WO2022137188A1 - Use of mirna-485 inhibitors for inducing hair growth - Google Patents

Use of mirna-485 inhibitors for inducing hair growth Download PDF

Info

Publication number
WO2022137188A1
WO2022137188A1 PCT/IB2021/062226 IB2021062226W WO2022137188A1 WO 2022137188 A1 WO2022137188 A1 WO 2022137188A1 IB 2021062226 W IB2021062226 W IB 2021062226W WO 2022137188 A1 WO2022137188 A1 WO 2022137188A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotides
mir
hair
aspects
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2021/062226
Other languages
English (en)
French (fr)
Inventor
Jin-Hyeob RYU
Begum SHAHNAZ
Jamil MD HOSSAIN
Hyun Su Min
Yu Na Lim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biorchestra Co Ltd
Original Assignee
Biorchestra Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biorchestra Co Ltd filed Critical Biorchestra Co Ltd
Priority to KR1020237019780A priority Critical patent/KR20230124904A/ko
Priority to EP21909691.4A priority patent/EP4267112A4/en
Priority to CN202180082153.3A priority patent/CN116568333A/zh
Priority to JP2023534651A priority patent/JP2024501437A/ja
Priority to US18/259,007 priority patent/US20240050461A1/en
Publication of WO2022137188A1 publication Critical patent/WO2022137188A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0014Skin, i.e. galenical aspects of topical compositions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A61K47/183Amino acids, e.g. glycine, EDTA or aspartame
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/22Heterocyclic compounds, e.g. ascorbic acid, tocopherol or pyrrolidones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542Carboxylic acids, e.g. a fatty acid or an amino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug
    • A61K47/551Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug one of the codrug's components being a vitamin, e.g. niacinamide, vitamin B3, cobalamin, vitamin B12, folate, vitamin A or retinoic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6907Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a microemulsion, nanoemulsion or micelle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/72Cosmetics or similar toiletry preparations characterised by the composition containing organic macromolecular compounds
    • A61K8/84Cosmetics or similar toiletry preparations characterised by the composition containing organic macromolecular compounds obtained by reactions otherwise than those involving only carbon-carbon unsaturated bonds
    • A61K8/86Polyethers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00Preparations for affecting hair growth
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/107Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs

Definitions

  • the present disclosure provides the use of a miR-485 inhibitor (e.g., polynucleotide encoding a nucleotide molecule comprising at least one miR-485 binding site) for inducing hair growth.
  • a miR-485 inhibitor e.g., polynucleotide encoding a nucleotide molecule comprising at least one miR-485 binding site
  • BACKGROUND OF THE DISCLOSURE [0004] As the aged population is increasing and stress is high in modern society, there are a growing number of people under the threat of hair fall and hair loss. Although medically benign, they can cause tremendous emotional and psychosocial pressure in affected patients and their families.
  • the cause of hair loss includes a part of the natural aging process, compromised hair growth cycle, genetic predisposition, unwanted side effects from medication and/or medical treatment, environmental causes such as allergies, infections, stress, a lack of proper diet and sleep, and/or other systematic disorders.
  • age 35 This condition gets worse as men get older.
  • age 60 it is estimated that 65% of adult males in the United States will suffer from noticeable hair loss.
  • Women also suffer from hair loss.
  • Female hair loss unlike in men, typically involves noticeable thinning all over the head and the hairline.
  • the American Academy of Dermatology reports that 40% of women have noticeable hair loss by the age 40. See e.g., U.S.
  • a method of inducing hair growth in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor").
  • a method of increasing the hair density in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor").
  • a method of increasing the follicular density in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor").
  • a method of increasing the hair shaft thickness in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor").
  • a method of increasing the hair length in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor").
  • a method for preventing hair loss in a subject at risk of hair loss comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor”).
  • a method for reducing hair loss in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor).
  • the subject has one or more disorders selected from the group consisting of alopecia greata, androgenic alopecia, alopecia areata, alopecia universalis, involutional alopecia, trichotillomania, telogen effluvium, anagen effluvium, cicatricial, alopecia, scarring alopecia, scalp thinning, hair shaft abnormalities, infectious hair disorders, genetic disorders, and hair loss due to chemotherapy, hormonal imbalance, fungal infection, medication intake, chemical hair treatment, or aging.
  • the subject is a human.
  • the miRNA inhibitors described herein induce autophagy and/or treats or prevents inflammation.
  • the miRNA inhibitors described herein inhibit miR485-3p.
  • the miR485-3p comprises 5'-GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1).
  • the miRNA inhibitor described herein comprises a nucleotide sequence comprising 5'-UGUAUGA-3' (SEQ ID NO: 2) and wherein the miRNA inhibitor comprises about 6 to about 30 nucleotides in length.
  • the miRNA inhibitors described herein comprise at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • the miRNA inhibitor described herein has a sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'-CCGUGUAUGA-3' (SEQ ID NO: 5), 5'- GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'- GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'- GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: (SEQ
  • the miRNA inhibitor described herein has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 30), 5'-GTGTATGA-3' (SEQ ID NO: 51), 5'-CGTGTATGA-3' (SEQ ID NO: 52), 5'-CCGTGTATGA-3' (SEQ ID NO: 53), 5'- GCCGTGTATGA-3' (SEQ ID NO: 54), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 55), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 35), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 56), 5'- GAGAGCCGTGTATGA-3' (SEQ ID NO: 57), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 58), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 59), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO:
  • sequence of the miRNA inhibitor described herein is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77).
  • the miRNA inhibitor described herein has a sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77).
  • the miRNA inhibitor described herein comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77) with one substitution or two substitutions.
  • the miRNA inhibitor described herein comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In some aspects, the miRNA inhibitor described herein comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28). [0021] In some aspects, the miRNA inhibitors described herein comprise at least one modified nucleotide.
  • the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • the miRNA inhibitors described herein comprise a backbone modification.
  • the backbone modification is a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • the miRNA inhibitors described herein are delivered in a delivery agent.
  • the delivery agent is a micelle, an exosome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle.
  • the miRNA inhibitors described herein are delivered by a viral vector.
  • the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the miRNA inhibitors described herein are delivered with a delivery agent.
  • the delivery agent comprises a micelle, an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a conjugate, a viral vector, or combinations thereof.
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle.
  • the miRNA inhibitors described herein interact with the cationic carrier unit via an ionic bond.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines (“POZ”) poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: [0029] (formula I), [0030]
  • n is 1-1000.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the cationic carrier moiety comprises about 40 lysine monomers.
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: [0036] , (formula II), [0037] wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises [0041] (formula III), [0042] wherein Ar is [0043] wherein each of Z1 and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: [0046] [0047] wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin can be vitamin B3.
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3.
  • the adjuvant moiety comprises about 10 vitamin B3.
  • the delivery agent comprises about a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly- lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the delivery agent is associated with the miRNA inhibitor, thereby forming a micelle.
  • the association can be a covalent bond, a non- covalent bond, or an ionic bond.
  • the cationic carrier unit and the miRNA inhibitor in the micelle is mixed in a solution so that the ionic ratio of the positive charges of the cationic carrier unit and the negative charges of the miRNA inhibitor is about 1: 1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor from enzymatic degradation.
  • the miRNA inhibitors described herein are administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, or any combination thereof.
  • the miRNA inhibitors described herein are administered to a skin area where promoting hair growth is needed by spread, spray, steam, or injection.
  • the miRNA inhibitors described herein are administered topically to a skin area where promoting hair growth is needed.
  • the miRNA inhibitors described herein are formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse.
  • the administering step is performed by soaking or bathing the subject in the miRNA inhibitor described herein formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse.
  • FIG.1 shows an exemplary architecture of a carrier unit of the present disclosure.
  • tissue specific adjuvant moiety can be located between water-soluble biopolymer (WP) and cationic carrier (CC).
  • WP water-soluble biopolymer
  • CC cationic carrier
  • FIGs. 2A-2F provide evaluation of the hair growth effect of a miR-485 inhibitor (485 ASO-001) on depilated C57BL/6J mice 5 days (FIG. 2A), 7 days (FIG.
  • FIG.2C 9 days
  • FIG.2D 12 days
  • FIG.2E 14 days
  • FIG.2F 16 days
  • 0.1 mg/kg mpk
  • 0.3 mg/kg mpk
  • 0.6 mg/kg mpk
  • the miR-485 inhibitor 485 ASO-001
  • PBS phosphate-buffered saline
  • 2G shows the hair regrowth quantification in depilated C57BL/6J mice 5 days, 7 days, 9 days, 12 days, and 14 days after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • FIGs. 3A-3B show the effect of miR-485 inhibitor (485 ASO-001) on the hair shaft density in depilated C57BL/6J mice 12 days (FIG. 3A) and 16 days (FIG. 3B) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • FIG. 3A-3B show the effect of miR-485 inhibitor (485 ASO-001) on the hair shaft density in depilated C57BL/6J mice 12 days (FIG. 3A) and 16 days (FIG. 3B) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • 3C shows the hair density quantification in depilated C57BL/6J mice 12 (white bars) and 16 days (shaded bars) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • FIG. 4A-4B show the effect of miR-485 inhibitor (485 ASO-001) on the hair length in depilated C57BL/6J mice 16 days (FIG. 4A) and 21 days (FIG. 4B) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • FIG. 4A-4B show the effect of miR-485 inhibitor (485 ASO-001) on the hair length in depilated C57BL/6J mice 16 days (FIG. 4A) and 21 days (FIG. 4B) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • PBS phosphate-buffered
  • 4C shows the hair length quantification in depilated C57BL/6J mice 16 (white bars) and 21 days (shaded bars) after administration of 0.1 mg/kg (mpk), 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control).
  • the y-axis shows the hair length in mm.
  • FIG. 4D-4I provide evaluation of the hair regrowth effect of the miR-485 inhibitor (485 ASO-001) on C57BL/6J mice 5 days (FIG. 4D), 7 days (FIG. 4E), 10 days (FIG. 4F), 12 days (FIG. 4G), 14 days (FIG.4H), and 16 days (FIG. 4I) after administration of twice intramuscular injection 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control) and positive control (2% Minoxidil).
  • PBS phosphate-buffered saline
  • 4J shows the hair regrowth quantification in depilated C57BL/6J mice 7 days, 10 days, 12 days, 14 days, 16 days after twice intramuscular injection of 0.3 mg/kg (mpk) or 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001), or phosphate-buffered saline (PBS) (negative control) and positive control Minoxidil.
  • FIGs. 5A-5B show the effect of miR-485 inhibitor (485 ASO-001) on the 485-3p (FW7_mimic) expression level on day 10 post-depilation (PD) (FIG. 5A) and 16 days (FIG. 5B) after administration of twice intramuscular injection of 0.3 mg/kg (mpk) (middle bar) or 0.6 mg/kg (mpk) (right bar) of miR-485 inhibitor (485 ASO-001 or “ASO”) or phosphate- buffered saline (PBS) (negative control) (left bar).
  • FIGs. 6A-6B show H&E staining results of mice dorsal skin during the hair follicle cycle 10 post depilation (pd).
  • FIG.6A shows a longitudinal and transverse section of mouse dorsal skin treated with phosphate-buffered saline (PBS) (negative control) and positive control (Minoxidil) after 10 days of treatment.
  • FIG. 6B shows a longitudinal and transverse section of mice dorsal skin treated with twice intramuscular injection of 0.3 mg/kg (mpk) and 0.6 mg/kg (mpk) of miR-485 inhibitor (485 ASO-001) after 10 days of treatment.
  • FIGs. 6C-6H show the effect of miR-485 inhibitor (485 ASO-001) on the thickness of dermis ( ⁇ m) (FIG. 6C) and subcutis ( ⁇ m) (FIG.
  • FIGs. 7A-7B show H&E staining results of mice dorsal skin on 16 pd.
  • FIG. 7A shows a longitudinal and transverse section of mouse dorsal skin treated with phosphate- buffered saline (PBS) (negative control) and positive control (Minoxidil) after 16 days of treatment.
  • PBS phosphate- buffered saline
  • FIGs. 7C-7H show the effect of miR-485 inhibitor (485 ASO-001) on the thickness of subcutis ( ⁇ m) (FIG. 7C) and dermis ( ⁇ m) (FIG. 7D), hair follicle length ( ⁇ m) (FIG. 7E) and hair bulb diameter ( ⁇ m) (FIG. 7F), hair follicle density in dermis (FIG. 7G) and subcutis (FIG.
  • FIG.8A shows Western blotting analysis of the expression of CD36 and vascular endothelial growth factor (VEGF-A).
  • FIGs. 8B-8C show CD36 protein (FIG. 8B) or VEGF-A protein (FIG.
  • FIG. 9A shows Western blotting analysis of the expression of Wnt3a and ⁇ - catenin.
  • FIGs. 9B-9C show Wnt3a protein (FIG. 9B) or ⁇ -catenin protein (FIG.
  • FIGs. 10A-10B show immunofluorescent staining for CD36. PBS treated control (FIG.
  • the present disclosure is directed to the use of a miR-485 inhibitor for inducing hair growth, increasing hair density, increasing the follicular density, increasing the hair shaft thickness, increasing hair length, preventing hair loss, reducing hair loss, or any combination thereof in a subject in need thereof, comprising a nucleotide sequence encoding a nucleotide molecule that comprises at least one miR-485 binding site, wherein the nucleotide molecule does not encode a protein.
  • ranges recited are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints.
  • a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
  • hair is used herein to mean scalp, head, facial and/or body hair, including but not limited to the scalp, eye lashes, brows, mustache, beard, ear, nasal, chest, pubic, auxiliary, and the like.
  • hair growth is used herein to mean earlier inducing growth of a new hair cycle, prolonging the active growth phase (anagen) of the hair cycle, increasing the growth rate of the hair, and/or increasing the width of hair shaft, including, but not limited to, the induction of the growth of hair and making it more visible to the eye.
  • hair loss and “hair thinning” are used herein to mean a decrease in normal hair density and/or shortening of the normal growth phase (anagen) of the hair cycle and/or reduction of the width of hair shaft, and reduction of the number of hairs, which can be caused by age increase, genetically predisposed and/or other causes, and can be suffered by male or female, young or old.
  • hair loss and “alopecia,” “balding,” and “pattern hair loss” are used interchangeably herein.
  • the term “induce hair growth,” “promote hair growth,” “stimulate hair growth,” “facilitate hair growth,” or “increase hair growth,” is used herein to mean at least one of the results of an increase in number and/or length and/or thickness of hair on at least part of the affected skin (or scalp) surface.
  • Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • 'a' represents adenine
  • 'c' represents cytosine
  • 'g' represents guanine
  • 't' represents thymine
  • 'u' represents uracil.
  • Amino acid sequences are written left to right in amino to carboxy orientation. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • the term "about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth.
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al.
  • an "AAV” includes a derivative of a known AAV.
  • an “AAV” includes a modified or an artificial AAV.
  • the terms "administration,” “administering,” and grammatical variants thereof refer to introducing a composition, such as a miRNA inhibitor of the present disclosure, into a subject via a pharmaceutically acceptable route.
  • a composition such as a micelle comprising a miRNA inhibitor of the present disclosure
  • introduction of a composition is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically.
  • Administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • the term “approximately,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain aspects, the term “approximately” refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • two or more sequences are said to be “completely conserved” or “identical” if they are 100% identical to one another.
  • two or more sequences are said to be "highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some aspects, two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.
  • two or more sequences are said to be "conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another.
  • Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof.
  • the term "derived from,” as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism.
  • a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence.
  • the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis.
  • the mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each.
  • the mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g., as discussed herein.
  • a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 8
  • a "coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids.
  • a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide.
  • the terms "complementary” and “complementarity” refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules.
  • nucleobase sequence "T-G-A (5' ⁇ 3'),” is complementary to the nucleobase sequence "A-C-T (3' ⁇ 5').”
  • Complementarity can be “partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules.
  • complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
  • the term "complementary” refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., miR-485 nucleic acid sequence). Or, there can be “complete” or “perfect” (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences.
  • downstream refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence.
  • downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
  • excipient and “carrier” are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a miRNA inhibitor of the present disclosure.
  • RNA or a polypeptide refers to a process by which a polynucleotide produces a gene product, e.g., RNA or a polypeptide. It includes without limitation transcription of the polynucleotide into micro RNA binding site, small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA), and the translation of mRNA into a polypeptide. Expression produces a "gene product.”
  • a gene product can be, e.g., a nucleic acid, such as an RNA produced by transcription of a gene.
  • a gene product can be either a nucleic acid, RNA or miRNA produced by the transcription of a gene, or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • the term “homology” refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules. Generally, the term “homology” implies an evolutionary relationship between two molecules.
  • polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions).
  • homologous necessarily refers to a comparison between at least two sequences (e.g., polynucleotide sequences).
  • substitutions are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
  • identity refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules.
  • polynucleotide A is identical to polynucleotide B
  • polynucleotide sequences are 100% identical (100% sequence identity).
  • Describing two sequences as, e.g., "70% identical,” is equivalent to describing them as having, e.g., "70% sequence identity.”
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides are then compared.
  • a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Suitable software programs that can be used to align different sequences are available from various sources.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) of a composition of the present disclosure, e.g., a miRNA inhibitor of the present disclosure from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
  • an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity.
  • the isolated composition is enriched as compared to the starting material from which the composition is obtained.
  • This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • isolated preparations are substantially free of residual biological products.
  • the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter.
  • Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites.
  • the term "linked" as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked" means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • a "miRNA inhibitor,” as used herein, refers to a compound that can decrease, alter, and/or modulate miRNA expression, function, and/or activity.
  • the miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence.
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that is at least partially complementary to the target miR-485 (e.g., miR-485-3p) nucleic acid sequence, such that the miR-485 inhibitor hybridizes to the miR-485 sequence.
  • the hybridization of the miR-485 to the miR-485 inhibitor sequence decreases, alters, and/or modulates the expression, function, and/or activity of miR-485 (e.g., hybridization results in an increase in the expression of SIRT1 protein and/or SIRT1 gene).
  • miRNA refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. In some aspects, the term “antisense oligomers” can also be used to describe the microRNA molecules of the present disclosure. Names of miRNAs and their sequences related to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • miRNA binding site a molecule comprising a sequence complementary to the seed region of the miRNA
  • targeting miRNAs via molecules comprising a miRNA binding site can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • one or more can occur with respect to the target nucleic acid sequence. Variations at any location within the oligomer are included.
  • antisense oligomers of the disclosure e.g., miR-485 inhibitor
  • antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunit of the 5' and/or 3' terminus.
  • one, two, or three nucleobases can be removed and still provide on-target binding.
  • the terms “modulate,” “modify,” and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g., directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g., to act as an antagonist or agonist.
  • a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity.
  • a miRNA inhibitor disclosed herein e.g., a miR-485 inhibitor
  • Nucleic acid “nucleic acid molecule,” “nucleotide sequence,” “polynucleotide,” and grammatical variants thereof are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • RNA molecules phosphate ester polymeric form of ribonucleosides
  • deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
  • DNA molecules any phospho
  • Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single- stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • pharmaceutically acceptable carrier encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable.
  • the term "pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g., a miRNA inhibitor of the present disclosure, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients.
  • a pharmaceutical composition is to facilitate administration of preparations comprising a miRNA inhibitor of the present disclosure to a subject.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof.
  • the term refers to the primary structure of the molecule.
  • the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA, miRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine).
  • polypeptide “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length, e.g., that are encoded by the SIRT1 gene.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function.
  • Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to about 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • the terms “prevent hair loss,” “preventing hair loss,” “prevent hair thinning,” and “preventing hair thinning” as used herein mean an effect on decreasing any hair loss or hair thinning as described herein in advance.
  • the terms “reduce hair loss,” “reducing hair loss,” “reduce hair thinning,” and “reducing hair thinning” as used herein mean an effect on decreasing any hair loss or hair thinning as described herein in a subject in need thereof (e.g., in a subject affected by hair loss).
  • promoter and “promoter sequence” are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence.
  • Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters.” Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as “cell-specific promoters” or “tissue-specific promoters.” Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as “developmentally-specific promoters” or “cell differentiation-specific promoters.” Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as “inducible promoters” or “regulatable promoters.” It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
  • the promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a promoter that can be used with the present disclosure includes a tissue specific promoter.
  • prolactic refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a “prophylaxis” refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • the term “gene regulatory region” or “regulatory region” refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem-loop structures.
  • a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • a miR-485 inhibitor disclosed herein e.g., a polynucleotide comprising a RNA comprising one or more miR-485 binding site
  • a coding region for a gene product is associated with one or more regulatory regions in such a way as to place expression of the gene product under the influence or control of the regulatory region(s).
  • a coding region and a promoter are "operably associated” if induction of promoter function results in the transcription of mRNA encoding the gene product encoded by the coding region, and if the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed.
  • Other expression control elements besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can also be operably associated with a coding region to direct gene product expression.
  • similarity refers to the overall relatedness between polymeric molecules, e.g.
  • polynucleotide molecules e.g. miRNA molecules
  • Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the nucleic acids are compared, e.g., according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • subject refers to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • domestic animals e.g., dogs, cats and the like
  • farm animals e.g., cows, sheep, pigs, horses and the like
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like
  • the phrases "subject in need thereof” and “subject at risk of hair loss” include subjects, such as mammalian subjects, that would benefit from administration of a miRNA inhibitor of the disclosure (e.g., miR-485 inhibitor), e.g., to induce hair growth.
  • a miRNA inhibitor of the disclosure e.g., miR-485 inhibitor
  • the subject has one or more disorders selected from the group consisting of alopecia greata, androgenic alopecia, alopecia areata, alopecia universalis, involutional alopecia, trichotillomania, telogen effluvium, anagen effluvium, cicatricial, alopecia, scarring alopecia, scalp thinning, hair shaft abnormalities, infectious hair disorders, genetic disorders, and hair loss due to chemotherapy, hormonal imbalance, fungal infection, medication intake, chemical hair treatment, or aging.
  • the subject is a human.
  • the term "therapeutically effective amount” is the amount of reagent or pharmaceutical compound comprising a miRNA inhibitor of the present disclosure that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition (e.g., diabetes); the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof.
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • a "vector” refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell.
  • a vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment.
  • a "replicon” refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control.
  • the term "vector” includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo.
  • Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector.
  • selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like.
  • reporter known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), ⁇ -galactosidase (LacZ), ⁇ -glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. II.
  • Methods of Use comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). Also provided herein are the methods for reducing hair loss in a subject in need thereof (e.g., a subject at risk of hair loss) comprising administering to the subject a compound that inhibits miR-485. Also provided herein are the methods of increasing hair density in a subject in need thereof (e.g., a subject at risk of hair loss) comprising administering to the subject a compound that inhibits miR-485.
  • Also provided herein are the methods for preventing hair loss in a subject at risk of hair loss comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor).
  • miR-485 miRNA inhibitor
  • the hair growth cycle is divided into three phases: an anagen phase, in which the hair is growing actively, with a very substantial level of cell proliferation occurring in the hair follicle; a catagen phase, when the follicle slows down its proliferative activity temporarily to permit hair development; and a telogen phase, in which the follicle simply stops growing and regresses, until the hair is shed, and a new anagen phase begins.
  • anagen phase in which the hair is growing actively, with a very substantial level of cell proliferation occurring in the hair follicle
  • a catagen phase when the follicle slows down its proliferative activity temporarily to permit hair development
  • a telogen phase in which the follicle simply stops growing and regresses, until the hair is shed, and a new anagen phase begins.
  • Typical follicular unit densities are in the range of 60-120 cm ⁇ 2 and each follicle generally contains one or two shafts, but rarely, more than two hair shafts of varying ages.
  • the hair shaft thickness can be classified as coarse, medium, or fine, and the mean value of the shaft thickness will vary from about 40 microns in width for fine hair, while coarse hair might average 90 microns in width.
  • N will generally be a number between 1 and 2, and more commonly 1-1.25 it can be eliminated from the density determination but may need to be considered in some rare cases.
  • a normalized hair density measurement for every individual is the ratio of top and/or front hair density to left and/or right side hair density.
  • the subject has one or more disorders selected from the group consisting of alopecia greata, androgenic alopecia, alopecia areata, alopecia universalis, involutional alopecia, trichotillomania, telogen effluvium, anagen effluvium, cicatricial, alopecia, scarring alopecia, scalp thinning, hair shaft abnormalities, infectious hair disorders, genetic disorders, and hair loss due to chemotherapy, hormonal imbalance, fungal infection, medication intake, chemical hair treatment, or aging.
  • the subject is a human.
  • a miR-485 inhibitor disclosed herein can be administered by any suitable route known in the art.
  • a miR-485 inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, topically, or any combination thereof.
  • a miR-485 inhibitor is administered intramuscularly.
  • a miR-485 inhibitor is administered to a skin area where promoting hair growth is needed by spread, spray, steam, or injection.
  • a miR-485 inhibitor is administered topically to a skin area where promoting hair growth is needed.
  • a miR-485 inhibitor is formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse.
  • the administering step is performed by soaking or bathing the subject in the miRNA inhibitor formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse.
  • a miR-485 inhibitor of the present disclosure can be used in combination with one or more additional therapeutic agents.
  • the additional therapeutic agent and the miR-485 inhibitor are administered concurrently.
  • the additional therapeutic agent and the miR-485 inhibitor are administered sequentially.
  • the administration of a miR-485 inhibitor disclosed herein does not result in any adverse effects.
  • the miR-485 inhibitors of the present disclosure do not adversely affect body weight when administered to a subject.
  • the miR-485 inhibitors disclosed herein do not result in increased mortality or cause pathological abnormalities when administered to a subject.
  • the miR-485 inhibitors of the present disclosure can exert therapeutic effects (e.g., inducing hair growth or preventing hair loss) by regulating the expression and/or activity of one or more genes.
  • miR-485 inhibitors disclosed herein are capable of regulating the expression and/or activity of a gene selected from CTBP1, TRIP6, SIRT1, CD36, PGC1-a, or combinations thereof.
  • CTBP1 Regulation [0165] In some aspects, contacting a miR-485 inhibitor described herein with a cell can increase the expression of a CTBP1 protein and/or a CTBP1 gene in the cell.
  • C-terminal-binding protein 1 is a protein that in humans is encoded by the CTBP1 gene.
  • CTBP1 is a regulatory protein that binds to sequence-specific DNA-binding proteins and help turn genes off, e.g., by recruiting histone modifying enzymes that add repressive histone marks and remove activating marks.
  • CTBP1 protein can also self-associate and bring together gene regulatory complexes.
  • the CTBP1 gene is located on chromosome 4 (nucleotides 1,211,444 to 1,250,355 of GenBank Accession Number NC_000004.12, minus strand orientation).
  • CTBP1 isoform 1 (UniProt identifier: Q13363-1; SEQ ID NO: 31) consists of 440 amino acids and has been chosen as the canonical sequence.
  • CTBP1 isoform 2 (UniProt identifier: Q13363-2; SEQ ID NO: 32) consists of 429 amino acids and differs from the canonical sequence as follows: 1-13: MGSSHLLNKGLPL ⁇ MS. Table 1 below provides the sequences for the two CTBP1 isoforms. Table 1.
  • CTBP1 Protein Isoforms [0169] As used herein, the term "CTBP1" includes any variants or isoforms of CTBP1 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of CTBP1 isoform 1. In some aspects, a miR- 485 inhibitor disclosed herein can increase the expression of CTBP1 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of both CTBP1 isoform 1 and isoform 2. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "CTBP1.”
  • CTBP1 both isoform 1 and isoform 2 are collectively referred to herein as "CTBP1.”
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of CTBP1 protein and/or CTBP1 gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared
  • a miR-485 inhibitor disclosed herein increases the expression of CTBP1 protein and/or CTBP1 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • TRIP6 Regulation [0172] In some aspects, contacting a miR-485 inhibitor described herein with a cell can increase the expression of a TRIP6 protein and/or a TRIP6 gene in the cell.
  • Thyroid receptor-interacting protein 6 (TRIP6) is a protein that in humans is encoded by the TRIP6 gene. TRIP6 protein is a member of the zyxin family and comprises three LIM zinc-binding domains.
  • TRIP6 protein has been shown to localize to focal adhesion sites and along actin stress fibers. [0174] In humans, the TRIP6 gene is located on chromosome 7 (nucleotides 100,867,387 to 100,873,454 of GenBank Accession Number NC_000007.14, plus strand orientation).
  • TRIP6 Synonyms of the TRIP6 gene, and the encoded protein thereof, are known and include: “Thyroid Hormone Receptor Interactor 6,” “ZRP-1,” “OIP1,” “Thyroid Hormone Receptor Interacting Protein 6,” “OPA-Interacting Protein 1,” and “Zyxin Related Protein 1.”
  • TRIP6 isoform 1 (UniProt identifier: Q15654-1; SEQ ID NO: 78) consists of 4766 amino acids and has been chosen as the canonical sequence.
  • TRIP6 isoform 2 (UniProt identifier: Q15654-2; SEQ ID NO: 79) consists of 106 amino acids and differs from the canonical sequence as follows: (i) 37-106: ALQPHPRVNF...IDLLSSTLAE ⁇ VLPGPRGTGG...CVTATRPTGI; (ii) 107-476: Missing.
  • TRIP6 isoform 3 (UniProt identifier: Q15654-2; SEQ ID NO: 80) consists of 80 amino acids and differs from the canonical sequence as follows: (i) 37-80: ALQPHPRVNF...SHGVLQHTQG ⁇ GAPCRQGGPS...CVTATRPTGI; (ii) 81-476: Missing.
  • TRIP6 Protein Isoforms [0176] As used herein, the term "TRIP6" includes any variants or isoforms of TRIP6 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 2. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 3. In further aspects, a miR-485 inhibitor disclosed herein can increase the expression of both TRIP6 isoform 1, isoform 2, and isoform 3.
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of TRIP6 protein and/or TRIP6 gene in the cell by at least about 1- fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor can also increase the expression and/or activity of other LIM-domain containing proteins.
  • a miR-485 inhibitor disclosed herein increases the expression of TRIP6 protein and/or TRIP6 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • SIRT1 Regulation [0180] In some aspects, contacting a miR-485 inhibitor described herein with a cell (e.g., neural stem cells) can increase the expression of a SIRT1 protein and/or a SIRT1 gene in the cell.
  • SIRT1 also known as NAD-dependent deacetylase sirtuin-1
  • SIRT1 is a protein that in humans is encoded by the SIRT1 gene.
  • the SIRT1 gene is located on chromosome 10 in humans (nucleotides 67,884,656 to 67,918,390 of GenBank Accession Number NC_000010.11, plus strand orientation).
  • SIRT1 Synonyms of the SIRT1 gene, and the encoded protein thereof, are known and include "regulatory protein SIR2 homolog 1,” “silent mating-type information regulation 2 homolog 1,” “SIR2,” “SIR2-Like Protein 1,” “SIR2L1,” “SIR2alpha,” “Sirtuin Type 1,” “hSIRT1,” or “hSIR2.”
  • SIRT1 isoform 1 (UniProt identifier: Q96EB6-1) consists of 747 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 31).
  • SIRT1 isoform 2 (also known as "delta-exon8) (UniProt identifier: Q96EB6-2) consists of 561 amino acids and differs from the canonical sequence as follows: 454-639: missing (SEQ ID NO: 32). Table 3 below provides the sequences for the two SIRT1 isoforms. Table 3. SIRT1 Protein Isoforms [0183] As used herein, the term “SIRT1" includes any variants or isoforms of SIRT1 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of both SIRT1 isoform 1 and isoform 2. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "SIRT1.”
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of SIRT1 protein and/or SIRT1 gene in the cell by at least about 1- fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g.,
  • a miR-485 inhibitor disclosed herein increases the expression of SIRT1 protein and/or SIRT1 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • CD36 Regulation [0186] In some aspects, contacting a miR-485 inhibitor described herein with a cell can increase the expression of a CD36 protein and/or a CD36 gene in the cell.
  • Cluster determinant 36 (CD36) is also known as platelet glycoprotein 4, is a protein that in humans is encoded by the CD36 gene.
  • the CD36 gene is located on chromosome 7 (nucleotides 80,602,656 to 80,679,277 of GenBank Accession Number NC_000007.14, plus strand orientation).
  • Synonyms of the CD36 gene, and the encoded protein thereof, are known and include "platelet glycoprotein IV,” “fatty acid translocase,” “scavenger receptor class B member 3,” “glycoprotein 88,” “glycoprotein IIIb,” “glycoprotein IV,” “thrombospondin receptor,” “GPIIIB,” “PAS IV,” “GP3B,” “GPIV,” “FAT,” “GP4,” “BDPLT10,” “SCARB3,” “CHDS7,” “PASIV,” or “PAS-4.” [0188] There are at least four known isoform of human CD36 protein, resulting from alternative splicing.
  • CD36 isoform 1 (UniProt identifier: P16671-1) consists of 472 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 36).
  • CD36 isoform 2 (also known as "ex8-del") (UniProt identifier: P16671-2) (SEQ ID NO: 37) consists of 288 amino acids and differs from the canonical sequence as follows: 274-288: SIYAVFESDVNLKGI ⁇ ETCVHFTSSFSVCKS; and 289-472: missing.
  • CD36 Isoform 3 (also known as “ex6-7-del") (UniProt identifier: P16671-3) (SEQ ID NO: 38) consists of 433 amino acids and differs from the canonical sequence as follows: 234-272: missing.
  • CD36 isoform 4 (also known as "ex4-del” (UniProt identifier: P16671-4) (SEQ ID NO: 39) consists of 412 amino acids and differs from the canonical sequence as follows: 144-203: missing. Table 4 below provides the sequences for the four CD36 isoforms. Table 4.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 1.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 4.
  • a miR-485 inhibitor disclosed herein can increase the expression of both CD36 isoform 1 and isoform 2, and/or isoform 3 and isoform 4, and/or isoform 1 and isoform 4, and/or isoform 2 and isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of all CD36 isoforms. Unless indicated otherwise, isoform 1, isoform 2, isoform 3, and isoform 4 are collectively referred to herein as "CD36.” [0190] In some aspects, contacting a cell with a miR-485 inhibitor increases the expression and/or activity of CD36 protein and/or CD36 gene in the cell by at least about 1- fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell
  • a miR-485 inhibitor disclosed herein increases the expression of CD36 protein and/or CD36 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • PGC1 Regulation [0192]
  • contacting a miR-485 inhibitor described herein with a cell can increase the expression of a PGC-1 ⁇ protein and/or a PGC-1 ⁇ gene in the cell.
  • PPC1- ⁇ Peroxisome proliferator-activated receptor gamma coactivator 1-alpha
  • PPARG Coactivator 1 Alpha or Ligand Effect Modulator-6 is a protein that in humans is encoded by the PPARGC1A gene.
  • the PGC1- ⁇ gene is located on chromosome 4 in humans (nucleotides 23,792,021 to 24,472,905 of GenBank Accession Number NC_000004.12, plus strand orientation).
  • PGC1- ⁇ gene Synonyms of the PGC1- ⁇ gene, and the encoded protein thereof, are known and include “PPARGC1A,” “LEM6,” “PGC1,” “PGC1A,” “PGC- 1v,” “PPARGC1, “PGC1alpha,” or “PGC-1(alpha).”
  • PGC1- ⁇ isoform 1 (UniProt identifier: Q9UBK2-1) consists of 798 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 40).
  • PGC1- ⁇ isoform 2 (also known as "Isoform NT-7a") (UniProt identifier: Q9UBK2-2) (SEQ ID NO: 41) consists of 271 amino acids and differs from the canonical sequence as follows: 269-271: DPK ⁇ LFL; 272-798: Missing.
  • PGC1- ⁇ isoform 3 (also known as "Isoform B5") (UniProt identifier: Q9UBK2-3) (SEQ ID NO: 42) consists of 803 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDETSPRLEEDWKKVLQREAGWQ.
  • PGC1- ⁇ isoform 4 (also known as "Isoform B4") (UniProt identifier: Q9UBK2-4) (SEQ ID NO: 43) consists of 786 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF.
  • PGC1- ⁇ isoform 5 (also known as "Isoform B4-8a") (UniProt identifier: Q9UBK2-5) (SEQ ID NO: 44) consists of 289 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF; 294-301: LTPPTTPP ⁇ VKTNLISK; 302-798: Missing.
  • PGC1- ⁇ isoform 6 (also known as "Isoform B5-NT") (UniProt identifier: Q9UBK2-6) (SEQ ID NO: 45) consists of 276 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDETSPRLEEDWKKVLQREAGWQ; 269-271: DPK ⁇ LFL; 272-798: Missing.
  • PGC1- ⁇ isoform 7 (also known as "B4-3ext") (UniProt identifier: Q9UBK2-7) (SEQ ID NO: 46) consists of 138 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF; 144-150: LKKLLLA ⁇ VRTLPTV; 151-798: Missing.
  • PGC1- ⁇ isoform 8 (also known as "Isoform 8a") (UniProt identifier: Q9UBK2-8) (SEQ ID NO: 47) consists of 301 amino acids and differs from the canonical sequence as follows: 294-301: LTPPTTPP ⁇ VKTNLISK; 302-798: Missing.
  • PGC1- ⁇ isoform 9 (also known as "Isoform 9" or "L-PGG-1alpha") (UniProt identifier: Q9UBK2-9) (SEQ ID NO: 48) consists of 671 amino acids and differs from the canonical sequence as follows: 1-127: Missing. Table 5 below provides the sequences for the nine PGC1- ⁇ isoforms. Table 5.
  • PGC1- ⁇ includes any variants or isoforms of PGC1- ⁇ which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1. In some aspects, a miR- 485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 4. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 5. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 6. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 7. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 8. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 9.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1, isoform 2, isoform 3, isoform 4, isoform 5, isoform 6, isoform 7, isoform 8, and isoform 9. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "PGC1- ⁇ .”
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of PGC1- ⁇ protein and/or PGC1- ⁇ gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90
  • a miR-485 inhibitor disclosed herein increases the expression of PGC1- ⁇ protein and/or PGC1- ⁇ gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p. III. miRNA-485 Inhibitors Useful for the Present Disclosure [0198] Disclosed herein are compounds that can inhibit miR-485 activity (miR-485 inhibitor).
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding or comprising a nucleotide molecule that comprises at least one miR-485 binding site, wherein the nucleotide molecule does not encode a protein.
  • the miR-485 binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485), such that the miR-485 inhibitor hybridizes to the miR-485 nucleic acid sequence.
  • the miR-485 binding site of a miR inhibitor disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485, e.g., miR- 485-3p.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence of a miR-485, e.g., miR-485-3p.
  • the miR-485 hairpin precursor can generate both miR-485-5p and miR-485-3p.
  • miR-485" encompasses both miR-485-5p and miR-485- 3p unless specified otherwise.
  • the human mature miR-485-3p has the sequence 5'- GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1; miRBase Acc. No. MIMAT0002176).
  • a 5' terminal subsequence of miR-485-3p 5'-UCAUACA-3' is the seed sequence.
  • the human mature miR-485-5p has the sequence 5'- AGAGGCUGGCCGUGAUGAAUUC-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0002175).
  • a 5' terminal subsequence of miR-485-5p 5'-GAGGCUG-3' (SEQ ID NO: 50) is the seed sequence. [0201] As will be apparent to those in the art, the human mature miR-485-3p has significant sequence similarity to that of other species.
  • the mouse mature miR- 485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A” at the 5'-end and missing "C” at the 3'-end).
  • the mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; underlined portion corresponds to overlap to human mature miR-485-3p).
  • the sequence for the mouse mature miR-485-5p is identical to that of the human: 5'-agaggcuggccgugaugaauuc-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0003128).
  • a miR-485 inhibitor disclosed herein is capable of binding to miR-485-3p and/or miR-485-5p from both human and mouse.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-3p (or a subsequence thereof).
  • the miR-485-3p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49.
  • the miR-485 binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-5p (or a subsequence thereof). In some aspects, the miR-485-5p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 50.
  • the miR-485 binding site is complementary to miR-485-5p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. [0204]
  • the seed region of a miRNA forms a tight duplex with the target mRNA.
  • the miR-485 binding site comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of miR-485.
  • miRNA sequences and miRNA binding sequences that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs.
  • any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name are contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA
  • miRNA binding sequences of the present disclosure can include additional nucleotides at the 5′, 3′, or both 5′ and 3′ ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to miR-485.
  • miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequences in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to miR-485.
  • any methods and compositions discussed herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules.
  • a miRNA-485 inhibitor of the present disclosure comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • a miRNA-485 inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • a miR-485 inhibitor disclosed herein is about 6 to about 30 nucleotides in length. In certain aspects, a miR-485 inhibitor disclosed herein is 7 nucleotides in length. In further aspects, a miR-485 inhibitor disclosed herein is 8 nucleotides in length. In some aspects, a miR-485 inhibitor is 9 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 10 nucleotides in length. In certain aspects, a miR-485 inhibitor is 11 nucleotides in length. In further aspects, a miR-485 inhibitor is 12 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 13 nucleotides in length.
  • a miR-485 inhibitor disclosed herein is 14 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 15 nucleotides in length. In further aspects, a miR-485 inhibitor is 16 nucleotides in length. In certain aspects, a miR-485 inhibitor of the present disclosure is 17 nucleotides in length. In some aspects, a miR-485 inhibitor is 18 nucleotides in length. In some aspects, a miR-485 inhibitor is 19 nucleotides in length. In certain aspects, a miR-485 inhibitor is 20 nucleotides in length. In further aspects, a miR-485 inhibitor of the present disclosure is 21 nucleotides in length.
  • a miR-485 inhibitor is 22 nucleotides in length.
  • a miR-485 inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30.
  • a miR-485 inhibitor comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • a miRNA inhibitor comprises 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGG
  • the miRNA inhibitor has 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5
  • the miRNA inhibitor has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 30), 5'-GTGTATGA-3' (SEQ ID NO: 51), 5'- CGTGTATGA-3' (SEQ ID NO: 52), 5'-CCGTGTATGA-3' (SEQ ID NO: 53), 5'- GCCGTGTATGA-3' (SEQ ID NO: 54), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 55), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 35), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 56), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 57), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 58), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 59), 5'- GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 59),
  • a miRNA inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77).
  • the miRNA inhibitor comprises a nucleotide sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In some aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77) with one substitution or two substitutions.
  • the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In certain aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28).
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and at least one, at least two, at least three, at least four or at least five additional nucleic acids at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acids at the C terminus, or both.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus.
  • a miR-485 inhibitor comprises 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29).
  • a miR-485 inhibitor of the present disclosure comprises one miR- 485 binding site.
  • a miR-485 inhibitor disclosed herein comprises at least two miR-485 binding sites.
  • a miR-485 inhibitor comprises three miR-485 binding sites.
  • a miR-485 inhibitor comprises four miR-485 binding sites.
  • a miR-485 inhibitor comprises five miR-485 binding sites.
  • a miR-485 inhibitor comprises six or more miR-485 binding sites.
  • all the miR- 485 binding sites are identical.
  • all the miR-485 binding sites are different.
  • at least one of the miR-485 binding sites is different.
  • a miR-485 binding sites are miR-485-3p binding sites. In other aspects, all the miR-485 binding sites are miR-485-5p binding sites. In further aspects, a miR-485 inhibitor comprises at least one miR-485-3p binding site and at least one miR-485-5p binding site. III.a. Chemically Modified Polynucleotides [0217] In some aspects, a miR-485 inhibitor disclosed herein comprises a polynucleotide which includes at least one chemically modified nucleoside and/or nucleotide.
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • a “nucleotide” refers to a nucleoside including a phosphate group.
  • Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • the modified polynucleotides disclosed herein can comprise various distinct modifications. In some aspects, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified polynucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified polynucleotide.
  • a polynucleotide of the present disclosure e.g., a miR-485 inhibitor is chemically modified.
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • a polynucleotide of the present disclosure can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the polynucleotide of the present disclosure e.g., a miR-485 inhibitor
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil.
  • TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units.
  • the polynucleotide (e.g., a miR-485 inhibitor) includes a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100%.
  • the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor).
  • the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine ( ⁇ ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1 ⁇ ), 1-ethyl-pseudouridine (e1 ⁇ ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1- methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl
  • the polynucleotide of the present disclosure is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
  • a polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • the polynucleotide of the present disclosure includes a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases.
  • the polynucleotide of the present disclosure can include any useful linkage between the nucleosides.
  • linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformace
  • the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of a polynucleotide of the present disclosure (i.e., miR- 485 inhibitor).
  • a backbone modification that can be included in a polynucleotide of the present disclosure comprises phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • PMO phosphorodiamidate morpholino oligomer
  • PS phosphorothioate
  • sugar modifications [0234] The modified nucleosides and nucleotides which can be incorporated into a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can be modified on the sugar of the nucleic acid. In some aspects, the sugar modification increases the affinity of the binding of a miR-485 inhibitor to a miR-485 nucleic acid sequence.
  • Incorporating affinity- enhancing nucleotide analogues in the miR-485 inhibitor, such as LNA or 2'-substituted sugars, can allow the length and/or the size of the miR-485 inhibitor to be reduced.
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.
  • GAA glyco
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar.
  • the 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents.
  • substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from
  • nucleotide analogues present in a polynucleotide of the present disclosure comprise, e.g., 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof.
  • ANA arabino nucleic acid
  • INA intercalating nucleic acid
  • the LNA is, e.g., oxy-LNA (such as beta- D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L- amino-LNA), thio-LNA (such as beta-D-thio0-LNA or alpha-L-thio-LNA), ENA (such a beta-D-ENA or alpha-L-ENA), or any combination thereof.
  • oxy-LNA such as beta- D-oxy-LNA, or alpha-L-oxy-LNA
  • amino-LNA such as beta-D-amino-LNA or alpha-L- amino-LNA
  • thio-LNA such as beta-D-thio0-LNA or alpha-L-thio-LNA
  • ENA such a beta-D-ENA or alpha-L-ENA
  • nucleotide analogues that can be included in a polynucleotide of the present disclosure comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • a polynucleotide of the present disclosure i.e., miR-485 inhibitor
  • a miR-485 inhibitor is a gapmer.
  • a miR-485 inhibitor is a micromir. See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety.
  • a polynucleotide of the present disclosure i.e., miR-485 inhibitor
  • Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. IV.
  • end modifications e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.)
  • base modifications e.g., replacement with modified bases, stabilizing bases
  • the miR-485 inhibitors of the present disclosure can be administered, e.g., to a subject at risk of hair loss, using any relevant delivery system known in the art.
  • the delivery system is a vector.
  • the present disclosure provides a vector comprising a miR-485 inhibitor of the present disclosure.
  • the vector is a viral vector.
  • the viral vector is an adenoviral vector or an adenoassociated viral vector.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the adenoviral vector is a third generation adenoviral vector.
  • ADEASYTM is by far the most popular method for creating adenoviral vector constructs.
  • the system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors.
  • the transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI.
  • This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASYTM.
  • PADEASYTM is a ⁇ 33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production.
  • the shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid.
  • Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred.
  • the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs. 293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later.
  • the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector). Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems.
  • the transfer vector plasmid portions of the HIV provirus
  • the packaging plasmid or construct and a plasmid with the heterologous envelop gene (env) of a different virus.
  • the three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell.
  • the virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system.
  • Current third generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of a replication-competent virus.
  • AAV vector known in the art can be used in the methods disclosed herein.
  • the AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof.
  • the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, bovine AAV, shrimp AVV, snake AVV, and any combination thereof.
  • AAV1 AAV type 1
  • AAV2 AAV2
  • AAV3A AAV3A
  • AVV3B AAV4
  • AAV5 AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74
  • avian AAV bovine AAV
  • canine AAV equine AAV, goat AVV
  • the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof.
  • the AAV vector is a chimeric vector derived from at least two AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof.
  • the AAV vector comprises regions of at least two different AAV vectors known in the art.
  • the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine A
  • the AVV vector comprises a portion of an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof.
  • the AAV vector comprises AAV2.
  • the AVV vector comprises a splice acceptor site.
  • the AVV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure.
  • the promoter is an RNA Pol III promoter.
  • the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof.
  • the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EF1a promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter.
  • the promoter comprises the U6 promoter.
  • the AAV vector comprises a constitutively active promoter (constitutive promoter).
  • the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus.
  • HPRT hypoxanthine phosphoribosyl transferase
  • CMV cytomegalovirus
  • simian virus e.g., SV40
  • papilloma virus adenovirus
  • the promoter is an inducible promoter.
  • the inducible promoter is a tissue specific promoter.
  • the tissue specific promoter drives transcription of the coding region of the AVV vector in a neuron, a glial cell, or in both a neuron and a glial cell.
  • the AVV vector comprises one or more enhancers.
  • the one or more enhancer is present in the AAV alone or together with a promoter disclosed herein.
  • the AAV vector comprises a 3'UTR poly(A) tail sequence.
  • the 3'UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'UTR poly(A) tail sequence comprises bGH poly(A). [0255] In some aspects, a miR-485 inhibitor disclosed herein is administered with a delivery agent.
  • Non-limiting examples of delivery agents that can be used include an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, a viral vector, or a conjugate.
  • the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) and a delivery agent.
  • the delivery agent comprises a carrier unit, e.g., that can self- assemble into micelles or be incorporated into micelles.
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged (i.e., cationic) carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle.
  • the miRNA inhibitor and the cationic carrier unit are capable of associating with each other (e.g., via a covalent bond or a non-valent bond) to form a micelle when mixed together.
  • composition comprising a miRNA inhibitor of the present disclosure i.e., miR-485 inhibitor
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: (formula III), wherein n is 1-1000.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the cationic carrier moiety comprises about 40 lysine monomers.
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: (formula IV), wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3.
  • the adjuvant moiety comprises about 10 vitamin B3.
  • the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3).
  • an amine group e.g., about 32 lysines
  • a thiol group e.g., about 16 lysines, each with a thiol group
  • vitamin B3 e.g., about 32 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miR485 inhibitor (e.g., SEQ ID NO: 28), wherein the miR485 inhibitor is encapsulated within the micelle.
  • a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other.
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See PCT Publication No. WO2020/261227, which is herein incorporated by reference in its entirety. V.
  • compositions comprising a miR-485 inhibitor disclosed herein (e.g., a polynucleotide or a vector comprising the miR-485 inhibitor) that are suitable for administration to a subject.
  • the pharmaceutical compositions generally comprise a miR-485 inhibitor described herein (e.g., a polynucleotide or a vector) and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • kits or products of manufacture comprising a miRNA inhibitor of the present disclosure (e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein) and optionally instructions for use, e.g., instructions for use according to the methods disclosed herein.
  • a miRNA inhibitor of the present disclosure e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein
  • optionally instructions for use e.g., instructions for use according to the methods disclosed herein.
  • the kit or product of manufacture comprises a miR-485 inhibitor (e.g., vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) in one or more containers.
  • the kit or product of manufacture comprises miR-485 inhibitor (e.g., a vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) and a brochure.
  • miR-485 inhibitors disclosed herein can be readily incorporated into one of the established kit formats which are well known in the art.
  • the following examples are offered by way of illustration and not by way of limitation. Examples Example 1: Preparation of miR-485 inhibitor [0277] (a) Synthesis of alkyne modified tyrosine: An alkyne modified tyrosine was generated as an intermediate for the synthesis of a tissue specific targeting moiety (TM, see FIG. 1) of a cationic carrier unit to direct micelles of the present disclosure to the LAT1 transporter in the BBB.
  • TM tissue specific targeting moiety
  • the resulting product was dissolved in 1,4-dioxane (1.0 ml) and 6.0 M HCl (1.0 ml). The reaction mixture was heated at 100 °C overnight. Next, the dioxane was removed and extracted by EA. Aqueous NaOH (0.5 M) solution was added to the mixture until the pH value become 7. The reactant was concentrated by evaporator and centrifuged at 12,000 rpm at 0°C. The precipitate was washed with deionized water and lyophilized.
  • MeO-PEG 600 mg, 0.12 mmol
  • Lys(TFA)-NCA 2574 mg, 9.6 mmol
  • DMF 1M thiourea and DMF(or NMP)
  • Lys(TFA)-NCA solution was dropped into the MeO-PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether.
  • N 3 -PEG 300 mg, 0.06 mmol
  • Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP).
  • Lys(TFA)-NCA solution was dropped into the N 3 -PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether.
  • N 3 -PEG-PLL 500 mg was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of N 3 -PEG-PLL was obtained after lyophilization.
  • N 3 -PEG-PLL(Nic/SH) Azido-poly(ethylene glycol)-b-poly(L-lysine/nicotinamide/mercaptopropanamide) was synthesized by chemical modification of N 3 -PEG-PLL and nicotinic acid in the presence of EDC/NHS.
  • N 3 -PEG-PLL (372 mg, 25.8 ⁇ mol) and nicotinic acid 556.7 mg, 1.02 equiv. to NH2 of PEG-PLL
  • EDC•HCl 556.7 mg, 1.5 equiv.
  • phenyl alanine was introduced by click reaction between N 3 -PEG-PLL(Nic/SH) and alkyne modified tyrosine in the presence of copper catalyst.
  • N 3 -PEG-PLL(Nic/SH) 130 mg, 6.5 ⁇ mol
  • alkyne modified phenyl alanine 5.7 mg, 4.0 equiv.
  • PIC Polyion Complex
  • micelles were produced.
  • the micelles described in the present example comprised cationic carrier units combined with an antisense oligonucleotide payload.
  • Nano sized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA. PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at 0.5 mg/mL concentration.
  • RNAase free water was mixed with the polymer solution at 2:1 (v/v) ratio of miRNA inhibitor (SEQ ID NO: 28) (485 ASO-001) to polymer.
  • SEQ ID NO: 28 miRNA inhibitor 485 ASO-001
  • the mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., ratio between amine in polymer (carrier of the present disclosure) to phosphate in anti-miRNA (payload).
  • the mixture of polymer (carrier) and anti- miRNA (payload) was vigorously mixed for 90 seconds by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • mice (10 ⁇ M of Anti-miRNA concentration) were stored at 4 oC prior to use. MeO- or Phe- micelles were prepared using the same method, and different amounts of Phe- containing micelles (25% ⁇ 75%) were also prepared by mixing both polymers during micelle preparation.
  • Example 2 Materials and Methods [0296] Unless provided otherwise, the Examples described below use one or more of the following materials and methods: Assay for in vivo hair growth in C57BL/6J mice [0297] C57BL/6J mice were obtained from DBL Co. Ltd. animal laboratory at 6 weeks of age and allowed to adapt to their new environment for one week.
  • IM Intramuscular
  • PBS vehicle control
  • PD PD0 and PD7 Intramuscular
  • IM injection of miR-485 inhibitor-485 ASO-001 (0.3 mpk and 0.6 mpk). Appearance of skin pigmentation and hair growth were monitored and documented by digital photomicrograph, with the experimenter(s) being blind to the treatment conditions.
  • Tissue staining measurement of histological structure of skin and hair follicle
  • the dorsal skin of all the groups was fixed in 4% PFA on PD10 and PD16 and assessed with hematoxylin and eosin (H&E) staining.
  • the number of HFs were counted (cross-section) in dermis and subcutis. Thickness of dermis and subcutis was taken from the visible microscopic field (3 fields) with at-least 7 measurements.
  • the length of hair follicle and diameter of hair bulb were measured from longitudinal and transverse section of dorsal skin by analyzing the images by Motic images plus 2.0 ML.
  • Lysate was boiled for 5 min in 1 x SDS (Fisher Scientific) loading buffer containing 5% ⁇ -mercaptoethanol (Fisher Scientific). Samples were then subjected to SDS–PAGE on PAGE 8%, 12% Bis-Tris gels (Invitrogen) in MOPS SDS Running Buffer (Invitrogen) and transferred to PVDF membranes and incubated with the following primary antibodies: rabbit anti-CD36 (Abcam, Cat# ab80080, 1:1000), rabbit anti- VEGF-A (Abcam, Cat# ab51745, 1:1000), rabbit anti-Wnt3a (IBL,Cat#11088, 1:1000), rabbit anti- ⁇ -actin (Abcam, Cat#ab1997, 1:100), anti-actin (Santa Cruz, Cat#sc-47778).
  • rabbit anti-CD36 Abcam, Cat# ab80080, 1:1000
  • rabbit anti- VEGF-A Abcam, Cat# ab51745, 1:1000
  • rabbit anti-Wnt3a I
  • the tissue was allowed to react for 1 hour at room temperature or overnight at 4°C using primary antibody solution obtained by diluting CD36 antibody solution (Invitrogen Cat# PA1-16813) 50-fold, with the blocking solution. After washing 3 time with PBS, the tissue was allowed to react for 1 hour at room temperature using a secondary antibody solution obtained by diluting FITC-labeled anti-mouse IgG antibody (Invitrogen Corp.) 200-fold each with blocking solution. After reacting with DAPI solution, the tissue was washed 3 times with PBS and sealed with an anti-fade reagent (Prolong Gold Antifade Reagent) and a cover glass. The tissue was observed using a fluorescence microscope (Olympus Corp.).
  • Negative control (PBS) and 485 ASO-001 were administered by a one-time intramuscular injection.
  • the digital photographs of mice were taken post-depilation (pd.) on days 5 (FIG. 2A), 7 (FIG. 2B), 9 (FIG.2C), 12 (FIG.2D), 14 (FIG.2E), and 16 (FIG.2F) after treatment, and the hair growth area was analyzed via morphological observation by a score of 0-6 (FIG.2G).
  • Negative control (PBS), and positive control (2% Minoxidil), and 485 ASO-001 (0.3 mpk, and 0.6 mpk) were administered by twice (PD0 and PD7) intramuscular injection.
  • the digital photographs of mice were taken post-depilation (pd.) on days 5 (FIG. 4D), 7 (FIG. 4E), 10 (FIG. 4F), 12 (FIG. 4G), 14 (FIG. 4H), and 16 (FIG. 4I) after treatment, and the hair growth area was analyzed via morphological observation by a score of 0-6 (FIG. 4J).
  • results showed that the miR- 485 inhibitor (485 ASO-001) enhanced early indication of anagen hair growth in telegenic mice (see e.g., Figures 4D-4J).
  • miR-485 inhibitor (485 ASO-001) (0.6 mpk- twice) treated mice group showed strongly activated and maintain anagen hair growth ( Figures 4D-4J) as compared to PBS-treated control group and Minoxidil treatment group.
  • Example 4 Analysis of Dose Dependent Effect of miR-485 Inhibitor on Hair Density [0307] To further assess the hair regrowth effect of the miR-485 inhibitor (485 ASO- 001) prepared as shown in Example 1 on depilated mice treated with PBS and 485 ASO-001, as described in Example 1, the hair density after treatment with 485 ASO-001 (0.1 mpk, 0.3 mpk, 0.6 mpk) was compared to the PBS-treated control group. Dermoscopic images of each mouse were acquired in the same region (3.6 mm 2 ) of interscapular skin on days 12 (FIG. 3A) and 16 (FIG.
  • Example 5 Analysis of Dose Dependent Effect of miR-485 Inhibitor on Hair Length
  • the hair length after treatment with 485 ASO-001 was compared to the PBS-treated control group. After treatment hairs were plucked from representative areas in the depilated dorsal interscapular region of the back at days 16 (FIG.
  • Example 6 Expression of miR ⁇ 485 ⁇ 3p During Skin Development and Hair Follicle Cycling [0313] To test the effect of miR-485 inhibitor (485 ASO-001) on the miR ⁇ 485 ⁇ 3p (FW7_mimic) expression level, tissue samples were obtained pd10 (FIG.5A) and pd16 (FIG. 5B) of the murine hair cycle from an early anagen to the late anagen. miRNA expressions were decreased during the late anagen growth phase of the adult hair cycle, as compared with early anagen.
  • Example 7 Assessment of Dose Dependent Effect of miR-485 Inhibitor on Skin and Hair Follicle Density
  • minoxidil treatment also significantly (p ⁇ 0.01) increased the hair follicle number as compared to the negative control, this increase was lower than that with miR-485 inhibitor (485 ASO-001) (0.6 mpk) treatment ( Figure FIG. 6G, FIG. 6H).
  • miR-485 inhibitor (485 ASO-001) (0.6 mpk) and minoxidil treatments significantly increased thickness of dermis (p ⁇ 0.03 and p ⁇ 0.04) as compared to the control group, but the minoxidil treatment increase in dermis and subcutis thickness was lower than that with miR-485 inhibitor (485 ASO-001) (0.6 mpk) (p ⁇ 0.001) treatment (Figure FIG.6C, FIG. 6D).
  • miR-485 inhibitor (485 ASO-001) (0.6 mpk) treatment significantly increased diameter of hair bulb (p ⁇ 0.01) compared to the control and minoxidil treatments group on day 10 pd.
  • the treatment with miR-485 inhibitor (485 ASO-001) (0.3 mpk and 0.6 mpk) (p ⁇ 0.001 and 0.0003) increased the thickness of subcutis in a dose-dependent manner compared to control.
  • miR-485 Inhibitor Increased the Wnt and ⁇ -catenin Protein Expression [0315] The effect of miR-485 inhibitor (485 ASO-001) on Wnt3a and ⁇ -catenin protein expression was assessed by Western blotting.
  • Wnt/ ⁇ -catenin signaling is specifically involved in hair follicle morphogenesis, regeneration, and growth.
  • Wnt3a induces hair growth due to the ability to activate the Wnt/ ⁇ -catenin signaling pathway in dermal papilla (DP) cells.
  • DP dermal papilla
  • ⁇ -catenin is expressed in the dermal papilla and promotes anagen induction and duration, as well as keratinocyte regulation and differentiation.
  • miR-485 inhibitor (485 ASO- 001) (0.6 mpk) up regulated the expression of Wnt3a (FIG. 9B) and ⁇ -catenin (FIG. 9C).
  • ⁇ - Catenin which has been implicated in skin and hair follicle development, is an essential molecule in the Wnt signaling pathway.
  • miR-485 inhibitor (485 ASO-001) (0.6 mpk) significantly promotes the elongation of the hair shafts and the differentiation.
  • miR-485 Inhibitor Increased CD36 and VEGF-A Protein Expression [0316] The effect of miR-485 inhibitor-485 ASO-001 on CD36 and vascular endothelial growth factor-A (VEGF-A) protein expression was assessed by Western blotting. Treatment with miR-485 inhibitor-485 ASO-001 (0.6 mpk) up regulated the protein expression level of CD36 (FIG.
  • VEGF-A is the most potent and specific vascular growth factor and a key regulator in physiological and pathological angiogenesis (blood capillary formation). VEGF-A levels are regulated through transcriptional control and mRNA stability.
  • Mesenchyme of the murine pelage follicle is comprised of a follicle-lining smooth muscle known as the dermal sheath (DS). DS modulates blood capillaries in hair follicles in association with hair cycling. An immunofluorescence experiment was conducted to assess the effect of miR-485 inhibitor (485 ASO-001) (0.6 mpk) on the expression of CD36 in DS affected angiogenesis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dermatology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Dispersion Chemistry (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nanotechnology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Inorganic Chemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Birds (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Cosmetics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/IB2021/062226 2020-12-23 2021-12-23 Use of mirna-485 inhibitors for inducing hair growth Ceased WO2022137188A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
KR1020237019780A KR20230124904A (ko) 2020-12-23 2021-12-23 모발 성장을 유도하기 위한 mirna-485 억제제의 용도
EP21909691.4A EP4267112A4 (en) 2020-12-23 2021-12-23 USE OF MIRNA-485 INHIBITORS TO INDUCE HAIR GROWTH
CN202180082153.3A CN116568333A (zh) 2020-12-23 2021-12-23 miRNA-485抑制剂用于诱导毛发生长的用途
JP2023534651A JP2024501437A (ja) 2020-12-23 2021-12-23 発毛を誘導するためのmirna-485阻害剤の使用
US18/259,007 US20240050461A1 (en) 2020-12-23 2021-12-23 Use of mirna-485 inhibitors for inducing hair growth

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063130121P 2020-12-23 2020-12-23
US63/130,121 2020-12-23

Publications (1)

Publication Number Publication Date
WO2022137188A1 true WO2022137188A1 (en) 2022-06-30

Family

ID=82157573

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/062226 Ceased WO2022137188A1 (en) 2020-12-23 2021-12-23 Use of mirna-485 inhibitors for inducing hair growth

Country Status (7)

Country Link
US (1) US20240050461A1 (https=)
EP (1) EP4267112A4 (https=)
JP (1) JP2024501437A (https=)
KR (1) KR20230124904A (https=)
CN (1) CN116568333A (https=)
TW (1) TW202241459A (https=)
WO (1) WO2022137188A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024228119A1 (en) * 2023-05-01 2024-11-07 Biorchestra Co., Ltd. Mirna-485 inhibitors

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118440899B (zh) * 2023-09-12 2025-05-09 上海泌靓生物科技有限公司 一种促进毛发再生的工程化纳米囊泡及其制备方法与应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160193140A1 (en) * 2010-09-29 2016-07-07 Shiseido Company, Ltd. Method for Regenerating Hair Follicles Using CD36-Expressing Dermal Sheath Cells

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005063279A1 (en) * 2003-12-29 2005-07-14 Universitätsklinikum Münster Means for stimulation and activation of hair growth by il-15
RU2515926C2 (ru) * 2009-02-04 2014-05-20 Борд Оф Риджентс, Дзе Юниверсити Оф Техас Систем Двойное нацеливание нп mir-208 и mir 499 в лечении заболеваний сердца
WO2018139759A1 (ko) * 2017-01-26 2018-08-02 주식회사 바이오오케스트라 마이크로 rna를 이용한 알츠하이머병 진단방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160193140A1 (en) * 2010-09-29 2016-07-07 Shiseido Company, Ltd. Method for Regenerating Hair Follicles Using CD36-Expressing Dermal Sheath Cells

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AKSENENKO MARIYA, PALKINA NADEZHDA, KOMINA ANNA, RUKSHA TATIANA: "MiR-92a-1-5p and miR-328-3p Are Up-Regulated in Skin of Female Pattern Hair Loss Patients", ANNALS OF DERMATOLOGY, vol. 31, no. 2, 1 January 2019 (2019-01-01), KR , pages 256 - 259, XP055946602, ISSN: 1013-9087, DOI: 10.5021/ad.2019.31.2.256 *
KOH HAN SEOK, JANG HANNAH, TAE SOOKIL, LEE MI-SUN, MIN JAE-WOONG, MUN HUI JIN, LEE JI NA, LEE HYO JIN, KIM DAE HOON, CHO HYUN-JEON: "Reducing miR485-3p ameliorates Alzheimer`s disease pathology by regulation of amyloid beta and neuro-inflammation", RESEARCH SQUARE, 26 March 2020 (2020-03-26), pages 1 - 56, XP055897461, DOI: 10.21203/rs.3.rs-19583/v1 *
LEE MYUNG JOO, CHA HWA JUN, LIM KYUNG MI, LEE OK-KYU, BAE SEUNGHEE, KIM CHUN-HO, LEE KEE-HO, LEE YU NA, AHN KYU JOONG, AN SUNGKWAN: "Analysis of the microRNA expression profile of normal human dermal papilla cells treated with 5α-dihydrotestosterone", MOLECULAR MEDICINE REPORTS, vol. 12, no. 1, 13 June 2015 (2015-06-13), GR , pages 1205 - 1212, XP055923932, ISSN: 1791-2997, DOI: 10.3892/mmr.2015.3478 *
See also references of EP4267112A4 *
YOSHIDA YUZO; SOMA TSUTOMU; KISHIMOTO JIRO: "Characterization of human dermal sheath cells reveals CD36-expressing perivascular cells associated with capillary blood vessel formation in hair follicles", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 516, no. 3, 2 July 2019 (2019-07-02), Amsterdam NL , pages 945 - 950, XP085743363, ISSN: 0006-291X, DOI: 10.1016/j.bbrc.2019.06.146 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024228119A1 (en) * 2023-05-01 2024-11-07 Biorchestra Co., Ltd. Mirna-485 inhibitors

Also Published As

Publication number Publication date
CN116568333A (zh) 2023-08-08
JP2024501437A (ja) 2024-01-12
TW202241459A (zh) 2022-11-01
EP4267112A4 (en) 2025-10-01
EP4267112A1 (en) 2023-11-01
US20240050461A1 (en) 2024-02-15
KR20230124904A (ko) 2023-08-28

Similar Documents

Publication Publication Date Title
US20150141320A1 (en) Compositions and methods for modulating gene expression
EA036791B1 (ru) Олигонуклеотидная терапия врожденного амавроза лебера
US20240050461A1 (en) Use of mirna-485 inhibitors for inducing hair growth
US20230304014A1 (en) Mirna-485 inhibitor for huntington's disease
US20230099372A1 (en) Use of mirna-485 inhibitors for treating tauopathy
US20230131083A1 (en) Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
WO2023012165A1 (en) Compositions and methods for treating cmt1a or cmt1e diseases with rnai molecules targeting pmp22
WO2022264038A1 (en) Use of mirna-485 inhibitors for treating inflammasome-related diseases or disorders
WO2024228119A1 (en) Mirna-485 inhibitors
US20240117350A1 (en) Use of mirna-485 inhibitor to regulate psd95, synaptophysin, and caspase-3 expression
KR20220154772A (ko) Pgc-1a 발현을 사용하는 진단 방법
WO2022168007A1 (en) Use of mirna-485 inhibitors for treating diseases or disorders associated with abnormal nlrp3 expression
KR20220155585A (ko) Sirt1 발현을 사용하는 진단 방법
WO2024127317A1 (en) Treating mitochondrial dysfunction with mirna-485 inhibitor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21909691

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202180082153.3

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023534651

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021909691

Country of ref document: EP

Effective date: 20230724