WO2022139530A1 - Composition for alleviating, preventing or treating autoimmune diseases, comprising lactobacillus sakei-derived extracellular vesicles as active ingredient - Google Patents

Composition for alleviating, preventing or treating autoimmune diseases, comprising lactobacillus sakei-derived extracellular vesicles as active ingredient Download PDF

Info

Publication number
WO2022139530A1
WO2022139530A1 PCT/KR2021/019780 KR2021019780W WO2022139530A1 WO 2022139530 A1 WO2022139530 A1 WO 2022139530A1 KR 2021019780 W KR2021019780 W KR 2021019780W WO 2022139530 A1 WO2022139530 A1 WO 2022139530A1
Authority
WO
WIPO (PCT)
Prior art keywords
autoimmune diseases
preventing
pharmaceutical composition
extracellular vesicles
lactobacillus sakei
Prior art date
Application number
PCT/KR2021/019780
Other languages
French (fr)
Korean (ko)
Inventor
진화섭
Original Assignee
주식회사 리스큐어바이오사이언시스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 리스큐어바이오사이언시스 filed Critical 주식회사 리스큐어바이오사이언시스
Priority claimed from KR1020210186079A external-priority patent/KR20220091427A/en
Publication of WO2022139530A1 publication Critical patent/WO2022139530A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Definitions

  • the present invention relates to a composition for improving, preventing or treating autoimmune diseases such as rheumatoid arthritis.
  • the immune system plays a role in protecting the body from invading antigens from the outside. Antigens include bacteria, viruses, toxins, cancer cells, blood and tissues of other people or animals. The immune system produces antibodies to destroy these harmful substances. However, when there is an autoimmune abnormality, the immune system cannot distinguish between healthy organs and harmful antigens, destroying normal tissues. A disease induced through this reaction is an autoimmune disease.
  • Rheumatoid arthritis a representative autoimmune disease, is an inflammatory autoimmune disease that appears multiple in multiple joints.
  • inflammatory cells such as macrophages, T-cells, B cells, and dendritic cells act excessively, causing chronic inflammation, causing joint and cartilage damage. characterized by causing pain.
  • the treatment of autoimmune reactions is performed for the purpose of controlling the autoimmune response and restoring the body's damaged immune function. For example, if there is a blood problem, a blood transfusion may be required, and if there is a problem with a bone, joint or muscle, exercise or other functional treatment may be required. Medications are also prescribed to modulate the immune system's response. Accordingly, immunosuppressive medicines prescribed include prednisone, a corticosteroid drug, cyclophosphamide, azathioprine, and tacrolimus, a nonsteroid drug. ) are known.
  • these therapeutic agents may cause side effects in the body and the therapeutic effect is not sufficient, so it is necessary to develop a new therapeutic agent for autoimmune diseases such as rheumatoid arthritis, which has excellent therapeutic effect while ensuring safety.
  • An object of the present invention is to promote tolDC induction from dendritic cells to directly inhibit the proliferation of CD4 T cells, and to promote the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR to prevent autoimmune diseases such as rheumatoid arthritis or To provide a therapeutic pharmaceutical composition.
  • Another object of the present invention is to promote tolDC induction from dendritic cells to directly inhibit the proliferation of CD4 T cells, and to promote the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR to prevent autoimmune diseases such as rheumatoid arthritis Or to provide a food composition that can be improved.
  • compositions for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  • the autoimmune disease is rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, lupus, atopic dermatitis, rhinitis, alopecia areata, psoriasis, pemphigus , asthma, aphthous stomatitis, chronic thyroiditis, acquired aplastic anemia, Behcet's disease, Crohn's disease, silicon pneumonitis, streptococcal glomerulonephritis (PSGN), dermatomyosit is, polymyositis, It may be any one selected from autoimmune hemolytic anemia, autoimmune encephalomyelitis, myasthenia gravis, Grave's disease, and polyarteritis nodosa.
  • the pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting induction of tolDC (Autologous tolerogenic dendritic cells) from dendritic cells.
  • tolDC Autologous tolerogenic dendritic cells
  • the pharmaceutical composition for preventing or treating autoimmune diseases may be for inhibiting proliferation of CD4 T cells.
  • the pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting expression of one or more immunosuppressive activity-inducing genes selected from DC-SIGN and DCIR.
  • a food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  • the pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells to directly promote CD4 T cell proliferation. It is possible to prevent or treat autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
  • the food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells and directly promotes proliferation of CD4 T cells. It is possible to prevent or improve autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
  • FIG. 1 is an electron micrograph of an extracellular vesicle derived from Lactobacillus sakeai isolated according to Example 1.
  • FIG. 2 is a result of analysis of tolDC induction in mature dendritic cells according to Experimental Example 1.
  • the pharmaceutical composition for preventing or treating autoimmune diseases of the present invention contains Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  • the Lactobacillus sakeai is not limited, but preferably Lactobacillus sakeai derived from kimchi, more preferably Lactobacillus sakeai deposited under the accession number KCTC13818BP.
  • Lactobacillus sakeai of the above accession number KCTC13818BP was deposited with the Center for Biological Resources on March 07, 2019.
  • the autoimmune disease is rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, lupus, atopic dermatitis, rhinitis, alopecia areata, psoriasis, pemphigus, Asthma, aphthous stomatitis, chronic thyroiditis, acquired aplastic anemia, Behcet's disease, Crohn's disease, silicon pneumonitis, streptococcal glomerulonephritis (PSGN), dermatomyosit is, polymyositis, autologous It may be any one selected from autoimmune hemolytic anemia, autoimmune encephalomyelitis, myasthenia gravis, Grave's disease and polyarteritis nodosa, preferably rheumatoid arthritis ), multiple sclerosis, or Sjogren syndrome, and more preferably rheumatoid arthritis.
  • the pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting induction of tolDC (Autologous tolerogenic dendritic cells) from dendritic cells.
  • tolDC Autologous tolerogenic dendritic cells
  • the pharmaceutical composition for preventing or treating autoimmune diseases may be for inhibiting proliferation of CD4 T cells.
  • CD4 T cells are helper T cells and refer to a group of cells that activate various immune cells. There are various Th1, Th2, Th1 7 CD4 T cells including Tfh2 cells in the aggregate called CD4 T cells.
  • the pharmaceutical composition for preventing or treating autoimmune diseases has at least one immunosuppressive activity selected from DC-SIGN (Dendritic Cell-Specific Intercellular Adhesion Molecule-3-Grabbing Non-integrin) and dendritic cell immunoreceptor (DCIR). It may be for promoting expression of an inducible gene.
  • DC-SIGN Dendritic Cell-Specific Intercellular Adhesion Molecule-3-Grabbing Non-integrin
  • DCIR dendritic cell immunoreceptor
  • DC-SIGN is a type of complement receptor and acts by using C1q as a ligand. It belongs to the C-type lectin receptor (CLR), which is a C-type lectin (CLEC) receptor, and is a receptor mainly expressed in macrophages and dendritic cells. .
  • CLR C-type lectin receptor
  • CLEC C-type lectin receptor
  • DC-SIGN and similar receptors are frequently found in macrophages located in lymph nodes or marginal zones of the spleen.
  • dendritic cells are responsible for antigen presentation to T cells, and in this process, CLRs on the surface of dendritic cells, including DC-SIGN, may be involved.
  • DC-SIGN can efficiently present antigens to CD4 T cells among CLRs.
  • dendritic cell immunoreceptor can inhibit the inflammatory response by interaction with NA2 (asialo-biantennary N-glycan), a glycoprotein on the surface of dendritic cells and bone cells.
  • NA2 asialo-biantennary N-glycan
  • extracellular vesicle refers to a vesicle having a lipid bilayer structure with a diameter ranging from 20 to 1,000 nm that is secreted into the extracellular environment through the fusion of polycystic bodies and plasma membranes in various cells.
  • the average diameter of the extracellular vesicles produced by the method of the present invention may be in the range of 20 to 500 nm, preferably 50 to 300 nm, more preferably 150 to 200 nm. .
  • Extracellular vesicles having a microdiameter within this range are called exosomes.
  • step a culture Lactobacillus sakei
  • Lactobacillus sakeai can be obtained from a stock solution of kimchi extract.
  • step b the Lactobacillus sakeai cultured medium is centrifuged to recover the culture supernatant.
  • the culture supernatant is mixed with a solution containing sodium chloride and an organic solvent and reacted, followed by centrifugation to obtain an extracellular vesicle pellet (step c).
  • the culture supernatant and the solution containing sodium chloride and the organic solvent may be mixed in a volume ratio of 1:0.5 to 1:1.5, preferably in a volume ratio of 1:0.8 to 1:1.2, more preferably the same amount can be mixed with
  • the organic solvent may be polyethylene glycol.
  • the solution containing sodium chloride and the organic solvent preferably has a sodium chloride concentration of 0.5 to 1 M.
  • centrifugation may be performed, and then the mixing and centrifugation may be repeated.
  • extracellular vesicle pellet is resuspended in extracellular vesicle extraction buffer to prepare a suspension, and the extracellular vesicles are isolated from the suspension (step d).
  • the term 'comprising as an active ingredient' means including an amount sufficient to achieve the efficacy or activity of the Lactobacillus sakeai-derived extracellular vesicles.
  • the Lactobacillus sakeai-derived extracellular vesicles in the composition of the present invention are, for example, 0.001 mg/kg or more, preferably 0.1 mg/kg or more, more preferably 10 mg/kg or more. or more, more preferably 100 mg/kg or more, still more preferably 250 mg/kg or more, and most preferably 1 g/kg or more.
  • the upper quantitative limit of the Lactobacillus Sakei-derived extracellular vesicles contained in the composition of the present invention can be selected and carried out by those skilled in the art by selecting within an appropriate range. have.
  • the pharmaceutical composition of the present invention may be prepared by using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant includes an excipient, a disintegrant, a sweetener, a binder, a coating agent, a swelling agent, a lubricant, and a lubricant. agent or flavoring agent, etc. may be used.
  • the pharmaceutical composition may be preferably formulated as a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration.
  • Formulations of the pharmaceutical composition may be granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops or injectables.
  • the active ingredient may be combined with an orally, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like.
  • suitable binders, lubricants, disintegrants and color-developers may also be included in the mixture.
  • Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like.
  • Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.
  • acceptable pharmaceutical carriers are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed.
  • diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc., preferably oral administration.
  • a suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration mode, age, weight, pathological condition, food, administration time, route of administration, excretion rate, and response sensitivity of the patient, usually skilled A trained physician can readily determine and prescribe an effective dosage for the desired treatment or prevention.
  • the daily dose of the pharmaceutical composition of the present invention is 0.001-10 g/kg.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. Alternatively, it may be prepared by being introduced into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.
  • the present invention provides a food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  • the Lactobacillus sakeai is not limited, but preferably Lactobacillus sakeai derived from kimchi, more preferably Lactobacillus sakeai deposited under the accession number KCTC13818BP.
  • Lactobacillus Sakei-derived extracellular vesicles are the same as those described in the pharmaceutical composition for preventing or treating autoimmune diseases comprising the above-described Lactobacillus Sakei-derived extracellular vesicles as an active ingredient. shall refer to.
  • the food composition according to the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods.
  • Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, sweets, diet bars, dairy products, meat, chocolate, pizza, ramen, other noodles, gums, ice cream, vitamin complexes, health supplements etc.
  • the food composition of the present invention may include not only the active ingredients, but also ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents.
  • examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • flavoring agents natural flavoring agents [taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.
  • stevia extract eg, rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the present invention provides a health functional food comprising a food composition for preventing or improving autoimmune diseases comprising the Lactobacillus sakeai-derived extracellular vesicles as an active ingredient.
  • Health functional food is a food prepared by adding Lactobacillus sakei-derived extracellular vesicles to food materials such as beverages, teas, spices, gum, and confectionery, or by encapsulating, powdering, or suspension, etc. It means to bring a specific effect, but unlike general drugs, it has the advantage of not having side effects that may occur when taking the drug for a long period of time by using food as a raw material.
  • the health functional food of the present invention obtained in this way is very useful because it can be ingested on a daily basis.
  • Lactobacillus sakeai-derived extracellular vesicles added in such a health functional food cannot be uniformly defined as it varies depending on the type of health functional food being targeted, but it can be added within a range that does not impair the original taste of the food, It is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight, based on the target food.
  • a health functional food in the form of pills, granules, tablets or capsules it is usually added in an amount of 0.1 to 100% by weight, preferably 0.5 to 80% by weight.
  • the health functional food of the present invention may be in the form of a pill, tablet, capsule or beverage.
  • Lactobacillus sakeai-derived extracellular vesicles according to the present invention or a composition comprising the same as an active ingredient may be used as a feed additive or feed.
  • the composition When used as a feed additive, the composition may be 20 to 90% highly concentrated or prepared in powder or granular form.
  • the feed additives include organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polyphosphate), polyphenol, catechin, alpha-tocopherol, rosemary Extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included.
  • the composition When used as a feed, the composition may be formulated in the form of a conventional feed, and may include common feed ingredients together.
  • the feed additive and feed include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean, and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
  • the feed additive may be administered alone or in combination with other feed additives in an edible carrier.
  • the feed additive can be easily administered to the animal as a top dressing, directly mixing them with animal feed, or in an oral formulation separate from the feed.
  • a pharmaceutically acceptable edible carrier as well known in the art, and may be prepared into an immediate release or sustained release formulation.
  • Such edible carriers may be solid or liquid, for example cornstarch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil and propylene glycol.
  • the feed additive may be a tablet, a capsule, a powder, a troche or a sugar-containing tablet, or a top dressing in a microdispersed form.
  • the feed additive may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.
  • the feed additives and feed may contain auxiliary agents, for example, preservatives, stabilizers, wetting or emulsifying agents, solution accelerators, and the like.
  • the feed additive may be used by adding to animal feed by immersion, spraying, or mixing.
  • the feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry and fish.
  • the mammal it can be used for pigs, cattle, sheep, goats, laboratory rodents, and laboratory rodents, as well as pets (eg, dogs, cats), etc., as the poultry, chickens, turkeys, ducks, geese, pheasants, and quail, and the like, and may be used as the fish such as trout, but is not limited thereto.
  • the present invention provides the use of the Lactobacillus sakeai-derived extracellular vesicles for the manufacture of a medicament or food for preventing, treating or improving autoimmune diseases.
  • the Lactobacillus Sakeai-derived extracellular vesicles can be used for the treatment or improvement of autoimmune diseases.
  • the present invention provides a method for improving, preventing or treating an autoimmune disease comprising administering to a mammal an effective amount of an extracellular vesicle derived from Lactobacillus sakeai.
  • mammal refers to a mammal that is the subject of treatment, observation or experimentation, preferably a human.
  • the term "effective amount” refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as conceived by a researcher, veterinarian, physician or other clinician, which is the disease in question. or an amount that induces alleviation of the symptoms of the disorder.
  • the effective amount and frequency of administration for the active ingredient of the present invention may vary depending on the desired effect.
  • the optimal dosage to be administered can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the content of active ingredients and other components contained in the composition, the type of formulation, and the age, weight, and general health of the patient It can be adjusted according to various factors including state, sex and diet, administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs.
  • the extract for adults, it is preferable to administer the extract at a dose of 0.001 g/kg to 10 g/kg when administered once to several times a day.
  • the composition comprising Lactobacillus sakeai-derived extracellular vesicles as an active ingredient is administered via oral, rectal, intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, or intradermal routes. It can be administered in a conventional manner.
  • Example 1 Lactobacillus sakeai-derived extracellular vesicle (P12E) isolation
  • the microorganism was named Lactobacillus sakei WIKIM0109 (Lactobacillus sakei WIKIM0109) and deposited at the Center for Biological Resources (Accession No. KCTC13818BP).
  • Lactobacillus Sakeai accesion No. KCTC13818BP
  • 0.1% of Lactobacillus Sakeai was inoculated into 30 ml of MRS broth and cultured at 30° C. for 18 hours. After incubation, the culture supernatant was recovered by first centrifugation at 3500 rpm, 4°C for 10 minutes, followed by a second centrifugation at 10,000 x g, 4°C for 20 minutes, and finally filtered through a 0.22 ⁇ m filter to remove cells. was recovered. Then, the culture supernatant and 1 M NaCl solution dissolved in 16% PEG 6000 were mixed in equal amounts and reacted at 4 ° C. for 15 hours, followed by centrifugation at 10,000 x g, 4 ° C.
  • a medium in which Lactobacillus sakeai was cultured in (1) of Example 1 was prepared.
  • Example 1 the Lactobacillus sakeai of (1) was prepared without separating the extracellular vesicles.
  • Monocytes from bone marrow cells of the femur and tibia of mice were centrifuged according to the Ficoll-Paque® density gradient centrifugation method.
  • the isolated monocytes were prepared in a 6-well plate at a concentration of 2 x 10 6 /well, and GM-CSF (Granulocyte-macrophage colony-stimulating factor) was added to a medium (RPMI) containing Fetal Bovine Serum (FBS). 20 ng/ml and 10 ng/ml of IL-4 (interleukin 4) were co-treated. After that, it was cultured for 6 days, and when 3 days had elapsed, it was replaced with a fresh medium and cytokines to obtain differentiated immature dendritic cells.
  • GM-CSF Granulocyte-macrophage colony-stimulating factor
  • the positive control LPS Lipopolysaccharide
  • the Lactobacillus sakeai of Comparative Example 2 and the Lactobacillus sakeai derived extracellular vesicles (EV) of Example 1 were inoculated with MOI (multiplicity of infection) 1 as a secondary stimulus, and co-cultured for 24 hours.
  • MOI multiplicity of infection
  • PD-L1 Programmed Death-Ligand 1
  • LPS Lactobacillus sakeai-derived extracellular vesicle-treated group
  • Dendritic cells have immune activation signal and immune suppression signal, and each signal is transmitted by various factors for homeostasis of immune response.
  • Toll-like receptor 4 TLR4
  • DC-SIGN dendritic cell-specific intercellular adhesion molecule (DC-SIGN) -3-grabbing non-integrin) and dendritic cell immunoreceptor (DCIR).
  • DC-SIGN is a C-type lectin receptor, and many ligands exist, and when co-stimulated with a toll-like receptor (TLR), it can suppress the immune response.
  • Primer information and qPCR conditions are as follows.
  • DC-SIGN expression was strongly inhibited in the mature dendritic cell treatment group (LPS group), and the Lactobacillus sakeai culture medium treatment group of Comparative Example 1 (LPS+P12 media) and Lactobacillus of Comparative Example 2
  • LPS+P12 the Lactobacillus sakeai culture medium treatment group of Comparative Example 1
  • LPS+P12E the Lactobacillus sakeai-derived extracellular vesicle-treated group
  • DC-IR expression was also strongly inhibited in the mature dendritic cell treatment group (LPS group), and the Lactobacillus sakeai culture medium treatment group (LPS+P12 media) of Comparative Example 1 and Lactobacillus sake of Comparative Example 2
  • DC-SIGN expression was slightly increased in the eye treatment group (LPS+P12), and DC-IR expression was significantly increased in the Lactobacillus sakeai-derived extracellular vesicle treatment group (LPS+P12E) of Example 1.
  • CD4 T cells Increased division of CD4 T cells is known to be involved in various inflammatory responses through activation of T cells.
  • dendritic cells cultured for 24 hours with Lactobacillus sakeai of Comparative Example 2 and dendritic cells cultured for 24 hours with the Sakeai-derived extracellular vesicles of Example 1 were prepared, and CD4 T cells were harvested from mice. It was isolated and stained with carboxyfluorescein succinimidyl ester (CFSE) for cell labeling. Thereafter, tolDC-induced cultured dendritic cells: CFSE-stained CD4 T cells were co-cultured at a ratio of 1:1 for 3 days, and the co-cultured cells were harvested after 3 days to measure the degree of decrease in CFSE.
  • the results of the CD4 T cell activity inhibitory ability analysis according to this are shown in FIG. 5 .
  • the LPS-treated dendritic cells and the co-cultured T cells showed a proliferation rate of about 90%, whereas the Lactobacillus sakeai-derived extracellular vesicles of Example 1 and dendritic cells cultured for 24 hours.
  • the proliferation of CD4 T cells was significantly reduced compared to the LPS-treated group, showing a proliferation rate of about 60%, and it was confirmed that it was suppressed to a level close to that of the dendritic cell untreated group (Non-DCs). there was.
  • the immunosuppressive ability of the Lactobacillus sakeai-derived extracellular ER was realized by directly inhibiting the activity of CD4 T cells by tolDC induced by the Lactobacillus sakeai-derived extracellular ER.
  • the Lactobacillus sakeai-derived extracellular vesicles of the present invention can promote tolDC induction of dendritic cells, and tolDC can improve rheumatoid arthritis by inhibiting the activity of CD4 T cells.
  • the above ingredients are mixed and filled in an airtight bag to prepare a powder.
  • tablets are prepared by tableting according to a conventional manufacturing method of tablets.
  • the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.
  • the content of the above components per 1 ampoule is prepared.
  • each component is added to purified water to dissolve, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 g by adding purified water, and then filled in a brown bottle to sterilize to prepare a liquid.
  • composition ratio of the vitamin and mineral mixture is relatively suitable for granules in a preferred embodiment, but the mixing ratio may be arbitrarily modified. It can be prepared and used in the preparation of a health functional food composition according to a conventional method.
  • the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized, then refrigerated. It is used to prepare the functional beverage composition of the present invention.
  • composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demand class, demanding country, and use.
  • the pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells to directly promote CD4 T cell proliferation. It is possible to prevent or treat autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
  • the food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells and directly promotes proliferation of CD4 T cells. It is possible to prevent or improve autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)

Abstract

The present invention relates to a composition for preventing, treating or alleviating autoimmune diseases, comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient. Accordingly, the composition of the present invention directly inhibits CD4 T cell proliferation by promoting the induction of tolDCs from dendritic cells, and promotes the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR, and thus may prevent, treat or alleviate autoimmune diseases such as rheumatoid arthritis.

Description

락토바실러스 사케아이 유래 세포밖 소포체를 유효성분으로 포함하는 자가면역질환의 개선, 예방 또는 치료용 조성물Composition for improving, preventing or treating autoimmune diseases comprising Lactobacillus sakeai-derived extracellular vesicles as an active ingredient
본 발명은 류마티스 관절염 등의 자가면역질환 개선, 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for improving, preventing or treating autoimmune diseases such as rheumatoid arthritis.
면역체계는 외부로부터 침입한 항원(antigen)으로부터 신체를 보호하는 역할을 한다. 항원의 종류로는 박테리아, 바이러스, 독소, 암세포, 타인이나 동물의 혈액과 조직이 이에 해당된다. 면역체계는 이와 같은 해로운 물질들을 파괴하기 위하여 항체를 생산한다. 그러나 자가 면역에 이상이 생긴 경우 면역체계는 자신의 건강한 신체의 장기와 해로운 항원을 구분하지 못하여, 정상적인 조직을 파괴하게 되는데 이러한 반응을 통해 유발되는 질환이 자가면역질환(autoimmune disease)이다.The immune system plays a role in protecting the body from invading antigens from the outside. Antigens include bacteria, viruses, toxins, cancer cells, blood and tissues of other people or animals. The immune system produces antibodies to destroy these harmful substances. However, when there is an autoimmune abnormality, the immune system cannot distinguish between healthy organs and harmful antigens, destroying normal tissues. A disease induced through this reaction is an autoimmune disease.
자가면역질환 중 대표적인 류마티스 관절염은 여러 관절에 다발성으로 나타나는 염증성 자가면역질환이다. 류마티스성 관절염 증상을 가진 환자의 활막조직과 활액은 염증성 세포인 대식세포, T-세포, B 세포, 수지상 세포(dendritic cells) 등이 과도하게 작용하여 만성염증을 일으키고, 관절 및 연골 손상을 야기하고 통증을 유발하는 것을 특징으로 한다.Rheumatoid arthritis, a representative autoimmune disease, is an inflammatory autoimmune disease that appears multiple in multiple joints. In the synovial tissue and synovial fluid of patients with rheumatoid arthritis symptoms, inflammatory cells such as macrophages, T-cells, B cells, and dendritic cells act excessively, causing chronic inflammation, causing joint and cartilage damage. characterized by causing pain.
자가 면역 반응의 치료는 자가 면역 반응을 조절하고, 신체의 손상된 면역기능을 회복시키는 것을 목적으로 이루어지며, 이는 다양한 자가 면역 질환의 종류에 따라 치료의 방법에 차이가 있다. 예를 들어, 혈액에 문제가 생긴 경우에는 수혈을 해야하며, 뼈, 관절 혹은 근육에 문제가 생긴 경우에는 운동이나 다른 기능적인 치료를 받아야 한다. 또한 면역 체계의 반응을 조절하기 위해서 약물이 처방된다. 이에 따라 처방되는 면역억제제(immunosuppressive medicine)로는 코르티코스테로이드(corticosteroids) 약물인 프레드니손(prednisone), 비스테로이드성(nonsteroid) 약물인 시클로포스파미드(cyclophosphamide), 아자티오프린(azathioprine), 및 타크로리무스(tacrolimus) 등이 알려져 있다.The treatment of autoimmune reactions is performed for the purpose of controlling the autoimmune response and restoring the body's damaged immune function. For example, if there is a blood problem, a blood transfusion may be required, and if there is a problem with a bone, joint or muscle, exercise or other functional treatment may be required. Medications are also prescribed to modulate the immune system's response. Accordingly, immunosuppressive medicines prescribed include prednisone, a corticosteroid drug, cyclophosphamide, azathioprine, and tacrolimus, a nonsteroid drug. ) are known.
그러나 이러한 치료제들은 체내 부작용을 유발할 수 있으며 치료 효과도 충분하지 못하므로 안전성이 보장되면서도 치료 효과가 우수한 새로운 류마티스 관절염 등 자가면역질환 치료제의 개발이 필요한 실정이다.However, these therapeutic agents may cause side effects in the body and the therapeutic effect is not sufficient, so it is necessary to develop a new therapeutic agent for autoimmune diseases such as rheumatoid arthritis, which has excellent therapeutic effect while ensuring safety.
본 발명의 목적은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 치료할 수 있는 약학 조성물을 제공하는 데 있다.An object of the present invention is to promote tolDC induction from dendritic cells to directly inhibit the proliferation of CD4 T cells, and to promote the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR to prevent autoimmune diseases such as rheumatoid arthritis or To provide a therapeutic pharmaceutical composition.
본 발명의 다른 목적은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 개선할 수 있는 식품 조성물을 제공하는 데 있다.Another object of the present invention is to promote tolDC induction from dendritic cells to directly inhibit the proliferation of CD4 T cells, and to promote the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR to prevent autoimmune diseases such as rheumatoid arthritis Or to provide a food composition that can be improved.
본 발명의 일 측면에 따르면,According to one aspect of the present invention,
락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물이 제공된다.Provided is a pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
상기 자가면역질환은 류마티스성 관절염 (rheumatoid arthritis), 다발성 경화증(multiple sclerosis), 쇼그렌 증후군(Sjogren syndrome), 루프스(lupus), 아토피 피부염, 비염, 원형탈모증(alopecia areata), 건선(psoriasis), 천포창, 천식， 아프타 구내염， 만성 갑상선염， 후천성 재생불량성 빈혈， 베체트병(Behcet's disease), 크론병， 규소 폐증, 연쇄상구균감염후 사구체신염(PSGN), 피부근염(dermatomyosit is)， 다발성 근염(polymyositis), 자가면역성 용혈성 빈혈(autoimmune hemolytic anemia), 자가면역성 뇌척수염， 중증 근무력증(myasthenia gravis), 그레이브병(Grave's disease) 및 결절성 다발성 동맥염(polyarteritis nodosa) 중에서 선택된 어느 하나일 수 있다.The autoimmune disease is rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, lupus, atopic dermatitis, rhinitis, alopecia areata, psoriasis, pemphigus , asthma, aphthous stomatitis, chronic thyroiditis, acquired aplastic anemia, Behcet's disease, Crohn's disease, silicon pneumonitis, streptococcal glomerulonephritis (PSGN), dermatomyosit is, polymyositis, It may be any one selected from autoimmune hemolytic anemia, autoimmune encephalomyelitis, myasthenia gravis, Grave's disease, and polyarteritis nodosa.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 수지상 세포로부터 tolDC(Autologous tolerogenic dendritic cell)의 유도 촉진용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting induction of tolDC (Autologous tolerogenic dendritic cells) from dendritic cells.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 CD4 T 세포의 증식 억제용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases may be for inhibiting proliferation of CD4 T cells.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 DC-SIGN 및 DCIR 중에서 선택된 1종 이상의 면역 억제활성 유도 유전자의 발현 촉진용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting expression of one or more immunosuppressive activity-inducing genes selected from DC-SIGN and DCIR.
본 발명의 다른 하나의 측면에 따르면,According to another aspect of the present invention,
락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물이 제공된다.Provided is a food composition for preventing or improving autoimmune diseases, comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
본 발명의 다른 또 하나의 측면에 따르면,According to another aspect of the present invention,
(a) 락토바실러스 사케아이(Lactobacillus sakei)를 배양하는 단계;(a) culturing Lactobacillus sakei (Lactobacillus sakei);
(b) 상기 락토바실러스 사케아이가 배양된 배양액을 원심분리하여 배양 상층액을 회수하는 단계; 및(b) recovering the culture supernatant by centrifuging the culture medium in which the Lactobacillus sakeai is cultured; and
(c) 상기 배양 상층액을 염화나트륨을 포함하는 유기용매와 혼합하여 반응시킨 후 원심분리하여 세포밖 소포체 펠릿을 수득하는 단계; 및(c) mixing and reacting the culture supernatant with an organic solvent containing sodium chloride, followed by centrifugation to obtain an extracellular vesicle pellet; and
(d) 상기 세포밖 소포체 펠릿을 세포밖 소포체 추출 버퍼에 재현탁시켜 현탁액을 제조하고, 상기 현탁액으로부터 세포밖 소포체를 분리하는 단계;를 포함하는 자가면역질환 예방, 치료 또는 개선용 조성물의 제조방법이 제공된다.(d) preparing a suspension by resuspending the extracellular vesicle pellet in extracellular vesicle extraction buffer, and separating the extracellular vesicles from the suspension; this is provided
본 발명의 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 치료할 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells to directly promote CD4 T cell proliferation. It is possible to prevent or treat autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
본 발명의 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 개선할 수 있다.The food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells and directly promotes proliferation of CD4 T cells. It is possible to prevent or improve autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
도 1은 실시예 1에 따라 분리된 락토바실러스 사케아이 유래 세포밖 소포체의 전자현미경 사진이다.1 is an electron micrograph of an extracellular vesicle derived from Lactobacillus sakeai isolated according to Example 1. FIG.
도 2는 실험예 1에 따른 성숙 수시상 세포에서 tolDC 유도 분석 결과이다.2 is a result of analysis of tolDC induction in mature dendritic cells according to Experimental Example 1. FIG.
도 3은 실험예 2에 따른 DC-SIGN의 발현에 대한 qPCR 분석 결과이다.3 is a qPCR analysis result for the expression of DC-SIGN according to Experimental Example 2.
도 4는 실험예 2에 따른 DCIR의 발현에 대한 qPCR 분석 결과이다.4 is a qPCR analysis result for the expression of DCIR according to Experimental Example 2.
도 5는 실험예 3에 따른 CD4 T 세포 활성 억제능 분석 결과이다.5 is an analysis result of CD4 T cell activity inhibitory ability according to Experimental Example 3.
이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 첨부된 도면을 참조하여 본 발명의 실시예를 상세히 설명하도록 한다. 그러나, 이하의 설명은 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다. 본원에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 출원에서, "포함하다" 또는 "가지다" 등의 용어는 명세서상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art can easily carry out the present invention. However, the following description is not intended to limit the present invention to specific embodiments, and when it is determined that detailed descriptions of related known technologies may obscure the gist of the present invention in describing the present invention, the detailed description thereof will be omitted. . The terminology used herein is used only to describe specific embodiments, and is not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly dictates otherwise. In the present application, terms such as "comprise" or "have" are intended to designate that a feature, number, step, operation, element, or combination thereof described in the specification exists, and includes one or more other features or It should be understood that the possibility of the presence or addition of numbers, steps, acts, elements, or combinations thereof is not precluded in advance.
본 발명의 자가면역질환 예방 또는 치료용 약학 조성물은 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함한다.The pharmaceutical composition for preventing or treating autoimmune diseases of the present invention contains Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
본 명세서에서, 락토바실러스 사케아이는 제한되지 않으나, 바람직하게는 김치 유래의 락토바실러스 사케아이, 보다 바람직하게는 수탁번호 KCTC13818BP로 기탁된 락토바실러스 사케아이이다.In the present specification, the Lactobacillus sakeai is not limited, but preferably Lactobacillus sakeai derived from kimchi, more preferably Lactobacillus sakeai deposited under the accession number KCTC13818BP.
상기 수탁번호 KCTC13818BP의 락토바실러스 사케아이는 생물자원센터에 2019년 03월 07일자로 기탁되었다.Lactobacillus sakeai of the above accession number KCTC13818BP was deposited with the Center for Biological Resources on March 07, 2019.
상기 자가면역질환은 류마티스 관절염 (rheumatoid arthritis), 다발성 경화증(multiple sclerosis), 쇼그렌 증후군(Sjogren syndrome), 루프스(lupus), 아토피 피부염, 비염, 원형탈모증(alopecia areata), 건선(psoriasis), 천포창, 천식， 아프타 구내염， 만성 갑상선염， 후천성 재생불량성 빈혈， 베체트병(Behcet's disease), 크론병， 규소 폐증, 연쇄상구균감염후 사구체신염(PSGN), 피부근염(dermatomyosit is)， 다발성 근염(polymyositis), 자가면역성 용혈성 빈혈(autoimmune hemolytic anemia), 자가면역성 뇌척수염， 중증 근무력증(myasthenia gravis), 그레이브병(Grave's disease) 및 결절성 다발성 동맥염(polyarteritis nodosa) 중에서 선택된 어느 하나일 수 있고, 바람직하게는 류마티스 관절염 (rheumatoid arthritis), 다발성 경화증(multiple sclerosis), 또는 쇼그렌 증후군(Sjogren syndrome)일 수 있고, 더욱 바람직하게는 류마티스 관절염 일 수 있다.The autoimmune disease is rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, lupus, atopic dermatitis, rhinitis, alopecia areata, psoriasis, pemphigus, Asthma, aphthous stomatitis, chronic thyroiditis, acquired aplastic anemia, Behcet's disease, Crohn's disease, silicon pneumonitis, streptococcal glomerulonephritis (PSGN), dermatomyosit is, polymyositis, autologous It may be any one selected from autoimmune hemolytic anemia, autoimmune encephalomyelitis, myasthenia gravis, Grave's disease and polyarteritis nodosa, preferably rheumatoid arthritis ), multiple sclerosis, or Sjogren syndrome, and more preferably rheumatoid arthritis.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 수지상 세포로부터 tolDC(Autologous tolerogenic dendritic cell)의 유도 촉진용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases may be for promoting induction of tolDC (Autologous tolerogenic dendritic cells) from dendritic cells.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 CD4 T 세포의 증식 억제용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases may be for inhibiting proliferation of CD4 T cells.
CD4 T 세포는 헬퍼 T 세포로 다양한 면역 세포를 활성화 시키는 세포군을 뜻한다. CD4 T 세포라는 집합체 안에 Tfh2세포를 포함한 다양한 Th1, Th2, Th1 7등의 CD4 T 세포들이 존재한다CD4 T cells are helper T cells and refer to a group of cells that activate various immune cells. There are various Th1, Th2, Th1 7 CD4 T cells including Tfh2 cells in the aggregate called CD4 T cells.
상기 자가면역질환 예방 또는 치료용 약학 조성물은 DC-SIGN(Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin) 및 수지상 세포 면역수용체(dendritic cell immunoreceptor, DCIR) 중에서 선택된 1종 이상의 면역 억제활성 유도 유전자의 발현 촉진용일 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases has at least one immunosuppressive activity selected from DC-SIGN (Dendritic Cell-Specific Intercellular Adhesion Molecule-3-Grabbing Non-integrin) and dendritic cell immunoreceptor (DCIR). It may be for promoting expression of an inducible gene.
DC-SIGN은 보체 수용체의 일종으로, C1q를 리간드로 하여 작용한다. C형 렉틴(C-type lectin, CLEC)의 수용체인 C형 렉틴 수용체(C-type lectin receptor, CLR)에 속하고, 큰포식세포(macrophage)와 수지상세포(dendritic cell)에서 주로 발현되는 수용체이다. 큰포식세포 중에서도 림프절(lymph node)이나 비장의 가장자리(marginal zone)에 존재하는 큰포식세포들에서 DC-SIGN과 그에 유사한 수용체들이 자주 발견된다. 한편, 수지상세포는 T 세포에게 항원제시(antigen presentation)를 담당하는데, 이 과정에서 DC-SIGN을 포함한 수지상 세포 표면의 CLR들이 관여할 수 있다. DC-SIGN은 CLR 중에서도 효율적으로 CD4 T 세포에 항원 제시가 가능하다.DC-SIGN is a type of complement receptor and acts by using C1q as a ligand. It belongs to the C-type lectin receptor (CLR), which is a C-type lectin (CLEC) receptor, and is a receptor mainly expressed in macrophages and dendritic cells. . Among macrophages, DC-SIGN and similar receptors are frequently found in macrophages located in lymph nodes or marginal zones of the spleen. On the other hand, dendritic cells are responsible for antigen presentation to T cells, and in this process, CLRs on the surface of dendritic cells, including DC-SIGN, may be involved. DC-SIGN can efficiently present antigens to CD4 T cells among CLRs.
한편, 수지상 세포 면역수용체(DCIR)는 수지상 세포와 골세포 표면에 있는 당단백질인 NA2(asialo-biantennary N-glycan)와의 상호작용으로 염증반응을 억제할 수 있다.On the other hand, dendritic cell immunoreceptor (DCIR) can inhibit the inflammatory response by interaction with NA2 (asialo-biantennary N-glycan), a glycoprotein on the surface of dendritic cells and bone cells.
본 명세서에서 용어 "세포밖 소포체(extracellular vesicle)"는 다양한 세포에서 다낭체와 원형질막의 융합을 통해 세포 밖 환경으로 분비되는 20 내지 1,000 nm 범위 직경의 지질 이중막 구조의 소낭을 의미한다.As used herein, the term "extracellular vesicle" refers to a vesicle having a lipid bilayer structure with a diameter ranging from 20 to 1,000 nm that is secreted into the extracellular environment through the fusion of polycystic bodies and plasma membranes in various cells.
본 발명의 구체적인 구현예에 따르면, 본 발명의 방법으로 제조되는 세포밖 소포체의 평균직경은 20 내지 500 nm 일 수 있고, 바람직하게는 50 내지 300 nm, 더욱 바람직하게는 150 내지 200nm 범위일 수 있다. 이와 같은 범위의 미세 직경을 갖는 세포밖 소포체를 엑소좀(exosome)이라고 한다.According to a specific embodiment of the present invention, the average diameter of the extracellular vesicles produced by the method of the present invention may be in the range of 20 to 500 nm, preferably 50 to 300 nm, more preferably 150 to 200 nm. . Extracellular vesicles having a microdiameter within this range are called exosomes.
이하, 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물의 제조방법에 대해 설명하도록 한다.Hereinafter, a method for preparing a pharmaceutical composition for preventing or treating autoimmune diseases including Lactobacillus sakei-derived extracellular vesicles as an active ingredient will be described.
먼저, 락토바실러스 사케아이(Lactobacillus sakei)를 배양한다(단계 a).First, culture Lactobacillus sakei (step a).
락토바실러스 사케아이는 김치 추출물의 원액으로부터 수득될 수 있다.Lactobacillus sakeai can be obtained from a stock solution of kimchi extract.
다음으로, 상기 락토바실러스 사케아이가 배양된 배양액을 원심분리하여 배양 상층액을 회수한다(단계 b).Next, the Lactobacillus sakeai cultured medium is centrifuged to recover the culture supernatant (step b).
이후, 상기 배양 상층액을 염화나트륨와 유기용매를 포함하는 용액과 혼합하여 반응시킨 후 원심분리하여 세포밖 소포체 펠릿을 수득한다(단계 c).Thereafter, the culture supernatant is mixed with a solution containing sodium chloride and an organic solvent and reacted, followed by centrifugation to obtain an extracellular vesicle pellet (step c).
상기 배양 상층액과, 염화나트륨와 유기용매를 포함하는 용액는 1:0.5 내지 1:1.5 부피비로 혼합할 수 있고, 바람직하게는 1:0.8 내지 1:1.2의 부피비로 혼합할 수 있고, 더욱 바람직하게는 동량으로 혼합할 수 있다.The culture supernatant and the solution containing sodium chloride and the organic solvent may be mixed in a volume ratio of 1:0.5 to 1:1.5, preferably in a volume ratio of 1:0.8 to 1:1.2, more preferably the same amount can be mixed with
상기 유기용매는 폴리에틸렌글리콜일 수 있다.The organic solvent may be polyethylene glycol.
상기 염화나트륨와 유기용매를 포함하는 용액은 염화나트륨 농도가 0.5 내지 1 M 인 것이 바람직하다.The solution containing sodium chloride and the organic solvent preferably has a sodium chloride concentration of 0.5 to 1 M.
상기 염화나트륨와 유기용매를 포함하는 용액과 혼합하여 반응시킨 후 원심분리한 후 상기 혼합 및 원심분리를 반복 수행할 수 있다.After the reaction is mixed with the solution containing the sodium chloride and the organic solvent, centrifugation may be performed, and then the mixing and centrifugation may be repeated.
마지막으로, 상기 세포밖 소포체 펠릿을 세포밖 소포체 추출 버퍼에 재현탁시켜 현탁액을 제조하고, 상기 현탁액으로부터 세포밖 소포체를 분리한다(단계 d).Finally, the extracellular vesicle pellet is resuspended in extracellular vesicle extraction buffer to prepare a suspension, and the extracellular vesicles are isolated from the suspension (step d).
상기 세포밖 소포체 추출 버퍼는 PBS(Phosphate-buffered saline)를 사용하는 것이 바람직하다.It is preferable to use the extracellular vesicle extraction buffer (Phosphate-buffered saline).
한편, 본 명세서에서 용어 ‘유효성분으로 포함하는’이란 락토바실러스 사케아이 유래 세포밖 소포체의 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미한다. 본 발명의 한 구체예에서, 본 발명의 조성물 내에서 락토바실러스 사케아이 유래 세포밖 소포체는 예를 들어, 0.001 mg/kg 이상, 바람직하게는 0.1 mg/kg 이상, 보다 바람직하게는 10 mg/kg 이상, 보다 더 바람직하게는 100 mg/kg 이상, 보다 더욱 더 바람직하게는 250 mg/kg 이상, 가장 바람직하게는 1 g/kg 이상 포함된다. 락토바실러스 사케아이 유래 세포밖 소포체는 천연물로서 과량 투여하여도 인체에 부작용이 없으므로 본 발명의 조성물 내에 포함되는 락토바실러스 사케아이 유래 세포밖 소포체의 양적 상한은 당업자가 적절한 범위 내에서 선택하여 실시할 수 있다.Meanwhile, in the present specification, the term 'comprising as an active ingredient' means including an amount sufficient to achieve the efficacy or activity of the Lactobacillus sakeai-derived extracellular vesicles. In one embodiment of the present invention, the Lactobacillus sakeai-derived extracellular vesicles in the composition of the present invention are, for example, 0.001 mg/kg or more, preferably 0.1 mg/kg or more, more preferably 10 mg/kg or more. or more, more preferably 100 mg/kg or more, still more preferably 250 mg/kg or more, and most preferably 1 g/kg or more. Since the Lactobacillus Sakei-derived extracellular vesicles are natural products and have no side effects to the human body even when administered in excess, the upper quantitative limit of the Lactobacillus Sakei-derived extracellular vesicles contained in the composition of the present invention can be selected and carried out by those skilled in the art by selecting within an appropriate range. have.
본 발명의 약학 조성물은 상기 유효 성분 이외에 약제학적으로 적합하고 생리학적으로 허용되는 보조제를 사용하여 제조될 수 있으며, 상기 보조제로는 부형제, 붕해제, 감미제, 결합제, 피복제, 팽창제, 윤활제, 활택제 또는 향미제 등을 사용할 수 있다.The pharmaceutical composition of the present invention may be prepared by using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant includes an excipient, a disintegrant, a sweetener, a binder, a coating agent, a swelling agent, a lubricant, and a lubricant. agent or flavoring agent, etc. may be used.
상기 약학 조성물은 투여를 위해서 상기 기재한 유효 성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함하여 약학 조성물로 바람직하게 제제화할 수 있다. The pharmaceutical composition may be preferably formulated as a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration.
상기 약학 조성물의 제제 형태는 과립제, 산제, 정제, 피복정, 캡슐제, 좌제, 액제, 시럽, 즙, 현탁제, 유제, 점적제 또는 주사 가능한 액제 등이 될 수 있다. 예를 들어, 정제 또는 캡슐제의 형태로의 제제화를 위해, 유효 성분은 에탄올, 글리세롤, 물 등과 같은 경구, 무독성의 약제학적으로 허용 가능한 불활성 담체와 결합될 수 있다. 또한, 원하거나 필요한 경우, 적합한 결합제, 윤활제, 붕해제 및 발색제 또한 혼합물로 포함될 수 있다. 적합한 결합제는 이에 제한되는 것은 아니나, 녹말, 젤라틴, 글루코스 또는 베타-락토오스와 같은 천연 당, 옥수수 감미제, 아카시아, 트래커캔스 또는 소듐올레이트와 같은 천연 및 합성 검, 소듐 스테아레이트, 마그네슘 스테아레이트, 소듐 벤조에이트, 소듐 아세테이트, 소듐 클로라이드 등을 포함한다. 붕해제는 이에 제한되는 것은 아니나, 녹말, 메틸 셀룰로스, 아가, 벤토니트, 잔탄 검 등을 포함한다. Formulations of the pharmaceutical composition may be granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops or injectables. For example, for formulation in the form of a tablet or capsule, the active ingredient may be combined with an orally, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. In addition, if desired or required, suitable binders, lubricants, disintegrants and color-developers may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.
액상 용액으로 제제화되는 조성물에 있어서 허용 가능한 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.In the composition formulated as a liquid solution, acceptable pharmaceutical carriers are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.
본 발명의 약학 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있으며, 바람직하게는 경구 투여이다.The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc., preferably oral administration.
본 발명의 약학 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약학 조성물의 1일 투여량은 0.001-10g/㎏이다.A suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration mode, age, weight, pathological condition, food, administration time, route of administration, excretion rate, and response sensitivity of the patient, usually skilled A trained physician can readily determine and prescribe an effective dosage for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.001-10 g/kg.
본 발명의 약학 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. Alternatively, it may be prepared by being introduced into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.
본 발명은 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물을 제공한다.The present invention provides a food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
상기 락토바실러스 사케아이는 제한되지 않으나, 바람직하게는 김치 유래의 락토바실러스 사케아이, 보다 바람직하게는 수탁번호 KCTC13818BP로 기탁된 락토바실러스 사케아이이다. The Lactobacillus sakeai is not limited, but preferably Lactobacillus sakeai derived from kimchi, more preferably Lactobacillus sakeai deposited under the accession number KCTC13818BP.
상기 락토바실러스 사케아이 유래 세포밖 소포체에 관한 내용은 상술한 락토바실러스 사케아이 유래 세포밖 소포체를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물에서의 설명과 동일하므로 상세한 내용은 그 부분을 참조하기로 한다.The contents of the Lactobacillus Sakei-derived extracellular vesicles are the same as those described in the pharmaceutical composition for preventing or treating autoimmune diseases comprising the above-described Lactobacillus Sakei-derived extracellular vesicles as an active ingredient. shall refer to.
본 발명에 따른 식품 조성물은 상기 약학 조성물과 동일한 방식으로 제제화되어 기능성 식품으로 이용하거나, 각종 식품에 첨가할 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는 예를 들어, 음료류, 알코올 음료류, 과자류, 다이어트바, 유제품, 육류, 초코렛, 피자, 라면, 기타 면류, 껌류, 아이스크림류, 비타민 복합제, 건강보조식품류 등이 있다.The food composition according to the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, sweets, diet bars, dairy products, meat, chocolate, pizza, ramen, other noodles, gums, ice cream, vitamin complexes, health supplements etc.
본 발명의 식품 조성물은 상기 유효성분뿐 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있으며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 [타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등]) 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제와 음료류로 제조되는 경우에는 본 발명의 유효성분 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 및 각종 식물 추출액 등을 추가로 포함시킬 수 있다.The food composition of the present invention may include not only the active ingredients, but also ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents [taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink or beverage, citric acid, high fructose, sugar, glucose, acetic acid, malic acid, fruit juice, and various plant extracts may be additionally included in addition to the active ingredient of the present invention.
본 발명은 상기 락토바실러스 사케아이 유래 세포밖 소포체를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물을 포함하는 건강기능식품을 제공한다. 건강기능식품이란, 락토바실러스 사케아이 유래 세포밖 소포체를 음료, 차류, 향신료, 껌, 과자류 등의 식품소재에 첨가하거나, 캡슐화, 분말화, 현탁액 등으로 제조한 식품으로, 이를 섭취할 경우 건강상 특정한 효과를 가져오는 것을 의미하나, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용시 발생할 수 있는 부작용 등이 없는 장점이 있다. 이와 같이 하여 얻어지는 본 발명의 건강기능식품은, 일상적으로 섭취하는 것이 가능하기 때문에 매우 유용하다. 이와 같은 건강기능식품에 있어서의 락토바실러스 사케아이 유래 세포밖 소포체의 첨가량은, 대상인 건강기능식품의 종류에 따라 달라 일률적으로 규정할 수 없지만, 식품 본래의 맛을 손상시키지 않는 범위에서 첨가하면 되며, 대상 식품에 대하여 통상 0.01 내지 50 중량%, 바람직하기로는 0.1 내지 20 중량%의 범위이다. 또한, 환제, 과립제, 정제 또는 캡슐제 형태의 건강기능식품의 경우에는 통상 0.1 내지 100 중량% 바람직하기로는 0.5 내지 80 중량%의 범위에서 첨가하면 된다. 한 구체예에서, 본 발명의 건강기능식품은 환제, 정제, 캡슐제 또는 음료의 형태일 수 있다.The present invention provides a health functional food comprising a food composition for preventing or improving autoimmune diseases comprising the Lactobacillus sakeai-derived extracellular vesicles as an active ingredient. Health functional food is a food prepared by adding Lactobacillus sakei-derived extracellular vesicles to food materials such as beverages, teas, spices, gum, and confectionery, or by encapsulating, powdering, or suspension, etc. It means to bring a specific effect, but unlike general drugs, it has the advantage of not having side effects that may occur when taking the drug for a long period of time by using food as a raw material. The health functional food of the present invention obtained in this way is very useful because it can be ingested on a daily basis. The amount of Lactobacillus sakeai-derived extracellular vesicles added in such a health functional food cannot be uniformly defined as it varies depending on the type of health functional food being targeted, but it can be added within a range that does not impair the original taste of the food, It is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight, based on the target food. In addition, in the case of a health functional food in the form of pills, granules, tablets or capsules, it is usually added in an amount of 0.1 to 100% by weight, preferably 0.5 to 80% by weight. In one embodiment, the health functional food of the present invention may be in the form of a pill, tablet, capsule or beverage.
상기 본 발명에 따른 락토바실러스 사케아이 유래 세포밖 소포체 또는 이를 유효성분으로 포함하는 조성물은 사료첨가제 또는 사료로써 이용될 수 있다.The Lactobacillus sakeai-derived extracellular vesicles according to the present invention or a composition comprising the same as an active ingredient may be used as a feed additive or feed.
사료 첨가제로써 이용될 경우, 상기 조성물은 20 내지 90% 고농축액이거나 분말 또는 과립 형태로 제조될 수 있다. 상기 사료첨가제는 구연산, 후말산, 아디픽산, 젖산, 사과산등의 유기산이나 인산 나트륨, 인산 칼륨, 산성 피로인산염, 폴리인산염(중합인산염) 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다. 사료로써 이용될 경우, 상기 조성물은 통상의 사료 형태로 제제화 될 수 있으며, 통상의 사료성분을 함께 포함할 수 있다.When used as a feed additive, the composition may be 20 to 90% highly concentrated or prepared in powder or granular form. The feed additives include organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polyphosphate), polyphenol, catechin, alpha-tocopherol, rosemary Extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included. When used as a feed, the composition may be formulated in the form of a conventional feed, and may include common feed ingredients together.
상기 사료첨가제 및 사료는 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩, 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조성분 등을 더 포함할 수 있으며, 이외에도 영양보충제, 소화 및 흡수향상제, 성장촉진제 등을 더 포함할 수 있다.The feed additive and feed include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean, and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
상기 사료첨가제는 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료첨가제는 탑드레싱으로서 또는 이들을 동물사료에 직접 혼합하거나 또는 사료와 별도의 경구제형으로 용이하게 동물에게 투여할 수 있다. 상기 사료첨가제를 동물사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수전분, 락토오스, 수크로오스, 콩플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 사료첨가제는 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 사료첨가제는 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다. The feed additive may be administered alone or in combination with other feed additives in an edible carrier. In addition, the feed additive can be easily administered to the animal as a top dressing, directly mixing them with animal feed, or in an oral formulation separate from the feed. When the feed additive is administered separately from animal feed, it may be combined with a pharmaceutically acceptable edible carrier as well known in the art, and may be prepared into an immediate release or sustained release formulation. Such edible carriers may be solid or liquid, for example cornstarch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil and propylene glycol. When a solid carrier is used, the feed additive may be a tablet, a capsule, a powder, a troche or a sugar-containing tablet, or a top dressing in a microdispersed form. When a liquid carrier is used, the feed additive may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.
또한, 상기 사료첨가제 및 사료는 보조제, 예를 들어 보존제, 안정화제, 습윤제 또는 유화제, 용액촉진제 등을 함유할 수 있다. 상기 사료첨가제는 침주, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.In addition, the feed additives and feed may contain auxiliary agents, for example, preservatives, stabilizers, wetting or emulsifying agents, solution accelerators, and the like. The feed additive may be used by adding to animal feed by immersion, spraying, or mixing.
본 발명의 사료 또는 사료첨가제는 포유류, 가금 및 어류를 포함하는 다수의 동물식이에 적용할 수 있다.The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry and fish.
상기 포유류로서 돼지, 소, 양, 염소, 실험용 설치동물, 및 실험용 설치동물뿐만 아니라, 애완동물(예: 개, 고양이) 등에게 사용할 수 있으며, 상기 가금류로서 닭, 칠면조, 오리, 거위, 꿩, 및 메추라기 등에도 사용할 수 있고, 상기 어류로서 송어 등에 이용될 수 있으나, 이에 한정되는 것은 아니다.As the mammal, it can be used for pigs, cattle, sheep, goats, laboratory rodents, and laboratory rodents, as well as pets (eg, dogs, cats), etc., as the poultry, chickens, turkeys, ducks, geese, pheasants, and quail, and the like, and may be used as the fish such as trout, but is not limited thereto.
또한, 본 발명은 자가면역질환 예방, 치료 또는 개선용 의약 또는 식품의 제조를 위한 락토바실러스 사케아이 유래 세포밖 소포체의 용도를 제공한다. 상기한 바와 같이 락토바실러스 사케아이 유래 세포밖 소포체는 자가면역질환의 치료 또는 개선을 위한 용도로 이용될 수 있다.In addition, the present invention provides the use of the Lactobacillus sakeai-derived extracellular vesicles for the manufacture of a medicament or food for preventing, treating or improving autoimmune diseases. As described above, the Lactobacillus Sakeai-derived extracellular vesicles can be used for the treatment or improvement of autoimmune diseases.
또한, 본 발명은 포유동물에게 유효량의 락토바실러스 사케아이 유래 세포밖 소포체를 투여하는 것을 포함하는 자가면역질환의 개선, 예방 또는 치료 방법을 제공한다.In addition, the present invention provides a method for improving, preventing or treating an autoimmune disease comprising administering to a mammal an effective amount of an extracellular vesicle derived from Lactobacillus sakeai.
여기에서 사용된 용어 "포유동물"은 치료, 관찰 또는 실험의 대상(subject)인 포유동물을 말하며, 바람직하게는 인간을 말한다.As used herein, the term “mammal” refers to a mammal that is the subject of treatment, observation or experimentation, preferably a human.
여기에서 사용된 용어 "유효량"은 연구자, 수의사, 의사 또는 기타 임상의에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응을 유도하는 유효 성분 또는 약학 조성물의 양을 의미하는 것으로, 이는 해당 질환 또는 장애의 증상의 완화를 유도하는 양을 포함한다. 본 발명의 유효 성분에 대한 유효량 및 투여횟수는 원하는 효과에 따라 변화될 수 있다. 그러므로, 투여될 최적의 투여량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효성분 및 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 본 발명의 예방, 치료 또는 개선 방법에 있어서, 성인의 경우, 추출물을 1일 1회 내지 수회 투여시, 0.001 g/kg 내지 10 g/kg의 용량으로 투여하는 것이 바람직하다.As used herein, the term "effective amount" refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as conceived by a researcher, veterinarian, physician or other clinician, which is the disease in question. or an amount that induces alleviation of the symptoms of the disorder. The effective amount and frequency of administration for the active ingredient of the present invention may vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the content of active ingredients and other components contained in the composition, the type of formulation, and the age, weight, and general health of the patient It can be adjusted according to various factors including state, sex and diet, administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs. In the prevention, treatment or improvement method of the present invention, for adults, it is preferable to administer the extract at a dose of 0.001 g/kg to 10 g/kg when administered once to several times a day.
본 발명의 치료방법에서 락토바실러스 사케아이 유래 세포밖 소포체를 유효 성분으로 포함하는 조성물은 경구, 직장, 정맥내, 동맥내, 복강내, 근육내, 흉골내, 경피, 국소, 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.In the treatment method of the present invention, the composition comprising Lactobacillus sakeai-derived extracellular vesicles as an active ingredient is administered via oral, rectal, intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, or intradermal routes. It can be administered in a conventional manner.
이하에서 실시예 등을 통해 본 발명을 더욱 상세히 설명하고자 하며, 다만 이하의 실시예 등에 의해 본 발명의 범위와 내용이 축소되거나 제한되어 해석될 수 없다. 또한, 이하의 실시예를 포함한 본 발명의 개시 내용에 기초한다면, 구체적으로 실험 결과가 제시되지 않은 본 발명을 통상의 기술자가 용이하게 실시할 수 있음은 명백한 것이며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속하는 것도 당연하다.Hereinafter, the present invention will be described in more detail through examples, etc., but the scope and contents of the present invention cannot be construed as being reduced or limited by the following examples. In addition, based on the disclosure of the present invention including the following examples, it is clear that a person skilled in the art can easily practice the present invention for which specific experimental results are not presented. It goes without saying that it falls within the scope of the claims.
또한 이하에서 제시되는 실험 결과는 상기 실시예 및 비교예의 대표적인 실 험 결과만을 기재한 것이며, 아래에서 명시적으로 제시하지 않은 본 발명의 여러 구현예의 각각의 효과는 해당 부분에서 구체적으로 기재하도록 한다.In addition, the experimental results presented below describe only the representative experimental results of the Examples and Comparative Examples, and the respective effects of various embodiments of the present invention that are not explicitly presented below will be described in detail in the corresponding part.
[실시예][Example]
실시예 1: 락토바실러스 사케아이 유래 세포밖 소포체(P12E) 분리Example 1: Lactobacillus sakeai-derived extracellular vesicle (P12E) isolation
(1) 균주의 분리 및 동정(1) Isolation and identification of strains
김치 추출물의 원액을 MRS 배지에 도말하여 얻은 균단일집락을 루프로 수거하여 MRS broth에 배양하였다. DNA 추출은 QIAamp DNA Mini Kit(QIAgen, Germany)를 사용하여 추출하였다. 추출된 DNA는 1% 아가로스 겔을 이용하여 확인하였으며, 16S rRNA gene을 증폭하기 위하여 추출된 genomic DNA를 주형으로 하여 PCR을 진행하였고, PCR 조건은 denaturation 95℃에서 1분, annealing 45℃에서 1 분, extension 72℃에서 1 분 30초로 30 사이클을 수행하였다. 얻어진 PCR 산물은 마크로젠(Seoul, Korea)에 의뢰하여 서열을 분석하였다. 세균의 동정은 16SrRNA 서열을 National Center for Biotechnology Information(NCBI, www.ncbi.nlm.nih.gov)의 Basic Local Alignment Search Tool (BLAST) 검색엔진의 유사도 분석을 통해 수행하였다.Single colonies obtained by smearing the stock solution of kimchi extract on MRS medium were collected in a loop and cultured in MRS broth. DNA extraction was performed using QIAamp DNA Mini Kit (QIAgen, Germany). The extracted DNA was confirmed using a 1% agarose gel, and PCR was performed using the extracted genomic DNA as a template to amplify the 16S rRNA gene. Min, extension 30 cycles were performed at 72° C. for 1 minute and 30 seconds. The PCR product obtained was requested to Macrogen (Seoul, Korea) and sequenced. Bacterial identification was performed through similarity analysis of the 16SrRNA sequence with the Basic Local Alignment Search Tool (BLAST) search engine of the National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov).
상기 미생물을 락토바실러스 사케아이 WIKIM0109 (Lactobacillus sakei WIKIM0109)으로 명명하였으며, 생물자원센터에 기탁하였다(수탁번호 KCTC13818BP).The microorganism was named Lactobacillus sakei WIKIM0109 (Lactobacillus sakei WIKIM0109) and deposited at the Center for Biological Resources (Accession No. KCTC13818BP).
(2) 세포밖 소포체 분리(2) Isolation of extracellular vesicles
락토바실러스 사케아이(수탁번호 KCTC13818BP)를 MRS 액체배지 30 ㎖에 0.1% 접종하여 30℃에서 18시간 동안 배양하였다. 배양 후, 3500 rpm, 4℃에서 10분간 1차 원심분리 후 10,000 x g, 4℃에서 20분간 2차 원심분리하여 배양 상층액을 회수하고, 최종 0.22 ㎛ 필터로 여과하여 균체가 제거된 배양 상층액을 회수하였다. 이후, 배양 상층액과 16% PEG 6000에 용해된 1 M NaCl 용액을 동량으로 섞어 4℃에서 15시간 반응시킨 후, 10,000 xg, 4℃에서 20분간 원심분리하여 세포밖 소포체(EV) 펠릿(pellet)을 얻었다. 세포밖 소포체 펠릿은 5% PEG 6000에 용해된 0.5 M NaCl 용액으로 재현탁(resuspension)시켜 세척 후, 11,000 rpm, 4℃에서 20분간 원심분리를 수행하였다. 원심분리 후 수득한 세포밖 소포체 펠릿을 PBS(Phosphate-buffered saline)에 재현탁시켜 최종적으로 락토바실러스 사케아이 유래 세포밖 소포체를 분리하였다. 락토바실러스 사케아이와 분리된 세포밖 소포체(화살표 표시)의 전자현미경 이미지를 도 1에 나타내었다.0.1% of Lactobacillus Sakeai (Accession No. KCTC13818BP) was inoculated into 30 ml of MRS broth and cultured at 30° C. for 18 hours. After incubation, the culture supernatant was recovered by first centrifugation at 3500 rpm, 4°C for 10 minutes, followed by a second centrifugation at 10,000 x g, 4°C for 20 minutes, and finally filtered through a 0.22 μm filter to remove cells. was recovered. Then, the culture supernatant and 1 M NaCl solution dissolved in 16% PEG 6000 were mixed in equal amounts and reacted at 4 ° C. for 15 hours, followed by centrifugation at 10,000 x g, 4 ° C. for 20 minutes to pellet the extracellular vesicles (EV). ) was obtained. The extracellular vesicle pellet was resuspended in 0.5 M NaCl solution dissolved in 5% PEG 6000, washed, and centrifuged at 11,000 rpm, 4° C. for 20 minutes. The extracellular vesicle pellet obtained after centrifugation was resuspended in PBS (Phosphate-buffered saline) to finally separate Lactobacillus sakeai-derived extracellular vesicles. An electron microscope image of the Lactobacillus sakeai and the isolated extracellular vesicles (arrow) is shown in FIG. 1 .
비교예 1: 락토바실러스 사케아이 배양배지(P12 media)Comparative Example 1: Lactobacillus sakeai culture medium (P12 media)
실시예 1의 (1)에서 락토바실러스 사케아이를 배양한 배지를 준비하였다. A medium in which Lactobacillus sakeai was cultured in (1) of Example 1 was prepared.
비교예 2: 락토바실러스 사케아이(P12)Comparative Example 2: Lactobacillus sakeai (P12)
실시예 1에서 세포밖 소포체를 분리하지 않고 (1)의 락토바실러스 사케아이를 준비하였다. In Example 1, the Lactobacillus sakeai of (1) was prepared without separating the extracellular vesicles.
[실험예: 생체 외 실험][Experimental Example: In vitro experiment]
수지상 세포 분화Dendritic Cell Differentiation
(1) 골수로부터 미성숙 수지상 세포 분화(1) Immature dendritic cell differentiation from bone marrow
마우스의 대퇴골(femur)과 경골(tibia)의 골수세포(bone marrow cells)로부터 단핵구(monocytes)를 Ficoll-Paque® 밀도구배원심법(density gradient centrifugation)에 따라 원심분리하였다. 분리된 단핵구는 2 x 106/well의 농도로 6 웰플레이트에 준비하였으며, 태아 소 혈청(Fetal Bovine Serum, FBS)이 포함된 배지(RPMI)에 GM-CSF(Granulocyte-macrophage colony-stimulating factor) 20 ng/㎖, IL-4(interleukin 4) 10 ng/㎖를 함께 처리하였다. 그 후 6일 동안 배양하였으며 3일이 경과하였을 때, 신선한 배지와 사이토카인으로 교체해주어 분화된 미성숙 수지상 세포를 수득하였다.Monocytes from bone marrow cells of the femur and tibia of mice were centrifuged according to the Ficoll-Paque® density gradient centrifugation method. The isolated monocytes were prepared in a 6-well plate at a concentration of 2 x 10 6 /well, and GM-CSF (Granulocyte-macrophage colony-stimulating factor) was added to a medium (RPMI) containing Fetal Bovine Serum (FBS). 20 ng/ml and 10 ng/ml of IL-4 (interleukin 4) were co-treated. After that, it was cultured for 6 days, and when 3 days had elapsed, it was replaced with a fresh medium and cytokines to obtain differentiated immature dendritic cells.
(2) 성숙 수지상 세포의 분화(2) Differentiation of mature dendritic cells
상술한 바와 같이 수득된 미성숙 수지상 세포(Immature DC)를 성숙 수지상 세포(mature DC)로 분화시키기 위해 양성 대조군 LPS(Lipopolysaccharide)를 2시간 동안 처리하여 성숙 수지상 세포로의 분화 및 활성을 유도하였다. 이후, 2차 자극원으로 비교예 2의 락토바실러스 사케아이, 실시예 1의 락토바실러스 사케아이 유래 세포밖 소포체(EV)를 각각 MOI(multiplicity of infection) 1로 접종하여 24시간 공동배양하였다. In order to differentiate the immature DCs obtained as described above into mature DCs, the positive control LPS (Lipopolysaccharide) was treated for 2 hours to induce differentiation and activity into mature DCs. Thereafter, the Lactobacillus sakeai of Comparative Example 2 and the Lactobacillus sakeai derived extracellular vesicles (EV) of Example 1 were inoculated with MOI (multiplicity of infection) 1 as a secondary stimulus, and co-cultured for 24 hours.
실험예 1: 성숙 수시상 세포에서 tolDC 유도 분석Experimental Example 1: Analysis of tolDC induction in mature dendritic cells
상술한 바와 같이 배양이 종료된 후 tolDC(Autologous tolerogenic dendritic cell)로의 분화가 유도되었는지 확인하기 위해 tolDC의 대표적인 마커인 PD-L1(Programmed Death-Ligand 1)의 발현정도를 유세포 분석(Flow cytometry)을 통해 확인하고, 그 결과를 도 2에 나타내었다. 이에 따르면, 성숙 수지상 세포군(LPS 군)과 비교했을 때 실시예 1의 락토바실러스 사케아이 유래 세포밖 소포체 처리군(LPS+P12E 군)의 성숙 수지상 세포의 PD-L1 발현의 정도가 유의미하게 증가한 것으로 나타났다((**p<0.0445 vs LPS).As described above, the expression level of PD-L1 (Programmed Death-Ligand 1), a representative marker of tolDC, was analyzed by flow cytometry to confirm that differentiation into tolDC (Autologous tolerogenic dendritic cell) was induced after the culture was terminated as described above. through, and the results are shown in FIG. 2 . According to this, compared to the mature dendritic cell group (LPS group), the degree of PD-L1 expression of the mature dendritic cells of the Lactobacillus sakeai-derived extracellular vesicle-treated group (LPS+P12E group) of Example 1 was significantly increased. appeared ((**p<0.0445 vs LPS).
실험예 2: 수지상 세포의 면역 억제신호전달 유도 유전자 발현 분석Experimental Example 2: Analysis of gene expression inducing immune suppression signal transduction in dendritic cells
수지상 세포는 면역 활성신호와 면역 억제신호를 가지고 있으며 면역반응의 항상성을 위해 다양한 인자에 의해 각 신호가 전달된다. 가장 대표적인 활성신호 전달을 유도하는 유전자로 톨유사수용체 4(Toll-like receptor 4, TLR4)는 LPS를 인식하여 활성화되는 것이고, 대표적인 억제신호 전달 유도 유전자로 DC-SIGN(dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin), 수지상세포 면역수용체(dendritic cell immunoreceptor, DCIR)이 있다. DC-SIGN은 C-형 렉틴(lectin) 수용체로 많은 리간드가 존재하고, 톨유사수용체(TLR)와 동시 자극되면 면역반응을 억제할 수 있다.Dendritic cells have immune activation signal and immune suppression signal, and each signal is transmitted by various factors for homeostasis of immune response. Toll-like receptor 4 (TLR4), which is the most representative gene inducing activation signal transduction, is activated by recognizing LPS, and DC-SIGN (dendritic cell-specific intercellular adhesion molecule (DC-SIGN) -3-grabbing non-integrin) and dendritic cell immunoreceptor (DCIR). DC-SIGN is a C-type lectin receptor, and many ligands exist, and when co-stimulated with a toll-like receptor (TLR), it can suppress the immune response.
성숙 수지상 세포의 활성을 감소시키는 락토바실러스 사케아이 유래 세포밖 소포체가 면역억제활성 유도 유전자 DC-SIGN 또는 DCIR을 인식하여 신호를 전달하는지 알아보기 위해 DC-SIGN의 발현을 qPCR을 통해 확인한 결과를 도 3에 나타내었고, DCIR의 발현을 qPCR을 통해 확인한 결과를 도 4에 나타내었다. The results of confirming the expression of DC-SIGN through qPCR to determine whether the Lactobacillus sakeai-derived extracellular vesicle, which reduces the activity of mature dendritic cells, recognizes the immunosuppressive activity-inducing genes DC-SIGN or DCIR and transmits a signal 3, the result of confirming the expression of DCIR through qPCR is shown in FIG.
프라이머 정보와 qPCR 조건은 아래와 같다.Primer information and qPCR conditions are as follows.
DC-SIGN:DC-SIGN:
(F) GCTCTGGTCCACCTTTGACA(F) GCTCTGGTCCACCTTTGACA
(R) GGGTCCCATAAAAAGGTGTGC(R) GGGTCCCATAAAAAGGTGTGC
DCIRDCIR
(F) TCC TGG CTT TGG ATC ACC AC(F) TCC TGG CTT TGG ATC ACC AC
(R) TTG GCA CCT GAG GAC AAA GT(R) TTG GCA CCT GAG GAC AAA GT
β-actinβ-actin
(F) CACTGTCGAGTCGCGTCC(F) CACTGTCGAGTCGCGTCC
(R) TCATCCATGGCGAACTGGTG(R) TCATCCATGGCGAACTGGTG
PCR 조건PCR conditions
Denaturation 95 ℃/ 15 sec; Denaturation 95 °C/ 15 sec;
Annealing 60 ℃/30 sec Annealing 60 ℃/30 sec
Extension 72 ℃/30 sec) Extension 72 ℃/30 sec)
40 cycle40 cycle
이에 따르면, 성숙 수지상 세포 처리군(LPS 군)에서 DC-SIGN 발현은 강하게 억제되는 것으로 나타났고, 비교예 1의 락토바실러스 사케아이 배양배지 처리군(LPS+P12 media)와 비교예 2의 락토바실러스 사케아이 처리군(LPS+P12)에서는 DC-SIGN 발현이 무처리군과 비슷한 수준으로 약간 증가였으며, 실시예 1의 락토바실러스 사케아이 유래 세포밖 소포체 처리군(LPS+P12E)에서는 DC-SIGN 발현이 현저히 증가하는 것으로 나타났다.According to this, DC-SIGN expression was strongly inhibited in the mature dendritic cell treatment group (LPS group), and the Lactobacillus sakeai culture medium treatment group of Comparative Example 1 (LPS+P12 media) and Lactobacillus of Comparative Example 2 In the sakeai treatment group (LPS+P12), DC-SIGN expression was slightly increased to a level similar to that of the untreated group, and DC-SIGN expression in the Lactobacillus sakeai-derived extracellular vesicle-treated group (LPS+P12E) of Example 1 was found to increase significantly.
또한, 성숙 수지상 세포 처리군(LPS 군)에서 DC-IR 발현 또한 강하게 억제되는 것으로 나타났고, 비교예 1의 락토바실러스 사케아이 배양배지 처리군(LPS+P12 media)와 비교예 2의 락토바실러스 사케아이 처리군(LPS+P12)에서는 DC-SIGN 발현이 약간 증가하였으며, 실시예 1의 락토바실러스 사케아이 유래 세포밖 소포체 처리군(LPS+P12E)에서는 DC-IR 발현이 현저히 증가하는 것으로 나타났다.In addition, DC-IR expression was also strongly inhibited in the mature dendritic cell treatment group (LPS group), and the Lactobacillus sakeai culture medium treatment group (LPS+P12 media) of Comparative Example 1 and Lactobacillus sake of Comparative Example 2 DC-SIGN expression was slightly increased in the eye treatment group (LPS+P12), and DC-IR expression was significantly increased in the Lactobacillus sakeai-derived extracellular vesicle treatment group (LPS+P12E) of Example 1.
실험예 3: CD4 T 세포 활성 억제능 분석Experimental Example 3: CD4 T cell activity inhibitory ability analysis
CD4 T 세포의 분열 증가는 T 세포가 활성화 되어 다양한 염증반응에 관여한다고 알려져 있다. 락토바실러스 사케아이 유래 세포밖 소포체에 의해 유도된 tolDC가 CD4 T 세포의 활성을 직접 억제할 수 있는지 분석하였다. Increased division of CD4 T cells is known to be involved in various inflammatory responses through activation of T cells. We analyzed whether tolDC induced by Lactobacillus sakeai-derived extracellular vesicles could directly inhibit the activity of CD4 T cells.
구체적으로, 상술한 바와 같이 비교예 2의 락토바실러스 사케아이와 24시간 배양된 수지상 세포, 실시예 1의 사케아이 유래 세포밖 소포체에 의해 24시간 배양된 수지상 세포를 준비하고, 마우스로부터 CD4 T 세포를 분리하고 셀 라벨링을 위해 CFSE(carboxyfluorescein succinimidyl ester) 염색하였다. 이후, tolDC로 유도된 배양된 수지상 세포: CFSE 염색된 CD4 T 세포를 1:1의 비율로 3일 동안 공동배양 하고, 3일 후 공동배양된 세포를 수거하여 CFSE의 감소 정도를 측정하였다. 이에 따른 CD4 T 세포 활성 억제능 분석 결과를 도 5에 나타내었다.Specifically, as described above, dendritic cells cultured for 24 hours with Lactobacillus sakeai of Comparative Example 2 and dendritic cells cultured for 24 hours with the Sakeai-derived extracellular vesicles of Example 1 were prepared, and CD4 T cells were harvested from mice. It was isolated and stained with carboxyfluorescein succinimidyl ester (CFSE) for cell labeling. Thereafter, tolDC-induced cultured dendritic cells: CFSE-stained CD4 T cells were co-cultured at a ratio of 1:1 for 3 days, and the co-cultured cells were harvested after 3 days to measure the degree of decrease in CFSE. The results of the CD4 T cell activity inhibitory ability analysis according to this are shown in FIG. 5 .
이에 따르면, LPS를 처리한 수지상 세포와 공동배양한 T 세포(LPS 처리군)은 약 90%의 증식율을 나타낸 것에 반해, 실시예 1의 락토바실러스 사케아이 유래 세포밖 소포체와 24시간 배양된 수지상 세포 처리군(LPS+P12E DCs)에서 CD4 T 세포의 증식이 LPS 처리군에 비하여 현저히 감소하여 약 60%의 증식율을 보여, 수지상 세포 무처리군(Non-DCs)에 가까운 수준으로 억제된 것을 확인할 수 있었다.According to this, the LPS-treated dendritic cells and the co-cultured T cells (LPS-treated group) showed a proliferation rate of about 90%, whereas the Lactobacillus sakeai-derived extracellular vesicles of Example 1 and dendritic cells cultured for 24 hours. In the treated group (LPS+P12E DCs), the proliferation of CD4 T cells was significantly reduced compared to the LPS-treated group, showing a proliferation rate of about 60%, and it was confirmed that it was suppressed to a level close to that of the dendritic cell untreated group (Non-DCs). there was.
즉, 락토바실러스 사케아이 유래 세포밖 소포체의 면역 억제능은 락토바실러스 사케아이 유래 세포밖 소포체에 의해 유도된 tolDC가 CD4 T 세포의 활성을 직접 억제함으로써 구현됨을 확인하였다. 다시 말해, 본원발명의 락토바실러스 사케아이 유래 세포밖 소포체는 수지상 세포의 tolDC 유도를 촉진하고, tolDC는 CD4 T세포의 활성을 억제하여 류마티스 관절염을 개선시킬 수 있다.That is, it was confirmed that the immunosuppressive ability of the Lactobacillus sakeai-derived extracellular ER was realized by directly inhibiting the activity of CD4 T cells by tolDC induced by the Lactobacillus sakeai-derived extracellular ER. In other words, the Lactobacillus sakeai-derived extracellular vesicles of the present invention can promote tolDC induction of dendritic cells, and tolDC can improve rheumatoid arthritis by inhibiting the activity of CD4 T cells.
하기에 본 발명의 분말을 포함하는 조성물의 제제예를 설명하나, 본 발명은 이를 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.Hereinafter, a formulation example of a composition comprising the powder of the present invention will be described, but the present invention is not intended to limit the present invention, but merely to describe it in detail.
제제예 1. 산제의 제조Formulation Example 1. Preparation of powder
실시예 1의 세포밖 소포체 500 mg500 mg of extracellular vesicles of Example 1
유당 100 mg Lactose 100 mg
탈크 10 mgtalc 10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.The above ingredients are mixed and filled in an airtight bag to prepare a powder.
제제예 2. 정제의 제조Formulation Example 2. Preparation of tablets
실시예 1의 세포밖 소포체 300 mg300 mg of extracellular vesicles of Example 1
옥수수전분 100 mg100 mg cornstarch
유당 100 mg Lactose 100 mg
스테아린산 마그네슘 2 mg2 mg magnesium stearate
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.After mixing the above ingredients, tablets are prepared by tableting according to a conventional manufacturing method of tablets.
제제예 3. 캅셀제의 제조Formulation Example 3. Preparation of capsules
실시예 1의 세포밖 소포체 200 mg200 mg of extracellular vesicles of Example 1
결정성 셀룰로오스 3 mg3 mg of crystalline cellulose
락토오스 14.8 mgLactose 14.8 mg
마그네슘 스테아레이트 0.2 mg0.2 mg magnesium stearate
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.According to a conventional capsule preparation method, the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.
제제예 4. 주사제의 제조Formulation Example 4. Preparation of injection
실시예 1의 세포밖 소포체 600 mg600 mg of the extracellular vesicles of Example 1
만니톨 180 mgmannitol 180 mg
주사용 멸균 증류수 2974 mg2974 mg of sterile distilled water for injection
Na2HPO4,12H2O 26 mgNa 2 HPO 4, 12H 2 O 26 mg
통상의 주사제의 제조방법에 따라 1 앰플 당 상기의 성분 함량으로 제조한다.According to a conventional method for preparing injections, the content of the above components per 1 ampoule is prepared.
제제예 5. 액제의 제조Formulation Example 5. Preparation of liquid formulation
실시예 1의 세포밖 소포체 4 g 4 g of extracellular vesicles of Example 1
이성화당 10 g10 g isomerized sugar
만니톨 5 g5 g of mannitol
정제수 적량Purified water appropriate amount
통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100g으로 조절한 후 갈색병에 충진하여 멸균시켜 액제를 제조한다.According to a conventional liquid preparation method, each component is added to purified water to dissolve, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 g by adding purified water, and then filled in a brown bottle to sterilize to prepare a liquid.
제제예 6. 과립제의 제조Formulation Example 6. Preparation of granules
실시예 1의 세포밖 소포체 1,000 mg1,000 mg of extracellular vesicles of Example 1
비타민 혼합물 적량appropriate amount of vitamin mixture
비타민 A 아세테이트 70 ㎍70 μg vitamin A acetate
비타민 E 1.0 mgVitamin E 1.0 mg
비타민 B1 0.13 mgVitamin B1 0.13 mg
비타민 B2 0.15 mgVitamin B2 0.15 mg
비타민 B6 0.5 mg0.5 mg of vitamin B6
비타민 B12 0.2 ㎍0.2 μg of vitamin B12
비타민 C 10 mgVitamin C 10 mg
비오틴 10 ㎍Biotin 10 μg
니코틴산아미드 1.7 mgNicotinamide 1.7 mg
엽산 50 ㎍50 μg of folic acid
판토텐산 칼슘 0.5 mgCalcium pantothenate 0.5 mg
무기질 혼합물 적량Mineral mixture appropriate amount
황산제1철 1.75 mgferrous sulfate 1.75 mg
산화아연 0.82 mgZinc Oxide 0.82 mg
탄산마그네슘 25.3 mgMagnesium carbonate 25.3 mg
제1인산칼륨 15 mgPotassium monophosphate 15 mg
제2인산칼슘 55 mgDibasic calcium phosphate 55 mg
구연산칼륨 90 mgPotassium citrate 90 mg
탄산칼슘 100 mg100 mg of calcium carbonate
염화마그네슘 24.8 mgMagnesium chloride 24.8 mg
상기의 비타민 및 미네랄 혼합물의 조성비는 비교적 과립제에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 과립제 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강기능식품 조성물 제조에 사용할 수 있다.The composition ratio of the vitamin and mineral mixture is relatively suitable for granules in a preferred embodiment, but the mixing ratio may be arbitrarily modified. It can be prepared and used in the preparation of a health functional food composition according to a conventional method.
제제예 7. 기능성 음료의 제조Formulation Example 7. Preparation of functional beverage
실시예 1의 세포밖 소포체 1,000 mg1,000 mg of extracellular vesicles of Example 1
구연산 1,000 mg1,000 mg citric acid
올리고당 100 g100 g of oligosaccharides
매실농축액 2 g2 g of plum concentrate
타우린 1 g1 g taurine
정제수를 가하여 전체 900 mLAdd purified water to total 900 mL
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1 시간 동안 85 ℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 L 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 기능성 음료 조성물 제조에 사용한다. After mixing the above ingredients according to a conventional health drink manufacturing method, after stirring and heating at 85 ° C for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized, then refrigerated. It is used to prepare the functional beverage composition of the present invention.
상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.Although the composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demand class, demanding country, and use.
본 발명의 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 치료할 수 있다.The pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells to directly promote CD4 T cell proliferation. It is possible to prevent or treat autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
본 발명의 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물은 수지상 세포로부터 tolDC 유도를 촉진하여 CD4 T 세포의 증식을 직접 억제하고, DC-SIGN 및 DCIR과 같은 면역 억제활성 유도 유전자의 발현을 촉진함으로써 류마티스 관절염 등의 자가면역질환을 예방 또는 개선할 수 있다.The food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient of the present invention promotes tolDC induction from dendritic cells and directly promotes proliferation of CD4 T cells. It is possible to prevent or improve autoimmune diseases such as rheumatoid arthritis by inhibiting and promoting the expression of immunosuppressive activity-inducing genes such as DC-SIGN and DCIR.
Figure PCTKR2021019780-appb-img-000001
Figure PCTKR2021019780-appb-img-000001

Claims (9)

  1. 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  2. 제1항에 있어서, According to claim 1,
    상기 자가면역질환은 류마티스성 관절염 (rheumatoid arthritis), 다발성 경화증(multiple sclerosis), 쇼그렌 증후군(Sjogren syndrome), 루프스(lupus), 아토피 피부염, 비염, 원형탈모증(alopecia areata), 건선(psoriasis), 천포창, 천식， 아프타 구내염， 만성 갑상선염， 후천성 재생불량성 빈혈， 베체트병(Behcet's disease), 크론병， 규소 폐증, 연쇄상구균감염후 사구체신염(PSGN), 피부근염(dermatomyosit is)， 다발성 근염(polymyositis), 자가면역성 용혈성 빈혈(autoimmune hemolytic anemia), 자가면역성 뇌척수염， 중증 근무력증(myasthenia gravis), 그레이브병(Grave's disease) 및 결절성 다발성 동맥염(polyarteritis nodosa) 중에서 선택된 어느 하나인 것을 특징으로 하는 자가면역질환 예방 또는 치료용 약학 조성물.The autoimmune disease is rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, lupus, atopic dermatitis, rhinitis, alopecia areata, psoriasis, pemphigus , asthma, aphthous stomatitis, chronic thyroiditis, acquired aplastic anemia, Behcet's disease, Crohn's disease, silicon pneumonitis, streptococcal glomerulonephritis (PSGN), dermatomyosit is, polymyositis, Prevention or treatment of autoimmune diseases, characterized in that any one selected from autoimmune hemolytic anemia, autoimmune encephalomyelitis, myasthenia gravis, Grave's disease and polyarteritis nodosa pharmaceutical composition for use.
  3. 제1항에 있어서,According to claim 1,
    상기 자가면역질환 예방 또는 치료용 약학 조성물은 수지상 세포로부터 tolDC(Autologous tolerogenic dendritic cell)의 유도 촉진용인 것을 특징으로 하는 자가면역질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating autoimmune diseases is a pharmaceutical composition for preventing or treating autoimmune diseases, characterized in that it is for promoting the induction of tolDC (Autologous tolerogenic dendritic cells) from dendritic cells.
  4. 제1항에 있어서,According to claim 1,
    상기 자가면역질환 예방 또는 치료용 약학 조성물은 CD4 T 세포의 증식 억제용인 것을 특징으로 하는 자가면역질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating autoimmune diseases is a pharmaceutical composition for preventing or treating autoimmune diseases, characterized in that it is for inhibiting proliferation of CD4 T cells.
  5. 제1항에 있어서, According to claim 1,
    상기 자가면역질환 예방 또는 치료용 약학 조성물은 DC-SIGN 및 DCIR 중에서 선택된 1종 이상의 면역 억제활성 유도 유전자의 발현 촉진용인 것을 특징으로 하는 자가면역질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating autoimmune diseases is a pharmaceutical composition for preventing or treating autoimmune diseases, characterized in that it is for promoting the expression of one or more immunosuppressive activity-inducing genes selected from DC-SIGN and DCIR.
  6. 제1항에 있어서, According to claim 1,
    상기 락토바실러스 사케아이는 수탁번호 KCTC13818BP로 기탁된 락토바실러스 사케아이 WIKIM0109 (Lactobacillus sakei WIKIM0109)인 것을 특징으로 하는 자가면역질환 예방 또는 치료용 약학 조성물.The Lactobacillus sakei is a pharmaceutical composition for preventing or treating autoimmune diseases, characterized in that Lactobacillus sakei WIKIM0109 (Lactobacillus sakei WIKIM0109) deposited under the accession number KCTC13818BP.
  7. 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 식품 조성물.A food composition for preventing or improving autoimmune diseases comprising Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  8. 락토바실러스 사케아이(Lactobacillus sakei) 유래 세포밖 소포체(extracellular vesicles)를 유효성분으로 포함하는 자가면역질환 예방 또는 개선용 사료 또는 사료첨가제.Feed or feed additive for preventing or improving autoimmune diseases containing Lactobacillus sakei-derived extracellular vesicles as an active ingredient.
  9. (a) 락토바실러스 사케아이(Lactobacillus sakei)를 배양하는 단계;(a) culturing Lactobacillus sakei (Lactobacillus sakei);
    (b) 상기 락토바실러스 사케아이가 배양된 배양액을 원심분리하여 배양 상층액을 회수하는 단계; 및(b) recovering the culture supernatant by centrifuging the culture medium in which the Lactobacillus sakeai is cultured; and
    (c) 상기 배양 상층액을 염화나트륨와 유기용매를 포함하는 용액와 혼합하여 반응시킨 후 원심분리하여 세포밖 소포체 펠릿을 수득하는 단계; 및(c) mixing and reacting the culture supernatant with a solution containing sodium chloride and an organic solvent, followed by centrifugation to obtain an extracellular vesicle pellet; and
    (d) 상기 세포밖 소포체 펠릿을 세포밖 소포체 추출 버퍼에 재현탁시켜 현탁액을 제조하고, 상기 현탁액으로부터 세포밖 소포체를 분리하는 단계;를 포함하는 자가면역질환 예방, 치료 또는 개선용 조성물의 제조방법.(d) preparing a suspension by resuspending the extracellular vesicle pellet in extracellular vesicle extraction buffer, and separating the extracellular vesicles from the suspension; .
PCT/KR2021/019780 2020-12-23 2021-12-23 Composition for alleviating, preventing or treating autoimmune diseases, comprising lactobacillus sakei-derived extracellular vesicles as active ingredient WO2022139530A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0181541 2020-12-23
KR20200181541 2020-12-23
KR10-2021-0186079 2021-12-23
KR1020210186079A KR20220091427A (en) 2020-12-23 2021-12-23 A composition for improving, preventing and treating autoimmune diseases comprising extracellular vesicles from Lactobacillus sakei

Publications (1)

Publication Number Publication Date
WO2022139530A1 true WO2022139530A1 (en) 2022-06-30

Family

ID=82159970

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/019780 WO2022139530A1 (en) 2020-12-23 2021-12-23 Composition for alleviating, preventing or treating autoimmune diseases, comprising lactobacillus sakei-derived extracellular vesicles as active ingredient

Country Status (1)

Country Link
WO (1) WO2022139530A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160060652A1 (en) * 2013-03-13 2016-03-03 Lapian's Corp Microvesicle and method for producing the same
KR20200053531A (en) * 2017-09-08 2020-05-18 에벨로 바이오사이언시즈, 인크. Bacterial extracellular vesicle
KR20200060637A (en) * 2018-11-22 2020-06-01 (주)프로스테믹스 Exomsome and various uses thereof
KR102123505B1 (en) * 2019-03-26 2020-06-17 한국식품연구원 Lactobacillus sakei WIKIM0109 having anti-arthritis activity and composition for comprising the same
WO2020214083A1 (en) * 2019-04-17 2020-10-22 Biogaia Ab Therapeutic microvesicles of probiotic bacteria

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160060652A1 (en) * 2013-03-13 2016-03-03 Lapian's Corp Microvesicle and method for producing the same
KR20200053531A (en) * 2017-09-08 2020-05-18 에벨로 바이오사이언시즈, 인크. Bacterial extracellular vesicle
KR20200060637A (en) * 2018-11-22 2020-06-01 (주)프로스테믹스 Exomsome and various uses thereof
KR102123505B1 (en) * 2019-03-26 2020-06-17 한국식품연구원 Lactobacillus sakei WIKIM0109 having anti-arthritis activity and composition for comprising the same
WO2020214083A1 (en) * 2019-04-17 2020-10-22 Biogaia Ab Therapeutic microvesicles of probiotic bacteria

Similar Documents

Publication Publication Date Title
WO2011010770A1 (en) Novel lactobacillus plantarum and composition comprising same
WO2023055188A1 (en) Novel probiotics and use thereof
WO2017179931A1 (en) Pharmaceutical composition for preventing or treating respiratory disease comprising extract of justicia procumbens l.
WO2022005035A1 (en) Novel bifidobacterium breve idcc 4401 strain and its dead cell id-bbr4401 having excellent acid tolerance and bile tolerance and prophylactic or therapeutic effect on dyslipidemia
WO2016190481A1 (en) Anticancer adjuvant containing panaxadiol ginsenocide compound
WO2022139530A1 (en) Composition for alleviating, preventing or treating autoimmune diseases, comprising lactobacillus sakei-derived extracellular vesicles as active ingredient
WO2017196140A2 (en) Aquaculture functional feedstuff additive comprising lactococcus lactis bfe920 strain inducing immunomodulatory t-cell.
WO2023068855A1 (en) Composition for alleviation, prevention or treatment of cancer using veillonella parvula strain having anti-cancer activity
WO2023080552A1 (en) Peptide having physiological activities and use thereof
WO2016093613A2 (en) Composition for preventing or treating abnormal weight loss, containing citrus unshiu peel extract
KR20220091427A (en) A composition for improving, preventing and treating autoimmune diseases comprising extracellular vesicles from Lactobacillus sakei
WO2022265430A1 (en) Combination therapy use of lactobacillus fermentum strain and natural killer cells for preventing and treating metabolic diseases
WO2022215925A1 (en) Composition for promoting osteogenesis, comprising milk-derived extracellular vesicles
WO2019209061A1 (en) Bone growth-promoting composition comprising allium fistulosum linn as active ingredient
WO2022039514A1 (en) Composition for treatment of brain diseases comprising lactobacillus sakei or extracellular vesicles derived therefrom as active ingredient
WO2022015033A1 (en) Composition for treating brain disease comprising pediococcus inopinatus or extracellular vesicles derived therefrom as active ingredient
WO2022139531A1 (en) Composition for ameliorating, preventing, or treating fatty liver comprising leuconostoc citreum-derived extracellular vesicles as active ingredient
WO2022139532A1 (en) Composition for ameliorating, preventing, or treating fatty liver, comprising weissella hellenica-derived extracellular vesicle as active ingredient
WO2021080298A1 (en) Composition containing enteroccocus faecalis as active ingredient for preventing or treating obesity or metabolic syndromes induced thereby
WO2019078381A1 (en) Pharmaceutical composition, food composition and food additive for preventing, alleviating or treating muscle loss, weakness and atrophy, containing, as active ingredient, enterococcus faecalis, culture liquid thereof or dead cells thereof
WO2016190689A2 (en) Composition for preventing, alleviating or treating muscle diseases or improving muscular function
WO2019198982A1 (en) Composition for preventing or improving skeletal muscle atrophy containing kukoamine a and kukoamine b as active ingredients
WO2023282622A1 (en) Composition for treatment of autoimmune diseases comprising lactobacillus sakei or extracellular vesicles derived therefrom as active ingredient
WO2015105373A1 (en) Composition for prevention or treatment of asthma, comprising e uonymus alatus extract or fraction thereof
WO2023027527A1 (en) Immunopotentiation composition comprising artemisia gmelinii extract

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21911595

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21911595

Country of ref document: EP

Kind code of ref document: A1