo analyses of Crohn’s disease patients carrying N0D2 risk alleles. This was further validated via altered in vitro differentiation of CD14+PBMCs from N0D2 carriers to produce collagen-high expressing cells, and in vivo zebrafish models of DS S -intestinal injury and nod2 deficiency. The observed enrichment of STAT3 regulation and gpl30-ligands IL11, IL6, and OSM in activated fibroblasts and macrophages supports that the blockade of gpl30 could rescue the activated program. As describe herein, post-treatment induction of this pathway was correlated in anti-TNF non-responders, and in vivo amelioration of the activated myeloid- stromal niche was demonstrated by blockade of gpl30. The results demonstrate novel biological insights into how NOD2 loss drives aberrant repair and fibrosis in Crohn’s disease. [0010] Accordingly, provided herein are methods, compositions, and kits for treating Crohn’s disease using gpl30 inhibitors, as a well as to gene signatures useful for identifying subjects who would not respond to standard of care treatments for Crohn’s disease (e.g., anti-TNF therapies, and anti-IL12p40/IL23R therapies such as ustekinumab).
[0011] In some aspects, the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof. In some embodiments, the method comprises administering to a subject a therapeutically effective amount of a gpl30 inhibitor, e.g., bazedoxifene or bazedoxifene derivative. In some embodiments, administering a gpl30 inhibitor, e.g., bazedoxifene or bazedoxifene derivative, decreases expression of one or more activated fibroblast transcripts in a subject (e.g., wtl; ILH tgfbla; cxcl!3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof).
[0012] In some aspects, the disclosure relates to a method of modulating expression of a transcriptional profile (e.g., a profile comprising a transcriptional regulator selected from: WT1; STAT3; TWIST1; CEBPB; or a combination thereof) in a subject by administering a therapeutically effective amount of a gpl30 inhibitor, e.g., bazedoxifene or bazedoxifene derivative. In some embodiments, a transcriptional profile results from cross-talk between myeloid and stromal cells. In some embodiments, expression of a transcriptional profile is modulated to prevent activation of fibroblasts and/or inflammatory macrophages.
[0013] Moreover, it has been discovered that the anti-TNF non-responder phenotype may be recognized based on detection of the gene signature of Table 1 in Example 1. In Example 1, it is demonstrated that gpl30 inhibition with bazedoxifene ameliorates pathogenic transcriptional activation of myeloid and stromal cells of the genes of Table 1, which represents a transcriptional signature (observed in non-responders even before anti-TNF treatment institution) that can be identified prior to treatment with a gpl30 inhibitor. This transcriptional signature may be probed and detected to identify not only anti-TNF non- responders, but also ustekinumab non-responders, thereby identifying suitable candidates for treatment with a gpl30 inhibitor (e.g., bazedoxifene) which causes the dampening of the transcriptional signature thereby also restoration of such treated subjects to anti-TNF and/or ustekinumab treatment.
[0014] In some aspects, the disclosure relates to a method of restoring sensitivity of a subject (e.g., a subject having a transcriptional profile associated with anti-TNF resistance) to a standard-of-care Crohn’s disease treatment, e.g., treatment with an anti-TNF agent or with ustekinumab (e.g., STELARA®). In some embodiments, restoring sensitivity in a subject can be achieved by administering a therapeutically effective amount of bazedoxifene to a subject to decrease expression of activated fibroblast transcripts (e.g., wtl illl; tgfbla; cxcl!3; mmp9; pdpn; chi3ll; pdgfrd) in a subject. In certain embodiments, a transcriptional profile results from cross-talk between myeloid and stromal cells.
[0015] The disclosure also provides a metho gene signature useful for identifying subjects who would not respond to standard of care treatments for Crohn’s disease (e.g., anti-TNF therapies, and anti-IL12p40/IL23R therapies such as ustekinumab) is also described herein. [0016] In some aspects, the disclosure relates to a method for identifying a Crohn’s disease subject in need of treatment. In some embodiments, identifying such a subject can be achieved by taking a sample from a subject and evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a N0D2 risk allele carrier (e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9). In certain embodiments, the method further comprises administering a gpl30 inhibitor to a subject.
[0017] In some aspects, the disclosure relates to a method for identifying and treating a Crohn’s disease subject in need of treatment. In some embodiments, identifying such a subject can be achieved by a) taking a sample from the subject; b) evaluating a sample for one or more increased activated fibroblast or macrophage signatures characteristic of a N0D2 risk allele carrier (e.g., one selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9); and c) administering a gpl30 inhibitor to a subject. [0018] In some aspects, the disclosure relates to a composition comprising a gpl30 inhibitor and an anti-TNF agent. In some embodiments, a composition comprises a therapeutically effective amount of a gpl30 inhibitor and an anti-TNF agent. In certain embodiments, a composition comprises one or more pharmaceutically acceptable excipients.
[0019] In some aspects, the disclosure relates to kits for treating or for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease. In some embodiments, a kit for treating such subjects comprises a gpl30 inhibitor and an anti-TNF agent. In some embodiments, a kit for diagnosing such subjects comprises reagents for performing any of the methods described herein and a gpl30 inhibitor. In some embodiments, a kit comprises any of the compositions disclosed herein.
[0020] In some aspects, the disclosure relates to a method of treating Crohn’s disease in a subject. In some embodiments, treating Crohn’s disease in a subject is accomplished by administering any of the compositions disclosed herein to a subject.
[0021] In some aspects, the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof, the method comprising:
(i) evaluating a sample taken from the subject for a gene signature comprising increased or decreased expression relative to a control sample of one or more genes selected from the group consisting of TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTHRC1, TNC, CSF3R, NCF2, STC1, FGF2, CCL2, PLXND1, LILRA2, G0S2, LRRC25, PLEK, CXCR2, IGFBP5, ENG, NRP2, MMP2, SLC2A3, TMEM71, RASSF8, SELL, PLTP, GLT1D1, LILRB3, MGP, FCN1, CSGALNACT1, COL7A1, COL15A1, RGS5, LILRA1, FCGR2A, SIGLEC5, CLEC7A, ANGPT2, EGFL6, ADGRE2, LOC 101928916///NNMT, CFH, PDPN, CMTM2, RGS2, COL6A3, PAPPA, ANGPTL2, DKK3, TLR4, CFHR1///CFH, FGR, SLC2A14///SLC2A3, IL7R, TIMP1, COL4A1, S100A4, LST1, TMEM45A, VWF, RGS18, SPARCL1, COL18A1, DUSP4, DSE, COL4A2, SLC9B2, EML1, ACSL4, KLHL5, CAV2, NINJ1, C3AR1, AKR1B1, PRKCDBP, TIMP2, C1R, SELM, LAMC1, GPX8, ELK3, TNFRSF1B, CEBPB, PRNP, MRC2, A2M, COTL1, MSANTD3, FGFR1OP2, PQLC3, and ABCG4; and (ii) administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor if the presence of the gene signature is observed in the sample taken from the subject.
[0022] In some embodiments, a gpl30 inhibitor is a selective estrogen receptor modulator (SERM). In some embodiments, a gp!30 inhibitor is bazedoxifene, having the structure:
Figure imgf000008_0001
certain embodiments, a gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of bazedoxifene.
[0023] In some embodiments, a subject is an anti-TNF non-responder (e.g., a primary anti- TNF non-responder or a secondary anti-TNF non-responder), or at risk for being an anti-TNF non-responder (e.g., at risk for being a primary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder). In some embodiments, the subject is an anti- IE12p40/IE23R therapy (e.g., ustekinumab) non-responder, or at risk for being an anti- IE12p40/IE23R therapy non-responder. In some embodiments, administering a gpl30 inhibitor to a subject prevents collagen secretion or activation; prevents intestinal length shortening; or decreases gpl30 target gene activation in a subject. In some embodiments, any of the methods described herein further comprise administering to the subject an anti-TNF therapy or an anti-IE12p40/IE23R therapy along with bazedoxifene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0025] FIGs. 1A-1H show that inflamed ileal CD14+PDGFRA+ cells and scRNASeq orthologies implicate key roles for myeloid- stromal clusters with inflammation and injury. FIG. 1A is a heatmap showing relative expression values of genes (columns) across myeloid and stromal cell subsets (rows) from single-cell RNA sequencing (scRNAseq) of PBMCs and inflamed CD ileum (n=l 1 patients). Relative expression defined as log2 of the expression of a gene in a cluster and its average across all shown clusters. FIG. IB shows the percentage of COL1A1+ single-positive, PDGFRA+ single-positive, CD14+ single-positive, and CD14+PDGFRA+ double-positive cells of total activated fibroblasts (1367 cells total) in inflamed ileum. FIG. 1C shows relative gene expression in double positive cells from CD14+PDGFRA+ vs. CD14- fraction from uninflamed vs. inflamed tissue (n=3 biological replicates). Data are mean ± SEM. *P<0.05; **P<0.01 (Student’s /-test). FIG. ID shows full thickness sections from involved CD strictured sections showing expression of WT1, PDGFRA and CD 14 in the muscularis mucosae (top) and lymphoid aggregates and around blood vessels (bottom). n=2 patients per stain. FIG. IE shows scRNAseq of DSS-injured and uninjured larval intestines (n=5 replicates; 25 pooled larval intestines in each replicate (80098 cells total), and innate immune, epithelial, and stromal human ileal CD cells (24364). Uniform Manifold Approximation and Projection (UMAP) shows joint clustering of 28 unique clusters between intestinal cells from zebrafish and human ileal CD lamina propria cells. FIG. IF depicts confusion matrices of human random forest model applied to human (left) and zebrafish (right) scRNAseq datasets showing the proportion of actual and model- predicted cell cluster identities for stromal and myeloid subsets. ILCs = innate lymphoid cells, M = macrophages, SI = activated fibroblasts, S2 = residential fibroblasts, S3 = smooth muscle cells, S4 = endothelial cells, S5 = Mesothelial cells (fish only). FIG. 1G is a dot plot showing markers commonly expressed between homologous zebrafish and human clusters. FIG. 1H depicts hematoxylin and eosin staining of 0.075% DSS IX- treated nod2+/+ and no 2mssl3/mss13 zebrafish larvae (left panel, comprising four boxes showing stained larvae). Arrows mark leukocyte staining in the anterior intestine. The number of leukocytes per 1.5 x 3.5 mm area is quantified (right panel, comprising column graphs). n=5 biological replicates for each condition, data are mean ± SEM. *P<0.05; **P<0.01 (2-way ANOVA test).
[0026] FIGs. 2A-2F show that NOD2 deficiency assessed direct ex-vivo, in vitro, and in vivo establish an activated fibroblast signature, implicating IL11 and WT1. FIG. 2A is series of boxplots showing principal component analysis of activated fibroblast and inflammatory macrophage top 200 differentially expressed genes in N0D2 risk allele carriers and noncarriers in pediatric inception RISK cohort (left) and individual gene expression, using DESeq2 normalized counts, in N0D2 carriers and non-carriers (right), n = 140, 61, 17 OX, IX and 2X N0D2 carriers respectively. *P<0.05; **P<0.01 (linear regression). FIG. 2B is a schematic of CD14+ CD16- PBMCs isolated from healthy NOD2 carriers and non-carriers, followed by differentiation assay (top). Representative images of myeloid (MPEG1: Macrophage Expressed 1) expression evenly distributed along the cell surface and stromal (MFAP4: Microfibrillar Associated Protein 4, COL5A1: Type V Collagen, COL1A1; Type I Collagen) expression localized to spindle edges as assessed by immunofluorescence (bottom). FIG. 2C shows COL1A1 secreted by unstimulated, 0.5 pg/mL Lipid A, 2.5 pg/mL Pam3Cys, or 1 pg/mL MDP- stimulated PBMCs (pg/mL) as measured via Luminex. n= 2 NOD2W1/W1 carriers, n= 3 N0D2MT/MT carriers. FIG. 2D provides RT-PCR data showing relative gene expression of 1 pg/mL muramyl dipeptide (MDP)-treated CD14+CD16- PBMCs after 2 weeks of differentiation from N0D2 risk allele carriers vs. non-carriers. n=4 biological replicates for each genotype. FIG. 2E is a schematic of nod2sa21011 mutant from Zebrafish Sanger Mutation Project: C>T single nucleotide polymorphism leads to early truncation of Nod2 zebrafish protein and nod2lll‘'‘'l3/lll‘'‘'13 CRISPR-knockout zebrafish line generated, showing a 4 amino acid deletion (left); timeline of IX and 2X MDP stimulation of zebrafish larvae (right). FIG. 2F provides RT-PCR data showing relative gene expression 24 hours and 48 hours after 1 pg/mL MDP-treated zebrafish nod2+/+, nod2+/sa21011 or no 2sa21011/sa21011 larvae. n= 5 biological replicates for IX treatment (5 clutches, 10-15 larvae per genotype per clutch) and n=4 biological replicates for 2X treatment (5 clutches, 10-15 larvae per genotype per clutch), data are mean ± SEM. *P<0.05; **P<0.01 (2-way ANOVA test).
[0027] FIGs. 3A-3I show that single and recurrent DSS injury defines NOD2-dependent effects on gene expression and mesenchymal clusters, with myeloid and stromal pathway analyses implicating STAT3. FIG. 3A shows a zebrafish intestine length measured after 24 hours of IX 0.075% DSS-treatment and after 24 hours of 2X 0.075% DSS -treatment). Data are ratios of gut length/body axis length. n= 3 clutches; 15-20 larvae per control and treatment group, data are mean ± SEM. *P<0.05; **P<0.01 (paired Wilcoxon signed-rank test). FIG. 3B depicts immunofluorescent staining of IL11 (GFP) and phalloidin (for F-actin staining; far red) in mid-intestines of DSS-injured or uninjured nod2+/+ or no^™^132 813 larvae; quantification of fluorescence (measured by Corrected Integrated Density), n = 10-15 biological replicates per genotype per time point, data are mean ± SEM. *P<0.05; **P<0.01 (2 way-ANOVA test). FIG. 3C shows relative gene expression 24 hours post IX DSS and 2X DSS injury of nod2+/+, nod2+/mss13 or nod2mssl3/mss13 zebrafish larvae. n=5 biological replicates for IX treatment (5 clutches, 10-15 larvae per genotype per clutch) and n=4 biological replicates for 2X treatment (4 clutches, 10-15 larvae per genotype per clutch), data are mean ± SEM. *P<0.05; **P<0.01 (2-way ANOVA test). FIG. 3D depicts UMAP showing joint clustering of stromal and myeloid populations from untreated and DSS-treated zebrafish larval intestines, in the nod2+/+ and no^™^133™813 backgrounds. FIG. 3E is a heatmap showing single-cell expression of the top 5 representative marker genes per cluster (rows) in each cluster (columns). Expression is Unique Molecular Identifier (UMI) counts. FIG. 3F shows violin plots for given genes significantly upregulated upon DSS-treatment in nod2+/+ and nOd2mssl3/mss13 background zebrafish larvae, as seen by scRNAseq expression. Asterisks designate nod2mssl3/mss13 -specific DSS differences. FIG. 3G depicts feature plots to show localized expression of key transcripts in nod2mss13 mutant larvae from scRNA seqmyeloid and stromal populations (log normalized expression). FIG. 3H shows percentage of stromal and myeloid populations out of total larval intestinal cells sequenced comparing cells from nod2+/+ and nod2mss13 -DSS treated larvae. FIG. 31 shows circos plots revealing transcription factors WT1 and STAT3, from ingenuity pathway analysis, upstream of gene signature enriched in activated fibroblasts and inflammatory macrophages from N0D2 risk allele carriers vs. wildtype carriers in scRNAseq ileal dataset.
[0028] FIGs. 4A-4I show that gpl30 inhibition rescues key members of the aberrant myeloid- stromal niche. FIG. 4A is a schematic of gpl30 signaling. IL6R and IL11R must dimerize with gpl30 to elicit downstream signaling. OSMR and LIFR contain intracellular signaling subunits, but also dimerize with gpl30 to signal. Bazedoxifene specifically competes with receptor ligands (IL6, IL11, OSM, LIF) for gpl30 to inhibit signaling. FIG. 4B shows log2 microarray expression data from Arijs el al., 2009 dataset, showing expression of gpl30-associated genes in anti-TNF (Infliximab) treated patients. Bars labeled “A” indicate Infliximab responders (before and after treatment), and bars labeled “B” indicate Infliximab non-responders (before and after treatment). FIG. 4C shows secretion of key proteins from CD14+ PBMCs differentiated from OX N0D2 carriers vs. 2X N0D2 mutation carriers as measured via Luminex (pg/mL). PBMCs were stimulated with 0.5 pg/mL MDP or co-stimulated with 0.5 pg/mL MDP + 1 pM bazedoxifene. n=2 replicates for OX N0D2 carriers, n=3 replicates for 2X N0D2 carriers. FIG. 4D shows feature plots of bazedoxifene target genes in stromal and myeloid cells in scRNAseq of DSS-treated intestinal larvae (log normalized expression). FIG. 4E shows violin plots for given genes significantly upregulated upon DSS-treatment, or down-regulated by DSS and BZA co-treatment (log normalized expression). Asterisks indicate genes that were significantly down-regulated only in the nod2mss13 larvae. FIG. 4F shows percentage of stromal and myeloid populations out of total larval intestinal cells sequences, comparing cells from DSS-treated larvae and DSS + BZA co-treated larvae. Asterisks indicate populations that were reduced only in the nod2mss13 larvae. FIG. 4G depicts hematoxylin and eosin staining of DSS+ BZA-co-treated nod2+/+ and nod2mss13 zebrafish larvae (top). Arrows mark leukocyte staining in the anterior intestine. Number of leukocytes per 1.5 x 3.5 mm area quantified (bottom), n = 5-10 biological replicates for each condition, data are mean ± SEM. *P<0.05; **P<0.01 (2 way-ANOVA test). FIG. 4H shows larval intestine length measured after 0.075% DSS, or 10 pM BZA + 0.075% DSS treatment 24 hours post-lX and 2X treatments, data are mean ± SEM. *P<0.05; **P<0.01 (paired Wilcoxon signed rank test). FIG. 41 provides RT-PCR data showing relative gene expression 24 hours post IX DSS+BZA and 2X DSS+ BZA co-treatment vs.
IX and 2X DSS injury alone. n=5 biological replicates for IX treatment (5 clutches, 45 larvae per clutch) and n=4 biological replicates for 2X treatment (4 clutches, 45 larvae per clutch), data are mean ± SEM. *P<0.05; **P<0.01, ***P<0.001, ****P<0.0001 (paired Student’s /-test).
[0029] FIG. 5 shows a proposed model for Crohn’s disease pathogenesis and treatment pathways. Model to show proposed mechanism of Crohn’s disease pathophysiology under specific genetic and cellular constraints. N0D2 risk allele carriers develop aberrant fibroblast-macrophage homeostasis and differentiation over time. At preclinical stages of disease development, CD patients increase production of antibodies (ASCA, CBir) to contain infection caused by increased bacterial load and elevate inflammatory mediators (cytokines and chemokines such as IL11, CXCL13, 1L6, CCL2, OSM). Patients carrying N0D2 risk alleles will upregulate a specific pathogenic activated fibroblast and macrophage signature with disease development. This results in downstream activation of STAT3, among other chronic inflammatory and fibrotic consequences. Some patients administered anti-TNF therapy will not respond and often develop complications such as stricturing disease. Furthermore, over time, initial primary responders may become secondary non-responders. Presently, it has been shown that treatment refractory patients have increased gpl30 and activated fibroblast signatures; these would be select patients in whom to supplement anti- TNF treatment with the gpl30 inhibitor bazedoxifene. This model summarizes a two-step candidate selection approach: first by CD patients carrying N0D2 risk alleles with elevation of key expression signatures, and then by anti-TNF non-response) to inform personalized therapeutic decision-making for CD. [0030] FIGs. 6A-6I show single-cell RNA seq from human CD ileum and DSS-injured zebrafish intestinal larvae. FIG. 6A is a heatmap showing relative expression values of genes (columns) across myeloid and stromal cell subsets (rows) from scRNAseq of uninflamed CD ileum (n=l 1 patients). Relative expression is defined as log2 of the expression of a gene in a cluster and its average across all shown clusters. FIG. 6B is a heatmap showing relative expression of N0D2, RIPK2, and XIAP (columns) across myeloid and stromal cell subsets (rows) from scRNAseq of PBMCs and inflamed CD ileum (n=l l). FIG. 6C shows gene ontology analysis from the upregulated gene set in activated fibroblasts from the inflamed ileum. The number of genes per biological process is shown in parentheses. Processes are ranked from top to bottom in decreasing order of -log(p-value). FIG. 6D shows the number of cells from direct ex vivo sorting of CD14+PDGFRA+ cells from uninflamed (uninvolved) and inflamed (involved) CD ileum. n=3 biological replicates, data are mean ± SEM. FIG. 6E shows full-thickness sections of involved ileal strictures stained with MPEG1 and MFAP4. Deposition is localized to stromal cells, around blood vessels, and in mononuclear phagocytes along the muscularis mucosae. n=3 biological replicates per stain. FIG. 6F depicts thickness sections from involved CD strictured sections showing expression of WT1, PDGFRA and CD 14 in specified cells. n=2 patients per stain (patient 7 and 8 denoted from Martin et al., 2019). FIG. 6G provides RT-PCR data of relative gene expression of zebrafishspecific myeloid genes 24h post IX DSS-treatment of zebrafish nod2+/+ and nod2sa21011' larvae, comparing intestinal vs. carcass expression. n=3 biological replicates (3 clutches, 10- 15 larvae per genotype per clutch), data are mean ± SEM. *P<0.05; **P<0.01 (paired Student’s /-test). FIG. 6H shows scRNAseq of uninjured and DSS-treated zebrafish larval intestines from nod2+/+ and nod2mss13 backgrounds. UMAP shows joint clustering of 30,069 cells revealing 32 unique clusters (top). The top 5 representative markers for each cluster are shown (rows) (bottom). FIG. 61 depicts a UMAP showing separation of clusters between human-zebrafish species integration via scRNAseq (top); the top 3 representative markers for each cluster are shown (rows) (bottom). Row names are gene names, and columns are designated cell types, Expression is UMI counts per gene per cell.
[0031] FIGs. 7A-7F show that NOD2 deficiency enhances collagen-high expressing cell differentiation from CD 14+ monocytes. FIG. 7A shows morphological quantification of CD14+ CD16- PBMC differentiation from N0D2WT/WT or N0D2MT/MT cells, upon stimulation with 2.5 pg/mL Pam3Cys, 0.5 pg/mL Lipid A, and 1 pg/mL MDP via ImageJ. Classification of categories is as follows: spindle: 0-0.29, intermediate: 0.3-0.64, round: 0.65-1. n = 6 biological replicates for NOD2WI/WI and n= 3 biological replicates for N0D2MT/MT carriers per each treatment condition, data are mean ± SEM. *P<0.05; **P<0.01 (paired Wilcoxon signed-rank test). FIG. 7B shows representative morphological images of “spindle”, “intermediate”, and “round” cells in NOD2 WT, IX and 2X carriers unstimulated or treated with 1 pg/mL MDP, or 0.5 pg/mL Lipid A, or 2.5 pg/m Pam3Cys. FIG. 7C shows the quantification of confocal staining of MPEG1, MFAP4 and COL5A1 in N0D2 WT CD14+ differentiated cells. Data are mean ± SEM of corrected cellular fluorescence as measured by integrated density via ImageJ. ***P<0.001; (2-way ANOVA test). FIG. 7D is a schematic of CD14+ CD16- PBMCs isolated from healthy N0D2 carriers and non-carriers, followed by differentiation assay (left). RT-PCR data showing relative gene expression of 1 pg/mL muramyl dipeptide (MDP)-treated CD14+CD16- PBMCs after 2 weeks of differentiation from N0D2WIYWT or N0D2MT/MT carriers, relative to unstimulated cells. n=5 biological replicates (right), data are mean ± SEM. FIG. 7E depicts RT-PCR data showing relative gene expression of unstimulated CD14+CD16+ PBMCs after 2 weeks of differentiation from N0D2wr/wr or N0D2MT/MT carriers. n=5 biological replicates, data are mean ± SEM. FIG. 7F shows secreted protein amount (pg/mL), as measured by Luminex, from unstimulated, 0.5 pg/mL Lipid A, 2.5 pg/mL Pam3Cys, or 1 pg/mL MDP- stimulated PBMCs as measured via Luminex. n=2 N0D2wr/wr cmie s, n=3 N0D2MT/MT carriers, data are mean ± SEM. *P<0.05; (2- way ANOVA test).
[0032] FIGs. 8A-8E show staining of key fibrotic protein deposition in zebrafish larvae and human ileal stricture resections. FIG. 8A shows Nod2 expression as assessed by western blotting to show loss of protein levels in nod2sa21011 and nod2mss13 CRISPR mutant zebrafish larvae. Larvae were untreated and protein was collected at 6 days post fertilization. FIG. 8B shows a UMAP of myeloid and stromal clusters from joint clustering of zebrafish scRNAseq larval cells, grouped by nod2+/+, and nod2mss13 genotypes. FIG. 8C shows N0D2 mutation information of patients in ileal CD cohort, used for differential expression analysis between activated and non-activated fibroblast and macrophage clusters. FIG. 8D shows transcription factors from Ingenuity Pathway Analysis upstream of genes enriched in activated fibroblasts and inflammatory macrophages from N0D2 risk allele vs. wildtype carriers. P-values were determined by IPA analysis for transcription factor regulation of genes in differential expression analysis. FIG. 8E depicts feature plots to show localized expression of key transcripts in nod2WT/WTlarvae from scRNA seq myeloid and stromal populations (log normalized expression). [0033] FIGs. 9A-9I show that gpl30 blockade by bazedoxifene ameliorates fibrosis signaling and poses a supplemental approach to anti-TNF therapy. FIG. 9A shows log2 microarray expression data from Arijs et al., 2009 dataset, showing expression of activated fibroblast-associated genes in anti-TNF (Infliximab) treated patients. Bars labeled “A” indicate Infliximab responders (before and after treatment), and bars labeled “B” indicate Infliximab non-responders (before and after treatment), data are mean ± SEM. *P<0.05; **P<0.01, ***P<0.001, ****P<0.0001 (paired Student’s /-test). FIG. 9B shows morphological quantification of CD14+ CD16- PBMCs differentiation from NOD2W1/W1 or N0D2MT/MT, unstimulated, stimulated with 0.5 pg/mL MDP alone, or co-stimulated with 0.5 pg/mL MDP + 1 pM Bazedoxifene. n = 6 biological replicates for NOD2 WT and n= 3 biological replicates for 2X carriers per each treatment condition (top) and CD 14+CD 16- PBMCs differentiated from NOD2wr/WTor NOD2Mr/Mr, unstimulated, stimulated with, 0.5ug/mL MDP alone, or co-stimulated with luM Bazedoxifene, or 0.05ug/mL a-gpl30 antibody (bottom), n = 2 biological replicates for each genotype, data are mean + SEM. *P<0.05; **P<0.01 (paired Wilcoxon signed-rank test). Classification of categories as follows: spindle: 0-0.29, intermediate: 0.3-0.64, round: 0.65-1. FIG. 9C shows secreted protein amount (pg/mL), as measured by Luminex, from unstimulated, 0.5ug/mL MDP, 0.5ug/mL MDP + luM Bazedoxifene, or 0.5ug/mL MDP + 0.05ug/mL a-gpl30 -stimulated PBMCs as measured via Luminex. n= 2 carriers for each genotype, data are mean ± SEM. FIG. 9D shows larval intestinal length of 2X-DSS or DSS + BZA co-treated nod2+/+, nod2+/~, and nod2'/' fish. n=3 clutches; 10-15 larvae per control and treatment group, data are mean ± SEM. *P<0.05; **P<0.01 (2-way ANOVA test). FIG. 9E shows percentage of stromal and myeloid populations out of total larval intestinal cells sequenced, comparing cells from DSS- treated larvae and DSS + BZA co-treated larvae. Dashed boxes indicate cell populations that were down-regulated only in nod2'/' DSS-treated larvae. FIG. 9F provides RT-PCR data of relative gene expression 24 hours post- IX DSS + BZA and 2X DSS + BZA co-treatment of nod2+/+, nod2+/~ or nod2'/' zebrafish larvae. n=4 biological replicates for IX treatment (4 clutches, 10-15 larvae per genotype per clutch); n=4 biological replicates for 2X treatment (4 clutches, 10-15 larvae per genotype per clutch), data are mean ± SEM. FIG. 9G shows violin plots for given genes significantly upregulated upon DSS -treatment, or down-regulated by DSS and BZA co-treatment in nod2mss13 larvae (log normalized expression). FIG. 9H shows violin plots for given genes significantly upregulated upon DSS -treatment, or down-regulated by DSS and BZA co-treatment in nod2'/' larvae (log normalized expression). FIG. 91 depicts hematoxylin and eosin staining of DSS and DSS+ BZA-co-treated nod2+/+ and nodd™^13 zebrafish larvae. Intestinal bulb hypertrophy was measured as indicated by scale bars, and quantified after IX (left) and 2X (right) treatments. >7=5-10 biological replicates for each condition, data are mean ± SEM. *P<0.05; **P<0.01 (2 way-ANOVA test).
[0034] FIGs. 10A-10F show that treatment with bazedoxifene during and after injury ameliorates myeloid- stromal activation. FIG 10A shows intestinal length quantification of 2X DSS-treated, 2X DSS + BZA-cotreated, or 2X DSS-treated followed by BZA treatment of nod2+/+ and nod.2~/~ larvae, n = 3 clutches; 10-15 zebrafish larvae per group. Data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. FIG. 10B provides a schematic to illustrate treatment and genotype groups of zebrafish larval intestines processed for single-cell RNA sequencing (scRNAseq). 0.075% DSS and lOuM BZA was used in each case. scRNAseq was performed using the 10X Genomics platform. FIG. 10C provides a Uniform Manifold Approximation and Projection (UMAP) to show joint clustering of 11,104 stromal and myeloid cells (from a total of 45,324 immune, epithelial, and stromal cells), revealing 18 unique clusters of myeloid and stromal subpopulations. FIG. 10D shows the percent of cells (total number of cells per cluster in a sample/total number of cells per sample) contributed to each cluster by treatment group. Dotted boxes are shown to highlight cell populations that contracted upon BZA treatment (during or post injury). FIG. 10E provides a UMAP to show 3225 stromal cells subclustered from a previously published dataset (Martin et al., 2019) of a Crohn’s disease ileal resection cohort (n = 11 patients, inflamed and uninflamed tissue), revealing 11 unique subclusters of stromal populations.
FIG. 10F provides a heatmap illustrating the top six unique transcription factors expressed by fibroblast and endothelial cell populations (rows). Expression is log normalized.
[0035] FIGs. 11A-11F show that gpl30 and associated expression on PDGFRAhi fibroblasts, inflammatory monocytes, and CD36hi endothelial cells reveals druggable subpopulations. FIG. 11A provides a heatmap illustrating an activated myeloid-stromal panel of genes in residential fibroblasts and activated fibroblasts (PDGFRAhi and PDPNhi) (rows). Numbers (in parentheses) indicate proposed lineage trajectory of populations. Expression is log normalized. FIG. 11B provides a table to show the top upstream regulators from Ingenuity Pathway Analysis upstream of genes enriched in PDGFRAhi vs PDPNhi activated fibroblasts. P values were determined by IPA for upstream regulation of genes upregulated in PDGFRAhi cells from differential expression analysis. FIG. 11C provides a UMAP to show joint clustering of 5378 cells from a terminal ileum resection of n = 1 Crohn’s disease patient (cells were processed via multimodal single cell CITE- and RNA- sequencing), revealing 17 unique clusters of immune, stromal, and epithelial populations. FIG. 11D provides a feature plot to illustrate gpl30 (adt_CD130) protein expression. FIG. HE provides ridge plots to show RNA (top, IL6ST) vs. protein (bottom, CD 130) expression of gpl30 from CITEseq analysis of Crohn’s ileal resection sample among stromal, endothelial, and myeloid populations (expression is log-normalized). FIG. HF provides a scatter plot to show concordance between PDPN and PDGFRA protein expression (top left), PDPN and gpl30 protein expression (top right), PDGFRA and gpl30 protein expression (bottom left), and CXCR5 and gpl30 expression (bottom right).
[0036] FIGs. 12A-12H show identification of a broad molecular signature, found both in tissue and in PBMCs, that identifies anti-TNF and Ustekinumab failure, and can be ameliorated with Bazedoxifene treatment. FIG. 12A provides a heatmap to show expression (log2(cluster expression/cluster averages)) of genes (columns) across immune and stromal subsets (rows) from scRNA-seq data of inflamed ileum from individuals with Crohn’s disease ileum (n = 11). Genes (columns) are those upregulated in mucosal biopsies from anti- TNF non-responding Crohn’s disease patients from Arijs et al., 2009 before treatment institution. Genes highlighted represent those enriched in activated populations of fibroblasts, endothelial cells, and macrophages that are also conserved in PBMCs. FIG. 12B provides a heatmap to show expression (log2(cluster expression/cluster averages)) of genes (columns) across all Peripheral Blood Mononuclear Cells (rows) from scRNA-seq data of PBMCs from individuals with Crohn’s disease ileum (n = 11). Genes (columns) are those upregulated in mucosal biopsies from anti-TNF non-responding Crohn’s disease patients from Arijs et al., 2009 before treatment institution. Genes highlighted represent those enriched in classical and non-classical monocytes, and in platelets, that are also conserved in ileal CD tissue. FIG.
12C provides a dotplot to show gene expression of significantly upregulated genes from Arijs et al., 2009 anti-TNF non-responders, in zebrafish larvae untreated or treated with 2X DSS or 2X DSS + BZA (expression is log-normalized). FIG. 12D shows percentage of tnfrsfla+ expressing and tnfrsf lb+ expressing cells (total number of gene+ cells per cluster in a sample/total number of cells per sample) from scRNAseq of zebrafish larvae untreated, treated with DSS and/or BZA. Data are mean ± s.e.m. *P < 0.05, **P < 0.01. FIG. 12E shows principal component (PC) analysis of the significantly upregulated genes from Arijs et al., 2009 before anti-TNF treatment institution in patients recovered, not recovered, and those who developed inflammation from the ustekinumab-treated patients in the UNITI trial (top; UNITI 1 cohort, bottom; UNITI 2 cohort). FIG. 12F provides a timeline showing Crohn’s disease “patient 13” (ref. pl3 from Martin et al., 2019) treatment and disease trajectory from 2017 to 2021. Green check mark indicates treatment success and reduced mucosal inflammation after Ustekinumab treatment (top). Cell percentages in “patient 13” ileum and PBMCs from scRNAseq results. FIG. 12G provides a schematic of CD14+CD16- PBMCs isolated from Crohn’s disease patient 13, and differentiation assay performed (top). Representative morphological images of differentiated cells either unstimulated or treated with 0.5ug/mL MDP, luM BZA, or 0.05ug/mL anti-gpl30 antibody, n = 5 images per well condition per patient. FIG. 12H shows gene expression fold change in treated relative to untreated patients.
[0037] FIG. 13 shows identification of a gene panel to predict potential bazedoxifene success in anti-TNF non-responders. Data from Arjis et al., 2009 was examined, and 126 genes were found to be upregulated in anti-TNF non-responders before treatment started. Previous data showed gpl30 and activated fibroblast genes in anti-TNF responders after treatment.
[0038] FIG. 14 provides further data showing identification of a gene panel to predict potential bazedoxifene success in anti-TNF non-responders. Many of these genes are expressed in inflammatory macrophages, activated fibroblasts, lymphatics, and CD36+ endothelial cells, highlighting the importance of the myeloid- stromal interaction, and also the perivascular niche.
[0039] FIG. 15 provides further data showing identification of a gene panel to predict potential bazedoxifene success in anti-TNF non-responders. Some of the non-responder genes in the blood of ileal CD patients can be identified, implicating monocytes (classical and non-classical) and platelets.
[0040] FIG. 16 shows data from a case study of a patient (“pl 3”) who failed anti-TNF therapy but responded to ustekinumab. Implicated populations include activated DCs, DC1, and inflammatory macrophages in tissue samples (left), and plasmablasts, pDCs, B cells, eDCs, and classical monocytes in PBMCs (right).
[0041] FIG. 17 provides a schematic showing the hypothesized role of dendritic cells (DCs) in treatment response and non-response.
[0042] FIG. 18 shows gene expression fold change examining T=14 CD14+ PBMC differentiation in treated relative to untreated patients. [0043] FIG. 19 shows RT-PCR gene expression timing of treatment with bazedoxifene in vivo. Co-treatment and post-DSS treatment with bazedoxifene reduce fibrotic and gpl30- family member induction most effectively.
[0044] FIG. 20 shows takeaways from single-cell RNA sequencing dataset. Joint clustering of 45,324 cells from untreated, DSS-treated, DSS + bazedoxifene co-treated, and DSS followed by bazedoxifene resolved 26 unique cell clusters (epithelial, innate immune, and stromal).
[0045] FIG. 21 provides additional data showing takeaways from single-cell RNA sequencing dataset related to timing of bazedoxifene in vivo. Key cell populations expand with DSS treatment and subsequently contract with DSS + bazedoxifene co-treatment. Cotreatment effects are more pronounced than post-treatment effects.
[0046] FIG. 22 shows identification of a gene panel to predict bazedoxifene success in anti- TNF non-responders. Many of the anti-TNF non-response genes (before treatment in Arijs et al., 2009) are downregulated with DSS + bazedoxifene co-treatment, suggesting that elevation of this signature can be ameliorated by bazedoxifene treatment. These effects are observed with some genes in DSS + bazedoxifene post-treatment, but effects are most pronounced with co-treatment.
[0047] FIG. 23 provides scatter plots to show unspliced and spliced proportions of mRNA expression per gene per cell from Crohn’s disease CDstromal scRNAseq dataset. Dotted line indicates steady state ratio, where RNA velocity is indicated (z.e., how much an observation deviates from that steady-state line). Positive velocity indicates a gene is upregulated, which also indicates a higher un spliced: spliced ratio. PDPN, IL6ST, and IL6 are all activated and have a positive velocity among stromal cells. Notably, IL6ST (gpl30) is activated.
DETAILED DESCRIPTION
[0048] Without being bound by theory, the present disclosure relates to the discovery that loss of NOD2 function leads to aberrant activated fibroblast and macrophage homeostasis. The inventors have discovered that cross-talk between stromal and myeloid cells results in a transcriptional profile associated with resistance to anti-TNF therapies, which are frequently used in the treatment of Crohn’s disease. Through these results, it has been discovered for the first time that gpl30 inhibitors, such as bazedoxifene, are useful in the treatment of Crohn’s disease. These therapeutics agents (e.g., gpl30 inhibitors (e.g., bazedoxifene)) are additionally capable of restoring sensitivity to anti-TNF agents in anti-TNF non-responder patients. Moreover, it has been discovered that the anti-TNF non-responder phenotype may be recognized based on detection of the gene signature of Table 1 in Example 1. In Example 1, it is demonstrated that gpl30 inhibition with bazedoxifene ameliorates pathogenic transcriptional activation of myeloid and stromal cells of the genes of Table 1, which represents a transcriptional signature (observed in non-responders even before anti-TNF treatment institution) that can be identified prior to treatment with a gpl30 inhibitor. This transcriptional signature may be probed and detected to identify not only anti-TNF non- responders, but also ustekinumab non-responders, thereby identifying suitable candidates for treatment with a gpl30 inhibitor (e.g., bazedoxifene) which causes the dampening of the transcriptional signature thereby also restoration of such treated subjects to anti-TNF and/or ustekinumab treatment.
[0049] Thus, in various aspects, the present disclosure provides methods, compositions, and kits for using gpl30 inhibitors as a means for treating Crohn’s disease, and for identifying anti-TNF and/or ustekinumab non-responding patients who would benefit from treatment with a gpl30 inhibitor. Accordingly, provided herein are methods for treating Crohn’s disease using gpl30 inhibitors. Also provided herein are methods for restoring sensitivity to anti-TNF and/or ustekinumab therapies in anti-TNF and/or ustekinumab non-responder subjects and methods for identifying such subjects. Further provided herein are kits and compositions for treating Crohn’s disease using a gpl30 inhibitor. In some embodiments, the gpl30 inhibitor is bazedoxifene.
Definitions
[0050] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms are clear; however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this disclosure, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including,” as well as other forms, such as "includes" and "included," is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise. [0051] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present disclosure unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of subjects.
[0052] That the present disclosure may be more readily understood, select terms are defined below.
[0053] “Crohn’s disease” is a chronic inflammatory disorder that affects the gastrointestinal tract. It is considered an inflammatory bowel disease (IBD) (e.g., an inflammatory condition of the colon and small intestine). Symptoms of Crohn’s disease may include, but are not limited to, abdominal pain, diarrhea, blood in stool, mouth sores, reduced appetite, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and fatigue. While definitive cause(s) of Crohn’s disease are presently poorly understood it is thought to be caused, at least in part, by environmental (e.g., diet, stress, external factors), immune, and bacterial factors, and is further believed to have a genetic component (as the disease is often observed in, or tends to run in, families) which may make subject more susceptible to the disease. The disease afflicts men and women nearly equally and while it can occur (e.g., present) at any age, it is most prevalently observed (e.g., diagnosed) in adolescents and adults in the age group of 15 - 35 years of age. Other risk factors that are believed to be associated with Crohn’s disease are, without limitation, ethnicity, cigarette use (e.g., tobacco use/inhalation), and nonsteroidal anti-inflammatory medication use.
[0054] In a Crohn’s disease subject, the immune system will often act aberrantly and initiate a response to harmless or beneficial bacteria present in a subject. This response often creates or triggers inflammation in the subject which can, among other things, lead to ulceration of an affected tissue (e.g., gastrointestinal tissue) and or thickening of the tissue. Other complications of Crohn’s disease include, without limitation, bowel obstruction, ulcers, fistulas, fissures, malnutrition, and colon cancer, as well as further complications that may come with the treatment of Crohn’s disease or any of the symptoms thereof.
[0055] As there is no known definitive cause of Crohn’s disease, there is also no single test which is definitive of a diagnosis of Crohn’s disease. Traditionally, a diagnosis of Crohn’s disease is reached by elimination of other possible causes (e.g., diseases) which may cause, indicate, or present with the symptoms as observed in a subject (e.g., by process of elimination of all other diseases or disorders which may cause the symptoms of the subject). Various tests may be used to reach this diagnosis (by eliminating other possibilities) such as blood tests, stool tests, endoscopies, colonoscopies, other imaging modalities (e.g., CT, MRI, X-ray), and tissue biopsies.
[0056] The treatments for Crohn’s disease often are aimed at managing the symptoms through non- surgical interventions. For example, without limitation, dietary changes and/or medications. Medications, for example, without limitation, may be anti-inflammatory drugs/compositions, immunomodulators, antibiotics, and/or biologies. Additionally, surgical intervention may be used to treat a subject with Crohn’s disease. It is estimated that approximately 75% of subjects diagnosed with Crohn’s disease will ultimately require surgery at some point in their life to treat the disease. Surgery often will be used to remove damaged portions of the affected tissue (e.g., gastrointestinal tract) and/or repair other damaged tissue.
[0057] A “subject” to which administration is contemplated refers to a human (z.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g., young adult, middle-aged adult, or senior adult)) or non-human animal. In some embodiments, the non-human animal is a mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey), commercially relevant mammal (e.g., cattle, pig, horse, sheep, goat, cat, or dog), or bird (e.g., commercially relevant bird, such as chicken, duck, goose, or turkey)). In certain embodiments, the non-human animal is a fish, reptile, or amphibian. The non- human animal may be a male or female at any stage of development. The non-human animal may be a transgenic animal or a genetically engineered animal. The term “patient” refers to a human subject in need of treatment of a disease. In some embodiments, a subject is human. In some embodiments, a patient is human. A subject or patient “in need” of treatment of a disease or disorder includes, without limitation, those who exhibit any risk factors or symptoms of a disease or disorder. Such risk factors or symptoms may be, for example and without limitation, any of those associated with Crohn’s disease as discussed herein. In some embodiments, a subject in need of treatment is one who exhibits characteristics of an anti- TNF non-responder, as discussed herein.
[0058] In some embodiments, a subject may be termed an anti-TNF non-responder, which is a term of art, generally known to refer to a subject who does not initially benefit from anti- TNF therapy or treatment for Crohn’s disease or who has a lessened benefit or no benefit resulting from the anti-TNF therapy or treatment after some duration of time following the initial anti-TNF therapy or treatment. Anti-TNF therapies include small molecules (e.g., thalidomide, lenalidomide, and pomalidomide), as well as monoclonal antibodies. In some embodiments, an anti-TNF non-responder is a primary anti-TNF non-responder. Primary anti-TNF non-responders are known in the art and generally referred to as subjects who do not benefit from anti-TNF therapy for Crohn’s disease at any point, e.g., they do not experience a benefit upon the first, or any subsequent, treatment received. In some embodiments, an anti-TNF non-responder is a secondary anti-TNF non-responder. Secondary anti-TNF non-responders are known in the art and generally referred to as subjects who initially benefit from anti-TNF therapy for Crohn’s disease when such therapy is initiated, but subsequently lose response while treatment is continued (for example, without limitation, subjects who show or experience a benefit upon the first treatment, but do not show or experience a benefit upon subsequent treatments, or as great a benefit as the first treatment). [0059] In some embodiments, a subject may also be termed an anti-IL12p40/IL23R therapy non-responder, referring to a subject who does not benefit from treatments targeting IL12p40/IL23R, such as ustekinumab.
[0060] The terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease described herein (e.g., Crohn’s disease). In some embodiments, treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed (e.g., prophylactically (as may be further described herein) or upon suspicion or risk of disease). In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease. For example, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of a history of symptoms). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence.
[0061] The terms “prevent,” “preventing,” and “prevention” refer to a prophylactic treatment of a subject who is not and was not diagnosed (as of the time of treatment, or upon which the treatment was predicated) with a disease or other condition but is at risk of developing, or suspected of having, the disease or other condition (or developing it again). In certain embodiments, the subject is at a higher risk of developing the disease or at a higher risk of regression of the disease than an average healthy member of a population. For example, without limitation, a subject may be at higher risk of disease if they exhibit any risk factors or symptoms of the disease. Such risk factors or symptoms may be, for example and without limitation, any of those associated with Crohn’s disease as discussed herein. In some embodiments, risk factors or symptoms include genetic characteristics, abdominal pain, diarrhea, blood in stool, mouth sores, reduced appetite, fever, abdominal distension, weight loss, anemia, skin rashes, arthritis, inflammation of the eye, and/or fatigue.
[0062] The terms “administer,” “administering,” and “administration” refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a compound described herein (e.g., a gpl30 inhibitor such as bazedoxifene or a derivative thereof), or a composition thereof, in or on a subject.
[0063] A “therapeutically effective amount” of a compound described herein (e.g., a gpl30 inhibitor (e.g., bazedoxifene or a derivative thereof)) is an amount sufficient to provide a therapeutic benefit in the treatment of a condition (e.g., Crohn’s disease) or to delay or minimize one or more symptoms associated with the condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of the condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms, signs, or causes of the condition, and/or enhances the therapeutic efficacy of another therapeutic agent. In certain embodiments, a therapeutically effective amount is an amount sufficient for inhibition of gpl30. In certain embodiments, a therapeutically effective amount is an amount sufficient for treating Crohn’s disease. In certain embodiments, a therapeutically effective amount is an amount sufficient for inhibition of gpl30 and treating Crohn’s disease.
[0064] In certain embodiments, an effective amount of a compound for administration one or more times a day to a 70 kilogram (kg) adult human comprises about 0.0001 milligrams (mg) to about 3000 mg, about 0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg, about 0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg, of a compound per unit dosage form. [0065] As used herein, the terms “signature,” “gene signature,” and “gene expression signature” refer to a single or combined group of genes in a cell with a uniquely characteristic pattern of gene expression. A characteristic pattern of gene expression may occur as a result of a disease or disorder (e.g., Crohn’s disease). Such a characteristic pattern may also occur as a result of the development of resistance to a treatment for a disease or disorder (e.g., resistance to anti-TNF therapies exhibited by anti-TNF non-responder subjects, as discussed herein). Gene signatures may be used for prognostic, diagnostic, and predictive applications (e.g., such signatures may be used to predict the survival or prognosis of an individual with a disease, or for differentiation between subtypes of a disease). Gene signatures may be observed in any cell type. In some embodiments, gene signatures are observed in fibroblasts (for example, activated fibroblasts). In some embodiments, gene signatures are observed in macrophages (for example, inflammatory macrophages). In certain embodiments, a gene signature comprises a transcriptional profile. A transcriptional profile is a profile of expressed gene products in a given transcriptome. A specific transcriptional profile may be associated with a specific disease or disorder (e.g., Crohn’s disease). A specific transcriptional profile may also be associated with the development of resistance to a specific treatment for a disease or disorder (e.g., resistance to anti-TNF therapies exhibited by anti-TNF non- responder subjects, as discussed herein).
[0066] In some embodiments, a gene signature comprises increased or decreased expression relative to a control sample of one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more) genes selected from the group consisting of: TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTHRC1, TNC, CSF3R, NCF2, STC1, FGF2, CCL2, PLXND1, LILRA2, G0S2, LRRC25, PLEK, CXCR2, IGFBP5, ENG, NRP2, MMP2, SLC2A3, TMEM71, RASSF8, SELL, PLTP, GLT1D1, LILRB3, MGP, FCN1, CSGALNACT1, COL7A1, COL15A1, RGS5, LILRA1, FCGR2A, SIGLEC5, CLEC7A, ANGPT2, EGFL6, ADGRE2, LOC 101928916///NNMT, CFH, PDPN, CMTM2, RGS2, COL6A3, PAPPA, ANGPTL2, DKK3, TLR4, CFHR1///CFH, FGR, SLC2A14///SLC2A3, IL7R, TIMP1, COL4A1, S100A4, LST1, TMEM45A, VWF, RGS18, SPARCL1, COL18A1, DUSP4, DSE, COL4A2, SLC9B2, EML1, ACSL4, KLHL5, CAV2, NINJ1, C3AR1, AKR1B1, PRKCDBP, TIMP2, C1R, SELM, LAMC1, GPX8, ELK3, TNFRSF1B, CEBPB, PRNP, MRC2, A2M, COTE1, MSANTD3, FGFR1OP2, PQEC3, and ABCG4.
[0067] A “gpl30 inhibitor” is an inhibitor of glycoprotein 130. Gpl30 is a transmembrane protein and a cytokine receptor within the IE-6 receptor family. It contains a WSXWS amino acid motif, which plays a role in ensuring correct protein folding and ligand binding. Gpl30 is composed of five fibronectin type-III domains and one immunoglobulin-like C2-type domain in its extracellular portion. Members of the IL-6, IL-11, OSMR, and LIFR families of receptors complex with gpl30 for signal transduction following cytokine engagement.
[0068] After complexing with other proteins, gpl30 is phosphorylated on tyrosine residues, leading to association with JAK/Tyk tyrosine kinases and STAT protein transcription factors (e.g., STAT-3) and activation of downstream genes. Activation of downstream genes (e.g., STAT-3) results cell survival, pro-inflammatory/fibrotic cytokines, and pathogenic T cell activation, among other effects. The effects of downstream signaling of gpl30 may be associated with development or worsening of the symptoms of a disease (e.g., Crohn’s disease) as discussed herein. For example, OSMR signaling plays a role in anti-TNF nonresponse, as discussed herein; IL11 signaling plays a key role in fibrosis; and IL6 signaling plays a key role in immune cell activation and proliferation. STAT3 also plays a central role in regulating genes enriched in N0D2 risk allele carriers, as discussed herein.
[0069] Gpl30 inhibitors specifically compete with receptor ligands (e.g., IL6, IL11, OSM, and LIF) for gpl30 to inhibit signaling. As discussed herein, gpl30 inhibitors may also inhibit downstream effects associated with gpl30 signaling (e.g., effects associated with Crohn’s disease symptoms and/or resistance to anti-TNF therapy as discussed herein). In some embodiments, a gp!30 inhibitor is bazedoxifene, having the structure:
Figure imgf000026_0001
[0070] In certain embodiments, a gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of bazedoxifene. In some embodiments, a gpl30 inhibitor is bazedoxifene. In some embodiments, a gpl30 inhibitor is a derivative of bazedoxifene. As used herein the term “inhibit” or “inhibition” in the context of an enzyme (e.g., gpl30) refers to a reduction in the activity of the enzyme. In some embodiments, the term refers to a reduction of the level of activation or signaling activity, e.g., gpl30 activity, to a level that is statistically significantly lower than an initial level, which may, for example, be a baseline level of activity. A baseline activity level, may be established by measuring (e.g., assessing, quantifying, observing) the activity level in a subject without treatment or prior to treatment, or may established from a group of subjects without treatment or prior to treatment. Additionally, a baseline activity level may be established through evaluation of measurements in a database, through analysis of subject histories, or any other means known or acceptable in the art. One of ordinary skill will readily appreciate that statistical methods exist and are readily employed to create and establish such baseline activity levels in subjects, and such experimentation is within such skilled artisan’s knowledge. In some embodiments, “inhibit” or “inhibition” refers to a reduction (as compared to a baseline activity level, and as shall be understood when referring to a “reduction” herein) of the level of enzyme activity, e.g., gpl30 activity, to a level that is less than 75%, less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1%, less than 0.01%, less than 0.001%, or less than 0.0001% of an initial level, which may, for example, be a baseline level of activity.
[0071] The term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid or with organic acids, such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods known in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N+(CI-4 alkyl)4- salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
[0072] The term “prodrug” refers to a compound that has cleavable groups and becomes, by solvolysis or under physiological conditions, one of the compounds described herein (e.g., a gpl30 inhibitor such as bazedoxifene or a derivative thereof), which are pharmaceutically active in vivo. Such examples include, but are not limited to, choline ester derivatives and the like, and N- alkylmorpholine esters and the like. Other derivatives of the compounds described herein have activity in both their acid and acid derivative forms, but in the acid sensitive form often offers advantages of solubility, tissue compatibility, or delayed release in the mammalian organism (see, Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985). Prodrugs include acid derivatives well-known to practitioners of the art, such as, for example, esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides. Simple aliphatic or aromatic esters, amides, and anhydrides derived from acidic groups pendant on the compounds described herein are particular prodrugs. In some cases, it is desirable to prepare double ester type prodrugs such as (acyloxy)alkyl esters or ((alkoxycarbonyl)oxy)alkylesters. Ci-Cs alkyl, C2-C8 alkenyl, C2- Cs alkynyl, aryl, C7-C12 substituted aryl, and C7-C12 arylalkyl esters of the compounds described herein may be preferred. [0073] The terms “tautomers” and “tautomeric” refer to two or more interconvertible compounds resulting from at least one formal migration of a hydrogen atom and at least one change in valency (e.g., a single bond to a double bond, a triple bond to a single bond, or vice versa). The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. Tautomerizations (z.e., the reaction providing a tautomeric pair) may be catalyzed by acid or base. Exemplary tautomerizations include keto-to-enol, amide-to-imide, lactam-to-lactim, enamine-to-imine, and enamine-to-(a different enamine) tautomerizations. [0074] It is also to be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers.” Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers.” When a compound has an asymmetric center (for example, it is bonded to four different groups) a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light. Enantiomers are designated as dextrorotatory or levorotatory (z.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either an individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture.” Compounds described herein (e.g., gpl30 inhibitors such as bazedoxifene or a derivative thereof) can comprise one or more asymmetric centers, and thus can exist in various stereoisomeric forms, e.g., enantiomers and/or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer, or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer.
[0075] The term “polymorph” refers to a crystalline form of a compound (or a salt, hydrate, or solvate thereof). All polymorphs have the same elemental composition. Different crystalline forms usually have different X-ray diffraction patterns, infrared spectra, melting points, density, hardness, crystal shape, optical and electrical properties, stability, and solubility. Recrystallization solvent, rate of crystallization, storage temperature, and other factors may cause one crystal form to dominate. Various polymorphs of a compound can be prepared by crystallization under different conditions. [0076] The term “co-crystal” refers to a crystalline structure comprising at least two different components (e.g., a compound disclosed herein, such as a gpl30 inhibitor, and an acid), wherein each of the components is independently an atom, ion, or molecule. In certain embodiments, none of the components is a solvent. In certain embodiments, at least one of the components is a solvent. A co-crystal of a compound disclosed herein and an acid is different from a salt formed from a compound disclosed herein and the acid. In the salt, a compound disclosed herein is complexed with the acid in a way that proton transfer (e.g., a complete proton transfer) from the acid to a compound disclosed herein easily occurs at room temperature. In the co-crystal, however, a compound disclosed herein is complexed with the acid in a way that proton transfer from the acid to a compound disclosed herein does not easily occur at room temperature. In certain embodiments, in the co-crystal, there is no proton transfer from the acid to a compound disclosed herein. In certain embodiments, in the cocrystal, there is partial proton transfer from the acid to a compound disclosed herein. Cocrystals may be useful to improve the properties (e.g., solubility, stability, and ease of formulation) of a compound disclosed herein.
[0077] The term “solvate” refers to forms of the compound, or a salt thereof, that are associated with a solvent, usually by a solvolysis reaction. This physical association may include hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. The compounds described herein (e.g., gpl30 inhibitors such as bazedoxifene or a derivative thereof) may be prepared, e.g., in crystalline form, and may be solvated. Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non- stoichiometric solvates. In certain instances, the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid. “Solvate” encompasses both solution-phase and isolatable solvates. Representative solvates include hydrates, ethanolates, and methanolates.
[0078] The term “hydrate” refers to a compound that is associated with water. Typically, the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R x H2O, wherein R is the compound, and x is a number greater than 0. A given compound may form more than one type of hydrate, including, e.g., monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R O.5 H2O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R-2 H2O) and hexahydrates (R-6 H2O)).
[0079] The term “derivative” in reference to bazedoxifene refers to any structural analog of bazedoxifene. A person of ordinary skill in the art would understand how to design and make such derivatives. Some bazedoxifene derivatives are also known in the art, including, for example, those described in Chen, S. el al. In Vitro and in Silico Analyses of the Inhibition of Human Aldehyde Oxidase by Bazedoxifene, Lasofoxifene, and Structural Analogues. J. Pharmacol. Exp. Ther. 2019, 371(1 ), 75-86, which is incorporated herein by reference. In some embodiments, a bazedoxifene derivative is lasofoxifene. In some embodiments, a bazedoxifene derivative is raloxifene. In some embodiments, a bazedoxifene derivative is des(l-azepanyl)ethylbazedoxifene. In some embodiments, a bazedoxifene derivative is bazedoxifene A-oxidc.
Methods of Use
[0080] In some aspects, the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof. In some embodiments, the method comprises administering to a subject a therapeutically effective amount of a gpl30 inhibitor. In some embodiments, administering a gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in a subject (e.g., wtl ; IL11-, tgfbla-, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof). In some embodiments, administering the gpl30 inhibitor decreases expression of wtl. In some embodiments, administering the gpl30 inhibitor decreases expression of IL11. In some embodiments, administering the gpl30 inhibitor decreases expression of tgfbla. In some embodiments, administering the gpl30 inhibitor decreases expression of cxcll3. In some embodiments, administering the gpl30 inhibitor decreases expression of mmp9. In some embodiments, administering the gpl30 inhibitor decreases expression of pdpn. In some embodiments, administering the gpl30 inhibitor decreases expression of chi3ll. In some embodiments, administering the gpl30 inhibitor decreases expression of pdgfra.
[0081] In some aspects, the disclosure relates to a method of modulating expression of a transcriptional profile, which is known as the profile of expressed gene products in a given transcriptome in relation to a disease or disorder (e.g., a profile comprising one or more transcriptional regulators selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof) in a subject by administering a therapeutically effective amount of a gpl30 inhibitor. In some embodiments, a transcriptional profile results from cross-talk between myeloid and stromal cells. In some embodiments, expression of a transcriptional profile is modulated to prevent activation of fibroblasts and/or inflammatory macrophages. In some embodiments, a transcriptional profile is modulated by inhibiting expression of one or more transcriptional regulators. In some embodiments, a transcriptional profile is modulated by promoting one or more transcriptional regulators. In some embodiments, a transcriptional profile is modulated by inhibiting expression of one or more transcriptional regulators and promoting one or more transcriptional regulators. In some embodiments, a transcriptional regulator is WT1. In some embodiments, a transcriptional regulator is STAT3. In some embodiments, a transcriptional regulator is TWIST 1. In some embodiments, a transcriptional regulator is CEBPB. In some embodiments, the gpl30 inhibitor is bazedoxifene or a derivative thereof.
[0082] In some aspects, the disclosure relates to a method of restoring sensitivity of a subject (e.g., a subject having a transcriptional profile associated with anti-TNF resistance) to anti- TNF agents. In some embodiments, restoring sensitivity in a subject can be achieved by administering a therapeutically effective amount of a gpl30 inhibitor (e.g., bazedoxifene) to a subject to decrease expression of activated fibroblast transcripts (e.g., wtl ; IL111, tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or combination thereof) in a subject. In certain embodiments, a transcriptional profile results from cross-talk between myeloid and stromal cells. In some embodiments, the activated fibroblast transcript is wtl. In some embodiments, the activated fibroblast transcript is IL11. In some embodiments, the activated fibroblast transcript is tgfbla. In some embodiments, the activated fibroblast transcript is cxcll3. In some embodiments, the activated fibroblast transcript is mmp9. In some embodiments, the activated fibroblast transcript is pdpn. In some embodiments, the activated fibroblast transcript is chi3ll . In some embodiments, the activated fibroblast transcript is pdgfra. In some embodiments, a gpl30 inhibitor is bazedoxifene or a derivative thereof.
[0083] In some aspects, the disclosure relates to a method for identifying a Crohn’s disease subject in need of treatment. In some embodiments, identifying such a subject can be achieved by taking a sample from the subject and evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier (e.g., one or more signatures selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9). In some embodiments, a signature may be expression of a gene (e.g., gene product). In some embodiments, a signature may be expression of one or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST 1, CEBPB, CXCL13, MMP9, or a combination thereof. In certain embodiments, a signature may be expression of exactly two, or two or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In still other embodiments, a signature may be expression of exactly three, or three or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In yet other embodiments, a signature may be expression of exactly four, or four or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In other embodiments, a signature may be expression of exactly five, or five or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In still other embodiments, a signature may be expression of exactly six, or six or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In other embodiments, a signature may be expression of exactly seven, or seven or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In still other embodiments, a signature may be expression of exactly eight, or eight or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In yet other embodiments, a signature may be expression of exactly nine, or nine or more of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In other embodiments, a signature may be expression of exactly ten, or ten or more of WTl, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In some embodiments, a signature may be expression of WT1. In other embodiments, a signature may be expression of all eleven of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9. In some embodiments, a signature may be expression of WT1. In some embodiments, a signature may be expression of IL11. In some embodiments, a signature may be expression of PDPN. In some embodiments, a signature may be expression of CHI3L1. In some embodiments, a signature may be expression of IL6. In some embodiments, a signature may be expression of OSM. In some embodiments, a signature may be expression of STAT3. In some embodiments, a signature may be expression of TWIST 1. In some embodiments, a signature may be expression of CEBPB. In some embodiments, a signature may be expression of CXCL13. In some embodiments, a signature may be expression of MMP9. In certain embodiments, the method further comprises administering a gpl30 inhibitor to the subject. In some embodiments, the gpl30 inhibitor is bazedoxifene or a derivative thereof.
[0084] As used in the methods herein, a sample may be any sample from a subject. For example, without limitation, blood, skin, tissue, hair, saliva, bodily fluid, cells, or any other biological component from which the skilled artisan may ascertain, using techniques known and readily available in the art, the parameter being evaluated (e.g., enzyme activity, signaling activity, protein or nucleic acid expression, etc). As used herein, an evaluation shall refer to any analysis done to ascertain (e.g.. assess for presence or absence, quantify, establish the quality of (for example, compare for mutations or other aberrant property as compared to a wild-type or native version of the sample), or measure) a property of a sample. The property may be of those stipulated herein, or of those which are readily apparent as related thereto by the skilled artisan.
[0085] In another aspect, the disclosure relates to a method for identifying and treating a Crohn’s disease subject in need of treatment. In some embodiments, identifying such a subject can be achieved by a) taking a sample from the subject; b) evaluating a sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier (e.g., one or more signatures selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9); and c) administering a gpl30 inhibitor to a subject. In some embodiments, a signature may be expression of a gene (e.g., gene product). In some embodiments, a signature may be expression of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, MMP9, or a combination thereof. In some embodiments, a signature may be expression of WT1. In some embodiments, a signature may be expression of IL11. In some embodiments, a signature may be expression of PDPN. In some embodiments, a signature may be expression of CHI3L1. In some embodiments, a signature may be expression of IL6. In some embodiments, a signature may be expression of OSM. In some embodiments, a signature may be expression of STAT3. In some embodiments, a signature may be expression of TWIST 1. In some embodiments, a signature may be expression of CEBPB. In some embodiments, a signature may be expression of CXCL13. In some embodiments, a signature may be expression of MMP9. In some embodiments, the gpl30 inhibitor is bazedoxifene or a derivative thereof. [0086] In another aspect, the disclosure relates to a method of treating Crohn’s disease in a subject. In some embodiments, treating Crohn’s disease in a subject is accomplished by administering any of the compositions disclosed herein to the subject.
[0087] In some aspects, the disclosure relates to a method of treating Crohn’s disease in a subject in need thereof, the method comprising: (i) evaluating a sample taken from the subject for a gene signature comprising increased or decreased expression relative to a control sample of one or more genes (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more of the genes) selected from the group consisting of TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTHRC1, TNC, CSF3R, NCF2, STC1, FGF2, CCL2, PLXND1, LILRA2, G0S2, LRRC25, PLEK, CXCR2, IGFBP5, ENG, NRP2, MMP2, SLC2A3, TMEM71, RASSF8, SELL, PLTP, GLT1D1, LILRB3, MGP, FCN1, CSGALNACT1, COL7A1, COL15A1, RGS5, LILRA1, FCGR2A, SIGLEC5, CLEC7A, ANGPT2, EGFL6, ADGRE2, LOC 101928916///NNMT, CFH, PDPN, CMTM2, RGS2, COL6A3, PAPPA, ANGPTL2, DKK3, TLR4, CFHR1///CFH, FGR, SLC2A14///SLC2A3, IL7R, TIMP1, COL4A1, S100A4, LST1, TMEM45A, VWF, RGS18, SPARCL1, COL18A1, DUSP4, DSE, COL4A2, SLC9B2, EML1, ACSL4, KLHL5, CAV2, NINJ1, C3AR1, AKR1B1, PRKCDBP, TIMP2, C1R, SELM, LAMC1, GPX8, ELK3, TNFRSF1B, CEBPB, PRNP, MRC2, A2M, COTL1, MSANTD3, FGFR1OP2, PQLC3, and ABCG4; and (ii) administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor if the presence of the gene signature is observed in the sample taken from the subject.
[0088] In some embodiments, the method further comprises administering a therapeutically effective amount of an anti-TNF therapy to the subject along with the gpl30 inhibitor. In some embodiments, the method further comprises administering a therapeutically effective amount of an anti-IL12p40/IL23R therapy (e.g., ustekinumab) to the subject along with the gpl30 inhibitor.
[0089] In some embodiments, the control sample is a sample taken from an anti-TNF nonresponder subject. In some embodiments, the control sample is a sample taken from an anti- IL12p40/IL23R non-responder subject. In some embodiments, the control sample is a sample taken from a healthy subject who does not have Crohn’s disease. In some embodiments, the subject has not been administered an anti-TNF therapy or an anti-IL12p40/IL23R therapy previously. In some embodiments, the presence of the gene signature in the sample taken from the subject indicates that the subject is an anti-TNF non-responder and/or an anti- IL12p40/IL23R non-responder. In some embodiments, administering the gpl30 inhibitor to the subject restores expression levels of the one or more genes in the gene signature to the levels observed in the control sample.
[0090] In any of the methods as described herein, a gpl30 inhibitor may be a selective estrogen receptor modulator (SERM). In any of the methods as described herein, a gpl30 inhibitor may be bazedoxifene. In any of the methods as described herein, a gpl30 inhibitor may be a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, cocrystal, solvate, hydrate, or derivative of bazedoxifene.
[0091] In some embodiments, as used in any of the methods as described herein, a subject is an anti-TNF non-responder (e.g., a primary anti-TNF non-responder or a secondary anti-TNF non-responder), or at risk for being an anti-TNF non-responder (e.g., at risk for being a primary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder). In some embodiments, as used in any of the methods as described herein, administering a gpl30 inhibitor to a subject prevents collagen secretion or activation; prevents intestinal length shortening; or decreases gpl30 target gene activation in the subject.
[0092] In some embodiments, any of the methods as described herein further comprise administering an anti-TNF treatment or therapy in conjunction with the administration of a gpl30 inhibitor. In some embodiments, the anti-TNF treatment or therapy is administered contemporaneously with the administration of the gpl30 inhibitor. In some embodiments, the anti-TNF treatment or therapy is administered prior to the administration of the gpl30 inhibitor. In some embodiments, the anti-TNF treatment or therapy is administered subsequent to the administration of the gpl30 inhibitor. In some embodiments, the anti-TNF therapy or treatment is formulated into a composition with a gpl30 inhibitor. In some embodiments, a gpl30 inhibitor used in conjunction with an anti-TNF therapy is bazedoxifene or a derivative thereof.
[0093] In some embodiments, in any of the methods as described herein, a gpl30 inhibitor is administered at least 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) time to a subject. In some embodiments, in any of the methods as described herein, a gpl30 inhibitor is administered more than 1 time (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) to a subject. In some embodiments, a gpl30 inhibitor is administered hourly, daily, weekly, monthly, yearly, or any interval therein (e.g., twice a day, every other day, bi-weekly, bi-monthly, every 3 days, every 10 days, and all intervals envisioned by the skilled artisan). In some embodiments, in any of the methods as described herein, an anti-TNF treatment or therapy is administered at least 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) time to a subject. In some embodiments, in any of the methods as described herein, an anti-TNF treatment or therapy is administered more than 1 time (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more) to a subject. In some embodiments, an anti-TNF treatment or therapy is administered hourly, daily, weekly, monthly, yearly, or any interval therein (e.g., twice a day, every other day, biweekly, bi-monthly, every 3 days, every 10 days, and all intervals envisioned by the skilled artisan). In some embodiments, an anti-TNF treatment or therapy is administered on the same schedule and/or at the same interval as a gpl30 inhibitor. In some embodiments, an anti-TNF treatment or therapy is administered on a different schedule and/or at a different interval from a gpl30 inhibitor.
Compositions
[0094] In certain embodiments, a compound described herein (e.g., a gpl30 inhibitor such as bazedoxifene or a derivative thereof) is provided in an effective amount in a composition. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is an amount effective for treating Crohn’s disease in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for preventing Crohn’s disease in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for reducing the risk of developing Crohn’s disease in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for inhibiting the activity of gpl30 in a subject or cell. In certain embodiments, the composition contains a second therapeutic agent (e.g., an anti-TNF agent). In some embodiments, an anti-TNF agent is a small molecule. In some embodiments, an anti-TNF agent is thalidomide. In some embodiments, an anti-TNF agent is lenalidomide. In some embodiments, an anti-TNF agent is pomalidomide. In some embodiments, an anti-TNF agent is a monoclonal antibody.
[0095] Compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include bringing the compound(s) described herein (z.e., the “active ingredient(s)”) into association with a carrier or excipient, and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping, and/or packaging the product into a desired single- or multi-dose unit. Compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. A “unit dose” is a discrete amount of the composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage, such as one -half or one-third of such a dosage. Relative amounts of the active ingredient(s), the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition described herein will vary, depending upon the identity, size, and/or condition of the subject treated, and further depending upon the route by which the composition is to be administered. The composition may comprise between 0.1% and 100% (w/w) active ingredient(s).
[0096] Pharmaceutically acceptable excipients used in the manufacture of provided compositions include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweetening, flavoring, and perfuming agents may also be present in the composition.
[0097] The compounds and compositions provided herein can be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol. Specifically contemplated routes are oral administration, intravenous administration (e.g., systemic intravenous injection), regional administration via blood and/or lymph supply, and/or direct administration to an affected site. In general, the most appropriate route of administration will depend upon a variety of factors, including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and/or the condition of the subject (e.g., whether the subject is able to tolerate oral administration).
[0098] In one aspect, the disclosure relates to a composition comprising a gpl30 inhibitor and an anti-TNF agent. In some embodiments, the composition comprises a therapeutically effective amount of the gpl30 inhibitor and the anti-TNF agent. In certain embodiments, the composition comprises one or more pharmaceutically acceptable excipients. In some embodiments, the gpl30 inhibitor is a selective estrogen receptor modulator (SERM). In some embodiments, the gpl30 inhibitor is bazedoxifene. In certain embodiments, the gpl30 inhibitor is a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative of bazedoxifene.
Kits
[0099] Also encompassed by the disclosure are kits (e.g., pharmaceutical packs). The kits provided may comprise a composition or compound described herein and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container). In some embodiments, provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of a composition or compound described herein. In some embodiments, the composition or compound described herein provided in the first container and the second container are combined to form one unit dosage form.
[0100] Thus, in one aspect, provided are kits including a first container comprising compound(s) or composition(s) described herein. In certain embodiments, the kits are useful for treating a disease (e.g., Crohn’s disease) in a subject in need thereof. In certain embodiments, the kits are useful for preventing a disease (e.g., Crohn’s disease) in a subject in need thereof. In certain embodiments, the kits are useful for reducing the risk of developing a disease (e.g., Crohn’s disease) in a subject in need thereof. In certain embodiments, the kits are useful for inhibiting the activity of gp 130 in a subject or cell.
[0101] In certain embodiments, a kit described herein further includes instructions for using the kit. A kit described herein may also include information as required by a regulatory agency such as the U.S. Food and Drug Administration (FDA). In certain embodiments, the information included in the kits is prescribing information. A kit described herein may include one or more additional pharmaceutical agents described herein as a separate composition.
[0102] In one aspect, the disclosure relates to kits for treating or for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease. In some embodiments, a kit for treating such subjects comprises a gpl30 inhibitor and an anti-TNF agent. In some embodiments, a kit for diagnosing such subjects comprises reagents for performing any of the methods described herein and a gpl30 inhibitor. In some embodiments, a kit comprises any of the compositions disclosed herein.
EXAMPLES
[0103] Cross-talk between activated macrophages and fibroblasts is increasingly understood to drive susceptibility and complications of Crohn’s disease (CD)3, which most commonly affects the terminal ileum. Design principles of stable macrophage-fibroblast systems have been reported, involving growth factors (e.g. CSF1, PDGFs) and autocrine and paracrine feedback loops7. Perturbations to stable systems can include genetic variation, especially major effect genes associated to human disease. The highest effect risk alleles in European ancestry Crohn’s disease are loss-of-function N0D2 alleles, which are associated with an earlier age of onset, and increased risk for fibrostenotic complications6,8; however mechanisms by which NOD2 loss drives fibrostenotic complications have not yet been fully elucidated. N0D2 genotype status has thus far not been reported to correlate with response to anti-TNF, the major agent used to treat moderate to severe Crohn’s disease9,10; however major clinical factors, such as the timing of anti-TNF introduction6,11, may confound retrospective, observational studies. Rather, elucidation of precise cell types at the single-cell level has defined combinations of cell clusters that together define a composite gene-set score correlated with anti-TNF non-response3. While the anti-TNF non-response module includes IgG producing plasmablasts and activated T cells, the majority of transcripts in the model are expressed in activated macrophages and fibroblasts3.
Example 1: Inflamed ileal CD14+PDGFRA + pathogenic cells contribute to myeloid- stromal crosstalk
[0104] As opposed to most tissues, tissue resident macrophages in the gut are constantly replenished from peripheral blood monocytes12, and similar gene expression is observed between blood monocytes and tissue macrophages (FIG. 1A). The activated fibroblast cluster is characterized by increased expression of PDPN, CHI3L1, MMP3, IL11 and WT1, with none of these genes highly expressed in peripheral blood mononuclear cells (PBMCs) or in the uninflamed tissue (FIG. 1A; FIG. 6A). Abundantly expressed collagens, such as COL5A1 and COL1A1 are observed in both activated and non-activated tissue fibroblasts, with COL1A1 demonstrating relative induction in the activated fibroblast cluster. Despite the sparsity of the 10X Genomics Chromium platform, 97.6% of cells in the activated fibroblasts cluster expressed at least one UMI (unique molecular identifier) of COL1A1, compared to 40% of cells expressing the stromal cell growth factor receptor, PDGFRA (platelet derived growth factor receptor A). Of interest, 6.5% and 4.3% of cells in the activated fibroblast cluster expressed CD14, and both CD14 and PDGFRA, respectively (FIG. IB). The UMI counts of the CD14+PDGFRA+ cells did not fall outside the UMI distribution characteristic of single cells, indicating that these cells are unlikely to be doublets, but rather single cells co-expressing CD14 and PDGFRA. To validate and explore transcriptional features of the PDGFRA+CD14+ double-positive population, selected transcript levels were compared between three inflamed vs. non-inflamed resected human ileal tissues and obtained an average of 3.52xl04/1.81xl06 (1.9%) and 1.75xl03/4.76xl05 (0.4%) CD14+ PDGFRA+/CD14- cells from inflamed and uninflamed ileum respectively (FIG. 6D). An elevated activated fibroblast transcriptional signature was observed in inflamed doublepositive cells compared to uninflamed (FIG. 1C). Specifically, pro-fibrotic mediators WT1 and ILll 'u (downstream of WT115) were significantly enriched in the inflamed CD14+PDGFRA+ cells (FIG. 1C).
[0105] At the histological level, expression of WT1, PDGFRA, and CD14 was shown in stromal and myeloid cells of the muscularis mucosae of lymphoid aggregates, and around blood vessels in the inflamed strictured ileal tissue (FIG. ID and FIG. 6F). Staining for monocyte and macrophage marker MPEG1 and extracellular matrix protein marker MFAP4 was also observed in inflamed human ileal strictures (FIG. 6E). An intravasation of leukocytes in the muscularis mucosae and a deposition of MFAP4 in stromal cells around blood vessels was observed. These findings implicate key points of entry in a pathogenic niche, where activated myeloid and stromal cells communicate in the inflamed fibrotic tissue16.
[0106] Crohn’s disease often involves transmural inflammation of the ileum, with frequent hypertrophy of the intestinal lumen. To explore fibroblast sub-types in response to injury in vivo, scRNASeq was performed on full thickness intestines dissected from dextran sodium sulfate (DSS)-treated zebrafish larvae, using protocols as reported previously17. Joint clustering of 30,069 cells revealed 32 distinct clusters comprising a first, single-cell atlas of the zebrafish larval intestine (FIG. 6H). To explore and confirm conserved orthologous clusters, integrated clustering was performed between zebrafish and human innate immune, stromal and epithelial cells (FIG. IE and FIG. 61) and observed conservation of key myeloid, stromal, and epithelial clusters. A random forest model was generated to compare the transcriptional profiles of human and zebrafish cells; as expected, the proportion of actual and predicted cells were highly correlated per cluster when testing the human dataset using the model (FIG. IF). The performance of the model on zebrafish data shows high accuracy, as almost all clusters were classified correctly. Additionally, transcriptomic analysis revealed key populations that shared distinctive gene expression signatures (FIG. 1G). Of note, the activated fibroblast cluster shows conserved expression of COL1A1, PDGFRA, WT1, and IL11 between human and zebrafish cells. These data highlight the power of the zebrafish larval DSS model in representing key hallmarks present in human ileal CD.
[0107] It was previously reported that intravasation of CD 14+ monocytes into the inflamed, but not uninflamed, CD ileum is a key hallmark of a pathogenic cellular module3. To explore this mechanism in vivo, leukocyte infiltration was quantified in the anterior intestine of DSS - treated nod2+/+ and nod2mss13 CRIS PR-mediated knockout zebrafish larvae. Significant enrichment of leukocytes was observed in the intestine of IX DS S-nod2mss13 zebrafish larvae, and importantly in 2X DSS-nod2~/~ zebrafish larvae compared to 2X DSS-nod2mss13 treated larvae (FIG. 1H). These data show intestine- specific recruitment of leukocytes in vivo upon injury (FIG. 1H and FIG. 6G).
Example 2: N0D2 deficiency enhances an activated fibroblast and inflammatory macrophase signature
[0108] Given that N0D2 can sense bacterial components in fibroblasts during infection18 and that N0D2, RIPK2 and XIAP are observed in activated fibroblast clusters within inflamed ileum (FIGs. 1A and 6B), it was hypothesized that the Crohn’s disease-associated N0D2 loss-of-function alleles drive aberrant differentiation and function of newly recruited CD 14+ PBMCs, resulting in relative induction of activated collagen-high expressing cells compared to classical macrophages19. These activated cells secrete chemokines and monokines, which in turn recruit additional CD 14+ PBMCs to the inflamed tissue. To test this, the top 200 genes were selected that are differentially expressed between activated and non-activated scRNAseq clusters to develop “activated fibroblast” and “inflammatory macrophage” signature scores from terminal ileal bulk RNASeq for patients in the inception, pre-treatment pediatric RISK cohort12 (see Methods). The top most significant principal components, calculated from activated fibroblast and inflammatory macrophage signature patterns across each of the RISK samples, show changing impact on gene expression based on minor allele count (zero (A = 140), one (A = 61), and two (A = 17) NOD2 risk alleles carried by CD patients), with a significant difference observed between wildtype and double-dose (homozygous or compound heterozygous) carriers (FIG. 2A). Consistent with the hypothesis of greater blood monocyte recruitment, significant increases in CD14 gene expression were observed with increasing NOD2 risk allele carriage. Similar trends are observed for PDGFRA, activated fibroblast markers (PDPN, CH13L1). matrix metalloproteinases (MMP3, MMP9 and gpl30 family genes (IL11, IL6, OSM) (FIG. 2A).
[0109] To directly model CD 14+ PBMC differentiation, established in vitro methods20,21 were adapted to test on N0D2 wildtype ( WT/WT heterozygote (WT/MT) or homozygote (MT/MT) PBMCs from healthy volunteers, to avoid the confounding effects of inflammation with CD patients (FIG. 2B). The NOD2-activating ligand, muramyl dipeptide (MDP), is a component of bacterial cell walls22, and induces production of macrophage- specific inflammatory mediators which polarize monocyte differentiation towards macrophages with short-term periods of MDP stimulation23,24. Long-term, chronic differentiation conditions were tested with and without MDP stimulation for two weeks. Consistent with the hypothesis, an increase in spindle-like collagen-high expressing cells was observed upon differentiation of CD 14+ PBMCs from N0D2 homozygote risk allele carriers vs. wildtype carriers (FIG. 7A), also marked by pro-fibrotic deposition of MFAP4, COL5A1 along edges of spindle cells, and global expression of COL1A1 (FIG. 2B). In contrast, the myeloid marker MPEG1 mostly localized to the cytoplasm of classical macrophages (FIG. 2B), although some co-expression is observed with MFAP4 in spindle cells (FIG. 2B, merged images and FIG. 7C). In the absence of NOD2, signaling is elevated by intracellular pattern recognition receptors18,25, long-term LPS stimulation can induce TLR4 signaling in spindle-cells26, and MDP can enhance LPS-induced TLR4 expression on stromal cells27. Long-term stimulation with both Lipid A and MDP can induce spindle-cell differentiation (FIG. 7A). In N0D2MT/MT carriers, COL1A1 secretion is induced by Lipid A, Pam3Cys, and MDP stimulation (FIG. 2C), whereas only MDP stimulation significantly induces secretion of IL6 and CXCL13 (FIG. 7F). Consistent with the morphological findings (FIGs. 7A and 7B), with increasing NOD2 risk alleles, an enrichment of the activated fibroblast gene signature (PDPN, MFAP4, CXCL13, IL11, WT1) was observed with MDP stimulation; while genotype-dependent trends were observed for WT1, the most significant differences observed were with IL11 (FIG. 2C). [0110] Next a zebrafish nod.2 mutant line (nod2sa21011)28 and zebrafish nod.2 CRISPR- mediated knockout line (nod2mssl3 were utilized to investigate the in vivo effects of recurrent MDP exposure on gene expression, measuring selected transcripts 24 and 48 hours after MDP removal (FIG. 2E). Key activated fibroblast transcripts are upregulated when one or more copies of nod2 are lost upon stages of recovery in MDP-mediated injury. While in nod2+/+ fish these transcripts recover to baseline during recovery phases, recovery was not achieved in nod2+/sa21011 or nOd2sa21011/sa21011 backgrounds after single or repetitive injury (FIG. 2F). Of note, pro-fibrotic transcription factor wtl remains elevated in no 2sa21011/sa21011 larvae with repetitive MDP injury, indicating sustained upstream transcriptional activation. [0111] To more broadly test mechanisms and timing of repair and fibrotic responses, treated zebrafish larvae were treated with one and two doses of DSS. Consistent with mouse models of DSS -colitis29, it is shown that DSS-injury significantly reduces intestinal length in both single and repetitive injury (FIG. 3A). Interestingly, marked differences in the kinetics of the profibrotic cytokine IL11 were observed, stratified by nod2 genotype. In nod2+'+ larvae, maximal IL11 immunofluorescent expression is observed immediately after DSS treatment; in marked contrast, IL11 expression was significantly increased in nod2mss13 larvae 24 hours post DSS removal, with substantially higher absolute levels of IL11 observed at that time (FIG. 3B). Key activated fibroblast and macrophage transcripts were also enriched when one or more copies of nod2 are lost after 24 hours of recovery in single (IX) and repetitive (2X) DSS-injury (FIG. 3C). These data implicate that Nod2 loss inhibits efficient amelioration of fibrotic and inflammatory activation at the molecular level.
[0112] Joint clustering of scRNAseq myeloid and stromal cells from nod2+/+ and nod2mss13 DSS-treated zebrafish larvae resolved 21 distinct clusters (FIGs. 3D, and 3E). Significant enrichment in activated transcripts coll al, col5al, wtl, mmp9, and tgfbla was observed in DSS-treated compared to untreated control larvae; of note, wtl and mmp9 were only significantly enriched in nod2mss13 DSS-treated zebrafish (FIG. 3F). These transcripts were specifically expressed in wtlhl stromal cells, pdgfrahl stromal cells, mesothelial cells, and activated macrophages (FIG. 3G and FIG. 8E), and an expansion of these populations was observed in DSS-treated nod2mss13 larvae vs. nod2+/+ larvae (FIG. 3H). These results together reveal key transcripts and cell populations that are elevated in injury upon loss of Nod2 at the single-cell level.
Example 3: Transcriptional regulation of NOD2MT-associated expression
[0113] To define mechanisms driving the pathogenic myeloid-stromal niche, differential expression was performed in activated fibroblasts and inflammatory macrophages from the scRNAseq datasets comparing N0D2 wild-type with N0D2 risk allele carriers (FIG. 8C). An increase in pro-inflammatory and pro-fibrotic cytokines in N0D2 risk allele carriers was observed, including MMP3, CCL2, CHI3L1, IL6, TNF and CXCL13. Ingenuity pathway analysis testing for upstream transcriptional regulators of differential gene expression between NOD2 genotypes in activated fibroblasts and inflammatory macrophages was performed. In activated fibroblasts, upstream transcriptional regulators revealed WT1 , STAT3 (FIG. 31), TWIST1, and CEBPB as highly significant regulators of differentially expressed genes in N0D2 risk allele carriers. More significant regulation by WT1 in activated fibroblasts (P value = 1.4 x 10 15) was observed compared to inflammatory macrophages (P value = 1.2 x 10-8, FIG. 8D). Comparing the top transcriptional regulators shared between the two cell types, STAT3 demonstrated uniquely high enrichment in both inflammatory macrophages (P value = 1.0 x IO-46) and activated fibroblasts (P value = 4.6 x 10 19) (FIG. 8D).
Example 4: gpl30 inhibitor bazedoxifene ameliorates pathogenic stromal-myeloid activation
[0114] Inhibition of JAK-STAT pathways via JAK-level inhibition is an area of active therapeutic development in IBD30. However, given the combinatorial complexity at this level of cytokine signaling, molecular specificity is compromised, and many JAK inhibitors have been associated with substantial side effects31. Given the key roles for a) OSM signaling in anti-TNF non-response2, b) IL11 in fibrosis13 14, and c) IL6 in immune cell activation and proliferation32, combined with a central role for STAT3 in regulating genes enriched in N0D2 risk allele carriers in both arms of the activated macrophage-fibroblast niche (FIG. 31), it was reasoned that blockade of the common cytokine receptor subunit, gpl30 (IL6ST) (FIG. 4A) might precisely target aberrant or inappropriate fibrotic responses to injury. In particular, bazedoxifene (BZA) is a small molecule gpl30 inhibitor which has recently been repurposed to treat colorectal and pancreatic cancers in preclinical models33-35.
[0115] The Arijs d al. dataset, which compares the bulk mucosal intestinal transcriptome before and after anti-TNF treatment36, was analyzed. Comparing post-treatment gene expression along the gpl30 pathway, marked induction of IL11, OSM, IL6, and IL6R was observed in treatment refractory patients compared to patients who responded to anti-TNF treatment (FIG. 4B); similar patterns were observed with CHI3L1 and PDPN. N0D2 expression decreased significantly in TNF responders, but not in non-responders, reflecting the induction of N0D2 transcript levels in activated macrophages (FIG. 9A). Consistent with previous reports, pre-treatment gene expression of OSM2, CHI3L1 and PDPN was higher in anti-TNF non-responders, and these transcripts remained elevated in non-responders even after anti-TNF institution. Of note, TWIST1 remained significantly elevated in nonresponders despite anti-TNF treatment; TWIST 1 is a key transcriptional inducer of activated fibroblasts37, it regulates genes differentially expressed by N0D2 risk allele carriers, and its expression is decreased with bazedoxifene treatment in livers from mice fed high fat diets38. [0116] To test the effects of bazedoxifene on CD14+ PBMC differentiation, CD14+ PBMCs were differentiated from N0D2 wildtype or N0D2 homozygote risk allele carriers in the presence of MDP alone or MDP co-treated with bazedoxifene for 2 weeks. Significant reduction in CXCL13, MMP3, and IL6 secretion was observed in co-treated PBMCs differentiated from N0D2MT/MT carriers, as well as a reversion of spindle-cell morphology to round cell morphology (FIG. 4Cand FIG. 9B). Specificity of bazedoxifene inhibition of gpl30 was confirmed by co- stimulating CD14+ PBMCs with MDP and a monoclonal gpl30 antibody, and consistently observed the same reversion of spindle-cell to round cell morphology (FIG. 9B) and reduced secretion of gpl30-cytokines, OSM, IL6, and IL11 (FIG. 9C).
[0117] Finally, gpl30 (il6st) expression in the zebrafish scRNAseq stromal cell clusters was inspected, which revealed its broad expression in all subtypes present transmurally (FIG. 4D). DSS + BZA co-treated larvae demonstrated significant reduction in key activated transcripts compared to DSS-treated larvae, with a significant reduction in cebpb, mmp9 and pdgfra in the nod2mss13 background only (FIG. 4E and FIG. 9G-9H). While bazedoxifene may have broad beneficial effects in vivo, key cell types that contracted upon DSS + BZA co-treatment compared to DSS-treatment alone were wtlhl stromal cells, pdgfrahl stromal cells, mesothelial cells, activated macrophages, activated endothelial cells, and myoblasts (FIG. 4F). Interestingly, pdgfrahl stromal cells, mesothelial cells, activated macrophages, and myoblasts only contracted in nod2mss13 larvae co-treated with DSS + BZA (FIG. 9E). A reduction of leukocytes and reduced intestinal bulb hypertrophy were also observed in the anterior intestine upon IX and 2X DSS + BZA, and this was significantly decreased in double-dose co-treatment of nod2mss13 larvae (FIG. 4G and FIG. 91). Bazedoxifene also significantly prevented intestinal length shortening (FIG. 4H), and significantly decreased activated fibroblast transcripts (yvtl, ill 1, tgfbla, cxcl!3, tnfa) for all genotypes; the reduction was more pronounced with repeated injury and co-treatment (2X DSS + BZA) compared to single treatment (FIG. 41). Notably, bazedoxifene does not decrease expression of genes that are necessary for transient, necessary wound healing. While some genotype-dependent trends of activated fibroblast transcripts were observed, especially with IX DSS (FIG. 9F), no significant genotype differences were observed in bazedoxifene response with 2X DSS; rather, bazedoxifene demonstrated generalized benefit that was most pronounced with repeated injury.
[0118] Taken together, serial transcriptome analyses before and after anti-TNF treatment, as well as in vivo amelioration of pathogenic myeloid-stromal activation, implicate blockade of gpl30 signaling as an important complementary pathway in addition to anti-TNF therapy.
Discussion
[0119] In this study, mechanisms by which N0D2 deficiency drives a pathogenic macrophage-fibroblast program were elucidated. This finding is conserved across a) direct ex vivo analyses of Crohn’s disease patients carrying N0D2 risk alleles, b) altered in vitro differentiation of CD 14+ PBMCs from N0D2 risk allele healthy controls carriers to produce collagen-high expressing cells, and c) in vivo zebrafish models of DSS -intestinal injury and nod.2 deficiency. Activated transcripts such as IL11, OSM, WT1, PDPN, CXCL13, and CCL2 orchestrate autocrine and paracrine crosstalk between newly recruited monocytes and activated fibroblasts of the diseased ileum. WT1 is a transcription factor that has been implicated in myofibroblast transformation in fibrotic lung disease39 and in mesothelial and fibroblastic stromal cells in homeostasis and disease40,41. WT1 is enriched in the CD14+PDGFRA+ subset of activated fibroblasts, enhanced in the in vitro and in vivo systems under NOD2-deficient backgrounds, and serves as an upstream transcriptional regulator of genes enriched in activated macrophages and fibroblasts from N0D2 risk allele carriers. Among other upstream transcriptional regulators of AOD2 w/-associatcd genes, STAT3 was highly significant in both cell types.
[0120] Beyond defining N0D2 genotype-dependent effects by direct ex vivo and in vitro studies (FIG. 5), the in vivo modeling with zebrafish allowed conserved defining of stromal subsets transmurally. A NOD2-dependent, conserved role was confirmed for WT1-IL11 and CXCL13 dysregulation with MDP exposure and tissue injury responses. CXCL13 enhances B cell recruitment and anti-microbial antibodies (e.g. ASCA, CBir)41, which can antedate disease presentation in Crohn’s disease by many years. To this extent, it was shown that cotreatment of DSS with bazedoxifene with single and repetitive injury partially ameliorates aberrant stromal-myeloid activation via molecular measurements at the single-cell level. [0121] Early institution of anti-TNF treatment in moderate to severe Crohn’s disease maximizes its benefit43. Treatment non-response may result from delayed treatment institution, as well as primary and secondary non-response (FIG. 5). Bazedoxifene, a specific gpl30 inhibitor, is an FDA-approved selective estrogen receptor modulator (SERM); it has recently been proposed for repurposing in the treatment of colon and pancreatic cancers33,35, with dampening of proliferative pathways demonstrated. PGE2 production from PDGFRA+PTGS2+ mesenchymal cells have been implicated in intestinal tumorigenesis via epithelial PTGER444; neoplasia is an uncommon, but dreaded complication of long-standing IBD. Therapeutic approaches targeting IL6 and IL11 in CD have been reported in clinical trials, but have not advanced toward approval of clinical use45,46. A potential advantage of using bazedoxifene in anti-TNF refractory CD patients is the simultaneous targeting of both myeloid and stromal arms of the pathogenic module. Foss of response in patients who initially responded to anti-TNF treatment (secondary non-responders) may reflect the cumulative effects of dysregulated NOD2 function and altered fibroblast-macrophage interactions and differentiation states over time. Despite the primacy of TNF in Crohn’s disease pathogenesis47 and clinical efficacy, combination therapies targeting distinct pathways, such as with bazedoxifene, will likely be required to substantially improve outcomes. Future combination efforts will require safety and efficacy studies, guided by genetically-driven patient selection, and interval transcriptome analyses at disease presentation, after treatment, and with disease progression.
Methods
RNA isolation and cDNA synthesis
[0122] RNA isolation (1): Cells/zebrafish larval intestines were homogenized in 1000 pF Trizol and vigorously vortexed. RNA isolation was performed using chloroform isolation (Qiagen), and the final pellet was resuspended in 20 pF RNase-free water. RNA was heated to 70°C before cDNA synthesis to disrupt any secondary structures.
[0123] RNA isolation (2): for <500,000 cells in a sample, the Invitrogen RN Aqueous Micro Kit (AM1931) was used to isolate RNA. Cells after CD14+ differentiation were scraped and homogenized immediately in 200 pF of lysis buffer (provided in kit). RNA isolation was performed via column methods as described in the protocol, briefly with 2 wash buffer steps, and an elution phase. The final column wash was resuspended in 20 pF RNase free water. RNA was heated to 70°C before cDNA synthesis to disrupt any secondary structures. cDNA was synthesized using Fife Technologies SuperScript III First-Strand Synthesis SuperMix (18080400) for qRT-PCR. Up to 1 pg of RNA was run per sample per reaction and the final volume of cDNA generated was 20 pF. [0124] In all cases where DSS-treatment was used, an additional Lithium Chloride purification step48 was performed to inhibit interference with PCR amplification. qRT-PCR
[0125] Applied Biosystems reagents and machinery were used in all qRT-PCR reactions. Briefly, using the Power Sybr Green PCR Master Mix (Life Technologies, #4368577) 1 pL of cDNA concentrate was used in a 20 pL qPCR reaction. 500 nm of forward and reverse primers were used in each reaction. Plates were spun at 200 x g for 1 minute before loading into the One-Step PCR thermocycler. The following conditions were used to run samples: 96°C heat for 15 minutes, 96°C, 72°C, 54°C (X40), 54°C, 96°C. Ct values from duplicated reactions were averaged and 2-Ct(target)/2-Ct(reference) method was used to calculate expression, with rpl32 serving as reference genes for human cells and zebrafish larvae.
Where genotype and treatment both served as independent variables, values were first normalized to genotype, then to treatment, to calculate fold change.
Figure imgf000049_0001
Figure imgf000050_0001
Unless otherwise specified, nucleic acid sequences are described 5' to 3'.
Human specimens
[0126] Patients eligible for inclusion in the study were identified by screening surgical programs at the Mount Sinai Hospital. Ileal resections from Crohn’s Disease patients and venous blood were collected after surgical resection. Healthy volunteers with N0D2 mutations of interest were screened through the Charles Bronfman Institute for Personalized Medicine at Mount Sinai. 21 mL of venous blood was collected from these patients, for downstream PBMC isolation. Protocols were reviewed by the Institutional Review Board (IRB) at the Icahn School of Medicine at Mount Sinai (Mechanisms of intestinal inflammation following ileal resection for Crohn’s Disease, HSM#13-00998; Recall and Deep Phenotyping of BioAfe Participants, #17-02727))
Single- cell isolation from terminal ileum plus CD14+PDGFRA+ sorting
[0127] Single-cell suspensions were prepared from 20-30 mucosal biopsies per resection as previously described3. Cell suspensions from both tissues were subject to CD 14+ magnetic selection, using the Miltenyi Biotec CD14 negative selection kit (#130-091-153). CD14+ cells (unstained at this point) were then washed and incubated with Miltenyi anti-biotin CD140a (PDGFRa) antibody (#130-115-335) for 10 minutes in the dark at 4°C. After washing, cells were incubated with anti-biotin microbeads for 15 minutes at 4°C and run through magnetic separation columns. Positive and negative fractions from each separation were pulled down, cells were counted, and cells were dissociated in Trizol for RNA isolation.
CD14+ PBMC differentiation
[0128] 21 mL of blood was isolated from healthy patients with QX(WT/WT), 1 x,WT/M I or 2X(MT/MT), N0D2 genotype status. PBMCs were isolated using the BD Vacutainer CPT Mononuclear Cell Preparation Tube-Sodium Heparin (BD Biosciences) and centrifuged for 20 minutes at 1800 x g at room temperature, with brakes off. PBMC were collected at the interphase and were subject to CD 14+ separation (Miltenyi CD 14+ negative selection kit). Final CD 14+ cell suspensions were resuspended in DMEM + 20% HI-FBS. About 1 million cells were plated per well in a 6 well plate with or without stimuli (below). At 48 hours post plating, unattached cells were aspirated and new media was added. Cells were left to differentiate for 2 weeks following removal of non-adherent cells21.
Figure imgf000051_0001
Luminex assay of CD14+ PBMCs
[0129] Supernatants from NOD2 7 and NOD2MT CD 14+ differentiated PBMCs were collected 2 weeks after initial seeding. Custom Luminex plates were designed by R&D Systems to capture analytes of interest, and all analyses were performed at Mount Sinai’s Human Immune Monitoring Core, according to the manufacturer’s directions.
CD14+ differentiated cells quantification
[0130] 5 images per well of cells were taken using the EVOS FL imaging system. Using ImageJ, each cell of interest was selected by the freeform drawing selection tool. Measurements were set to "area, mean grey value, integrated density, and shape descriptors". After all cells were outlined, "measure" was applied on all selected cells to quantify number of cells per morphological characterization based on the roundness parameter: "Spindle" = 0- 0.29, "Intermediate" = 0.3-0.64, "Round" = 0.65-1.
Immunofluorescence of CD14+ PBMCs
[0131] Cells were washed in IX PBS for 1 minute before fixing. Cells were fixed in Paraformaldehyde (4% in PBS), permeabilized where needed using Triton-X (0.2% in PBS), and blocked in UltraCruz blocking reagent (Santa Cruz Biotechnology, sc51624) for 30 minutes at room temperature. Cells were incubated in 1:166 anti-MPEGl antibody (LSBio, LS-C680878), 1:200 anti-MFAP4 antibody (SCBT, sc398438), or 1:100 anti-COL5Al-FITC antibody (SCBT, scl66155), and diluted in UltraCruz blocking reagent overnight at 4°C. Cells were then incubated in secondary antibodies (1:5000, goat anti-rabbit or anti-mouse Alexafluor 568/388, Abeam) for 1 hour at room temperature. Cells were washed and mounted with DAPI-mounting medium (EMS; #17984-24) and imaged either using EVOS upright microscope, or with the ZEISS LSM 800 Airyscan confocal microscope. All images were quantified using ImageJ via the Corrected Total Cell Fluorescence method.
Immunohistochemistry of stricture slides (terminal ileum)
[0132] Serial 4 pm-thick sections from each block of stricture uninflamed and inflamed regions were taken to perform the following immunohistochemical analyses as previously described49. For double stains, tissue specimens were fixed in 10% formalin and embedded in paraffin and 3 //m sections were used for IHC.
[0133] IHC was performed using VENTANA DISCOVERY ULTRA from Roche. This system allows for automated baking, deparaffinization and cell conditioning. Semiautomatic dual staining was performed sequentially using WT1 at a 1:25 dilution (abeam ab89901) during 60 min. As secondary antibody Discovery OMNIMap anti-rabbit-HRP from Roche (760-4310) was used and the signal was obtained using Discovery ChromoMap DAB RUO from Roche (760-2513) (brown signal). PDGFRA (Thermofisher TA804956) was used at a 1:50 dilution during 60 min and after secondary antibody (Discovery OMNIMap anti-mouse- NP from Roche (760-4816)) positive signal was obtain using Discovery Purple Kit (760-229) (purple signal). Tissues were counterstained with Hematoxylin to visualize the nuclei.
Figure imgf000053_0001
Zebrafish maintenance
[0134] Adult zebrafish were maintained on a 14:10 hour light dark cycle at 28°C. Wildtype (WT; AB) and nod2sa21011 (Sanger Mutation Database) and CRIS PR-mediated nod2 /_ knockout lines were used for all experiments. Fertilized eggs following natural spawning were cultured in 28C fish water (0.6g/L Crystal Sea Marinemix). Where larvae were used for drug treatments, all larvae were maintained in 50 mL petri dishes in a 28°C incubator, and not in the fish facility. Larvae and adults were fed once a day with Hikari First Bites (Hikari) after 6dpf and Zeigler Zebrafish Diet with Hatching Brine Shrimp Eggs (Pentair Aquatic Eco-Systems, FL), respectively. The Mount Sinai School of Medicine Institutional Animal Care and Use Committee approved all protocols.
CRISPR-Cas9 generation of nod2 mutant zebrafish line
[0135] 58 pmol crRNA (sequences below), 58 pmol FP-labeled tracrRNA (Sigma), and 6.75 pmol Cas9 protein were combined and allowed to complex for 30 minutes on ice prior to injection. AB WT zebrafish embryos were injected with 4 nL of injection mix per embryo at the one- to four- cell stage. Embryos were screened for the presence of fluorescent gRNA at 2-3hpf. 5dpf larvae were collected for gDNA extraction. A region of genomic DNA containing the intended CRISPR target site was amplified by PCR. PCR products were purified using Qiaquick PCR Purification Kit (Qiagen). The EnGen® Mutation Detection Kit (NEB) was used to identify mosaicism for nod2 mutations. Once T7 digest indicated the presence of CRISPR-Cas9-induced mutations, injected fish were added to system and raised to adulthood.
[0136] At 3 months of age, CRISPR F0 fish were outcrossed against AB WT fish. gDNA was extracted from 5 dpf larvae, and the EnGen® Mutation Detection Kit was used to identify clutches with germline-transmitted mutations. Clutches positive for mutations in nod2 were added to system and raised to adulthood. At 2-3 months of age, Fl fish were fin clipped. High resolution melting (HRM) analysis was used to identify Fl fish that were heterozygous for a mutation in nod2 (sequences below). gDNA from mutant heterozygotes was PCR amplified and sequenced by Sanger sequencing (Genewiz). CRISP- ID was used to predict the mutated sequence50. Fish predicted to carry the same mutation became founders for the mutant line and were incrossed. Resultant embryos were sequenced with Sanger sequencing (Genewiz) to confirm the mutant sequence. The resulting mutation is a 4bp deletion (CTTG) in exon 1, which causes a premature stop, resulting in a frameshift. The genomic location is Chr7:37563204-37563207. Mutants were assigned the allele name “mssl3” by The Zebrafish Information Network (ZFIN).
Figure imgf000054_0001
[0137] After intestinal dissections of 6dpf zebrafish larvae, carcasses were placed in 20 pF NaOH for genomic DNA isolation. Fish carcasses in suspension were heated at 96 °C for 15 minutes, tubes were spun down, and 2 pF of Tris-HCF was added to each reaction. Tubes were vortexed and gDNA was either immediately used or stored at -20 °C. All gDNA was nano-dropped for concentration prior to running Taqman assays. [0138] nod2sa21011 fish probe was designed to perform Taqman genotyping =
TTTTGGCTGCGATTGAGCAAGAATTAGCTGAGGAG[C/T]AAAAGGCTGGACTATG TTTTGGTAATGGATGCGTT (SEQ ID NO: 45)
[0139] Taqman genotyping protocol (96-well plate; 25 pL reaction) was followed and plates were run on the Viia7 Applied Biosystems Taqman genotyping system.
DSS treatment of zebrafish larvae
[0140] Single and repetitive DSS treatments were conducted as described in Chuang et al., 2019, however with 0.075% DSS (MP Biomedicals #0216011010) used in all cases and firsttime treatments were conducted at 5dpf. All incrossed larvae were subject to treatments; a single DSS treatment period consists of 24 hours. Larvae were collected for further experimental use (intestinal dissections, followed by genotyping and RNA extractions) 24 hours post removal of DSS, during the rescue phase. A second dose of DSS was administered 48 hours after recovery of the first dose, at 8dpf. DSS was treated for 24 hours and the larvae were then recovered to egg water. Collection timepoints were taking 24 hours after DSS removal.
MDP treatment of zebrafish larvae
[0141] A 10 mg/mL working stock of Muramyl Dipeptide (MDP, InvivoGen #53678-77-6) was diluted to 1 pg/mL for all treatments. No more than 20 larvae at 5dpf were placed in 1.5 mL Eppendorf tubes and incubated with 1 pg/mL MDP in 1 mL egg water with the cap open, in a 37°C incubator for 1 hour. Larvae were rinsed and moved to fresh egg water in a petri dish for rescue. Larvae were collected for further experimental use (intestinal dissections, followed by genotyping and RNA extractions) at 1 hour, 24 hours, and 48 hours post removal of MDP, during the rescue phases. A second 1-hour incubation of MDP was conducted at 8dpf, and similar timepoints were collected post recovery.
Bazedoxifene treatment of zebrafish larvae
[0142] Bazedoxifene (BZA) concentrations (Selleck Chemicals #S2128) were titrated to obtain an optimal concentration of 10 pM. (adaptation from prior murine studies33, decrease in pSTAT3 upon treatment, and no toxicity to zebrafish larvae). Bazedoxifene was either administered alone or with 0.075% DSS co-treatment to nod2 WT, +/- or -I- larvae at 5dpf (IX) and 8dpf (2X), by emulsion in 15 mL egg water. 24 hours after each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 hours after removal of DSS and/or BZA. STAT3-inhibitor treatment of zebrafish larvae
[0143] S3I-201 (Sigma-Aldrich SML0330-5MG) STAT3 -inhibitor concentrations were titrated to obtain an optimal concentration of 20 p M. S3I-201was either administered alone, or with 10 pM BZA co-treatment to nod2 WT, +/- or -I- larvae at 5dpf (IX) by emulsion in 15 mL egg water. 24 hours after each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 hours after removal of DSS and/or BZA.
Western Blotting
[0144] Protein lysates were prepared from 5dpf zebrafish larvae. Twenty larvae were homogenized in lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, 2 mM EDTA, 10% glycerol and protease inhibitors), by manual homogenization, followed by sonication. All lysates were centrifuged in a 1:5 volume of sample buffer (2% SDS, 5% 2- mercaptoethanol final concentration). Samples were boiled to 96°C for 5 minutes before loading into Mini-Protean TGX 4-15% gels (Bio-Rad), and western blotted. Membranes were blocked for 45 minutes in 5% BSA in TBST (0.1% Tween 20). Membranes were probed with a custom anti-zebrafish nod2 antibody, raised in rabbit (1:500, Pocono Rabbit Farm) or antizebrafish phospho-STAT3 antibody (1:500, MBL #D 128-3), and anti-tubulin antibody (1:2000, Cell Signaling #2148) in 5% BSA in TBST, at 4°C overnight. Membranes were washed and incubated in HRP-conjugated secondary antibody (1:5000 goat anti-rabbit, and 1:5000 goat anti-mouse). Immunoblots were developed with SuperSignal West Pico (Life Technologies) and were visualized by chemiluminscence using standard film developing processes. Band intensities were quantified through ImageJ; fold change was normalized first to tubulin, and then to no treatment controls.
Immunohistochemistry of zebrafish larval sections
[0145] IX or 2X- untreated, DSS-treated or DSS+BZA co-treated zebrafish larvae were fixed in 4% PFA for 24 hours at 4°C. Larvae were then embedded in the Mount Sinai Biorepository and Pathology Core. Paraffin sections are cut at 4 pm using a Leica RM2125 RTS manual rotary microtome. The sections are placed on de-ionized water heated to a temperature of 40°C using the Fisher Tissue Prep Flotation Bath, Model 134. Sections are picked up using StatLab Colorview Adhesion slides and placed in a 60°C oven for 30 minutes. After removing from the oven, they are cooled and placed on the Leica Autostainer XL for H&E staining. [0146] Quantification of leukocytes were performed in ImageJ by measuring number of leukocytes in a 1.5x3.5mm square area of the anterior intestine.
Immunofluorescence of zebrafish larval sections
[0147] Zebrafish were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) overnight at 5 days postfertilization (dpf) and transferred to 30% sucrose in PBS overnight. Larvae were embedded in optimum cutting temperature (OCT) compound (Tissue - Tek), and 10-pm serial sections were obtained using the Leica CM3050 S Research Cryostat. Sections were washed in PBS + 0.1% Tween-20 (PBST). Tissue sections were blocked with 5% fetal bovine serum (FBS) and 2% bovine serum albumin (BSA) in PBST for 1.5 hours at room temperature (RT). Sections were stained with IL11 antibody (1:150, Thermo Fischer #PA5-36544 or isotype control IgG rabbit antibody 1:1, Thermo Fisher #08-6199), overnight at 4°C and then with 1:250 goat anti-rabbit Alexa Fluor 488 (for-ILl 1 non-fluorescently labeled) or Alex Fluor 647- conjugated Phalloidin antibody (1:250, Thermo Fisher, #A22287) for 1.5 hours in the dark at room temperature. Sections were mounted with Pro Long Gold Antifade Mountant with 4',6-diamidino-2-phenylindole (DAPI; Life Technologies) and imaged using a Leica SP5 DMI at 20X and 40X.
Intestinal dissections of larval zebrafish
[0148] 6dpf and 9dpf zebrafish larvae treated with DSS, DSS + BZA, MDP, or untreated, were subject to intestinal dissections. Larvae were anesthetized with Tricaine solution (1.25 g/500 mL water, pH 7.4) and an individual larva was placed in a depression slide with 3% methylcellulose in preparation, ensuring that the larva was laid anterior to posterior. One razor blade was used to keep the larva in place at the swim bladder, while the other razor blade was used to scoop the intestine free from the remaining carcass. Intestines were pooled and placed in Trizol for RNA extraction, or autoMACS Rinsing Solution (Miltenyi, # 130- 091-222) for single cell suspension. Where genotyping was conducted, individual carcasses were placed into NaOH in PCR strip tubes, while intestines were placed individually into tubes with Trizol.
Larval zebrafish intestinal length measurements
[0149] Single course DSS treatments were administered to 5dpf zebrafish larvae. DSS or DSS + BZA-treated fish were washed and removed to clean egg water at 6dpf. Larvae were individually mounted onto a depression slide with 3% methylcellulose and imaged under brightfield view, using a 4X objective on EVOS XL core microscope. Gut length measurements were characterized from the intestinal bulb until the completion of the intestine at the anal pore of the larva and body length measurements were characterized from tip of head to tail; measurements were quantified using Image J and the Wilcoxon-signed rank test was used to compare differences between control and treated fish (not genotype-dependent) or 2-way ANOVA (genotype variable included) to test for multiple comparisons.
Single-cell RNA sequencing of zebrafish larvae
Single-cell suspension
[0150] Post intestinal dissections, 20-30 pooled larval intestines were mixed into an autoMACS blending tube (Miltenyi, # 130-093-237) with 2 mL autoMACS Rinsing Solution (PBS + EDTA + 0.5% BSA). Tubes were rocked for 30 minutes at room temperature to exclude epithelial cell proportions. Tubes were spun at 4200 rpm for 5 minutes. After removal of the supernatant, intestinal pellets were resuspended in 2 mL PBS -EDTA +Ca2+ + Mg2+ +lmg DNasel + Img Collagenase IV. Tubes were rocked for 35 mins at 37 °C at lOOrpm. Mixtures were filtered with a 70 pM filter into a new tube and spun at 4200 rpm for 5 minutes. Final suspensions were generated in 300 pL PBS + 0.5% BSA. Cells were counted with AO/PI dye using the Nexcelom Biosciences cell counter and viability was -65%. 10,000 cells were loaded onto the 10X Genomics Chromium™ Controller instrument within 30 minutes of completion of cell suspension using GemCode Gel Bead and Chip (10X Genomics, Pleasanton, CA). Cells were partitioned into Gel Beads in Emulsion in the Controller where cell lysis and reverse transcription occurred. Libraries were prepared using 10X Genomics Library Kits and sequenced on Illumina NextSeq500, according to manufacturer’s recommendations.
Alignment, transcriptome assembly, and QC
[0151] Raw BCL (raw base call) files generated from Illumina were demultiplexed using cellranger-v4.0.0 which uses bcl2fastq pipeline, into single cell fastq files. FASTQs were then aligned to an Ensembl GRCzl 1 zebrafish genome and transcript count matrices were generated using default parameters in cellranger count. The raw (unfiltered) output matrices were then used for the clustering and downstream analysis in Seurat-v3.1. Density plots for UMI, number of genes, and mitochondrial percentages were analyzed for each sample. Data was filtered to include cells with >200 UMIs and 250>genes per cell>4000. Clustering was performed using the R package ‘Seurat Version 3.1’. Samples were individually normalized, and the 200 most variable genes were identified for each sample. Integration of all zebrafish samples was performed using “FindlntegrationAnchors”, ensuring appropriate metadata annotation for each sample (genotype, treatment, stage). The data was scaled in Seurat, and dimensionality reduction was then performed; the first 18 principal components were used to generate clustering, with a resolution of 0.8. Cluster marker genes were identified using the “FindAllMarkers” function.
Differential expression between clusters/samples
[0152] In all cases for differential expression testing in zebrafish samples, the “FindMarkers” function was used, with test.use = “negbinom”, to account for the one-tailed distribution of UMIs in each cluster.
Stromal and myeloid subclustering
[0153] Cells annotated in “stromal” or “myeloid” families were subsetted; normalization and identification of variable features was once again conducted. After dimensionality reduction, the first 15 principal components were used to generate clustering, with a resolution of 0.8. Human-zebrafish integrated clustering
[0154] Human-to-fish orthologs lists were generated using ZFIN zebrafish-human orthologs database dated 020.08.20. The orthologs in the database are curated considering 3 factors - CL (Conserved Genome Location), AA (amino acid sequence comparison) and PT (Phylogenetics Tree). Raw (unfiltered) matrices for human single cell data from 22 paired samples previously published3 were filtered to contain only cells with genes detected > 500, number of UMI > 300 and at least minimum 5 cells. The gene names from Fish data were changed to their corresponding orthologous pair in the Human- Zebrafish ortholog database created above. Joint clustering of Human-Fish was performed using Seurat-v3.1. The dataset was inspected for the number of significant PCs using the 200 most variable genes on an elbow plot. For the integrated clustering, the first 15 principal components were used to perform clustering with a resolution of 1.2.
Random Forest Models
[0155] Cross species random forest models were trained using the ‘randomForest’ R package with normalized gene expression values from myeloid and stromal subsets from fish and human ileal CD datasets. Gene names in the fish dataset were renamed to their corresponding human orthologous gene names from the above Human-Fish orthologs dataset. The following parameters were used to run the training on the human dataset with a total of 9157 cells: ntree=1000, mtry =square root of total gene (9740). The fish dataset with total of 7983 cells was used as the test dataset. The ‘Predict’ function was used for the prediction in the test data using the random forest model. Activated fibroblast and inflammatory macrophages PCA analyses of RISK patients [0156] RNA-seq data collected from RISK consortium terminal ileum biopsies (PMIDs: 25003194, 28259484, 30692607) was normalized (median-of-ratios) using DESeq2 (PMID: 25516281) based on calculated size factors.
[0157] Differential expression was performed between the following cellular subsets in the scRNAseq human CD ileal dataset (FindMarkers in Seurat v.3):
[0158] 1. ident.l=activated fibroblasts vs. ident.2=residential fibroblasts
[0159] 2. ident.l inflammatory macrophages vs. ident.2=residential macrophages,
[0160] from clusters previously reported in the ileal scRNA sequencing cohort. Macrophage and fibroblast top 200 pattern genes were then used to calculate the first 10 principal components (PCs) across each of the RISK samples, and each component was tested along with sex in a series of linear (for NOD2 minor allele count) or logistic (for stricturing status and anti-TNF response) regression models to identify relationships between cell-specific PC scores and NOD2 minor allele count, stricture formation, and anti-TNF treatment response.
Statistical analysis
[0161] Statistical comparisons were performed as indicated in figure legends, and using GraphPad Prism v8.3.1. After determining normality, differences for means were tested for statistical significance with either Student’s /-test or Wilcoxon signed rank test (paired analyses) in the events that multiple comparisons did not need to be accounted for. In the case were variance analyses between genotypes and treatment conditions were to be tested, tests were performed using 2-way ANOVA tests. P-values <0.05 were considered statistically significant.
Example 5: A treatment-naive blood and tissue signature highlights gp!30 inhibition as an alternative for anti-TNF refractory/ Crohn’s disease patients
[0162] Anti-TNF therapy remains the most efficacious therapeutic treatment strategy for the majority of patients with moderate-to- severe Crohn’s disease, yet it shows no clinical benefit in -40% of patients. Cellular and molecular mechanisms of pathogenic activation in Crohn’s disease have highlighted the importance of cellular niches and cellular communication between activated immune and stromal cells, such as inflammatory macrophages and activated fibroblasts. As described herein, gpl30 inhibition may be a beneficial complementary target in CD patients who carry elevated transcriptional signatures. While recent research efforts have also elucidated other mechanisms of anti-TNF non-response and potential biomarker targets, there remains a need for early identification and accurate bloodbased assessment of therapeutic non-response in patients prior to treatment institution. gpl30 inhibition with Bazedoxifene ameliorates pathogenic myeloid-stromal activation in vivo, and importantly reduces induction of an anti-TNF and ustekinumab non-response transcriptional signature, which can be detected in the blood of CD patients.
[0163] In this Example, it is shown that gpl30 inhibition with bazedoxifene ameliorates pathogenic transcriptional activation of myeloid and stromal cells when given during and post DSS-injury in vivo. scRNAseq and CITEseq were used to further reveal specialized stromal populations (notably PDGFRAhi fibroblasts and ACKRlhi endothelial cells) that are likely more important for targeted cellular gpl30 therapeutic inhibition. Lastly, a broad transcriptional signature (observed in non-responders even before anti-TNF treatment institution) was observed that can be identified prior to treatment institution both in CD ileal tissue and, importantly, in PBMCs. This signature also significantly separates responders and non-responders to ustekinumab treatment and, importantly, can be dampened with bazedoxifene treatment in vivo in a larval zebrafish model of CD and in vitro in a CD 14+ PBMC differentiation system.
[0164] These results reveal an anti-TNF and anti-IL12p40/IL23R transcriptional signature that can be detected in the blood of CD patients prior to treatment institution. Notably, this signature can be ameliorated with bazedoxifene treatment in vitro and in vivo, likely through targeting activated PDGFRAhi fibroblasts, ACKRlhi endothelial cells, and inflammatory macrophages. This easily identifiable anti-TNF non-response/gpl30 inhibition response signature prior to treatment institution will implicate new precision therapeutic approaches for CD patients.
[0165] As shown in FIGs. 10A-10F, bazedoxifene administered during or post DSS-injury in zebrafish larvae ameliorates intestinal length shortening in both nod2 WT and nod.2-1- backgrounds. scRNAseq of zebrafish larvae treated with DSS alone, DSS + BZA, and DSS followed by BZA revealed 18 unique clusters of stromal and myeloid cells. Fibroblast, macrophage, and lymphatic (endothelial; enteric neurons) populations expanded upon DSS treatment and, importantly, contracted with BZA treatment given during and after injury. The effects were most pronounced when BZA was given during injury. Stromal cells from CD ileal scRNAseq can be subclustered to further reveal specialized activated subsets (notably PDGFRAhi vs. PDPNhi fibroblasts). These cell types can be transcriptionally segregated by unique signatures of transcription factors. [0166] As shown in FIGs. 11A-1 IE, a trajectory of activation was observed among fibroblast subsets from CD ileal patients: residential fibroblasts; PDGFRAhi activated fibroblasts (inflamed tissue only); PDPNhi activated fibroblasts (inflamed tissue only). DEG analysis between PDGFRAhi vs. PDPNhi fibroblasts reveals a) upstream regulation by members along the gpl30 family axis for PDGFRAhi fibroblasts, and b) upstream regulation by GPCR, and growth factors (including platelet-derived) for PDPNhi fibroblasts, indicating that these are distinct activated subsets. The advance on IE6ST + CD130 expression (CfTEseq) reveals fibroblast populations, but also ACKR1+ activated endothelial cells with gpl30 expression. PDGFRA protein expression has the highest correlation with gpl30 protein expression (again supporting that PDGFRA and PDPN activated fibroblasts are distinct). This has important implications for directed targeting on the right cell subset.
[0167] As shown in FIGs. 12A-12H, to further understand what signatures would help determine gpl30 responsiveness, DEG analysis was performed from the microarray analysis from Arijs et al., 2009. Specifically, mucosal biopsies from patients before anti-TNF treatment institution comparing non-responders vs. responders were analyzed. Genes upregulated in non-responders pre-treatment were found to be enriched in activated fibroblasts, activated endothelial cells, dendritic cells, and inflammatory macrophages in CD ileal tissue when the scRNAseq dataset was inspected. Importantly, many of these genes are expressed in PBMCs of these patients in classical and non-classical monocyte subsets and platelets. Analysis of the in vivo zebrafish larvae scRNAseq dataset revealed that BZA treatment significantly reduces the gene signature upregulated in non-responders pretreatment, by reduction in expression of conserved transcripts, providing a rationale for patients with this signature to be put on gpl30 inhibition therapeutics. To compare across a “pseudo anti-TNF signature” in zebrafish, cells were segregated by tnfrsfla+ and tnfrsflb+ expression (notably, tnfrsflb was included among genes upregulated in non-responders pretreatment), and significant reduction of these cells was observed with BZA treatment compared to DSS alone.
[0168] Next, the application of this tissue and blood identifiable signature to therapeutic responses other than anti-TNF was tested. Genes that were significantly upregulated in non- responders pre-anti-TNF treatment were taken, and PCA was performed in patients enrolled in UNITI trial (ustekinumab). It was found that this signature could also significantly separate out patients who had recovered vs. not recovered on this drug, which has implications for gpl30 inhibition as a complementary therapeutic approach for both patients who do not respond to anti-TNF and anti-IL12p40/IL23R blockade.
[0169] To assess if this signature is dampened with bazedoxifene in humans, an ileal CD patient from 2017 (“patient 13”) was followed up on. This patient experienced initial failure on anti-TNF therapy, had resection, and now is being managed by ustekinumab treatment. Initial analysis from scRNAseq comparison between 2017 and 2021 showed an increase in ustkeinumab response signature, but still an increase in inflammatory macrophages in the ileal tissue (and decrease of circulating classical monocytes), indicating that the patient could further benefit from gpl30 inhibition. In vitro CD14+ PBMC differentiation of cells from this patient was performed four years after surgery unstimulated, or stimulated with MDP, BZA, anti-gpl30 antibody, or combinations, and it was found that BZA can enhance protective effects when treated with MDP (round macrophage phenotype and reduction of inflammatory/fibrotic/DC mediators ) .
[0170] The gene signature (or transcriptional profile) described herein is provided in detail in
Table 1 below.
[0171] Table 1:
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Methods for Example 5
[0172] BZA treatment of zebrafish larvae: lOuM BZA was either administered alone, before, in combination with, or after 0.075% DSS cotreatment to nod2+!+, nod2+!~ or nod2-l- larvae at 5 dpf (lx) and 8 dpf (2x), by emulsion in 15 ml egg water. After 24 h of each administration, the zebrafish larvae were rescued to egg water without any additional chemicals. Larval intestines were collected for further experimental use at 24 h after removal of DSS and/or BZA.
[0173] CITE sequencing of Crohn’s disease ileal tissue: Following singe-cell isolation and suspension from inflamed and uninflamed matched resection samples of one CD ileal patient (Martin et al., 2021), cell suspensions were split and barcoded using “hashing antibodies” beta-2-microglobulin and CD298 and conjugated to “hash-tag” oligonucleotides (HTOs). Hashed samples were pooled and stained with CITEseq antibodies that had been purchased either from the Biolegend TotalSeq catalog or custom conjugated for the following markers (CD14, PDGFRA/CD140A, CXCR5, CD62E/SELE, CCR7, CD3E/CD3, CD8A/CD8, HLA- DRA, IL2RA/CD25, CTLA4/CD152, CD38, PD1/PDCD1, PDPN, NOTCH3, ITGB3/CD61, CD130, CXCR4, IL11RA, PTGER2, PTGER4, MRGPRX2, TNFRSF25, IL23RA). All stained cells were then encapsulated by gel beads in emulsion in the controller in which cell lysis and reverse transcription occurred. Libraries were prepared using 10X Genomics library kits and sequenced on Illumina NextSeq500, according to manufacturer’s recommendations. [0174] Principal component analyses ofArijs pre-treatment signature score in UNITI trial patients: RNA-seq data collected from biopsies by the UNITI cohort were normalized (median-of-ratios) using DESeq on the basis of calculated size factors. Differential expression was performed between non-responders and responders pre-anti TNF treatment in patient data published in Arijs et al., 2009. The 126 significantly upregulated genes were used to calculate the first 10 principal components across each of the UNITI1 and UNITE patient samples, and each component was tested along with sex in a logistic regression model to identify relationships between pre-treatment non-response genes principal component scores and disease recurrence and inflammation.
Other Embodiments
[0175] Embodiment 1. A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
[0176] Embodiment 2. The method of embodiment 1, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
[0177] Embodiment 3. The method of embodiment 1 or 2, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
[0178] Embodiment 4. The method of any one of embodiments 1-3, wherein the subject is a primary anti-TNF non-responder or at risk for being a primary anti-TNF non-responder.
[0179] Embodiment 5. The method of any one of embodiments 1-3, wherein the subject is a secondary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder.
[0180] Embodiment 6. The method of any one of embodiments 1-5, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject.
[0181] Embodiment 7. The method of any one of embodiments 1-6, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
[0182] Embodiment 8. The method of any one of embodiments 1-7, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject.
[0183] Embodiment 9. The method of any one of embodiments 1-8, wherein administering the gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in the subject.
[0184] Embodiment 10. The method of embodiment 9, wherein the activated fibroblast transcript is selected from: wtl ; ILi , tgfbla, cxcl!3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
[0185] Embodiment 11. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is wtl .
[0186] Embodiment 12. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is IL11. [0187] Embodiment 13. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is tgfbla.
[0188] Embodiment 14. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is cxcll3.
[0189] Embodiment 15. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is mmp9.
[0190] Embodiment 16. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is pdpn.
[0191] Embodiment 17. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is chi3ll .
[0192] Embodiment 18. The method of embodiment 9 or 10, wherein the activated fibroblast transcript is pdgfra.
[0193] Embodiment 19. A method of modulating expression of a transcriptional profile resulting from cross-talk between myeloid and stromal cells in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
[0194] Embodiment 20. The method of embodiment 19, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
[0195] Embodiment 21. The method of embodiment 19 or 20, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
[0196] Embodiment 22. The method of any one of embodiments 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of fibroblasts.
[0197] Embodiment 23. The method of any one of embodiments 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of inflammatory macrophages.
[0198] Embodiment 24. The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof.
[0199] Embodiment 25. The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is WT1. [0200] Embodiment 26. The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is STAT3.
[0201] Embodiment 27. The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is TWIST 1.
[0202] Embodiment 28. The method of any one of embodiments 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is CEBPB.
[0203] Embodiment 29. A method of restoring sensitivity to anti-TNF agents in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of bazedoxifene and an anti-TNF agent, wherein the anti-TNF non- responder subject has a transcriptional profile comprising markers associated with anti-TNF resistance.
[0204] Embodiment 30. The method of embodiment 29, wherein the transcriptional profile results from cross-talk between myeloid and stromal cells.
[0205] Embodiment 31. The method of embodiment 29 or 30, wherein the subject is a primary anti-TNF non-responder or at risk for being a primary anti-TNF non-responder. [0206] Embodiment 32. The method of embodiment 29 or 30, wherein the subject is a secondary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder. [0207] Embodiment 33. The method of any one of embodiments 29-32, wherein administering bazedoxifene and the anti-TNF agent prevents collagen secretion or activation in the subject.
[0208] Embodiment 34. The method of any one of embodiments 29-33, wherein administering bazedoxifene and the anti-TNF agent prevents intestinal length shortening in the subject.
[0209] Embodiment 35. The method of any one of embodiments 29-34, wherein administering bazedoxifene and the anti-TNF agent decreases gpl30 target gene activation in the subject.
[0210] Embodiment 36. The method of any one of embodiments 29-35, wherein administering bazedoxifene and the anti-TNF agent decreases expression of activated fibroblast transcripts in the subject. [0211] Embodiment 37. The method of embodiment 36, wherein the activated fibroblast transcript is selected from: wtl ; IL11 tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
[0212] Embodiment 38. The method of embodiment 36, wherein the activated fibroblast transcript is wtl .
[0213] Embodiment 39. The method of embodiment 36, wherein the activated fibroblast transcript is IL11.
[0214] Embodiment 40. The method of embodiment 36, wherein the activated fibroblast transcript is tgfbla.
[0215] Embodiment 41. The method of embodiment 36, wherein the activated fibroblast transcript is cxcll3.
[0216] Embodiment 42. Embodiment 1. The method of embodiment 36, wherein the activated fibroblast transcript is mmp9.
[0217] Embodiment 43. The method of embodiment 36, wherein the activated fibroblast transcript is pdpn.
[0218] Embodiment 44. The method of embodiment 36, wherein the activated fibroblast transcript is chi3ll .
[0219] Embodiment 45. The method of embodiment 36, wherein the activated fibroblast transcript is pdgfra.
[0220] Embodiment 46. A method for identifying a Crohn’s disease subject in need of treatment, the method comprising: (a) taking a sample from a subject; and (b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier.
[0221] Embodiment 47. The method of embodiment 46, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
[0222] Embodiment 48. The method of embodiment 46 or 47, further comprising administering a gpl30 inhibitor.
[0223] Embodiment 49. The method of embodiment 48, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM). [0224] Embodiment 50. The method of embodiment 48 or 49, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
[0225] Embodiment 51. A method for identifying and treating Crohn’s disease in a subject in need of treatment, the method comprising: (a) taking a sample from a subject; (b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier; and (c) administering a gpl30 inhibitor to the subject.
[0226] Embodiment 52. The method of embodiment 51, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
[0227] Embodiment 53. The method of embodiment 51 or 52, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
[0228] Embodiment 54. The method of any one of embodiments 51-53, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
[0229] Embodiment 55. A composition comprising a gpl30 inhibitor and an anti-TNF agent.
[0230] Embodiment 56. The composition of embodiment 55, wherein the gpl30 inhibitor is bazedoxifine.
[0231] Embodiment 57. The composition of embodiment 56, wherein the composition comprises a therapeutically effective amount of bazedoxifine and an anti-TNF agent.
[0232] Embodiment 58. The composition of any one of embodiments 55-57, wherein the composition further comprises one or more pharmaceutically acceptable excipients.
[0233] Embodiment 59. A kit for treating subjects having, at risk of having, or suspected of having Crohn’s disease, comprising: (a) a gpl30 inhibitor; and (b) an anti-TNF agent.
[0234] Embodiment 60. A kit for diagnosing subjects having, at risk of having, or suspected of having Crohn’s disease, comprising: (a) reagents for performing any of the methods of embodiments 46-50; and (b) a gpl30 inhibitor.
[0235] Embodiment 61. The kit of embodiment 59 or 60, wherein the gpl30 inhibitor is bazedoxifene.
[0236] Embodiment 62. A kit comprising the composition of any one of embodiments 55- 58. [0237] Embodiment 63. A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject the composition of any one of embodiments 55-58.
[0238] Embodiment 64. The method of any one of embodiments 1-54, wherein the subject is an anti-IL12p40/IL23R therapy non-responder, or at risk for being an anti-IL12p40/IL23R therapy non-responder.
[0239] Embodiment 65. The method of embodiment 64, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
[0240] Embodiment 66. The method of any one of embodiments 1-54, 64, or 65 further comprising administering to the subject an anti-TNF therapy or an anti-IL12p40/IL23R therapy.
[0241] Embodiment 67. A method of treating Crohn’s disease in a subject in need thereof, the method comprising:
(i) evaluating a sample taken from the subject for a gene signature comprising increased or decreased expression relative to a control sample of one or more genes selected from the group consisting of TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTHRC1, TNC, CSF3R, NCF2, STC1, FGF2, CCL2, PLXND1, LILRA2, G0S2, LRRC25, PLEK, CXCR2, IGFBP5, ENG, NRP2, MMP2, SLC2A3, TMEM71, RASSF8, SELL, PLTP, GLT1D1, LILRB3, MGP, FCN1, CSGALNACT1, COL7A1, COL15A1, RGS5, LILRA1, FCGR2A, SIGLEC5, CLEC7A, ANGPT2, EGFL6, ADGRE2, LOC 101928916///NNMT, CFH, PDPN, CMTM2, RGS2, COL6A3, PAPPA, ANGPTL2, DKK3, TLR4, CFHR1///CFH, FGR, SLC2A14///SLC2A3, IL7R, TIMP1, COL4A1, S100A4, LST1, TMEM45A, VWF, RGS18, SPARCL1, COL18A1, DUSP4, DSE, COL4A2, SLC9B2, EML1, ACSL4, KLHL5, CAV2, NINJ1, C3AR1, AKR1B1, PRKCDBP, TIMP2, C1R, SELM, LAMC1, GPX8, ELK3, TNFRSF1B, CEBPB, PRNP, MRC2, A2M, COTL1, MSANTD3, FGFR1OP2, PQLC3, and ABCG4; and
(ii) administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor if the presence of the gene signature is observed in the sample taken from the subject. [0242] Embodiment 68. The method of embodiment 67 further comprising administering a therapeutically effective amount of an anti-TNF therapy to the subject along with the gpl30 inhibitor.
[0243] Embodiment 69. The method of embodiment 67 or 68 further comprising administering a therapeutically effective amount of an anti-IL12p40/IL23R therapy to the subject along with the gpl30 inhibitor.
[0244] Embodiment 70. The method of embodiment 69, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
[0245] Embodiment 71. The method of any one of embodiments 67-70, wherein the control sample is a sample taken from an anti-TNF non-responder subject.
[0246] Embodiment 72. The method of any one of embodiments 67-71, wherein the control sample is a sample taken from an anti-IL12p40/IL23R non-responder subject.
[0247] Embodiment 73. The method of any one of embodiments 67-72, wherein the subject has not been administered an anti-TNF therapy or an anti-IL12p40/IL23R therapy previously. [0248] Embodiment 74. The method of any one of embodiments 67-73, wherein the presence of the gene signature in the sample taken from the subject indicates that the subject is an anti-TNF non-responder and/or an anti-IL12p40/IL23R non-responder.
[0249] Embodiment 75. The method of any one of embodiments 67-74, wherein the control sample is a sample taken from a healthy subject who does not have Crohn’s disease.
[0250] Embodiment 76. The method of any one of embodiments 67-75, wherein the sample taken from the subject is a tissue sample.
[0251] Embodiment 77. The method of any one of embodiments 67-75, wherein the sample taken from the subject is a blood sample.
[0252] Embodiment 78. The method of any one of embodiments 67-77, wherein the gene signature comprises increased or decreased expression relative to the control sample of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more of the genes.
[0253] Embodiment 79. The method of any one of embodiments 67-78, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
[0254] Embodiment 80. The method of any one of embodiments 67-79, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof. [0255] Embodiment 81. The method of any one of embodiments 67-80, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject. [0256] Embodiment 82. The method of any one of embodiments 67-81, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
[0257] Embodiment 83. The method of any one of embodiments 67-82, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject. [0258] Embodiment 84. The method of any one of embodiments 67-83, wherein administering the gpl30 inhibitor to the subject restores expression levels of the one or more genes in the gene signature to the levels observed in the control sample.
[0259] In addition to the embodiments expressly described herein, it is to be understood that all of the features disclosed in this description may be combined in any combination (e.g., permutation, combination). Each element disclosed in the description may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0260] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, without departing from the spirit and scope thereof, and can make various changes and modifications to the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
Equivalents and scope
[0261] In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0262] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the disclosure, or embodiments of the disclosure, is/are referred to as comprising particular elements and/or features, certain embodiments of the disclosure or embodiments of the disclosure consist, or consist essentially of, such elements and/or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0263] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the present disclosure, the specification shall control. In addition, any particular embodiment of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the disclosure can be excluded from any claim, for any reason, whether or not related to the existence of prior art.
[0264] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present disclosure, as defined in the following claims.
References
[0265] The following references are incorporated herein by reference in their entireties. 1. Kugathasan, S. et al. Prediction of complicated disease course for children newly diagnosed with Crohn’s disease: a multicentre inception cohort study. Lancet Land. Engl.
389, 1710-1718 (2017).
2. West, N. R. et al. Oncostatin M drives intestinal inflammation and predicts response to tumor necrosis factor-neutralizing therapy in patients with inflammatory bowel disease. Nat. Med. 23, 579-589 (2017).
3. Martin, J. C. et al. Single-Cell Analysis of Crohn’s Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell 178, 1493-1508. e20 (2019).
4. Ogura, Y. et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 411, 603-606 (2001).
5. Hugot, J. P. et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature 411, 599-603 (2001).
6. Lesage, S. et al. CARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease. Am. J. Hum. Genet. IQ, 845- 857 (2002).
7. Zhou, X. et al. Circuit Design Features of a Stable Two-Cell System. Cell 172, 744- 757.el7 (2018).
8. Verstockt, B. & Cleynen, I. Genetic Influences on the Development of Fibrosis in Crohn’s Disease. Front. Med. 3, (2016).
9. Vermeire, S. et al. NOD2/CARD15 does not influence response to infliximab in Crohn’s disease. Gastroenterology 123, 106-111 (2002).
10. Mascheretti, S. et al. Pharmacogenetic investigation of the TNF/TNF-receptor system in patients with chronic active Crohn’s disease treated with infliximab. Pharmacogenomics J. 2, 127-136 (2002).
11. Brant, S. R. et al. Defining complex contributions of NOD2/CARD15 gene mutations, age at onset, and tobacco use on Crohn’s disease phenotypes. Inflamm. Bowel Dis. 9, 281— 289 (2003).
12. Bain, C. C. et al. Constant replenishment from circulating monocytes maintains the macrophage pool in the intestine of adult mice. Nat. Immunol. 15, 929-937 (2014).
13. Schafer, S. et al. IL-11 is a crucial determinant of cardiovascular fibrosis. Nature 552, 110-115 (2017). 14. Lim, W.-W. et al. Transgenic interleukin 11 expression causes cross-tissue fibro- inflammation and an inflammatory bowel phenotype in mice. PloS One 15, e0227505 (2020).
15. Kim, H.-S. et al. Identification of novel Wilms’ tumor suppressor gene target genes implicated in kidney development. J. Biol. Chem. 282, 16278-16287 (2007).
16. Tamplin, O. J. et al. Hematopoietic stem cell arrival triggers dynamic remodeling of the perivascular niche. Cell 160, 241-252 (2015).
17. Chuang, L.-S. et al. Zebrafish modeling of intestinal injury, bacterial exposures and medications defines epithelial in vivo responses relevant to human inflammatory bowel disease. Dis. Model. Meeh. 12, (2019).
18. Kim, Y.-G. et al. The Nod2 Sensor Promotes Intestinal Pathogen Eradication via the Chemokine CCL2-Dependent Recruitment of Inflammatory Monocytes. Immunity 34, 769- 780 (2011).
19. Reilkoff, R. A., Bucala, R. & Herzog, E. L. Fibrocytes: emerging effector cells in chronic inflammation. Nat. Rev. Immunol. 11, 427-435 (2011).
20. Sun, H. et al. Netrin-1 regulates fibrocyte accumulation in the decellularized fibrotic scleroderma lung microenvironment and in bleomycin induced pulmonary fibrosis: Netrin-1 and Collagen production by PBMCs in Scleroderma. Arthritis Rheumatol. v\J -v\J . (2016) doi:10.1002/art.39575.
21. Garcfa-de-Alba, C. et al. Expression of matrix metalloproteases by fibrocytes: possible role in migration and homing. Am. J. Respir. Crit. Care Med. 182, 1144-1152 (2010).
22. Girardin, S. E. et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278, 8869-8872 (2003).
23. Orekhov, A. N. et al. Monocyte differentiation and macrophage polarization. Vessel Plus 2019, (2019).
24. Ma, G. et al. Nod2-Rip2 Signaling Contributes to Intestinal Injury Induced by Muramyl Dipeptide Via Oligopeptide Transporter in Rats. Dig. Dis. Sci. 60, 3264-3270 (2015).
25. Strober, W., Kitani, A., Fuss, I., Asano, N. & Watanabe, T. The molecular basis of NOD2 susceptibility mutations in Crohn’s disease. Mucosal Immunol. 1 Suppl 1, S5-9 (2008).
26. Liu, Y. et al. Circulating fibrocytes are involved in inflammation and leukocyte trafficking in neonates with necrotizing enterocolitis. Medicine (Baltimore) 96, e7400 (2017). 27. Ishida, M. et al. Muramyl dipeptide enhances lipopolysaccharide-induced osteoclast formation and bone resorption through increased RANKL expression in stromal cells. J. Immunol. Res. 2015, 132765 (2015).
28. Kettleborough, R. N. W. et al. A systematic genome- wide analysis of zebrafish protein-coding gene function. Nature 496, 494-497 (2013).
29. Chassaing, B., Aitken, J. D., Malleshappa, M. & Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15.25. (2014).
30. Salas, A. et al. JAK-STAT pathway targeting for the treatment of inflammatory bowel disease. Nat. Rev. Gastroenterol. Hepatol. (2020) doi:10.1038/s41575-020-0273-0.
31. De Vries, L. C. S., Wildenberg, M. E., De Jonge, W. J. & D’Haens, G. R. The Future of Janus Kinase Inhibitors in Inflammatory Bowel Disease. J. Crohns Colitis 11, 885-893 (2017).
32. Waldner, M. J. & Neurath, M. F. Master regulator of intestinal disease: IE-6 in chronic inflammation and cancer development. Semin. Immunol. 26, 75-79 (2014).
33. Thilakasiri, P. et al. Repurposing the selective estrogen receptor modulator bazedoxifene to suppress gastrointestinal cancer growth. EMBO Mol. Med. 11, (2019).
34. Wei, J. et al. Bazedoxifene as a novel GP130 inhibitor for Colon Cancer therapy. J. Exp. Clin. Cancer Res. CR 38, 63 (2019).
35. Wu, X., Cao, Y., Xiao, H., Li, C. & Lin, J. Bazedoxifene as a Novel GP130 Inhibitor for Pancreatic Cancer Therapy. Mol. Cancer Ther. 15, 2609-2619 (2016).
36. Arijs, I. et al. Mucosal Gene Expression of Antimicrobial Peptides in Inflammatory Bowel Disease Before and After First Infliximab Treatment. PEoS ONE 4, e7984 (2009).
37. Yeo, S.-Y. et al. A positive feedback loop bi-stably activates fibroblasts. Nat. Commun. 9, 3016 (2018).
38. Chen, K. L. A., Zhao, Y. C., Hieronymi, K., Smith, B. P. & Madak-Erdogan, Z. Bazedoxifene and conjugated estrogen combination maintains metabolic homeostasis and benefits liver health. PEOS ONE 12, e0189911 (2017).
39. Sontake, V. et al. Wilms’ tumor 1 drives fibroproliferation and myofibroblast transformation in severe fibrotic lung disease. JCI Insight 3, el21252 (2018).
40. Kinchen, J. et al. Structural Remodeling of the Human Colonic Mesenchyme in Inflammatory Bowel Disease. Cell 175, 372-386.el7 (2018). 41. Buechler, M. B. et al. A Stromal Niche Defined by Expression of the Transcription
Factor WT1 Mediates Programming and Homeostasis of Cavity-Resident Macrophages. Immunity 51, 119-130. e5 (2019).
42. Coukos, J. A. et al. ASCA IgG and CBir antibodies are associated with the development of Crohn’s disease and fistulae following ileal pouch-anal anastomosis. Dig. Dis. Sci. 57, 1544-1553 (2012).
43. Frei, R. et al. Early Initiation of Anti-TNF is Associated with Favourable Fong-term Outcome in Crohn’s Disease: 10-Year-Follow-up Data from the Swiss IBD Cohort Study. J. Crohns Colitis 13, 1292-1301 (2019).
44. Roulis, M. et al. Paracrine orchestration of intestinal tumorigenesis by a mesenchymal niche. Nature 580, 524-529 (2020).
45. Danese, S. et al. Randomised trial and open-label extension study of an anti- interleukin-6 antibody in Crohn’s disease (ANDANTE I and II). Gut 68, 40-48 (2019).
46. Sands, B. E. et al. Randomized, controlled trial of recombinant human interleukin- 11 in patients with active Crohn’s disease. Aliment. Pharmacol. Ther. 16, 399-406 (2002).
47. Kontoyiannis, D., Pasparakis, M., Pizarro, T. T., Cominelli, F. & Kollias, G. Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated immunopathologies. Immunity 10, 387-398 (1999).
48. Viennois, E., Chen, F., Laroui, H., Baker, M. T. & Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res. Notes 6, 360 (2013).
49. Zhang, X. et al. Luminally polarized mural and vascular remodeling in ileal strictures of Crohn’s disease. Hum. Pathol. 79, 42-49 (2018).
50. Dehairs, J., Talebi, A., Cherifi, Y. & Swinnen, J. V. CRISP-ID: decoding CRISPR mediated indels by Sanger sequencing. Sci. Rep. 6, 28973 (2016).
51. Huai-Bin et al., “A myeloid- stromal niche and gpl30 rescue in NOD2-driven Crohn’s disease,” Nature, 2021, Vol. 593, No. 7858, pp. 275-281 (the entire contents of which are incorporated herein by reference.)

Claims

CLAIMS What is claimed is:
1. A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
2. The method of claim 1, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
3. The method of claim 1 or 2, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
4. The method of any one of claims 1-3, wherein the subject is a primary anti-TNF nonresponder or at risk for being a primary anti-TNF non-responder.
5. The method of any one of claims 1-3, wherein the subject is a secondary anti-TNF non-responder or at risk for being a secondary anti-TNF non-responder.
6. The method of any one of claims 1-5, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject.
7. The method of any one of claims 1-6, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
8. The method of any one of claims 1-7, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject.
9. The method of any one of claims 1-8, wherein administering the gpl30 inhibitor decreases expression of one or more activated fibroblast transcripts in the subject, or one or more pathogenic transcripts of Table 1.
78
10. The method of claim 9, wherein the activated fibroblast transcript is selected from: wtl ; IL17; tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
11. The method of claim 9 or 10, wherein the activated fibroblast transcript is wtl.
12. The method of claim 9 or 10, wherein the activated fibroblast transcript is IL11.
13. The method of claim 9 or 10, wherein the activated fibroblast transcript is tgfbla.
14. The method of claim 9 or 10, wherein the activated fibroblast transcript is cxcll3.
15. The method of claim 9 or 10, wherein the activated fibroblast transcript is mmp9.
16. The method of claim 9 or 10, wherein the activated fibroblast transcript is pdpn.
17. The method of claim 9 or 10, wherein the activated fibroblast transcript is chi3ll.
18. The method of claim 9 or 10, wherein the activated fibroblast transcript is pdgfra.
19. A method of modulating expression of a transcriptional profile resulting from crosstalk between myeloid and stromal cells in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor.
20. The method of claim 19, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
21. The method of claim 19 or 20, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
22. The method of any one of claims 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of fibroblasts.
79
23. The method of any one of claims 19-21, wherein expression of the transcriptional profile is modulated to prevent activation of inflammatory macrophages.
24. The method of any one of claims 19-23, wherein the transcriptional profile comprises a transcriptional regulator selected from: WT1; STAT3; TWIST 1; CEBPB; or a combination thereof.
25. The method of any one of claims 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is WT1.
26. The method of any one of claims 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is STAT3.
27. The method of any one of claims 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is TWIST 1.
28. The method of any one of claims 19-23, wherein the transcriptional profile comprises a transcriptional regulator, wherein the transcriptional regulator is CEBPB.
29. The method of any one of claims 19-23, wherein the administering of the therapeutically effective amount of the glycoprotein 130 (gpl30) inhibitor results in the reduction in the expression of one or more genes in the transcriptional profile of Table 1.
30. A method of restoring sensitivity to anti-TNF agents in an anti-TNF non-responder subject, the method comprising administering to the subject a therapeutically effective amount of bazedoxifene and an anti-TNF agent, wherein the anti-TNF non-responder subject has a transcriptional profile comprising markers associated with anti-TNF resistance.
31. The method of claim 30, wherein the transcriptional profile results from cross-talk between myeloid and stromal cells.
80
32. The method of claim 30 or 31, wherein the subject is a primary anti-TNF nonresponder or at risk for being a primary anti-TNF non-responder.
33. The method of claim 30 or 31, wherein the subject is a secondary anti-TNF non- responder or at risk for being a secondary anti-TNF non-responder.
34. The method of any one of claims 30-33, wherein administering bazedoxifene and the anti-TNF agent prevents collagen secretion or activation in the subject.
35. The method of any one of claims 30-34, wherein administering bazedoxifene and the anti-TNF agent prevents intestinal length shortening in the subject.
36. The method of any one of claims 30-35, wherein administering bazedoxifene and the anti-TNF agent decreases gpl30 target gene activation in the subject.
37. The method of any one of claims 30-36, wherein administering bazedoxifene and the anti-TNF agent decreases expression of activated fibroblast transcripts in the subject.
38. The method of claim 37, wherein the activated fibroblast transcript is selected from: wtl ; IL17; tgfbla, cxcll3; mmp9; pdpn; chi3ll; pdgfra; or a combination thereof.
39. The method of claim 37, wherein the activated fibroblast transcript is wtl.
40. The method of claim 37, wherein the activated fibroblast transcript is IL11.
41. The method of claim 37, wherein the activated fibroblast transcript is tgfbla.
42. The method of claim 37, wherein the activated fibroblast transcript is cxcll3.
43. The method of claim 37, wherein the activated fibroblast transcript is mmp9.
44. The method of claim 37, wherein the activated fibroblast transcript is pdpn.
81
45. The method of claim 37, wherein the activated fibroblast transcript is chi3ll.
46. The method of claim 37, wherein the activated fibroblast transcript is pdgfra.
41. The method of claim 37, wherein the transcriptional profile comprises the genes identified in Table 1.
48. A method for identifying a Crohn’s disease subject in need of treatment, the method comprising:
(a) taking a sample from a subject; and
(b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier.
49. The method of claim 48, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3L1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
50. The method of claim 48 or 49, further comprising administering a gpl30 inhibitor.
51. The method of claim 50, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
52. The method of claim 50 or 51, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, co-crystal, solvate, hydrate, or derivative thereof.
53. A method for identifying and treating Crohn’s disease in a subject in need of treatment, the method comprising:
(a) taking a sample from a subject;
(b) evaluating the sample for one or more increased activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier; and
(c) administering a gpl30 inhibitor to the subject.
82
54. The method of claim 53, wherein the activated fibroblast or macrophage signatures characteristic of a NOD2 risk allele carrier are selected from the group consisting of WT1, IL11, PDPN, CHI3E1, IL6, OSM, STAT3, TWIST1, CEBPB, CXCL13, and MMP9.
55. The method of claim 53 or 54, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
56. The method of any one of claims 53-54, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, cocrystal, solvate, hydrate, or derivative thereof.
57. A composition comprising a gpl30 inhibitor and an anti-TNF agent.
58. The composition of claim57, wherein the gpl30 inhibitor is bazedoxifine.
59. The composition of claim 58, wherein the composition comprises a therapeutically effective amount of bazedoxifine and an anti-TNF agent.
60. The composition of any one of claims 57-59, wherein the composition further comprises one or more pharmaceutically acceptable excipients.
61. A kit for treating subjects having, at risk of having, or suspected of having Crohn’ s disease, comprising:
(a) a gpl30 inhibitor; and
(b) an anti-TNF agent.
62. A kit for diagnosing subjects having, at risk of having, or suspected of having Crohn’ s disease, comprising:
(a) reagents for performing any of the methods of claims 48-56; and
(b) a gp 130 inhibitor.
63. The kit of claim 61 or 62, wherein the gpl30 inhibitor is bazedoxifene.
83
64. A kit comprising the composition of any one of claims 57-60.
65. A method of treating Crohn’s disease in a subject in need thereof, the method comprising administering to the subject the composition of any one of claims 57-60.
66. The method of any one of claims 1-56, wherein the subject is an anti-IL12p40/IL23R therapy non-responder, or at risk for being an anti-IL12p40/IL23R therapy non-responder.
67. The method of claim 66, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
68. The method of any one of claims 1-56, 66, or 67 further comprising administering to the subject an anti-TNF therapy or an anti-IL12p40/IL23R therapy.
69. A method of treating Crohn’s disease in a subject in need thereof, the method comprising:
(i) evaluating a sample taken from the subject for a gene signature comprising increased or decreased expression relative to a control sample of one or more genes selected from the group consisting of TFPI2, IL11, PROK2, MUC5AC, TREM1, S100A8, SERPINB2, IL13RA2, CSF3, OSM, PI15, KCNJ15, TNFAIP6, COL12A1, AQP9, CXCL6, S100A12, HGF, VM01, FCGR3B, SELE, MMP3, MMP1, FAM124A, LILRB2, PTX3, FPR1, VNN2, S100A9, FCGR3B///FCGR3A, BCL2A1, IL1RN, MNDA, TFAP2A, LOC401317///CREB5, MCEMP1, ACOD1, F5, NRP1, CTHRC1, TNC, CSF3R, NCF2, STC1, FGF2, CCL2, PLXND1, LILRA2, G0S2, LRRC25, PLEK, CXCR2, IGFBP5, ENG, NRP2, MMP2, SLC2A3, TMEM71, RASSF8, SELL, PLTP, GLT1D1, LILRB3, MGP, FCN1, CSGALNACT1, COL7A1, COL15A1, RGS5, LILRA1, FCGR2A, SIGLEC5, CLEC7A, ANGPT2, EGFL6, ADGRE2, LOC 101928916///NNMT, CFH, PDPN, CMTM2, RGS2, COL6A3, PAPPA, ANGPTL2, DKK3, TLR4, CFHR1///CFH, FGR, SLC2A14///SLC2A3, IL7R, TIMP1, COL4A1, S100A4, LST1, TMEM45A, VWF, RGS18, SPARCL1, COL18A1, DUSP4, DSE, COL4A2, SLC9B2, EML1, ACSL4, KLHL5, CAV2, NINJ1, C3AR1, AKR1B1, PRKCDBP, TIMP2, C1R, SELM, LAMC1, GPX8, ELK3,
84 TNFRSF1B, CEBPB, PRNP, MRC2, A2M, C0TL1, MSANTD3, FGFR1OP2, PQLC3, and
ABCG4; and
(ii) administering to the subject a therapeutically effective amount of a glycoprotein 130 (gpl30) inhibitor if the presence of the gene signature is observed in the sample taken from the subject.
70. The method of claim 69 further comprising administering a therapeutically effective amount of an anti-TNF therapy to the subject along with the gpl30 inhibitor.
71. The method of claim 69 or 70 further comprising administering a therapeutically effective amount of an anti-IL12p40/IL23R therapy to the subject along with the gpl30 inhibitor.
72. The method of claim 71, wherein the anti-IL12p40/IL23R therapy comprises ustekinumab.
73. The method of any one of claims 69-72, wherein the control sample is a sample taken from an anti-TNF non-responder subject.
74. The method of any one of claims 69-73, wherein the control sample is a sample taken from an anti-IL12p40/IL23R non-responder subject.
75. The method of any one of claims 69-74, wherein the subject has not been administered an anti-TNF therapy or an anti-IL12p40/IL23R therapy previously.
76. The method of any one of claims 69-75, wherein the presence of the gene signature in the sample taken from the subject indicates that the subject is an anti-TNF non-responder and/or an anti-IL12p40/IL23R non-responder.
77. The method of any one of claims 69-76, wherein the control sample is a sample taken from a healthy subject who does not have Crohn’s disease.
78. The method of any one of claims 69-77, wherein the sample taken from the subject is a tissue sample.
79. The method of any one of claims 69-77, wherein the sample taken from the subject is a blood sample.
80. The method of any one of claims 69-79, wherein the gene signature comprises increased or decreased expression relative to the control sample of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more of the genes.
81. The method of any one of claims 69-80, wherein the gpl30 inhibitor is a selective estrogen receptor modulator (SERM).
82. The method of any one of claims 69-81, wherein the gpl30 inhibitor is bazedoxifene, or a pharmaceutically acceptable salt, prodrug, tautomer, stereoisomer, polymorph, cocrystal, solvate, hydrate, or derivative thereof.
83. The method of any one of claims 69-82, wherein administering the gpl30 inhibitor prevents collagen secretion or activation in the subject.
84. The method of any one of claims 69-83, wherein administering the gpl30 inhibitor prevents intestinal length shortening in the subject.
85. The method of any one of claims 69-84, wherein administering the gpl30 inhibitor decreases gpl30 target gene activation in the subject.
86. The method of any one of claims 69-85, wherein administering the gpl30 inhibitor to the subject restores expression levels of the one or more genes in the gene signature to the levels observed in the control sample.
PCT/US2021/065075 2020-12-23 2021-12-23 Method for treating crohn's disease WO2022140667A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063130035P 2020-12-23 2020-12-23
US63/130,035 2020-12-23
US202163157574P 2021-03-05 2021-03-05
US63/157,574 2021-03-05

Publications (2)

Publication Number Publication Date
WO2022140667A2 true WO2022140667A2 (en) 2022-06-30
WO2022140667A3 WO2022140667A3 (en) 2022-09-29

Family

ID=82160183

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/065075 WO2022140667A2 (en) 2020-12-23 2021-12-23 Method for treating crohn's disease

Country Status (1)

Country Link
WO (1) WO2022140667A2 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR051597A1 (en) * 2004-11-01 2007-01-24 Merck & Co Inc MODULATORS OF STROGEN RECEIVERS
CN105209643A (en) * 2013-05-17 2015-12-30 豪夫迈·罗氏有限公司 Methods for diagnosing and treating inflammatory bowel disease
KR101934651B1 (en) * 2017-10-19 2019-01-02 가톨릭대학교 산학협력단 Composition for Preventing or Treating TNF-mediated Disease Comprising Novel Derivatives and Method for Inhibiting TNF-activity with the Same
AU2019378008A1 (en) * 2018-11-15 2021-06-03 Janssen Biotech, Inc. Methods and compositions for prediction of response to a therapy of an inflammatory bowel disease

Also Published As

Publication number Publication date
WO2022140667A3 (en) 2022-09-29

Similar Documents

Publication Publication Date Title
Connor et al. Maternal immune activation alters behavior in adult offspring, with subtle changes in the cortical transcriptome and epigenome
Yang et al. Id proteins are critical downstream effectors of BMP signaling in human pulmonary arterial smooth muscle cells
Lin et al. Colonic epithelial mTORC1 promotes ulcerative colitis through COX-2-mediated Th17 responses
Kleijer et al. Neurobiology of autism gene products: towards pathogenesis and drug targets
US20150119327A1 (en) Drug screening platform for rett syndrome
Yeh et al. C9orf72 is essential for neurodevelopment and motility mediated by Cyclin G1
Chassaing et al. Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
Jia et al. Mutation of kri1l causes definitive hematopoiesis failure via PERK-dependent excessive autophagy induction
JP6923215B2 (en) Anti-HTLV-1 agent, HTLV-1-related myelopathy (HAM / TSP) therapeutic agent
Kloska et al. Nrf2 sequesters Keap1 preventing podosome disassembly: a quintessential duet moonlights in endothelium
Xiong SALL4: engine of cell stemness
Liu et al. MicroRNA 1283 alleviates cardiomyocyte damage caused by hypoxia/reoxygenation via targeting GADD45A and inactivating the JNK and p38 MAPK signaling pathways
Wang et al. ZNF667 facilitates angiogenesis after myocardial ischemia through transcriptional regulation of VASH1 and Wnt signaling pathway
Wang et al. An epigenetic circuit controls neurogenic programs during neocortex development
Sun et al. Craniofacial and cardiac defects in chd7 zebrafish mutants mimic CHARGE syndrome
WO2022140667A2 (en) Method for treating crohn&#39;s disease
US20220251569A1 (en) Treatment and prevention of disease mediated by wwp2
WO2020196725A1 (en) Agent for improving nerve axon branching anomalies
Whelan Harnessing the link between BRAFV600E and metabolism in colorectal cancer
Cook Understanding airway smooth muscle molecular physiology using the cystic fibrosis pig
Borchers et al. XNF-ATc3 affects neural convergent extension
Truong PRDM1 in Development and Disease
Rogala et al. The lncRNA Sweetheart regulates compensatory cardiac hypertrophy after myocardial injury
Granata et al. High-Dose Everolimus May Induce Pro-Inflammatory/Fibrotic Transcriptomic Changes in Bronchial Epithelial Cells from Cystic Fibrosis Patients
Nezhad Genetics of Skeletal Muscle Phenotypes with a Focus on Hippo Genes

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21912228

Country of ref document: EP

Kind code of ref document: A2