WO2022131742A1 - Exosomes derived from cells treated with material inducing endoplasmic reticulum stress, and use thereof - Google Patents

Exosomes derived from cells treated with material inducing endoplasmic reticulum stress, and use thereof Download PDF

Info

Publication number
WO2022131742A1
WO2022131742A1 PCT/KR2021/018961 KR2021018961W WO2022131742A1 WO 2022131742 A1 WO2022131742 A1 WO 2022131742A1 KR 2021018961 W KR2021018961 W KR 2021018961W WO 2022131742 A1 WO2022131742 A1 WO 2022131742A1
Authority
WO
WIPO (PCT)
Prior art keywords
tsg
exosomes
mesenchymal stem
inflammatory
derived
Prior art date
Application number
PCT/KR2021/018961
Other languages
French (fr)
Korean (ko)
Inventor
유경록
오미경
주한솔
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to JP2023536117A priority Critical patent/JP2023554034A/en
Publication of WO2022131742A1 publication Critical patent/WO2022131742A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes

Definitions

  • the present invention relates to the therapeutic use of mesenchymal stem cell-derived exosomes induced endoplasmic reticulum stress.
  • MSC Mesenchymal stem cells
  • Known paracrine secretomes include the secretion of immune regulatory cytokines, growth factors and small membrane vesicles.
  • direct use of mesenchymal stem cells has problems such as maintaining their phenotypic or functional stability or high isolation and handling costs.
  • exosomes play an important role in immune regulation by mediating the delivery of paracrine factors in cell-to-cell communication.
  • Exosomes are small membrane lipid vesicles with a size of 30 to 150 nm that are released into the extracellular space and promote the activation of immune regulatory pathways by delivering proteins, mRNAs, microRNAs (miRNAs) or other components to target cells.
  • mRNAs microRNAs
  • exosomes secreted from mesenchymal stem cells are known to show regenerative medical treatment efficacy of stem cells.
  • the functions and transduction factors of exosomes depend on the cell type, and cellular stress can affect the factors exosomes transmit.
  • the endoplasmic reticulum plays an important role in modulating signal transduction pathways to ensure cellular homeostasis, and newly synthesized proteins undergo folding and translocation through the ER membrane.
  • the unfolded protein response UCR
  • TSG Thapsigargin
  • TSG thapsigargin
  • Republic of Korea Patent No. 10-1980453 relates to a composition for promoting the generation of stem cell-derived exosomes, and stem cell-derived exo using pioglitazone, metformin, or AICAR (5-Aminoimidazole-4-carboxamide ribonucleotide).
  • compositions and methods for increasing the amount of production or the amount of protein and RNA in the exosome are disclosed.
  • studies or descriptions of exosomes secreted from stem cells treated with endoplasmic reticulum stress-inducing substances such as thapsigargin have not been disclosed.
  • Non-Patent Document 1 Kim, W., Lee, S. K., Kwon, Y. W., Chung, S. G. & Kim, S. Pioglitazone-Primed Mesenchymal Stem Cells Stimulate Cell Proliferation, Collagen Synthesis and Matrix Gene Expression in Tenocytes. International journal of molecular sciences 20, doi:10.3390/ijms20030472 (2019).
  • Non-Patent Document 2 Kim, H. S. et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 145, 1392-1403.e1391-1398, doi:10.1053/j.gastro.2013.08.033 (2013).
  • Non-Patent Document 3 Kang, J. Y. et al. Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton's Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity. J Clin Med 9, doi:10.3390/jcm9092913 (2020).
  • mesenchymal stem cells that induced stress in the ER with ER stress-inducing substances such as thapsigargin
  • thapsigargin ER stress-inducing substances
  • an object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of inflammatory diseases, including mesenchymal stem cell-derived exosomes treated with ER stress-inducing substances, and uses thereof.
  • the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
  • the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
  • the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group.
  • the size of the exosome may be 10 to 200 nm.
  • the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
  • the present invention also provides a composition for regulating immunity comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
  • the immune modulation is anti-inflammatory cytokine (anti-inflammatory cytokine), regulatory T cells (regulatory T cells) and M2-type macrophages (M2-type macrophage) to increase the level and Pro-inflammatory cytokines, helper T cells, and M1-type macrophages may be immune modulators that decrease.
  • anti-inflammatory cytokine anti-inflammatory cytokine
  • regulatory T cells regulatory T cells
  • M2-type macrophages M2-type macrophages
  • the present invention also provides a method for promoting the production of mesenchymal stem cell-derived exosomes comprising the step of treating the endoplasmic reticulum stress-inducing substance to the mesenchymal stem cells.
  • the present invention also provides a method of treating an inflammatory disease comprising administering a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance to an inflammatory disease patient.
  • the present invention also provides the use of a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance for use in the prevention or treatment of an inflammatory disease.
  • MSC-derived exosomes are more immunogenic than parental MSCs due to their lower content of membrane-bound proteins, including tetraspanin (CD81, CD63, CD9), heat shock proteins (HSP60, HSP70, HSP90), and TSG 101. is low, and it is not known to cause rejection due to activation of allogeneic immune responses in MHC-mismatched recipients.
  • membrane-bound proteins including tetraspanin (CD81, CD63, CD9), heat shock proteins (HSP60, HSP70, HSP90), and TSG 101.
  • the present inventors found that secreted from human Wharton's jelly-derived MSC (WJ-MSC) treated with endoplasmic reticulum (ER) stress inducer thapsigargin (TSG, thapsigargin) The improved immunomodulatory properties of exosomes (TSG-Exo) were confirmed.
  • Stimulation of WJ-MSCs with TSG increases exosome secretion, increases the yield and expression of immunomodulatory or anti-inflammatory factors such as IL-10, COX2, or IDO (Indoleamine 2,3-dioxygenase), and increases pro-inflammatory factors ( The expression level of IFN ⁇ , TNF ⁇ or IL-1 ⁇ decreased or remained similar. The same results were also confirmed in TSG-Exo, indicating that TSG-induced exosome release is different from inflammation or senescence-associated secretion mechanism (SASP). It was suggested to have a secretory mechanism.
  • SASP senescence-associated secretion mechanism
  • TSG-Exo is derived from human MSC, a distinct immune rejection response was not observed when administered to a mouse colitis model. meant TSG-Exo substantially alleviated colitis by reducing the inflammatory response and maintaining intestinal barrier integrity in a mouse model of colitis.
  • a significant increase in Tregs and M2-type macrophages in the E. coli colon of mice treated with TSG-Exo suggests an anti-inflammatory effect of TSG-Exo.
  • similar expression occurred in exosomes and exosome-treated MNCs because anti-inflammatory factors of exosomes were efficiently delivered to MNCs when treated with Con A-stimulated MNCs (monocytes). Since TSG-Exo showed superior T cell/macrophage polarization regulation than control exosomes, the secretome of exosomes can be a reliable indicator for predicting the therapeutic effect of exosomes.
  • TSG-Exo significantly enhanced the effects of human peripheral blood-derived T cell proliferation and inhibition of Th1 and Th17 differentiation, whereas regulatory T cells and M2-type macrophages were abundant compared to the control exosome-treated group. This suggests that intestinal Tregs and macrophages may be mediators for the anti-inflammatory effects of MSC exosomes. Upregulation of Tregs and M2-type macrophages maintained intestinal homeostasis as suggested by disease activity scores, histological scores, and decreased neutrophil activity.
  • TSG treatment was sufficient to induce exosome release of WJ-MSCs and promoted the immunomodulatory properties of TSG-Exo, so TSG-treated MSCs or TSG-Exo provide a novel therapeutic method for the treatment of colitis. indicates that you can
  • the present invention can provide a pharmaceutical composition for preventing or treating inflammatory diseases comprising the mesenchymal stem cell-derived exosomes treated with endoplasmic reticulum stress-inducing substances.
  • the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
  • the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
  • the size of the exosome may be 10 to 200 nm.
  • the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
  • the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
  • the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
  • the present invention also provides a composition for regulating immunity comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
  • the immune modulation is anti-inflammatory cytokine (anti-inflammatory cytokine), regulatory T cells (regulatory T cells) and M2-type macrophages (M2-type macrophage) to increase the level and Pro-inflammatory cytokines, helper T cells, and M1-type macrophages may be immune modulators that decrease.
  • anti-inflammatory cytokine anti-inflammatory cytokine
  • regulatory T cells regulatory T cells
  • M2-type macrophages M2-type macrophages
  • the present invention can also provide a method for promoting the production of mesenchymal stem cell-derived exosomes comprising the step of treating the endoplasmic reticulum stress-inducing substance to the mesenchymal stem cells.
  • the promotion of production may mean promoting the number of exosomes or protein or mRNA production of the exosomes.
  • the present invention may also provide a method for treating an inflammatory disease comprising administering a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance to an inflammatory disease patient.
  • the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
  • the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
  • the size of the exosome may be 10 to 200 nm.
  • the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
  • the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
  • the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
  • the present invention may also provide the use of a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance for use in the prevention or treatment of inflammatory diseases.
  • the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
  • the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
  • the size of the exosome may be 10 to 200 nm.
  • the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
  • the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
  • the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
  • 'prevention' means any action that suppresses or delays the onset of an inflammatory disease.
  • 'Improvement' or 'treatment' of the present invention refers to all parameters related to inflammatory disease, for example, the degree of symptom improvement or benefit due to the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance of the present invention. means action.
  • the pharmaceutical composition of the present invention may be in various parenteral formulations.
  • one or more buffers eg, saline or PBS
  • antioxidants e.g, bacteriostatic agents, chelating agents (eg, EDTA or glutathione), fillers, bulking agents, binders, adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.
  • chelating agents eg, EDTA or glutathione
  • fillers eg, bulking agents, binders, adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.
  • adjuvants eg, aluminum hydroxide
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, or suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, and the like can be used.
  • composition of the present invention can be administered parenterally, and when administered parenterally, it can be formulated according to a method known in the art in the form of an injection for intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection. can
  • suitable carriers include, but are not limited to, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof, and/or a solvent or dispersion medium containing vegetable oil.
  • suitable carriers include Hanks' solution, Ringer's solution, PBS (phosphate buffered saline) with triethanolamine or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose. etc. can be used.
  • the injection may further include various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • the injection may further contain an isotonic agent such as sugar or sodium chloride.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • a pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the patient's disease type, severity, drug activity, drug sensitivity, and administration time. , administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.
  • the composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times.
  • the total effective amount of the composition of the present invention may be administered to a patient as a single dose, and may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time. .
  • the dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease.
  • a daily dose based on the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance when administered parenterally, preferably 0.01 to 50 mg, more preferably 0.1 to 30 mg per 1 kg of body weight per day.
  • To be administered as, and when administered orally preferably 0.01 to 100 mg, more preferably 0.01 to 10 mg per 1 kg of body weight per day, based on the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance of the present invention.
  • the dosage is not intended to limit the scope of the present invention in any way.
  • composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
  • TSG-Exo Mesenchymal stem cell-derived exosomes treated with ER stress-inducing substances according to the present invention increase the levels of anti-inflammatory cytokines, regulatory T cells to M2-type macrophages, and pro-inflammatory cytokines, helper T Immunomodulatory ability was increased, such as a decrease in the level of cells to M1-type macrophages, and inflammation was effectively alleviated in a mouse model of colitis. Accordingly, the present invention can be effectively used as a composition for preventing or treating inflammatory diseases or as a composition for regulating immunity.
  • 1A is a cell surface marker of WJ-MSC and Exos isolation, showing the expression levels of MSC-specific antigens CD29, CD44, CD73, CD105, CD146 and CD34, CD45 by flow cytometry.
  • 1B shows a scheme of ultracentrifugation-based Exos isolation as a cell surface marker and Exos isolation of WJ-MSC.
  • naive or TSG-primed WJ-MSC-derived exosomes (TSG-Exo).
  • B Western blot analysis of CD63 and ⁇ actin in WJ-MSCs and exosomes;
  • C size distribution and concentration of exosomes by qNano;
  • D protein concentration of exosomes by BCA protein analysis; (* p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001).
  • CTL-Exo naive
  • TSG-primed WJ-MSC-derived exosomes TSG-Exo
  • E Relative mRNA expression levels of immune regulatory factors by qRT-PCR
  • F levels of TGF ⁇ IDO and COX2 by Western blot analysis
  • G Relative mRNA expression levels of immunomodulatory factors in Con A-stimulated MNCs co-cultured with CTL-Exo (+CTL-Exo) or TSG-Exo (+TSG-Exo) for 48 h by qRT-PCR
  • H Early apoptosis or Late apoptosis levels of Con A-stimulated MNCs by flow cytometry; (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • FIG. 4 shows the regulation of T cell proliferation on activated peripheral blood mononuclear cells (PBMC) of TSG-primed WJ-MSC-derived exosomes (TSG-Exo).
  • PBMC peripheral blood mononuclear cells
  • TSG-Exo WJ-MSC-derived exosomes
  • TSG-primed WJ-MSC-derived exosomes regulate helper T cell (Th) differentiation and macrophage polarization.
  • D Percentage of CD4+IFN ⁇ +Th1, CD4+IL-17A+Th17 and CD4+CD25+Foxp3+Treg by flow cytometry;
  • E expression levels of M1 macrophage (CD80, CD86) or M2 macrophage (CD206, CD163) surface markers by flow cytometry; indicates
  • FIG. 6 shows TSG-primed WJ-MSC-derived exosomes (TSG-Exo) as regulating helper T cell (Th) differentiation, showing the percentage of Th1, Th17 and Treg cells by flow cytometry.
  • FIG. 8 shows TSG-primed WJ-MSC-derived exosomes (TSG-Exo) regulating macrophage polarization, showing the expression of M1 and M2 macrophage surface markers by flow cytometry.
  • TSG-primed WJ-MSC-derived exosomes ameliorate DSS-induced colitis in mice.
  • A Schematic image of a DSS-induced colitis experiment;
  • B body weight; and
  • C change in disease activity index (DAI) score;
  • n 3 mice per group; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • TSG-primed WJ-MSC-derived exosomes ameliorate DSS-induced colitis in mice.
  • D, E colon length measured after sacrificing mice on day 10;
  • G histological score;
  • H colonic MPO activity;
  • n 3 mice per group; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • TSG-primed WJ-MSC-derived exosomes induce regulatory T cell and M2 macrophage polarization in vivo.
  • A Th1, Th2, Th17 and Treg related cytokines in colon tissue by qRT-PCR;
  • B expression levels of macrophage phenotype-related genes; (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • TSG-primed WJ-MSC-derived exosomes induce polarization of M2 macrophages in the lamina intestinal of the colon in vivo.
  • TSG endoplasmic reticulum stress-inducing substances
  • tunicamycin Tunicamycin
  • BFA Brefeldin A
  • dithiothreitol DTT
  • MG132 MG
  • TSG endoplasmic reticulum stress-inducing substances
  • TSG endoplasmic reticulum stress-inducing substances
  • Tu endoplasmic reticulum stress-inducing substances
  • BFA DTT, MG
  • Wharton's jelly-derived mesenchymal stem cells were isolated and cultured according to Non-Patent Document 3 to further characterize them by surface marker expression profiles.
  • Wharton's jelly tissue was obtained from the umbilical cord after normal full-term delivery with the written consent of the mother and the approval of the Institutional Review Board of Asan Hospital, Seoul (Protocol No. 2015-3030).
  • WJ-MSC was isolated according to Non-Patent Document 1 and mycoplasma test was performed. Cells were cultured at 37° C.
  • WJ-MSC-derived exosomes were isolated from culture supernatants of naive (CTL-Exo) or TSG-primed WJ-MSCs (TSG-Exo) by standard ultracentrifugation ( FIG. 1B ).
  • WJ-MSC cells (3 ⁇ 10 6 ) were stimulated with 1 ⁇ M Thapsigargin (Thapsigargin, TSG; Sigma-Aldrich, St. Louis, MO) for 24 h in 100 mm culture dishes. The medium was then replaced with medium supplemented with 10% Exo-depleted FBS. Exo-depleted FBS was obtained by ultracentrifugation at 100,000 ⁇ g for 18 h.
  • the culture medium was collected and centrifuged at 300 xg for 10 minutes, 2,500 xg for 25 minutes, and 10,000 xg for 1 hour at 4 °C. The supernatant was filtered through a 0.22 ⁇ m filter and ultracentrifuged at 100,000 ⁇ g for 2 h. Thereafter, the Exo pellets were washed by centrifugation in sterile PBS at 100,000 x g for 2 hours, and then suspended in 200 ⁇ l of PBS and stored at -80° C. until use. To inhibit Exo production, cells were treated with culture medium containing 10 ⁇ M GW4869 (Santa cruz Biotechnology, Dallas, TX) for 12 h.
  • the medium was then replaced with medium supplemented with 10% Exo-depleted FBS. After 72 hours, the culture supernatant was ultracentrifuged to isolate Exo and stored at -80 °C until use (concentrated-CM; concentrated-CM). Concentrated-CM derived from GW4869-treated MSC (inhibited Exo secretion) was used as a vehicle control for all mouse experiments. The amount of Exo was determined with a BCA assay kit (Thermo Fisher Scientific, Waltham, MA) for total protein determination. Exo size and number were determined by qNano (Izon Science, Wales, New Zealand) and transmission electron microscopy (TEM; Jeol, Tokyo, Japan) according to the manufacturer's instructions.
  • TSG-Exo had significantly higher expression levels of IL-10, TGF ⁇ COX2 and IDO, but lower expression of pro-inflammatory cytokines including IFN ⁇ , TNF ⁇ and IL-1 ⁇ (Fig. 3E). Consistent with the mRNA expression results, TGF ⁇ COX2 and IDO protein expression levels were significantly increased in TSG-Exo (Fig. 3F).
  • MNCs activated mononuclear cells
  • MNC Mononuclear cells
  • hUCB Mononuclear cells
  • CHSCB National Catholic Hematopoietic Stem Cell Bank
  • MNCs were stimulated with 5 ⁇ g/ml Con A (Concanavalin A) and 96 well plates (1 ⁇ 10 5 ) in growth medium with or without Exos (4 ⁇ g) from naive or TSG-primed WJ-MSCs for 72 h. /well).
  • Annexin V/7AAD (BD Biosciences, Franklin Lakes, NJ) staining was performed to determine cell apoptosis according to the manufacturer's instructions and analyzed by flow cytometry.
  • PBMC peripheral blood-derived mononuclear cells
  • T cell proliferation was quantified by CFSE dilution.
  • the isolated PBMCs were labeled with 2 ⁇ M CFSE (CellTrace CFSE Cell Proliferation Kit, Thermo Fisher Scientific).
  • CFSE-labeled PBMCs (1 ⁇ 10 5 /well) were treated with either naive or TSG primed WJ in the presence of anti-CD3/CD28 microbeads (Gibco) and recombinant human IL-2 (30 U/ml, Peprotech).
  • CFSE dilution analysis showed that addition of TSG-Exo more potently inhibited total T, CD4+ T and CD8+ T cell proliferation than CTL-Exo ( FIGS. 4A, B).
  • TSG-Exo-treated PBMCs the proportion of cells in early division cycle 1 was significantly increased, and the cell ratio in division cycles 4 and 5 was significantly decreased ( FIG. 4C ).
  • T helper cell (Th) differentiation To confirm the effect of TSG-Exo on specific T cell subsets.
  • Th cells were induced by stimulation with lineage-specific cytokines on CD4+ cells purified from human PBMCs in the presence of exosomes.
  • CD4+ T cell isolation from PBMC lymphocytes was performed with a human CD4 T cell isolation kit (Miltenyi Biotec, Marburg, Germany) according to the manufacturer's protocol.
  • CD4+ T cells were stimulated with anti-CD3/CD28 microbeads and IL-2 (20 ng/ml) and specific cytokines were added for differentiation of specific Th cells: IFN ⁇ against Th1 and IL-12 (25 ml).
  • Cytokine-treated CD4+ T cells (5 ⁇ 10 5 /well) were cultured for 5 days by adding naive or TSG-primed WJ-MSC-derived Exos to a 24-well plate. For intracellular staining, cells were stimulated with Cell Stimulation Cocktail (Invitrogen) for 5 hours before staining.
  • Cells were stained with cell surface markers anti-CD3, anti-CD4 and anti-CD25 antibodies, then fixed/permeabilized and stained with fluorescently labeled anti-IFN ⁇ anti-IL-17A and anti-Foxp3 antibodies (BD Biosciences). . Stained cells were analyzed by flow cytometry.
  • TSG-Exo can modulate the phenotype of macrophages in order to confirm the effect of TSG-Exo on specific T cell subsets.
  • GM-CSF (for M1 type)- or M-CSF (for M2 type)-stimulated primary human macrophages were cultured with exosomes in the presence of either M1 type cytokines or M2 type cytokines.
  • CD14+ monocytes were isolated from hUCB-derived MNCs using CD14-bound microbeads (Miltenyi Biotec).
  • monocytes (5 ⁇ 10 5 /well) were mixed with GM-CSF (50 ng/ml; Peprotech) or M-CSF (100 ng/ml) in RPMI 1640 medium containing 10% FBS (Gibco). ) incubated for 6 days.
  • GM-CSF-derived macrophages were stimulated with IFN ⁇ ng/ml) + LPS (1 ⁇ g/ml) with Exo from naive or TSG primed WJ-MSCs for 48 h.
  • M-CSF-derived macrophages were stimulated with IL-4 (20 ng/ml) and IL-13 (20 ng/ml) along with naive or TSG-primed WJ-MSC-derived Exo for 48 h. After co-culture, cells were stained with human monoclonal antibodies fluorescently labeled CD14, CD80, CD86, CD206 and CD163 (BD Biosciences) and analyzed by flow cytometry.
  • the M1-type cell surface markers CD80+ and CD86+ were significantly reduced in M1-type macrophages cultured with TSG-Exo compared to those cultured with CTL-Exo.
  • the expression of the M2-type cell surface markers CD206+ and CD163+ was increased when incubated with exosomes, and this effect was greater in the TSG-Exo-treated group ( FIGS. 5E and 8 ).
  • the present inventors confirmed the potential protective effect of TSG-Exo in a mouse model of colitis induced by 3% DSS ( FIG. 9A ).
  • DSS-induced colitis mouse model 3% (w/v) DSS (Dextran sulfate sodium; MP Biomedicals, Santa Ana, CA) was administered to the drinking water of 7-week-old C57BL/6 mice for 7 days. did Mice were divided into 4 groups of 10 mice per group: (1) control (negative control), (2) DSS (positive control) administered with concentrated-CM extracted from GW4869-treated MSC (solvent control, 200 ⁇ l), (3) ) DSS administered with naive MSC-derived Exo, (4) DSS administered with TSG-primed MSC-derived Exos.
  • control negative control
  • DSS positive control
  • concentrated-CM extracted from GW4869-treated MSC solvent control, 200 ⁇ l
  • DSS administered with naive MSC-derived Exo (4) DSS administered with TSG-primed MSC-derived Exos.
  • mice were intraperitoneally injected with 200 ⁇ g Exo diluted in 200 ⁇ l PBS into mice on days 1, 3 and 5. On day 10, mice were euthanized. Weight loss (0-4), stool consistency (0-4), stool blood (0-4), coat roughness (0-4), rectal prolapse (0-3), crouching (0-3) The severity of colitis was assessed daily using the disease activity index (DAI), which included , bedding contamination (0-2), and not inquisitive/alert (0-2). All animal testing procedures were approved by the Catholic University Animal Research Ethics Committee (IACUC no. 2019-0301-03).
  • DAI disease activity index
  • GW-CM culture supernatant
  • nSMase2 neutral sphingomyelinase supernatant 2 inhibitor that regulates exosome secretion
  • MPO myeloperoxidase
  • GW4869 successfully inhibited exosome release from MSCs.
  • GW-CM-treated colitis mice exhibited markedly elevated disease activity index (DAI) such as persistent weight loss and stool consistency, bloody diarrhea and general activity.
  • DAI disease activity index
  • exosome treatment improved weight loss and DAI, especially in the TSG-Exo treatment group (Fig. 9B, C).
  • the shortening of colon length by DSS administration was significantly improved in TSG-Exo-treated mice compared to CTL-Exo-treated mice (Fig. 10D, E).
  • TSG-Exo treated mice maintained colonic tissue integrity; marked structural disruption, loss of intestinal crypt and reduced infiltration of inflammatory cells; and had lower histological scores compared to CTL-Exo-treated mice (Fig. 10 F, G).
  • MPO myeloperoxidase activity, which indicates neutrophil infiltration, of mice sacrificed on day 10 was significantly reduced in TSG-Exo-treated mice compared to CTL-Exo-treated mice ( FIG. 10H ).
  • IBD inflammatory bowel disease
  • TSG-primed exosomes Through enhanced regulatory T cell and M2-type macrophage polarization The purpose of this study was to confirm the immunomodulatory effect.
  • Lamina propria cells were isolated from the intestine. Colon tissue was cut into small pieces (3 mm ⁇ 3 mm) and incubated in a shaking incubator with HBSS buffer containing 2 mM EDTA (Sigma) at 220 rpm for 30 minutes.
  • the tissue was digested in RPMI containing 5% FBS, 1 mg/ml Collagenase D (Sigma) and 0.1 mg/ml DNase I (Sigma) at 220 rpm in a shaking incubator at 37 °C for 60 min ( digest).
  • the lysed samples were filtered through a 40 ⁇ m cell strainer and then centrifuged at 300 ⁇ g for 5 minutes.
  • the isolated cells were stained with fluorescently labeled antibodies to CD11b, F4/80, CD206 and arginase 1 (arginase 1, BD Biosciences) and analyzed by flow cytometry.
  • Th1 T-bet
  • Th2 GATA3
  • Th17 Th17
  • M1-type markers of CXCL9, MCP1 and iNOS was decreased in CTL-Exo- and TSG-Exo-treated mice compared to GW-CM-treated mice.
  • CXCL9 levels were significantly reduced in TSG-Exo treated mice compared to CTL-Exo treated mice.
  • M2-type marker expression of Arg1 and CD206 was increased in exosome treatment, and this effect was significantly greater in TSG-Exo treatment group ( FIG. 11B ).
  • DSS-induced colitis mice showed a significant increase in the proportion of F4/80+CD11b+ cells (macrophages) in the lamina intestinal of the colon compared with the negative control mice ( FIGS. 12C, D ). Although exosome treatment did not affect the proportion of F4/80+CD11b+ cells (Fig. 12 C, D), the expression levels of CD206 and arginase 1 in colonic macrophages were significantly lower in TSG-primed exosome-treated mice. rose (Fig. 12E). These data suggest that TSG-primed exosomes attenuate mucosal inflammation by inducing regulatory T cells and polarizing M2-type macrophages.
  • TSG thapsigargin
  • tunicamycin Tu
  • Brefeldin A as ER-stress inducers , BFA
  • DTT dithiothreitol
  • MG132 MG
  • ER-stress markers GRP94 and CHOP were significantly increased after treatment with ER-stress-inducing substances in human MSC.
  • MSCs treated with ER-stress inducing substances had significantly higher expression levels of anti-inflammatory cytokines COX2, IDO and IL-10 than untreated MSCs, but the expression of pro-inflammatory cytokines including IL-1 ⁇ , IFN ⁇ and TNF ⁇ was found to be lower.
  • PBMCs and MSCs were co-cultured in the same manner as in Example ⁇ 1-2>.
  • MSCs treated with ER-stress-inducing substances (TSG, Tu, BFA, DTT, MG) exhibited an inhibitory effect on the proliferation of total T, CD4+, and CD8+ T cells compared to untreated MSCs. It could be seen that there was a further increase.
  • MSCs subjected to ER stress by ER-stress-inducing substances exhibit an effective function in enhancing the inhibition of T cell proliferation by increasing the production of anti-inflammatory cytokines.
  • TSG-Exo Mesenchymal stem cell-derived exosomes treated with ER stress-inducing substances according to the present invention increase the levels of anti-inflammatory cytokines, regulatory T cells to M2-type macrophages, and pro-inflammatory cytokines, helper T Immunomodulatory ability was increased, such as a decrease in the cell to M1-type macrophage level, and inflammation was effectively alleviated in a mouse model of colitis. Therefore, the present invention can be effectively used as a composition for preventing or treating inflammatory diseases or as a composition for immune modulation, and thus has industrial applicability.
  • SEQ ID NO: 1 corresponds to the forward primer sequence of hCOX-2.
  • SEQ ID NO: 2 corresponds to the reverse primer sequence of hCOX-2.
  • SEQ ID NO: 3 corresponds to the forward primer sequence of hIDO.
  • SEQ ID NO: 4 corresponds to the reverse primer sequence of hIDO.
  • SEQ ID NO: 5 corresponds to the forward primer sequence of hIFN ⁇ .
  • SEQ ID NO: 6 corresponds to the reverse primer sequence of hIFN ⁇ .
  • SEQ ID NO: 7 corresponds to the forward primer sequence of hIL-10.
  • SEQ ID NO: 8 corresponds to the reverse primer sequence of hIL-10.
  • SEQ ID NO: 9 corresponds to the forward primer sequence of hIL-1 ⁇ .
  • SEQ ID NO: 10 corresponds to the reverse primer sequence of hIL-1 ⁇ .
  • SEQ ID NO: 11 corresponds to the forward primer sequence of hNOS2.
  • SEQ ID NO: 12 corresponds to the reverse primer sequence of hNOS2.
  • SEQ ID NO: 13 corresponds to the forward primer sequence of hTGF ⁇ .
  • SEQ ID NO: 14 corresponds to the reverse primer sequence of hTGF ⁇ .
  • SEQ ID NO: 15 corresponds to the forward primer sequence of hTNF ⁇ .
  • SEQ ID NO: 16 corresponds to the reverse primer sequence of hTNF ⁇ .
  • SEQ ID NO: 17 corresponds to the forward primer sequence of mArg1.
  • SEQ ID NO: 18 corresponds to the reverse primer sequence of mArg1.
  • SEQ ID NO: 19 corresponds to the forward primer sequence of mCD206.
  • SEQ ID NO: 20 corresponds to the reverse primer sequence of mCD206.
  • SEQ ID NO: 21 corresponds to the forward primer sequence of mCXCL9.
  • SEQ ID NO: 22 corresponds to the reverse primer sequence of mCXCL9.
  • SEQ ID NO: 23 corresponds to the forward primer sequence of mFoxp3.
  • SEQ ID NO: 24 corresponds to the reverse primer sequence of mFoxp3.
  • SEQ ID NO: 25 corresponds to the forward primer sequence of mGATA3.
  • SEQ ID NO: 26 corresponds to the reverse primer sequence of mGATA3.
  • SEQ ID NO: 27 corresponds to the forward primer sequence of miNOS.
  • SEQ ID NO: 28 corresponds to the reverse primer sequence of miNOS.
  • SEQ ID NO: 29 corresponds to the forward primer sequence of mMCP1.
  • SEQ ID NO: 30 corresponds to the reverse primer sequence of mMCP1.
  • SEQ ID NO: 31 corresponds to the forward primer sequence of mROR ⁇ .
  • SEQ ID NO: 32 corresponds to the reverse primer sequence of mROR ⁇ .
  • SEQ ID NO: 33 corresponds to the forward primer sequence of mT-bet.
  • SEQ ID NO: 34 corresponds to the reverse primer sequence of mT-bet.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Pain & Pain Management (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to: a pharmaceutical composition for preventing or treating inflammatory diseases, comprising exosomes derived from mesenchymal stem cells in which endoplasmic reticulum stress is induced; and a use thereof. Particularly, immunoregulatory factors of exosomes derived from WJ-MSC, of the present invention, are increased by the treatment of materials inducing endoplasmic reticulum stress, such as thapsigargin. TSG-primed WJ-MSC-derived exosomes have a central role in the in vitro regulation of T cell proliferation and T helper cell differentiation and exhibit effective treatment effects in a colitis murine model. In addition, the administration of TSG-primed WJ-MSC-derived exosomes alleviates inflammatory responses and induces, in vivo, regulatory T cell and M2 macrophage polarization. Therefore, the present invention can be effectively used as a composition for preventing or treating inflammatory diseases.

Description

소포체 스트레스 유발 물질로 처리된 세포 유래 엑소좀 및 이의 용도Cell-derived exosomes treated with endoplasmic reticulum stress-inducing substances and uses thereof
본 출원은 2020년 12월 14일 출원된 대한민국 특허출원 제10-2020-0174576호 를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다. This application claims priority to Korean Patent Application No. 10-2020-0174576 filed on December 14, 2020, and the entire specification is a reference to the present application.
본 발명은 소포체 스트레스를 유도한 중간엽 줄기세포 유래 엑소좀의 치료적 용도에 관한 것이다.The present invention relates to the therapeutic use of mesenchymal stem cell-derived exosomes induced endoplasmic reticulum stress.
중간엽 줄기세포(Mesenchymal stem cells, MSC)는 면역 조절 특성을 가진 것으로 알려져 있는데, 이는 면역 억제, 혈관 조절 및 측분비 인자(paracrine factor) 활동으로 매개된다. 알려진 측분비 분비단백체(secretome)에는 면역 조절 사이토카인, 성장 인자 및 작은 막 소포의 분비가 포함된다. 그러나, 중간엽 줄기세포의 직접적인 사용은 이의 표현형 내지 기능적 안정성을 지속시키는 것 또는 높은 분리 내지 취급 비용 등의 문제점이 존재한다. Mesenchymal stem cells (MSC) are known to have immunomodulatory properties, which are mediated by immunosuppression, vascular regulation and paracrine factor activity. Known paracrine secretomes include the secretion of immune regulatory cytokines, growth factors and small membrane vesicles. However, direct use of mesenchymal stem cells has problems such as maintaining their phenotypic or functional stability or high isolation and handling costs.
중간엽 줄기세포 분비단백체(MSC secretome) 중 엑소좀은 세포 간 통신에서 측분비 인자의 전달을 매개하여 면역 조절에 중요한 역할을 한다. 엑소좀은 세포 외 공간으로 방출되는 30 ~ 150nm 크기의 작은 막 지질 소포인데, 단백질, mRNA, microRNA (miRNA) 또는 기타 구성 요소를 표적 세포로 전달하여 면역 조절 경로의 활성화를 촉진한다. 특히, 중간엽 줄기세포에서 분비하는 엑소좀은 줄기세포가 가지는 재생의학적인 치료 효능을 보인다고 알려져 있다. 엑소좀의 기능과 전달하는 요소는 세포 유형에 따라 다르며 세포 스트레스는 엑소좀이 전달하는 요소에 영향을 미칠 수 있다. Among the mesenchymal stem cell secretome (MSC secretome), exosomes play an important role in immune regulation by mediating the delivery of paracrine factors in cell-to-cell communication. Exosomes are small membrane lipid vesicles with a size of 30 to 150 nm that are released into the extracellular space and promote the activation of immune regulatory pathways by delivering proteins, mRNAs, microRNAs (miRNAs) or other components to target cells. In particular, exosomes secreted from mesenchymal stem cells are known to show regenerative medical treatment efficacy of stem cells. The functions and transduction factors of exosomes depend on the cell type, and cellular stress can affect the factors exosomes transmit.
소포체(Endoplasmic reticulum)은 세포 항상성을 보장하기 위한 신호 전달 경로 조정에 중요한 역할을 하는데, 새로 합성된 단백질은 ER 막을 통해 접힘(folding) 및 전좌(translocation)를 겪는다. 그러나 스트레스가 많은 병리학적 및 생리적 조건에서 ER이 항상성을 유지할 수 없게 된 경우, UPR(Unfolded Protein Response)이 활성화되어 세포 기능에 영향을 미칠 수 있다. 장기적인 ER의 기능 장애 또는 스트레스는 대사성 질환 및 염증 관련 질환을 포함한 많은 질병의 병인에 관여한다. 탑시가르긴(TSG, thapsigargin)은 세포질 칼슘 농도를 높이고 ER 칼슘 저장을 고갈시켜 ER 스트레스를 유발하는 것으로 알려져 있다.The endoplasmic reticulum plays an important role in modulating signal transduction pathways to ensure cellular homeostasis, and newly synthesized proteins undergo folding and translocation through the ER membrane. However, when the ER becomes unable to maintain homeostasis under stressful pathological and physiological conditions, the unfolded protein response (UPR) is activated, which may affect cellular function. Long-term ER dysfunction or stress is implicated in the pathogenesis of many diseases, including metabolic and inflammatory-related diseases. Thapsigargin (TSG, thapsigargin) is known to induce ER stress by increasing cytosolic calcium concentration and depleting ER calcium stores.
대한민국 등록특허 제10-1980453호는 줄기세포 유래 엑소좀 생성 촉진용 조성물에 대한 것으로서, 피오글리타존(pioglitazone), 메트포르민(metformin) 또는 AICAR(5-Aminoimidazole-4-carboxamide ribonucleotide) 을 이용하여 줄기세포 유래 엑소좀의 생산량 내지 엑소좀 내 단백질 및 RNA의 함량을 증가시키는 조성물 내지 방법을 개시하고 있다. 그러나, 탑시가르긴 등 소포체 스트레스 유발 물질이 처리된 줄기세포에서 분비되는 엑소좀에 대한 연구 내지 기재는 개시된 바 없다.Republic of Korea Patent No. 10-1980453 relates to a composition for promoting the generation of stem cell-derived exosomes, and stem cell-derived exo using pioglitazone, metformin, or AICAR (5-Aminoimidazole-4-carboxamide ribonucleotide). Disclosed are compositions and methods for increasing the amount of production or the amount of protein and RNA in the exosome. However, studies or descriptions of exosomes secreted from stem cells treated with endoplasmic reticulum stress-inducing substances such as thapsigargin have not been disclosed.
[선행기술문헌][Prior art literature]
[비특허문헌][Non-patent literature]
(비특허문헌 1) Kim, W., Lee, S. K., Kwon, Y. W., Chung, S. G. & Kim, S. Pioglitazone-Primed Mesenchymal Stem Cells Stimulate Cell Proliferation, Collagen Synthesis and Matrix Gene Expression in Tenocytes. International journal of molecular sciences 20, doi:10.3390/ijms20030472 (2019).(Non-Patent Document 1) Kim, W., Lee, S. K., Kwon, Y. W., Chung, S. G. & Kim, S. Pioglitazone-Primed Mesenchymal Stem Cells Stimulate Cell Proliferation, Collagen Synthesis and Matrix Gene Expression in Tenocytes. International journal of molecular sciences 20, doi:10.3390/ijms20030472 (2019).
(비특허문헌 2) Kim, H. S. et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 145, 1392-1403.e1391-1398, doi:10.1053/j.gastro.2013.08.033 (2013).(Non-Patent Document 2) Kim, H. S. et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 145, 1392-1403.e1391-1398, doi:10.1053/j.gastro.2013.08.033 (2013).
(비특허문헌 3) Kang, J. Y. et al. Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton's Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity. J Clin Med 9, doi:10.3390/jcm9092913 (2020).(Non-Patent Document 3) Kang, J. Y. et al. Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton's Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity. J Clin Med 9, doi:10.3390/jcm9092913 (2020).
본 발명자들은 중간엽 줄기세포를 직접적으로 사용하는 치료의 대안으로서 중간엽 줄기세포의 분비단백체를 제공하고자 예의 노력한 결과, 탑시가르긴 등 소포체 스트레스 유발 물질로 소포체에 스트레스를 유발한 중간엽 줄기세포에서 분비된 엑소좀의 경우 T 세포와 대식세포의 활성화 및 분극화에 관여하는 것을 확인하고 본 발명을 완성하였다. As a result of the present inventors' earnest efforts to provide secretory proteome of mesenchymal stem cells as an alternative to treatment using mesenchymal stem cells directly, mesenchymal stem cells that induced stress in the ER with ER stress-inducing substances such as thapsigargin In the case of secreted exosomes, it was confirmed that they were involved in the activation and polarization of T cells and macrophages, and the present invention was completed.
따라서, 본 발명의 목적은 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 염증성 질환의 예방 또는 치료용 약학적 조성물 및 이것의 용도를 제공하는 것이다.Accordingly, an object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of inflammatory diseases, including mesenchymal stem cell-derived exosomes treated with ER stress-inducing substances, and uses thereof.
본 발명은 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물을 제공한다. The present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
본 발명의 바람직한 일실시예에 따르면, 상기 소포체 스트레스 유발 물질은, 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin), 브레펠딘 A(Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. According to a preferred embodiment of the present invention, the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
본 발명의 바람직한 일실시예에 따르면, 상기 중간엽 줄기세포는 지방 조직, 골수, 제대혈, 양수, 와튼 젤리(Wharton's jelly), 태반, 말초 혈액, 나팔관, 각막 기질, 폐, 근육 및 태아 간 으로 이루어진 군에서 선택되는 어느 하나 이상의 조직에서 수득된 중간엽 줄기세포일 수 있다. According to a preferred embodiment of the present invention, the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group.
본 발명의 바람직한 일실시예에 따르면, 상기 엑소좀의 크기는 10 내지 200 nm 인 것일 수 있다. According to a preferred embodiment of the present invention, the size of the exosome may be 10 to 200 nm.
본 발명의 바람직한 일실시예에 따르면, 상기 염증성 질환은 급성 또는 만성 염증질환, 만성 기관지염, 비염, 관절염, 자가면역질환, 이식거부 및 염증성 장 질환 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. According to a preferred embodiment of the present invention, the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
본 발명은 또한, 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 면역 조절용 조성물을 제공한다. The present invention also provides a composition for regulating immunity comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
본 발명의 바람직한 일실시예에 따르면, 상기 면역 조절은 항-염증 사이토카인(anti-inflammatory cytokine), 조절 T 세포(regulatory T cell) 및 M2 유형 대식세포(M2-type macrophage)의 수준을 증가시키고 전-염증 사이토카인(pro-inflammatory cytokine), 도움 T 세포(helper T cell) 및 M1 유형 대식세포(M1-type macrophage)은 감소시키는 면역 조절인 것일 수 있다. According to a preferred embodiment of the present invention, the immune modulation is anti-inflammatory cytokine (anti-inflammatory cytokine), regulatory T cells (regulatory T cells) and M2-type macrophages (M2-type macrophage) to increase the level and Pro-inflammatory cytokines, helper T cells, and M1-type macrophages may be immune modulators that decrease.
본 발명은 또한, 소포체 스트레스 유발 물질을 중간엽 줄기세포에 처리하는 단계를 포함하는 중간엽 줄기세포 유래 엑소좀의 생산 촉진 방법을 제공한다.The present invention also provides a method for promoting the production of mesenchymal stem cell-derived exosomes comprising the step of treating the endoplasmic reticulum stress-inducing substance to the mesenchymal stem cells.
본 발명은 또한, 염증성 질환 환자에게 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환의 치료 방법을 제공한다.The present invention also provides a method of treating an inflammatory disease comprising administering a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance to an inflammatory disease patient.
본 발명은 또한, 염증성 질환 예방 또는 치료에 사용하기 위한 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물의 용도를 제공한다. The present invention also provides the use of a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance for use in the prevention or treatment of an inflammatory disease.
중간엽 줄기세포(MSC) 유래 엑소좀은 테트라스파닌(tetraspanin; CD81, CD63, CD9), 열충격 단백질 (HSP60, HSP70, HSP90) 및 TSG 101 을 포함한 막 결합 단백질 함량이 낮기 때문에 모 MSC보다 면역원성이 낮으며, MHC 불일치 수용자에서 동종 면역 반응의 활성화로 인한 거부를 일으키지 않는 것으로 알려져 있다. Mesenchymal stem cell (MSC)-derived exosomes are more immunogenic than parental MSCs due to their lower content of membrane-bound proteins, including tetraspanin (CD81, CD63, CD9), heat shock proteins (HSP60, HSP70, HSP90), and TSG 101. is low, and it is not known to cause rejection due to activation of allogeneic immune responses in MHC-mismatched recipients.
이에 본 발명자들은 MSC 유래 엑소좀을 면역 매개 염증성 질환 치료에 적용하기 위하여, 소포체(ER) 스트레스 유도제인 탑시가르긴(TSG, thapsigargin)으로 처리된 인간 Wharton's jelly 유래 MSC(WJ-MSC)에서 분비되는 엑소좀(TSG-Exo)의 향상된 면역 조절 특성을 확인했다. Therefore, in order to apply the MSC-derived exosomes to the treatment of immune-mediated inflammatory diseases, the present inventors found that secreted from human Wharton's jelly-derived MSC (WJ-MSC) treated with endoplasmic reticulum (ER) stress inducer thapsigargin (TSG, thapsigargin) The improved immunomodulatory properties of exosomes (TSG-Exo) were confirmed.
TSG로 WJ-MSC를 자극하면 엑소좀 분비가 증가하며, IL-10, COX2 또는 IDO(Indoleamine 2,3-dioxygenase)와 같은 면역 조절 내지 항염증 인자의 수율 및 발현이 증가하고, 전 염증 인자(IFNγ, TNFα 또는 IL-1β의 발현 수준이 감소하거나 유사하게 유지되었다. 상기와 같은 결과는 TSG-Exo 에서도 유사하게 확인되었으며, 이는 TSG 유도 엑소좀 방출이 염증 또는 노화 관련 분비 메커니즘(SASP)과 다른 분비 메커니즘을 가짐을 시사하였다. Stimulation of WJ-MSCs with TSG increases exosome secretion, increases the yield and expression of immunomodulatory or anti-inflammatory factors such as IL-10, COX2, or IDO (Indoleamine 2,3-dioxygenase), and increases pro-inflammatory factors ( The expression level of IFNγ, TNFα or IL-1β decreased or remained similar.The same results were also confirmed in TSG-Exo, indicating that TSG-induced exosome release is different from inflammation or senescence-associated secretion mechanism (SASP). It was suggested to have a secretory mechanism.
또한, TSG-Exo는 인간 MSC 유래임에도 불구하고 마우스 대장염 모델에 투여되었을 때 뚜렷한 면역거부 반응이 관찰되지 않았으며, 이는 TSG-Exo가 이종 시스템에서도 숙주에 의해 면역 내성이 있어 향후 임상적용에 유리함을 의미하였다. TSG-Exo는 마우스 대장염 모델에서 염증 반응을 줄이고 장 장애물 무결성(intestinal barrier integrity)을 유지함으로써 대장염을 실질적으로 완화시켰다. TSG-Exo로 처리된 마우스의 대장균 결장에서 Tregs 및 M2 형 대식세포의 유의한 증가는 TSG-Exo의 항염증 효과를 시사한다. 또한, Con A 자극 MNC(단핵세포)와 함께 처리할 때 엑소좀의 항 염증 인자가 MNC에 효율적으로 전달되었기 때문에, 엑소좀 및 엑소좀 처리된 MNC 에 유사한 발현이 발생했다. TSG-Exo는 대조군 엑소좀보다 우수한 T 세포/대식세포 분극화 조절을 나타냈기 때문에, 엑소좀의 분비단백체(secretome)는 엑소좀의 치료 효과 예측에 대한 신뢰할 수 있는 지표가 될 수 있다.In addition, although TSG-Exo is derived from human MSC, a distinct immune rejection response was not observed when administered to a mouse colitis model. meant TSG-Exo substantially alleviated colitis by reducing the inflammatory response and maintaining intestinal barrier integrity in a mouse model of colitis. A significant increase in Tregs and M2-type macrophages in the E. coli colon of mice treated with TSG-Exo suggests an anti-inflammatory effect of TSG-Exo. In addition, similar expression occurred in exosomes and exosome-treated MNCs because anti-inflammatory factors of exosomes were efficiently delivered to MNCs when treated with Con A-stimulated MNCs (monocytes). Since TSG-Exo showed superior T cell/macrophage polarization regulation than control exosomes, the secretome of exosomes can be a reliable indicator for predicting the therapeutic effect of exosomes.
TSG-Exo는 인간 말초 혈액 유래 T 세포 증식과 Th1 및 Th17 분화 억제 효과가 현저하게 향상된 반면, 조절 T 세포 및 M2 유형 대식세포는 대조군 엑소좀 처리군에 비해 풍부했다. 이는 장의 Tregs와 대식세포가 MSC 엑소좀의 항 염증 효과에 대한 매개체가 될 수 있음을 시사한다. Tregs 및 M2 유형 대식세포의 상향 조절은 질병 활동 점수, 조직학적 점수 및 호중구 활동 감소에 의해 제안된대로 장 항상성을 유지했다.TSG-Exo significantly enhanced the effects of human peripheral blood-derived T cell proliferation and inhibition of Th1 and Th17 differentiation, whereas regulatory T cells and M2-type macrophages were abundant compared to the control exosome-treated group. This suggests that intestinal Tregs and macrophages may be mediators for the anti-inflammatory effects of MSC exosomes. Upregulation of Tregs and M2-type macrophages maintained intestinal homeostasis as suggested by disease activity scores, histological scores, and decreased neutrophil activity.
이러한 데이터는 TSG 처리가 WJ-MSC의 엑소좀 방출을 유도하기에 충분하며, TSG-Exo의 면역 조절 특성을 촉진했음을 의미하므로, TSG 처리 MSC 또는 TSG-Exo가 대장염 치료를 위한 새로운 치료방법을 제공할 수 있음을 나타낸다.These data suggest that TSG treatment was sufficient to induce exosome release of WJ-MSCs and promoted the immunomodulatory properties of TSG-Exo, so TSG-treated MSCs or TSG-Exo provide a novel therapeutic method for the treatment of colitis. indicates that you can
따라서, 본 발명은 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물을 제공할 수 있다. Therefore, the present invention can provide a pharmaceutical composition for preventing or treating inflammatory diseases comprising the mesenchymal stem cell-derived exosomes treated with endoplasmic reticulum stress-inducing substances.
본 발명의 바람직한 일실시예에 따르면, 상기 소포체 스트레스 유발 물질은, 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin), 브레펠딘 A(Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. According to a preferred embodiment of the present invention, the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
본 발명의 바람직한 일실시예에 따르면, 상기 중간엽 줄기세포는 지방 조직, 골수, 제대혈, 양수, 와튼 젤리(Wharton's jelly), 태반, 말초 혈액, 나팔관, 각막 기질, 폐, 근육 및 태아 간 으로 이루어진 군에서 선택되는 어느 하나 이상의 조직에서 수득된 중간엽 줄기세포일 수 있다. 바람직하게는 상기 중간엽 줄기세포는 와튼 젤리에서 수득된 중간엽 줄기세포일 수 있다. According to a preferred embodiment of the present invention, the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
본 발명의 바람직한 일실시예에 따르면, 상기 엑소좀의 크기는 10 내지 200 nm 인 것일 수 있다. 바람직하게는 상기 엑소좀의 크기는 30 내지 150 nm 인 것일 수 있으며, 보다 바람직하게는 50 내지 120 nm 인 것일 수 있다. According to a preferred embodiment of the present invention, the size of the exosome may be 10 to 200 nm. Preferably, the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
본 발명의 바람직한 일실시예에 따르면, 상기 염증성 질환은 급성 또는 만성 염증질환, 만성 기관지염, 비염, 관절염, 자가면역질환, 이식거부 및 염증성 장 질환 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. 바람직하게는 상기 염증성 질환은 염증성 장 질환일 수 있으며, 상기 염증성 장질환은 궤양성 대장염, 크론병 또는 베체트병 일 수 있다. According to a preferred embodiment of the present invention, the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease. Preferably, the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
본 발명은 또한, 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 면역 조절용 조성물을 제공한다. The present invention also provides a composition for regulating immunity comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance.
본 발명의 바람직한 일실시예에 따르면, 상기 면역 조절은 항-염증 사이토카인(anti-inflammatory cytokine), 조절 T 세포(regulatory T cell) 및 M2 유형 대식세포(M2-type macrophage)의 수준을 증가시키고 전-염증 사이토카인(pro-inflammatory cytokine), 도움 T 세포(helper T cell) 및 M1 유형 대식세포(M1-type macrophage)은 감소시키는 면역 조절인 것일 수 있다. According to a preferred embodiment of the present invention, the immune modulation is anti-inflammatory cytokine (anti-inflammatory cytokine), regulatory T cells (regulatory T cells) and M2-type macrophages (M2-type macrophage) to increase the level and Pro-inflammatory cytokines, helper T cells, and M1-type macrophages may be immune modulators that decrease.
본 발명은 또한, 소포체 스트레스 유발 물질을 중간엽 줄기세포에 처리하는 단계를 포함하는 중간엽 줄기세포 유래 엑소좀의 생산 촉진 방법을 제공할 수 있다.The present invention can also provide a method for promoting the production of mesenchymal stem cell-derived exosomes comprising the step of treating the endoplasmic reticulum stress-inducing substance to the mesenchymal stem cells.
상기 생산 촉진은, 엑소좀의 수 내지 엑소좀의 단백질 내지 mRNA 생산 촉진을 의미할 수 있다. The promotion of production may mean promoting the number of exosomes or protein or mRNA production of the exosomes.
본 발명은 또한, 염증성 질환 환자에게 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환의 치료 방법을 제공할 수 있다.The present invention may also provide a method for treating an inflammatory disease comprising administering a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance to an inflammatory disease patient.
본 발명의 바람직한 일실시예에 따르면, 상기 소포체 스트레스 유발 물질은, 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin), 브레펠딘 A(Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. According to a preferred embodiment of the present invention, the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
본 발명의 바람직한 일실시예에 따르면, 상기 중간엽 줄기세포는 지방 조직, 골수, 제대혈, 양수, 와튼 젤리(Wharton's jelly), 태반, 말초 혈액, 나팔관, 각막 기질, 폐, 근육 및 태아 간 으로 이루어진 군에서 선택되는 어느 하나 이상의 조직에서 수득된 중간엽 줄기세포일 수 있다. 바람직하게는 상기 중간엽 줄기세포는 와튼 젤리에서 수득된 중간엽 줄기세포일 수 있다. According to a preferred embodiment of the present invention, the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
본 발명의 바람직한 일실시예에 따르면, 상기 엑소좀의 크기는 10 내지 200 nm 인 것일 수 있다. 바람직하게는 상기 엑소좀의 크기는 30 내지 150 nm 인 것일 수 있으며, 보다 바람직하게는 50 내지 120 nm 인 것일 수 있다. According to a preferred embodiment of the present invention, the size of the exosome may be 10 to 200 nm. Preferably, the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
본 발명의 바람직한 일실시예에 따르면, 상기 염증성 질환은 급성 또는 만성 염증질환, 만성 기관지염, 비염, 관절염, 자가면역질환, 이식거부 및 염증성 장 질환 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. 바람직하게는 상기 염증성 질환은 염증성 장 질환일 수 있으며, 상기 염증성 장질환은 궤양성 대장염, 크론병 또는 베체트병 일 수 있다. According to a preferred embodiment of the present invention, the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease. Preferably, the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
본 발명은 또한, 염증성 질환 예방 또는 치료에 사용하기 위한 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물의 용도를 제공할 수 있다. The present invention may also provide the use of a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance for use in the prevention or treatment of inflammatory diseases.
본 발명의 바람직한 일실시예에 따르면, 상기 소포체 스트레스 유발 물질은, 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin), 브레펠딘 A(Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. According to a preferred embodiment of the present invention, the endoplasmic reticulum stress-inducing substance is thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) And it may be any one or more selected from the group consisting of MG132.
본 발명의 바람직한 일실시예에 따르면, 상기 중간엽 줄기세포는 지방 조직, 골수, 제대혈, 양수, 와튼 젤리(Wharton's jelly), 태반, 말초 혈액, 나팔관, 각막 기질, 폐, 근육 및 태아 간 으로 이루어진 군에서 선택되는 어느 하나 이상의 조직에서 수득된 중간엽 줄기세포일 수 있다. 바람직하게는 상기 중간엽 줄기세포는 와튼 젤리에서 수득된 중간엽 줄기세포일 수 있다. According to a preferred embodiment of the present invention, the mesenchymal stem cells are composed of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. It may be mesenchymal stem cells obtained from any one or more tissues selected from the group. Preferably, the mesenchymal stem cells may be mesenchymal stem cells obtained from Wharton's jelly.
본 발명의 바람직한 일실시예에 따르면, 상기 엑소좀의 크기는 10 내지 200 nm 인 것일 수 있다. 바람직하게는 상기 엑소좀의 크기는 30 내지 150 nm 인 것일 수 있으며, 보다 바람직하게는 50 내지 120 nm 인 것일 수 있다. According to a preferred embodiment of the present invention, the size of the exosome may be 10 to 200 nm. Preferably, the size of the exosome may be 30 to 150 nm, more preferably 50 to 120 nm.
본 발명의 바람직한 일실시예에 따르면, 상기 염증성 질환은 급성 또는 만성 염증질환, 만성 기관지염, 비염, 관절염, 자가면역질환, 이식거부 및 염증성 장 질환 으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다. 바람직하게는 상기 염증성 질환은 염증성 장 질환일 수 있으며, 상기 염증성 장질환은 궤양성 대장염, 크론병 또는 베체트병 일 수 있다. According to a preferred embodiment of the present invention, the inflammatory disease may be any one or more selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease. Preferably, the inflammatory disease may be an inflammatory bowel disease, and the inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's disease.
이하, 본원 명세서에 사용된 용어에 대한 정의는 다음과 같다.Hereinafter, definitions of terms used in this specification are as follows.
본 발명의 '예방' 이란, 염증성 질환이 억제되거나 그 발병이 지연되도록 하는 모든 행위를 의미한다. In the present invention, 'prevention' means any action that suppresses or delays the onset of an inflammatory disease.
본 발명의 '개선' 또는 '치료'란, 본 발명의 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀으로 인해 염증성 질환과 관련된 파라미터, 예를 들면 증상의 정도가 호전되거나 이롭게 되도록 하는 모든 행위를 의미한다.'Improvement' or 'treatment' of the present invention refers to all parameters related to inflammatory disease, for example, the degree of symptom improvement or benefit due to the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance of the present invention. means action.
본 발명의 약학적 조성물은 비경구의 여러 가지 제형일 수 있다. 상기 조성물을 제형화할 경우에는 하나 이상의 완충제(예를 들어, 식염수 또는 PBS), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 충진제, 증량제, 결합제, 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제 습윤제, 붕해제 또는 계면활성제, 희석제 또는 부형제를 사용하여 조제될 수 있다. The pharmaceutical composition of the present invention may be in various parenteral formulations. When formulating the composition, one or more buffers (eg, saline or PBS), antioxidants, bacteriostatic agents, chelating agents (eg, EDTA or glutathione), fillers, bulking agents, binders, adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제, 동결건조제제 또는 좌제 등이 포함된다. 비수성용제 및 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, or suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, and the like can be used.
본 발명의 조성물은 비경구로 투여될 수 있으며, 비경구 투여시 복강내, 직장, 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사하는 주사제 의 형태로 당업계에 공지된 방법에 따라 제형화할 수 있다.The composition of the present invention can be administered parenterally, and when administered parenterally, it can be formulated according to a method known in the art in the form of an injection for intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection. can
상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다. 주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질일 수 있다. 보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS (phosphate buffered saline) 또는 주사용 멸균수, 10% 에탄올, 40% 프로필렌 글리콜 및 5% 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다. 상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다. 또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.In the case of the injection, it must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. For injection, examples of suitable carriers include, but are not limited to, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof, and/or a solvent or dispersion medium containing vegetable oil. can More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS (phosphate buffered saline) with triethanolamine or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose. etc. can be used. In order to protect the injection from microbial contamination, it may further include various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In addition, in most cases, the injection may further contain an isotonic agent such as sugar or sodium chloride.
본 발명의 조성물은 약제학적으로 유효한 양으로 투여한다. 약제학적으로 유효한 양은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 즉, 본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.The composition of the present invention is administered in a pharmaceutically effective amount. A pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the patient's disease type, severity, drug activity, drug sensitivity, and administration time. , administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. That is, the total effective amount of the composition of the present invention may be administered to a patient as a single dose, and may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time. . In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art.
본 발명의 약학적 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도에 따라 그 범위가 다양하다. 일일 투여량으로는, 비경구 투여 시 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 기준으로 하루에 체중 1 kg당 바람직하게 0.01 내지 50 mg, 더 바람직하게는 0.1 내지 30 mg의 양으로 투여되도록, 그리고 경구 투여 시는 본 발명의 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 기준으로 하루에 체중 1 kg당 바람직하게 0.01 내지 100 mg, 더 바람직하게는 0.01 내지 10 mg의 양으로 투여되도록 1 내지 수회에 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.The dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease. As a daily dose, based on the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance when administered parenterally, preferably 0.01 to 50 mg, more preferably 0.1 to 30 mg per 1 kg of body weight per day. To be administered as, and when administered orally, preferably 0.01 to 100 mg, more preferably 0.01 to 10 mg per 1 kg of body weight per day, based on the mesenchymal stem cell-derived exosomes treated with the endoplasmic reticulum stress-inducing substance of the present invention. It can be administered in 1 to several divided doses to be administered in an amount of However, since it may increase or decrease depending on the route of administration, the severity of obesity, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any way.
본 발명의 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
본 발명에 따라 소포체 스트레스 유발 물질을 처리한 중간엽 줄기세포 유래 엑소좀(TSG-Exo)은 항 염증 사이토카인, 조절 T 세포 내지 M2 유형 대식세포의 수준이 증가되고, 전 염증 사이토카인, 도움 T 세포 내지 M1 유형 대식세포 수준이 감소되는 등 면역 조절 능력이 증가되며, 대장염 마우스 모델에서 효과적으로 염증을 완화시켰다. 따라서, 본 발명은 염증성 질환 예방 또는 치료용 조성물 내지 면역 조절용 조성물로서 효과적으로 사용될 수 있다.Mesenchymal stem cell-derived exosomes (TSG-Exo) treated with ER stress-inducing substances according to the present invention increase the levels of anti-inflammatory cytokines, regulatory T cells to M2-type macrophages, and pro-inflammatory cytokines, helper T Immunomodulatory ability was increased, such as a decrease in the level of cells to M1-type macrophages, and inflammation was effectively alleviated in a mouse model of colitis. Accordingly, the present invention can be effectively used as a composition for preventing or treating inflammatory diseases or as a composition for regulating immunity.
도 1a는 WJ-MSC의 세포 표면 마커 및 엑소좀(Exos) 분리로서, 유세포 분석에 의한 MSC 특이적 항원 CD29, CD44, CD73, CD105, CD146 및 CD34, CD45의 발현 수준을 나타낸다.1A is a cell surface marker of WJ-MSC and Exos isolation, showing the expression levels of MSC-specific antigens CD29, CD44, CD73, CD105, CD146 and CD34, CD45 by flow cytometry.
도 1b는 WJ-MSC의 세포 표면 마커 및 엑소좀(Exos) 분리로서, 초원심분리 기반 Exos 분리의 계획을 나타낸다.1B shows a scheme of ultracentrifugation-based Exos isolation as a cell surface marker and Exos isolation of WJ-MSC.
도 2는 나이브(naive; CTL-Exo) 또는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)의 특징을 나타낸다. (A) 엑소좀의 투과 전자 현미경 (TEM) 이미지(스케일 바=100nm); (B) WJ-MSC 및 엑소좀에서 CD63 및 β액틴의 웨스턴 블롯 분석; (C) qNano에 의한 엑소좀의 크기 분포 및 농도; (D) BCA 단백질 분석에 의한 엑소좀의 단백질 농도; 를 나타낸다(* p<0.05, ** p<0.01, *** p< 0.001).2 shows the characteristics of naive (CTL-Exo) or TSG-primed WJ-MSC-derived exosomes (TSG-Exo). (A) Transmission electron microscopy (TEM) image of exosomes (scale bar=100 nm); (B) Western blot analysis of CD63 and β actin in WJ-MSCs and exosomes; (C) size distribution and concentration of exosomes by qNano; (D) protein concentration of exosomes by BCA protein analysis; (* p <0.05, ** p < 0.01, *** p < 0.001).
도 3은 나이브(naive; CTL-Exo) 또는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)의 면역 조절 인자를 나타낸다. (E) qRT-PCR에 의한 면역 조절 인자의 상대적 mRNA 발현수준; (F) 웨스턴 블롯 분석에 의한 TGFβIDO 및 COX2 의 수준; (G) qRT-PCR에 의한 CTL-Exo(+CTL-Exo) 또는 TSG-Exo(+TSG-Exo)와 함께 48 시간 동안 공동 배양한 Con A-자극 MNC의 면역 조절 인자의 상대적 mRNA 발현수준; (H) 유세포 분석에 의한 Con A-자극 MNC의 초기 세포 사멸(Early apoptosis) 또는 후기 세포 사멸(Late apoptosis) 수준; 을 나타낸다(* p<0.05, ** p<0.01, *** p<0.001).3 shows immune modulators of naive (CTL-Exo) or TSG-primed WJ-MSC-derived exosomes (TSG-Exo). (E) Relative mRNA expression levels of immune regulatory factors by qRT-PCR; (F) levels of TGFβIDO and COX2 by Western blot analysis; (G) Relative mRNA expression levels of immunomodulatory factors in Con A-stimulated MNCs co-cultured with CTL-Exo (+CTL-Exo) or TSG-Exo (+TSG-Exo) for 48 h by qRT-PCR; (H) Early apoptosis or Late apoptosis levels of Con A-stimulated MNCs by flow cytometry; (*p<0.05, **p<0.01, ***p<0.001).
도 4는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)의 활성화된 말초혈액단핵세포(PBMC)에 대한 T 세포 증식 조절을 나타낸다. (A) 총 T 세포 증식의 대표적인 히스토그램; (B) 총 T, CD4+ T 및 CD8+ T 세포의 증식률에 대한 정량 분석; (C) CFSE 표지 세포의 형광 프로파일에 의한 5 개의 개별 PBMC 부분에서의 세포 분열; 을 나타낸다.Figure 4 shows the regulation of T cell proliferation on activated peripheral blood mononuclear cells (PBMC) of TSG-primed WJ-MSC-derived exosomes (TSG-Exo). (A) Representative histogram of total T cell proliferation; (B) Quantitative analysis of proliferation rates of total T, CD4+ T and CD8+ T cells; (C) Cell division in five individual PBMC sections by fluorescence profiles of CFSE-labeled cells; indicates
도 5는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)이 도움 T 세포(Th) 분화 및 대식세포 분극화를 조절하는 것을 나타낸다. (D) 유세포 분석법에 의한 CD4+IFNγ+Th1, CD4+IL-17A+Th17 및 CD4+CD25+Foxp3+Treg 의 백분율; (E) 유세포 분석에 의한 M1 대식세포(CD80, CD86) 또는 M2 대식세포(CD206, CD163) 표면 마커의 발현 수준; 을 나타낸다.5 shows that TSG-primed WJ-MSC-derived exosomes (TSG-Exo) regulate helper T cell (Th) differentiation and macrophage polarization. (D) Percentage of CD4+IFNγ+Th1, CD4+IL-17A+Th17 and CD4+CD25+Foxp3+Treg by flow cytometry; (E) expression levels of M1 macrophage (CD80, CD86) or M2 macrophage (CD206, CD163) surface markers by flow cytometry; indicates
도 6은 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)가 도움 T 세포(Th) 분화를 조절하는 것으로서, 유세포 분석에 의한 Th1, Th17 및 Treg 세포의 백분율을 나타낸다.Figure 6 shows TSG-primed WJ-MSC-derived exosomes (TSG-Exo) as regulating helper T cell (Th) differentiation, showing the percentage of Th1, Th17 and Treg cells by flow cytometry.
도 7은 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)가 대식세포 분극화를 조절하는 것으로서, M0, M1 및 M2의 대표 이미지(스케일 바=100 μm)를 나타낸다.7 shows representative images of M0, M1 and M2 (scale bar=100 μm) as TSG-primed WJ-MSC-derived exosomes (TSG-Exo) regulate macrophage polarization.
도 8는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)가 대식세포 분극화를 조절하는 것으로서, 유세포 분석에 의한 M1 및 M2 대식세포 표면 마커의 발현을 나타낸다.FIG. 8 shows TSG-primed WJ-MSC-derived exosomes (TSG-Exo) regulating macrophage polarization, showing the expression of M1 and M2 macrophage surface markers by flow cytometry.
도 9는 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)이 마우스에서 DSS로 유도된 대장염을 개선하는 것을 나타낸다. (A) DSS 유도 대장염 실험의 개략 이미지; (B) 체중; 및 (C) 질병 활동 지수(DAI) 점수의 변화; 를 나타낸다(그룹당 n = 3 마우스; * p<0.05, ** p<0.01, *** p<0.001).9 shows that TSG-primed WJ-MSC-derived exosomes (TSG-Exo) ameliorate DSS-induced colitis in mice. (A) Schematic image of a DSS-induced colitis experiment; (B) body weight; and (C) change in disease activity index (DAI) score; (n = 3 mice per group; *p<0.05, **p<0.01, ***p<0.001).
도 10은 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)이 마우스에서 DSS로 유도된 대장염을 개선하는 것을 나타낸다. (D, E) 10 일째에 마우스를 희생시키고 측정한 결장 길이; (F) 결장 섹션의 H & E 염색(스케일 바=100㎛); (G) 조직학적 점수; (H) 결장 MPO 활성; 을 나타낸다(그룹당 n = 3 마우스; * p<0.05, ** p<0.01, *** p<0.001).10 shows that TSG-primed WJ-MSC-derived exosomes (TSG-Exo) ameliorate DSS-induced colitis in mice. (D, E) colon length measured after sacrificing mice on day 10; (F) H & E staining of colon sections (scale bar=100 μm); (G) histological score; (H) colonic MPO activity; (n = 3 mice per group; *p<0.05, **p<0.01, ***p<0.001).
도 11은 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)이 생체 내에서 조절 T 세포와 M2 대식세포 분극화를 유도하는 것을 나타낸다. (A) qRT-PCR로에 의한 결장 조직에서 Th1, Th2, Th17 및 Treg 관련 사이토카인; (B) 대식세포 표현형 관련 유전자의 발현 수준; 을 나타낸다(* p<0.05, ** p<0.01, *** p<0.001). 11 shows that TSG-primed WJ-MSC-derived exosomes (TSG-Exo) induce regulatory T cell and M2 macrophage polarization in vivo. (A) Th1, Th2, Th17 and Treg related cytokines in colon tissue by qRT-PCR; (B) expression levels of macrophage phenotype-related genes; (*p<0.05, **p<0.01, ***p<0.001).
도 12은 TSG 프라이밍된 WJ-MSC 유래 엑소좀(TSG-Exo)이 생체 내에서 결장의 고유판내 M2 대식세포 분극화를 유도하는 것을 나타낸다. 유세포 분석으로 분석(C) 및 (D) 정량화한 3 % DSS-대장염 마우스 결장의 고유판 세포에서 F4/80+CD11b+ 대식세포의 백분율; (E) 유세포 분석법으로 분석 및 정량화한 F4/80+CD11b+ 대식세포에서 CD206 및 아르기나제 1의 발현; 을 대조군으로 표준화된 상대 평균 형광 강도(RelMFI)로 나타낸다(* p<0.05, ** p<0.01, *** p<0.001).12 shows that TSG-primed WJ-MSC-derived exosomes (TSG-Exo) induce polarization of M2 macrophages in the lamina propria of the colon in vivo. Percentage of F4/80+CD11b+ macrophages in lamina propria cells of 3% DSS-colitis mouse colon as analyzed (C) and (D) quantified by flow cytometry; (E) expression of CD206 and arginase 1 in F4/80+CD11b+ macrophages analyzed and quantified by flow cytometry; are expressed as relative mean fluorescence intensity (RelMFI) normalized to control (* p<0.05, ** p<0.01, *** p<0.001).
도 13은 인간 WJ-MSC 에 처리된 소포체 스트레스 유발 물질 종류(탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tu, Tunicamycin), 브레펠딘 A(BFA, Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132(MG))에 따른 소포체 스트레스 마커, 전염증성 및 항염증성 사이토카인의 분비 패턴을 나타낸다. 소포체 스트레스 유발 물질 처리에 따라 소포체 스트레스 마커(GRP94) 및 항염증성 사이토카인(COX2, IDO, IL-10)의 발현 수준은 증가하였으나, 전염증성 사이토카인(IL-1βIFNγ, TNFα)의 발현수준은 감소하는 것을 확인할 수 있었다. 13 shows the types of endoplasmic reticulum stress-inducing substances (thapsigargin (TSG, thapsigargin), tunicamycin (Tu, Tunicamycin), brefeldin A (BFA, Brefeldin A), dithiothreitol (DTT)) treated in human WJ-MSC. , dithiothreitol) and MG132 (MG)), and the secretion patterns of ER stress markers, pro-inflammatory and anti-inflammatory cytokines. The expression level of ER stress marker (GRP94) and anti-inflammatory cytokines (COX2, IDO, IL-10) increased according to the ER stress-inducing substance treatment, but the expression level of pro-inflammatory cytokines (IL-1βIFNγ, TNFα) decreased could confirm that
도 14는 소포체 스트레스 유발 물질(TSG, Tu, BFA, DTT, MG)이 처리된 인간 WJ-MSC 의 면역 조절 효과로서 T 세포 증식 억제를 확인한 결과를 나타낸다. 소포체 스트레스 유발 물질이 처리된 MSC는 처리하지 않은 MSC에 비해 총 T, CD4+, CD8+ T 세포 증식 억제 효과가 더 증가하는 것을 확인할 수 있었다.14 shows the results of confirming the inhibition of T cell proliferation as an immunomodulatory effect of human WJ-MSC treated with endoplasmic reticulum stress-inducing substances (TSG, Tu, BFA, DTT, MG). It was confirmed that the MSC treated with the endoplasmic reticulum stress-inducing substance had an increased inhibitory effect on total T, CD4+, and CD8+ T cell proliferation compared to the untreated MSC.
도 15는 소포체 스트레스 유발 물질(TSG, Tu, BFA, DTT, MG)이 처리된 인간 WJ-MSC 에서 분비된 엑소좀의 면역 조절 효과로서 T 세포 증식 억제를 확인한 결과를 나타낸다. 소포체 스트레스 유발 물질 중 TSG, Tu 또는 BFA 이 처리된 MSC는 처리하지 않은 MSC에 비해 총 T, CD4+, CD8+ T 세포 증식 억제 효과가 더 증가하는 것을 확인할 수 있었다.15 shows the results of confirming the inhibition of T cell proliferation as an immunomodulatory effect of exosomes secreted from human WJ-MSC treated with endoplasmic reticulum stress-inducing substances (TSG, Tu, BFA, DTT, MG). Among the endoplasmic reticulum stress-inducing substances, MSCs treated with TSG, Tu, or BFA had an increased inhibitory effect on total T, CD4+, and CD8+ T cell proliferation compared to non-treated MSCs.
[실시예 1] [Example 1]
TSG 프라이밍된 WJ-MSC 유래 엑소좀 특징 확인Characterization of TSG-primed WJ-MSC-derived exosomes
<1-1> WJ-MSC 준비 및 배양<1-1> WJ-MSC preparation and culture
Wharton's jelly 유래 중간엽 줄기세포(WJ-MSCs) 를 비특허문헌 3 에 따라 분리 및 배양하여 표면 마커 발현 프로파일에 의해 추가로 특성화하고자 하였다. Wharton's jelly-derived mesenchymal stem cells (WJ-MSCs) were isolated and cultured according to Non-Patent Document 3 to further characterize them by surface marker expression profiles.
구체적으로, 산모의 서면 동의와 서울 아산 병원 기관 검토 이사회(프로토콜 번호 2015-3030) 승인을 받아 정상적인 만삭 분만 후 탯줄에서 Wharton's jelly 조직을 수득했다. WJ-MSC는 비특허문헌 1에 따라 분리되었고 마이코플라스마 테스트를 수행하였다. 세포를 37 ℃ 및 5 % CO2 에서 10 % FBS (Tissue Culture Biologicals, Tulare, CA), 1 % Glutamax (Gibco), 25 ng/㎖ EGF (Biolegend NS, Inc., San Diego, CA), 50 ng/㎖ bFGF (Peprotech, Rocky Hill, NJ) 및 1 % 항생제/항균제 (Gibco)와 함께 DMEM (Gibco BRL, Grand Island, NY)으로 배양했다. 80 ~ 90 % confluence에 도달하면 세포를 0.05 % Trypsin-EDTA (Gibco)로 분리하여 추가 계대 배양하였다.Specifically, Wharton's jelly tissue was obtained from the umbilical cord after normal full-term delivery with the written consent of the mother and the approval of the Institutional Review Board of Asan Hospital, Seoul (Protocol No. 2015-3030). WJ-MSC was isolated according to Non-Patent Document 1 and mycoplasma test was performed. Cells were cultured at 37° C. and 5% CO 2 in 10% FBS (Tissue Culture Biologicals, Tulare, CA), 1% Glutamax (Gibco), 25 ng/ ml EGF (Biolegend NS, Inc., San Diego, CA), 50 ng Incubated in DMEM (Gibco BRL, Grand Island, NY) with /ml bFGF (Peprotech, Rocky Hill, NJ) and 1% antibiotic/antibacterial (Gibco). When 80 ~ 90% confluence was reached, cells were separated with 0.05% Trypsin-EDTA (Gibco) and further subcultured.
유세포 분석 결과, WJ-MSC가 MSC 특이적 세포 표면 마커 CD29, CD44, CD73, CD105 및 CD146을 양성으로 발현하고 조혈 줄기세포 특이적 마커 CD34 및 CD45 를 음성으로 발현한다는 것을 입증했다 (도 1a).Flow cytometry analysis demonstrated that WJ-MSCs positively expressed MSC-specific cell surface markers CD29, CD44, CD73, CD105 and CD146 and negatively expressed hematopoietic stem cell-specific markers CD34 and CD45 (Fig. 1a).
<1-2> WJ-MSC 유래 엑소좀 분리 및 특성화<1-2> WJ-MSC-derived exosome isolation and characterization
엑소좀 특이적 마커와 함께, 전염증성 및 항염증성 사이토카인 분비 패턴이 MSC 또는 MSC 유래 엑소좀의 면역 조절 특성을 결정함에 따라 염증 유전자의 발현을 확인하고자 하였다.Along with exosome-specific markers, we tried to confirm the expression of inflammatory genes as pro-inflammatory and anti-inflammatory cytokine secretion patterns determine the immunomodulatory properties of MSC or MSC-derived exosomes.
WJ-MSC 유래 엑조좀(Exo(s)) 은 표준 초원심분리(도 1b)에 의해 나이브(CTL-Exo) 또는 TSG-프라이밍된 WJ-MSC (TSG-Exo)의 배양 상청액으로부터 분리되었다. WJ-MSC 세포 (3×106)를 100mm 배양 접시에서 1μM 탑시가르긴(Thapsigargin, TSG; Sigma-Aldrich, St. Louis, MO)으로 24 시간 동안 자극했다. 그 후 배지를 10 % Exo-고갈 FBS가 보충된 배지로 교체했다. Exo-고갈 FBS는 100,000 xg에서 18 시간 동안 초원심분리하여 얻었다. 72 시간 배양 후 배양액을 수집하여 300 xg 에서 10 분, 2,500 xg 에서 25 분, 10,000 xg 에서 1 시간 동안 4 ℃에서 원심분리하였다. 상청액을 0.22 ㎛ 필터를 통해 여과하고 100,000 xg에서 2 시간 동안 초원심분리 하였다. 그 후, Exo 펠렛을 멸균 PBS에서 100,000 xg 에서 2 시간 동안 원심분리하여 세척한 후 200 ㎕의 PBS에 현탁시켜 사용 전까지 -80 ℃에서 보관하였다. Exo 생성을 억제하기 위해 세포를 10 μM GW4869 (Santa cruz Biotechnology, Dallas, TX)를 포함하는 배양 배지로 12 시간 동안 처리했다. 그 후 배지를 10 % Exo-고갈 FBS가 보충된 배지로 교체했다. 72 시간 후, 배양 상층액을 초원심분리하여 Exo를 분리하고 사용할 때까지 -80 ℃에서 보관하였다(concentrated-CM; 농축-CM). 모든 마우스 실험에 대해 GW4869 처리된 MSC (Exo 분비 억제)에서 유래한 농축-CM을 용매(vehicle) 대조군으로 사용했다. Exo의 양은 총 단백질 측정을 위해 BCA 분석 키트 (Thermo Fisher Scientific, Waltham, MA)로 결정하였다. Exo 크기와 수는 제조업체의 지침에 따라 qNano(Izon Science, Christchurch, New Zealand) 및 투과 전자 현미경(TEM; Jeol, Tokyo, Japan)으로 결정하였다. WJ-MSC-derived exosomes (Exo(s)) were isolated from culture supernatants of naive (CTL-Exo) or TSG-primed WJ-MSCs (TSG-Exo) by standard ultracentrifugation ( FIG. 1B ). WJ-MSC cells (3×10 6 ) were stimulated with 1 μM Thapsigargin (Thapsigargin, TSG; Sigma-Aldrich, St. Louis, MO) for 24 h in 100 mm culture dishes. The medium was then replaced with medium supplemented with 10% Exo-depleted FBS. Exo-depleted FBS was obtained by ultracentrifugation at 100,000×g for 18 h. After culturing for 72 hours, the culture medium was collected and centrifuged at 300 xg for 10 minutes, 2,500 xg for 25 minutes, and 10,000 xg for 1 hour at 4 °C. The supernatant was filtered through a 0.22 μm filter and ultracentrifuged at 100,000×g for 2 h. Thereafter, the Exo pellets were washed by centrifugation in sterile PBS at 100,000 x g for 2 hours, and then suspended in 200 μl of PBS and stored at -80° C. until use. To inhibit Exo production, cells were treated with culture medium containing 10 μM GW4869 (Santa cruz Biotechnology, Dallas, TX) for 12 h. The medium was then replaced with medium supplemented with 10% Exo-depleted FBS. After 72 hours, the culture supernatant was ultracentrifuged to isolate Exo and stored at -80 °C until use (concentrated-CM; concentrated-CM). Concentrated-CM derived from GW4869-treated MSC (inhibited Exo secretion) was used as a vehicle control for all mouse experiments. The amount of Exo was determined with a BCA assay kit (Thermo Fisher Scientific, Waltham, MA) for total protein determination. Exo size and number were determined by qNano (Izon Science, Christchurch, New Zealand) and transmission electron microscopy (TEM; Jeol, Tokyo, Japan) according to the manufacturer's instructions.
웨스턴 블롯 분석은 WJ-MSC 용해물 및 Exo는 프로테아제 억제제와 함께 RIPA 완충액 (Thermo Fisher)으로 용해되었다. 동일한 양의 단백질을 SDS-PAGE에 적용하고 CD63 (SBI), COX2 (Abcam, Cambridge, UK), IDO (Merk Millipore, Darmstadt, Germany), TGFβ 및 GAPDH (Santa cruz) 1 차 항체로 분석했다. 밴드는 강화된 화학 발광 (Thermo Fisher)을 사용하여 감지되었고 이미지는 LAS-3000 시스템 (Fujifilm, Tokyo, Japan)을 사용하여 캡쳐하였다.Western blot analysis showed that WJ-MSC lysates and Exo were lysed with RIPA buffer (Thermo Fisher) together with protease inhibitors. Equal amounts of protein were subjected to SDS-PAGE and analyzed with CD63 (SBI), COX2 (Abcam, Cambridge, UK), IDO (Merk Millipore, Darmstadt, Germany), TGFβ and GAPDH (Santa cruz) primary antibodies. Bands were detected using enhanced chemiluminescence (Thermo Fisher) and images were captured using a LAS-3000 system (Fujifilm, Tokyo, Japan).
그 결과, 투과 전자 현미경 분석은 정제된 엑소좀이 직경 50-120 nm의 둥근 소포를 포함한다는 것을 보여주었다(도 2 A). 엑소좀 특이적 마커 CD63은 CTL-Exo와 TSG-Exo에서 발현되었으나 세포질 마커 β액틴은 어느 엑소좀에서도 발현되지 않았다(도 2 B). qNano 분석 결과 엑소좀의 평균 입자 직경은 CTL-Exo와 TSG-Exo 모두에서 110-120 nm 였다(도 2 C). TSG-프라이밍된 WJ-MSC 유래 엑소좀의 생산은 나이브 WJ-MSC 유래 엑소좀보다 50 % 더 높았다(도 2 C, D). TSG-Exo는 CTL-Exo에 비해 IL-10, TGFβCOX2 및 IDO의 발현 수준이 유의하게 높았지만 IFNγ, TNFα 및 IL-1β를 포함한 전 염증성 사이토 카인의 발현이 낮았다(도 3 E). mRNA 발현 결과와 일치하여 TGFβCOX2 및 IDO 단백질 발현 수준은 TSG-Exo에서 유의하게 증가했다(도 3 F).As a result, transmission electron microscopy analysis showed that the purified exosomes contained round vesicles with a diameter of 50-120 nm (Fig. 2A). The exosome-specific marker CD63 was expressed in CTL-Exo and TSG-Exo, but the cytoplasmic marker β-actin was not expressed in any exosomes ( FIG. 2B ). As a result of qNano analysis, the average particle diameter of the exosomes was 110-120 nm in both CTL-Exo and TSG-Exo ( FIG. 2C ). The production of TSG-primed WJ-MSC-derived exosomes was 50% higher than that of naive WJ-MSC-derived exosomes (Fig. 2C, D). Compared to CTL-Exo, TSG-Exo had significantly higher expression levels of IL-10, TGFβCOX2 and IDO, but lower expression of pro-inflammatory cytokines including IFNγ, TNFα and IL-1β (Fig. 3E). Consistent with the mRNA expression results, TGFβCOX2 and IDO protein expression levels were significantly increased in TSG-Exo (Fig. 3F).
[실시예 2] [Example 2]
TSG-프라이밍된 엑소좀의 면역 조절 효과 확인-T 세포 증식 억제 TSG-Immune modulatory effect of primed exosomes-Inhibition of T cell proliferation
TSG-프라이밍된 엑소좀의 면역 조절 능력을 평가하기 위해 활성화된 단핵 세포(MNC)에서 항 염증성 사이토카인 및 전 염증성 사이토카인의 발현 수준을 측정했다. To evaluate the immunomodulatory ability of TSG-primed exosomes, we measured the expression levels of anti-inflammatory and pro-inflammatory cytokines in activated mononuclear cells (MNCs).
정량적 RT-PCR 에서 총 RNA는 TRizol 시약 (Invitrogen, Waltham, MA)을 사용하여 세포, Exos 또는 조직 샘플에서 추출되었으며, cDNA는 Superscript™ 역전사 효소 (Invitrogen)를 사용하여 총 RNA에서 합성되었다. MX300P 열 순환기 (Stratagene, San diego, CA)에서 SYBR Green Master Mix (Applied Biosystems, Foster City, CA)를 사용하여 정량적 PCR을 측정했다. mRNA의 발현 수준은 GAPDH의 수준으로 정규화되었다. qRT-PCR의 프라이머 서열은 하기 [표 1]에 기재된 바와 같다.In quantitative RT-PCR, total RNA was extracted from cell, Exos or tissue samples using TRizol reagent (Invitrogen, Waltham, MA), and cDNA was synthesized from total RNA using Superscript™ reverse transcriptase (Invitrogen). Quantitative PCR was measured using SYBR Green Master Mix (Applied Biosystems, Foster City, CA) on an MX300P thermocycler (Stratagene, San diego, CA). The expression level of mRNA was normalized to the level of GAPDH. The primer sequences of qRT-PCR are as described in [Table 1] below.
유전자gene 프라이머 서열(5'→3')Primer sequence (5'→3') 서열목록sequence list
hCOX-2hCOX-2 F: AGACGCCCTCAGACAGCAAA
R: TCCTGTCCGGGTACAATCGCF: AGACGCCCTCAGACAGCAAA
R: TCCTGTCCGGGTACAATCGC 		서열번호 1
서열번호 2SEQ ID NO: 1
SEQ ID NO: 2
hIDOhIDO F: CCTGAGGAGCTACCATCTGC
R: TCAGTGCCTCCAGTTCCTTTF: CCTGAGGAGCTACCATCTGC
R: TCAGTGCCTCCAGTTCCTTT 		서열번호 3
서열번호 4SEQ ID NO: 3
SEQ ID NO: 4
hIFNγhIFNγ F: GAGTGTGGAGACCATCAAGGAAG
R: TGCTTTGCGTTGGACATTCAAGTCF: GAGTGTGGAGACCATCAAGGAAG
R: TGCTTTGCGTTGGACATTCAAGTC 		서열번호 5
서열번호 6SEQ ID NO: 5
SEQ ID NO: 6
hIL-10hIL-10 F: TCTCCGAGATGCCTTCAGCAGA
R: TCAGACAAGGCTTGGCAACCCAF: TCTCCGAGATGCCTTCAGCAGA
R: TCAGACAAGGCTTGGCAACCCA 		서열번호 7
서열번호 8SEQ ID NO: 7
SEQ ID NO: 8
hIL-1βhIL-1β F: CTCTTCGAGGCACAAGGCAC
R: CAAGTCATCCTCATTGCCACTGTF: CTCTTCGAGGCACAAGGCAC
R: CAAGTCATCCTCATTGCCACTGT 		서열번호 9
서열번호 10SEQ ID NO: 9
SEQ ID NO: 10
hNOS2hNOS2 F: GCTCTACACCTCCAATGTGACC
R: CTGCCGAGATTTGAGCCTCATGF: GCTCTACACCTCCAATGTGACC
R: CTGCCGAGATTTGAGCCTCATG 		서열번호 11
서열번호 12SEQ ID NO: 11
SEQ ID NO: 12
hTGFβhTGFβ F: GATGTCACCGGAGTTGTGCG
R: GCCGGTAGTGAACCCGTTGATF: GATGTCACCGGAGTTGTGCG
R: GCCGGTAGTGAACCCGTTGAT 		서열번호 13
서열번호 14SEQ ID NO: 13
SEQ ID NO: 14
hTNFαhTNFα F: CTCTTCTGCCTGCTGCACTTTG
R: ATGGGCTACAGGCTTGTCACTCF: CTCTTCTGCCTGCTGCACTTTG
R: ATGGGCTACAGGCTTGTCACTC 		서열번호 15
서열번호 16SEQ ID NO: 15
SEQ ID NO: 16
mArg1mArg1 F: CTGCCAAAGACATCGTGTAC
R: CTTCCATCACCTTGCCAATCF: CTGCCAAAGACATCGTGTAC
R: CTTCCATCACCTTGCCAATC 		서열번호 17
서열번호 18SEQ ID NO: 17
SEQ ID NO: 18
mCD206mCD206 F: GCAAAGAGAAGGAAACCATG
R: CCAATAAAATATGGTGACTGCCCF: GCAAAGAGAAGGAAACCATG
R: CCAATAAAATATGGTGACTGCCC 		서열번호 19
서열번호 20SEQ ID NO: 19
SEQ ID NO: 20
mCXCL9mCXCL9 F: GTTGTCCACCTCCCTTCGGT
R: CCAGCTGTCAGATGCAAGGGF: GTTGTCCACCTCCCTTCGGT
R: CCAGCTGTCAGATGCAAGGG 		서열번호 21
서열번호 22SEQ ID NO: 21
SEQ ID NO: 22
mFoxp3mFoxp3 F: TTGGCCAGCGCCATCTT
R: TGCCTCCTCCAGAGAGAAGTGF: TTGGCCAGCGCCATCTT
R: TGCCTCCTCCAGAGAGAAGTG 		서열번호 23
서열번호 24SEQ ID NO: 23
SEQ ID NO: 24
mGATA3mGATA3 F: GATCCAGCACAGAAGGCAGG
R: CGCTTGGGCTTGATAAGGGGF: GATCCAGCACAGAAGGCAGG
R: CGCTTGGGCTTGATAAGGGG 		서열번호 25
서열번호 26SEQ ID NO: 25
SEQ ID NO: 26
miNOSmiNOS F: GAGACAGGGAAGTCTGAAGCAC
R: CCAGCAGTAGTTGCTCCTCTTCF: GAGACAGGGAAGTCTGAAGCAC
R: CCAGCAGTAGTTGCTCCTCTTC 		서열번호 27
서열번호 28SEQ ID NO: 27
SEQ ID NO: 28
mMCP1mMCP1 F: CTGGAGCATCCACGTGTTGG
R: TCCTTCTTGGGGTCAGCACAGF: CTGGAGCATCCACGTTGTTGG
R: TCCTTCTTGGGGTCAGCACAG 		서열번호 29
서열번호 30SEQ ID NO: 29
SEQ ID NO: 30
mRORγmRORγ F: GAAGGCAAATACGGTGGTGTGG
R: GCTGAGGAAGTGGGAAAAGTCF: GAAGGCAAATACGTGGTGTGG
R: GCTGAGGAAGTGGGAAAAGTC 		서열번호 31
서열번호 32SEQ ID NO: 31
SEQ ID NO: 32
mT-betmT-bet F: TTCCCAGCCGTTTCTACCCC
R: CGTCTTGGCCCCGGTAGTAGF: TTCCCAGCCGTTTCTACCCC
R: CGTCTTGGCCCCGGTAGTAG 		서열번호 33
서열번호 34SEQ ID NO: 33
SEQ ID NO: 34
세포자멸사 분석을 위한 단핵 세포 (MNC)는 비특허문헌 2에 따라 Ficoll-Hypaque (GE Healthcare, Chicago, IL) 구배 원심 분리를 사용하여 hUCB에서 분리되었고, 10 % Exo-고갈 FBS가 보충된 RPMI 1640 배지에 재현탁되었다. 제대혈 (UCB) 단위는 기관 심의위원회 승인 (IRB No. 2019-0467-0003)에 따라 2019 년 4 월부터 2020 년 6 월까지 국내 가톨릭 조혈 모세포 은행 (CHSCB)에서 획득했다. MNC를 5 ㎍/㎖ Con A (Concanavalin A)로 자극하고 72 시간 동안 나이브(naive) 또는 TSG-프라이밍된 WJ-MSC 유래 Exos(4㎍)가 있거나 없는 성장 배지에서 96 웰 플레이트 (1×105/웰)에 시드했다. Annexin V/7AAD (BD Biosciences, Franklin Lakes, NJ) 염색을 수행하여 제조업체의 지침에 따라 세포의 세포자멸사(apoptosis)를 결정하고 유세포 분석으로 분석했다.Mononuclear cells (MNC) for apoptosis assay were isolated from hUCB using Ficoll-Hypaque (GE Healthcare, Chicago, IL) gradient centrifugation according to Non-Patent Document 2, RPMI 1640 supplemented with 10% Exo-depleted FBS resuspended in the medium. Cord blood (UCB) units were obtained from the National Catholic Hematopoietic Stem Cell Bank (CHSCB) from April 2019 to June 2020 under Institutional Review Board approval (IRB No. 2019-0467-0003). MNCs were stimulated with 5 μg/ml Con A (Concanavalin A) and 96 well plates (1×10 5 ) in growth medium with or without Exos (4 μg) from naive or TSG-primed WJ-MSCs for 72 h. /well). Annexin V/7AAD (BD Biosciences, Franklin Lakes, NJ) staining was performed to determine cell apoptosis according to the manufacturer's instructions and analyzed by flow cytometry.
다음으로 활성화된 말초 혈액 유래 단핵 세포(PBMC)의 증식에 대한 TSG-Exo의 면역 억제 효과를 테스트하고자 건강한 기증자의 인간 말초 혈액은 대한 적십자사(Seoul, Korea)에서 가톨릭 대학교 기관 심의위원회 (IRB No. 2019-2891-0003)의 승인을 받아 제공되었다. PBMC를 Ficoll-Hypaque 밀도 구배를 통해 원심 분리하여 분리하고, 10 % Exo-고갈 FBS가 보충된 RPMI 1640 배지에 재현탁되었다.Next, to test the immunosuppressive effect of TSG-Exo on the proliferation of activated peripheral blood-derived mononuclear cells (PBMC), human peripheral blood from healthy donors was collected from the Korean Red Cross (Seoul, Korea) by the Catholic University Institutional Review Board (IRB No. 2019-2891-0003) was provided with permission. PBMCs were isolated by centrifugation through a Ficoll-Hypaque density gradient and resuspended in RPMI 1640 medium supplemented with 10% Exo-depleted FBS.
T 세포의 증식은 CFSE 희석으로 정량화되었다. 분리된 PBMC를 2μM CFSE(CellTrace CFSE Cell Proliferation Kit, Thermo Fisher Scientific)로 표지했다. CFSE-표지된 PBMC(1×105/웰)는 항-CD3/CD28 마이크로비드(Gibco) 및 재조합 인간 IL-2 (30 U/㎖, Peprotech)의 존재하에 나이브(naive) 또는 TSG 프라이밍된 WJ-MSC 유래 Exos(4 ㎍)가 있거나 없는 96 웰 플레이트에서 공동 배양되었다. 6 일 배양 후, 세포를 CD45, CD3, CD4 또는 CD8(BD Biosciences)에 형광 표지된 인간 단일 클론 항체로 염색하고 유세포 분석으로 측정했다. 모든 세포는 7AAD 음성 세포에서 게이트되었다.T cell proliferation was quantified by CFSE dilution. The isolated PBMCs were labeled with 2 μM CFSE (CellTrace CFSE Cell Proliferation Kit, Thermo Fisher Scientific). CFSE-labeled PBMCs (1×10 5 /well) were treated with either naive or TSG primed WJ in the presence of anti-CD3/CD28 microbeads (Gibco) and recombinant human IL-2 (30 U/ml, Peprotech). -Co-cultured in 96 well plates with or without MSC-derived Exos (4 μg). After 6 days of culture, cells were stained with human monoclonal antibodies fluorescently labeled to CD45, CD3, CD4 or CD8 (BD Biosciences) and measured by flow cytometry. All cells were gated on 7AAD negative cells.
그 결과, Con A(concanavalin A)로 자극된 MNC를 엑소좀으로 처리하면 COX2, NOS2, IDO, IL-10 및 TGFβ의 발현 수준이 증가하는 반면 TNFα 및 IL-1β의 발현 수준은 감소했다. 이는 CTL-Exo로 처리한 것보다 TSG-Exo로 처리한 활성화된 MNC에서 더 두드러졌다(도 3 G). TSG-Exo는 MNC의 초기 세포 사멸을 약간 감소 시켰지만 후기 세포 사멸에는 영향을 미치지 않았는데, 이는 엑소좀 처리가 세포 독성을 유도하지 않았음을 시사한다(도 3 H). CFSE 희석 분석은 TSG-Exo의 첨가가 CTL-Exo보다 총 T, CD4+ T 및 CD8+ T 세포 증식을 더 강력하게 억제함을 나타냈다(도 4 A, B). TSG-Exo 처리된 PBMC에서 초기 분열주기 1에서 세포의 비율은 현저하게 증가했고, 분열주기 4와 5의 세포 비율은 현저하게 감소했다(도 4 C). 이러한 결과는 TSG-프라이밍된 엑소좀이 항염증 사이토카인 생산을 증가시켜 T 세포 증식에 상당한 억제 효과가 있음을 시사한다.As a result, when MNCs stimulated with Con A (concanavalin A) were treated with exosomes, the expression levels of COX2, NOS2, IDO, IL-10 and TGFβ were increased while the expression levels of TNFα and IL-1β were decreased. This was more pronounced in activated MNCs treated with TSG-Exo than those treated with CTL-Exo (Fig. 3G). TSG-Exo slightly reduced early apoptosis of MNCs but had no effect on late apoptosis, suggesting that exosome treatment did not induce cytotoxicity (Fig. 3H). CFSE dilution analysis showed that addition of TSG-Exo more potently inhibited total T, CD4+ T and CD8+ T cell proliferation than CTL-Exo ( FIGS. 4A, B). In TSG-Exo-treated PBMCs, the proportion of cells in early division cycle 1 was significantly increased, and the cell ratio in division cycles 4 and 5 was significantly decreased ( FIG. 4C ). These results suggest that TSG-primed exosomes have a significant inhibitory effect on T cell proliferation by increasing the production of anti-inflammatory cytokines.
[실시예 3][Example 3]
TSG-프라이밍된 엑소좀의 면역 조절 효과 확인-조절 T 세포 및 M2형 대식세포 분극 향상 Immune modulatory effect of TSG-primed exosomes confirmed-Enhancement of polarization of regulatory T cells and M2-type macrophages
<3-1> TSG-프라이밍된 엑소좀의<3-1> TSG-primed exosome T 도움 세포 (Th) 분화 확인Confirmation of T helper cell (Th) differentiation
MSC 엑소좀은 조절 T 세포(Tregs) 분화를 통해 면역 조절 효과를 매개할 수 있다고 보고되었다. 따라서 본 발명자들은 특정 T 세포 하위 집합에 대한 TSG-Exo의 효과를 확인하고자 T 도움 세포 (Th) 분화를 조사하였다. It has been reported that MSC exosomes can mediate immunomodulatory effects through regulatory T cell (Tregs) differentiation. Therefore, the present inventors investigated T helper cell (Th) differentiation to confirm the effect of TSG-Exo on specific T cell subsets.
Th 세포는 엑소좀의 존재하에 인간 PBMC로부터 정제된 CD4+ 세포상의 계통-특이적 사이토카인으로 자극함으로써 유도되었다. 구체적으로, PBMC 림프구에서 CD4+ T 세포 분리는 제조업체의 프로토콜에 따라 인간 CD4 T 세포 분리 키트 (Miltenyi Biotec, Marburg, Germany)로 수행하였다. CD4+ T 세포를 항-CD3/CD28 마이크로비드 및 IL-2 (20 ng/㎖)로 자극하고 특정 Th 세포의 분화를 위해 특정 사이토카인을 첨가했다: Th1에 대한 IFNγ㎖) 및 IL-12 (25 ng/㎖); Th17 에 대한 IL-6 (50 g/㎖) 및 TGFβg/㎖); Treg에 대한 TGFβg/㎖) 및 레티노산(10nM). 사이토카인 처리된 CD4+ T 세포 (5×105/웰)는 24 웰 플레이트에 나이브(naive) 또는 TSG 프라이밍된 WJ-MSC 유래 Exos를 첨가하여 5 일 동안 배양되었다. 세포 내 염색을 위해, 염색 전 5 시간 동안 세포 자극 칵테일 (Invitrogen)로 세포를 자극하였다. 세포를 세포 표면 마커인 항-CD3, 항-CD4 및 항-CD25 항체로 염색한 다음 고정/투과화하고 형광 표지된 항-IFNγ항-IL-17A 및 항-Foxp3 항체 (BD Biosciences)로 염색했다. 염색 세포는 유세포 분석으로 분석하였다.Th cells were induced by stimulation with lineage-specific cytokines on CD4+ cells purified from human PBMCs in the presence of exosomes. Specifically, CD4+ T cell isolation from PBMC lymphocytes was performed with a human CD4 T cell isolation kit (Miltenyi Biotec, Marburg, Germany) according to the manufacturer's protocol. CD4+ T cells were stimulated with anti-CD3/CD28 microbeads and IL-2 (20 ng/ml) and specific cytokines were added for differentiation of specific Th cells: IFNγ against Th1 and IL-12 (25 ml). ng/ml); IL-6 to Th17 (50 g/ml) and TGFβg/ml); TGFβg/ml for Treg) and retinoic acid (10 nM). Cytokine-treated CD4+ T cells (5×10 5 /well) were cultured for 5 days by adding naive or TSG-primed WJ-MSC-derived Exos to a 24-well plate. For intracellular staining, cells were stimulated with Cell Stimulation Cocktail (Invitrogen) for 5 hours before staining. Cells were stained with cell surface markers anti-CD3, anti-CD4 and anti-CD25 antibodies, then fixed/permeabilized and stained with fluorescently labeled anti-IFNγ anti-IL-17A and anti-Foxp3 antibodies (BD Biosciences). . Stained cells were analyzed by flow cytometry.
그 결과, TSG-Exo와의 공동 배양은 CTL-Exo에 비해 IFNγ+CD4+Th1 및 IL-17A+CD4+Th17 세포의 유도를 크게 감소시켰고 Foxp3+CD25+CD4+ Treg 세포를 증가 시켰다(도 5 D 및 도 6). M1 형 대식세포는 둥근 모양을 보인 반면 M2 형 대식세포는 스핀들 모양의 형태를 나타냈다(도 7).As a result, co-culture with TSG-Exo significantly reduced the induction of IFNγ+CD4+Th1 and IL-17A+CD4+Th17 cells and increased Foxp3+CD25+CD4+ Treg cells compared to CTL-Exo (Fig. 5D and Fig. 6). M1-type macrophages showed a round shape, whereas M2-type macrophages showed a spindle-shaped shape (FIG. 7).
<3-2> TSG-프라이밍된 엑소좀의<3-2> TSG-primed exosome M2형 대식세포 분극 향상 확인Confirmation of improvement in polarization of M2-type macrophages
MSC 엑소좀은 M2 형 대식세포 분극화 유도를 통해 면역 조절 효과를 매개할 수 있다고 보고되었다. 따라서 본 발명자들은 특정 T 세포 하위 집합에 대한 TSG-Exo의 효과를 확인하고자 TSG-Exo가 대식세포의 표현형을 조절할 수 있는지 여부를 조사하였다. It has been reported that MSC exosomes can mediate immunomodulatory effects through the induction of M2-type macrophage polarization. Therefore, the present inventors investigated whether TSG-Exo can modulate the phenotype of macrophages in order to confirm the effect of TSG-Exo on specific T cell subsets.
GM-CSF(M1 유형의 경우)- 또는 M-CSF(M2 유형의 경우)-자극 1 차 인간 대식세포를 M1 유형 사이토카인 또는 M2 유형 사이토카인의 존재하에 엑소좀과 함께 배양했다. 구체적으로, CD14 결합된 마이크로 비드 (Miltenyi Biotec)를 사용하여 hUCB 유래 MNC로부터 CD14+ 단핵구를 분리하였다. 대식세포를 생성하기 위해 단핵구 (5×105/웰)를 GM-CSF (50 ng/㎖; Peprotech) 또는 M-CSF (100 ng/㎖)와 함께 10 % FBS를 포함하는 RPMI 1640 배지 (Gibco)에서 6 일 동안 배양했다. 24 웰 플레이트에 M1 분극화를 위해, GM-CSF 유래 대식세포는 48 시간 동안 나이브(naive) 또는 TSG 프라이밍된 WJ-MSC 유래 Exo와 함께 IFNγng/㎖) + LPS (1 ㎍/㎖)로 자극되었다. M2 분극화를 위해, M-CSF 유래 대식세포는 48 시간 동안 나이브 또는 TSG 프라이밍된 WJ-MSC 유래 Exo와 함께 IL-4 (20 ng/㎖)와 IL-13 (20 ng/㎖)으로 자극되었다. 공동 배양 후, 세포를 CD14, CD80, CD86, CD206 및 CD163 (BD Biosciences)에 형광 표지된 인간 단일 클론 항체로 염색하고 유세포 분석으로 분석했다.GM-CSF (for M1 type)- or M-CSF (for M2 type)-stimulated primary human macrophages were cultured with exosomes in the presence of either M1 type cytokines or M2 type cytokines. Specifically, CD14+ monocytes were isolated from hUCB-derived MNCs using CD14-bound microbeads (Miltenyi Biotec). To generate macrophages, monocytes (5×10 5 /well) were mixed with GM-CSF (50 ng/ml; Peprotech) or M-CSF (100 ng/ml) in RPMI 1640 medium containing 10% FBS (Gibco). ) incubated for 6 days. For M1 polarization in 24-well plates, GM-CSF-derived macrophages were stimulated with IFNγng/ml) + LPS (1 μg/ml) with Exo from naive or TSG primed WJ-MSCs for 48 h. For M2 polarization, M-CSF-derived macrophages were stimulated with IL-4 (20 ng/ml) and IL-13 (20 ng/ml) along with naive or TSG-primed WJ-MSC-derived Exo for 48 h. After co-culture, cells were stained with human monoclonal antibodies fluorescently labeled CD14, CD80, CD86, CD206 and CD163 (BD Biosciences) and analyzed by flow cytometry.
그 결과, M1 유형 세포 표면 마커 CD80+ 및 CD86+ 는 CTL-Exo로 배양된 것에 비해 TSG-Exo로 배양된 M1 형 대식세포에서 현저하게 감소되었다. 그러나 M2 유형 세포 표면 마커 CD206+ 및 CD163+ 의 발현은 엑소좀과 함께 배양했을 때 증가했으며, 이 효과는 TSG-Exo 처리 그룹에서 더 컸다(도 5 E 및 도 8). 이러한 결과는 TSG-Exo가 나이브 엑소좀보다 M2 형 대식세포 표현형을 더 효과적으로 유도함을 시사한다. 따라서 MSC에 대한 TSG 처리는 개선된 면역 조절 특성을 가진 엑소좀을 생성할 수 있다.As a result, the M1-type cell surface markers CD80+ and CD86+ were significantly reduced in M1-type macrophages cultured with TSG-Exo compared to those cultured with CTL-Exo. However, the expression of the M2-type cell surface markers CD206+ and CD163+ was increased when incubated with exosomes, and this effect was greater in the TSG-Exo-treated group ( FIGS. 5E and 8 ). These results suggest that TSG-Exo induces the M2-type macrophage phenotype more effectively than naive exosomes. Therefore, TSG treatment for MSCs can generate exosomes with improved immunomodulatory properties.
[실시예 4] [Example 4]
TSG-프라이밍된 엑소좀의 DSS로 유도된 대장염 완화 효과 확인Confirmation of DSS-induced colitis relief effect of TSG-primed exosomes
본 발명자들은 3 % DSS로 유발된 대장염 마우스 모델에서 TSG-Exo의 잠재적인 보호 효과를 확인했다(도 9 A). The present inventors confirmed the potential protective effect of TSG-Exo in a mouse model of colitis induced by 3% DSS ( FIG. 9A ).
구체적으로, DSS로 유발된 대장염 마우스 모델 제조를 위해 7 일 동안 7 주령 C57BL/6 마우스의 식수에 3 % (w/v) DSS(Dextran sulfate sodium; MP Biomedicals, Santa Ana, CA)을 투여하여 유도하였다. 마우스는 그룹별로 10 마리씩 총 4 그룹으로 나누었다: (1) 대조군 (음성 대조군), (2) GW4869 처리 MSC에서 추출한 농축-CM(용매 대조군, 200㎕)를 투여한 DSS (양성 대조군), (3) 나이브(naive) MSC 유래 Exo를 투여한 DSS, (4) TSG 프라이밍된 MSC 유래 Exos를 투여한 DSS. (3) 및 (4) 그룹은 1 일, 3 일 및 5 일에 마우스에 200 ㎕ PBS에 희석된 200 ㎍ Exo를 복강 내 주사하였다. 10 일째에 마우스를 안락사시켰다. 체중 감소 (0-4), 대변 농도 (0-4), 대변 혈액 (0-4), 윤기(coat roughness) (0-4), 직장 탈출 (0-3), 구부러진 자세 (0-3), 침구 오염 (0-2), 호기심없음/경계없음(not inquisitive/alert) (0-2)을 포함한 질병 활동 지수(disease activity index, DAI)를 사용하여 대장염의 중증도를 매일 평가했다. 모든 동물 실험 절차는 가톨릭 대학교 동물 연구 윤리위원회 (IACUC no. 2019-0301-03)의 승인을 받았다. 용매(vehicle) 대조군으로는 엑소좀 분비를 조절하는 nSMase2(neutral sphingomyelinase supernatant 2) 억제제인 GW4869(10μM)로 처리된 MSC의 배양상청액(GW-CM)을 사용하였다.Specifically, for the preparation of a DSS-induced colitis mouse model, 3% (w/v) DSS (Dextran sulfate sodium; MP Biomedicals, Santa Ana, CA) was administered to the drinking water of 7-week-old C57BL/6 mice for 7 days. did Mice were divided into 4 groups of 10 mice per group: (1) control (negative control), (2) DSS (positive control) administered with concentrated-CM extracted from GW4869-treated MSC (solvent control, 200 μl), (3) ) DSS administered with naive MSC-derived Exo, (4) DSS administered with TSG-primed MSC-derived Exos. Groups (3) and (4) were intraperitoneally injected with 200 μg Exo diluted in 200 μl PBS into mice on days 1, 3 and 5. On day 10, mice were euthanized. Weight loss (0-4), stool consistency (0-4), stool blood (0-4), coat roughness (0-4), rectal prolapse (0-3), crouching (0-3) The severity of colitis was assessed daily using the disease activity index (DAI), which included , bedding contamination (0-2), and not inquisitive/alert (0-2). All animal testing procedures were approved by the Catholic University Animal Research Ethics Committee (IACUC no. 2019-0301-03). As a solvent (vehicle) control, the culture supernatant (GW-CM) of MSCs treated with GW4869 (10 μM), an nSMase2 (neutral sphingomyelinase supernatant 2) inhibitor that regulates exosome secretion, was used.
10 일째에 희생된 마우스의 결장 길이를 측정했다. 결장 조직은 4 % 포름 알데히드(Wako, Osaka, Japan)에 고정하고 파라핀에 묻은 다음 5㎛에서 절편했다. 조직학적 분석을 위해 결장 절편을 헤마톡실린 & 에오신 (H & E)으로 염색했다. 조직 병리학 점수는 염증 세포 침윤 정도 (0-4) 및 조직 손상 정도 (0-4)에 의해 맹검 방식으로 결정되었다.On day 10, the colon length of sacrificed mice was measured. Colonic tissues were fixed in 4% formaldehyde (Wako, Osaka, Japan), embedded in paraffin, and sectioned at 5 μm. For histological analysis, colon sections were stained with hematoxylin & eosin (H & E). Histopathology scores were determined in a blinded manner by the degree of inflammatory cell infiltration (0-4) and tissue damage (0-4).
골수세포형과산화효소(myeloperoxidase, MPO) Colorimetric Activity Assay Kit (Sigma)를 사용하여 대장 조직으로의 호중구의 침투를 측정했다. 결장을 MPO 분석 완충액에서 균질화하고 상청액을 13,000 xg에서 10 분 동안 원심 분리하여 수집했다. 상청액을 MPO 분석 완충액 및 MPO 기질과 혼합하고 25 ℃에서 120 분 동안 배양한 다음 TNB(tetramethylbenzidine) 프로브를 첨가하였다. 분광 광도계(Biotek, Winooski, WT)를 사용하여 412nm에서 흡광도를 측정했다.Infiltration of neutrophils into colonic tissues was measured using myeloperoxidase (MPO) Colorimetric Activity Assay Kit (Sigma). Colons were homogenized in MPO assay buffer and the supernatant was collected by centrifugation at 13,000 x g for 10 min. The supernatant was mixed with MPO assay buffer and MPO substrate, incubated at 25° C. for 120 minutes, and then TNB (tetramethylbenzidine) probe was added. Absorbance was measured at 412 nm using a spectrophotometer (Biotek, Winooski, WT).
그 결과, GW4869는 MSC에서 엑소좀 방출을 성공적으로 억제했다. GW-CM 처리된 대장염 마우스는 지속적인 체중 감소와 대변 일관성, 혈성 설사 및 일반적인 활동과 같은 현저하게 상승된 질병 활동 지수 (DAI)를 나타냈다. 그러나 엑소좀 처리는 특히 TSG-Exo 처리 그룹에서 체중 감소와 DAI를 개선했다(도 9 B, C). 더욱이, DSS 투여에 의한 결장 길이의 단축은 CTL-Exo 처리된 마우스에 비해 TSG-Exo 처리된 마우스에서 현저하게 개선되었다(도 10 D, E). 조직학적 검사는 TSG-Exo 처리된 마우스가 결장 조직 완전성을 유지함을 보여 주었다; 현저한 구조 파괴, 창자 샘 세포(crypt) 손실 및 염증 세포의 침윤 감소; 그리고 CTL-Exo-처리된 마우스에 비해 더 낮은 조직학적 점수를 가졌다(도 10 F, G). 더욱이, 10일째에 희생된 마우스의 호중구 침윤을 나타내는 MPO(myeloperoxidase) 활성은 CTL-Exo-처리된 마우스에 비해 TSG-Exo-처리된 마우스에서 현저하게 감소하였다(도 10 H). 이러한 결과는 TSG-Exo 가 나이브 엑소좀에 비해 DSS로 유도된 대장염에서 장 염증에 대한 보호 활성이 향상되었음을 나타낸다.As a result, GW4869 successfully inhibited exosome release from MSCs. GW-CM-treated colitis mice exhibited markedly elevated disease activity index (DAI) such as persistent weight loss and stool consistency, bloody diarrhea and general activity. However, exosome treatment improved weight loss and DAI, especially in the TSG-Exo treatment group (Fig. 9B, C). Moreover, the shortening of colon length by DSS administration was significantly improved in TSG-Exo-treated mice compared to CTL-Exo-treated mice (Fig. 10D, E). Histological examination showed that TSG-Exo treated mice maintained colonic tissue integrity; marked structural disruption, loss of intestinal crypt and reduced infiltration of inflammatory cells; and had lower histological scores compared to CTL-Exo-treated mice (Fig. 10 F, G). Moreover, MPO (myeloperoxidase) activity, which indicates neutrophil infiltration, of mice sacrificed on day 10 was significantly reduced in TSG-Exo-treated mice compared to CTL-Exo-treated mice ( FIG. 10H ). These results indicate that TSG-Exo has improved protective activity against intestinal inflammation in DSS-induced colitis compared to naive exosomes.
[실시예 5] [Example 5]
TSG-프라이밍된 엑소좀의 염증이 있는 결장에서 조절 T 세포와 M2 대식세포 분극화 향상 효과 확인Effect of TSG-primed exosomes on enhancing regulatory T cell and M2 macrophage polarization in inflamed colon
면역 세포 반응은 염증성 장 질환(IBD)의 병인에 중요한 역할을 한다. 특히, 장내 미세 환경에서 Tregs와 다른 T 세포 사이의 균형은 대장염의 완화에 중요한 역할을 하고, 대식세포는 결장에서 M1/M2 분극화를 통해 염증 반응을 매개하여 IBD의 발병 기전에 중요한 역할을 한다. 따라서, 염증이 있는 결장에서 TSG-프라이밍된 엑소좀의 조절 T 세포 및 M2형 대식세포 분극 향상을 통한 면역 조절 효과를 확인하고자 하였다. 또한, 본 발명자들은 다음으로 DSS로 유도된 대장염 마우스의 면역 세포 프로파일에 대한 TSG 프라이밍된 엑소좀의 효과를 조사했다.Immune cell responses play an important role in the pathogenesis of inflammatory bowel disease (IBD). In particular, the balance between Tregs and other T cells in the intestinal microenvironment plays an important role in the alleviation of colitis, and macrophages play an important role in the pathogenesis of IBD by mediating the inflammatory response through M1/M2 polarization in the colon. Thus, in the inflamed colon, TSG-primed exosomes Through enhanced regulatory T cell and M2-type macrophage polarization The purpose of this study was to confirm the immunomodulatory effect. In addition, we next investigated the effect of TSG-primed exosomes on the immune cell profile of DSS-induced colitis mice.
구체적으로, 3 % DSS-대장염 마우스(그룹당 n = 2 ~ 4 마우스)를 10 일에 희생시키고 결장 조직을 수득한 후, 결장 조직에서 Th1, Th2, Th17 및 Treg 세포의 수준을 평가했다. 고유판(Lamina propria) 세포는 장으로부터 분리되었다. 결장 조직을 작은 조각 (3mm × 3mm)으로 자르고 진탕배양기(shaking incubator)에서 2mM EDTA (Sigma)를 포함하는 HBSS 완충액과 함께 220rpm 에서 30 분 동안 배양했다. 37 ℃에서 상피를 제거한 후, 조직을 5 % FBS, 1mg/㎖ Collagenase D (Sigma) 및 0.1 mg/㎖ DNase I (Sigma)를 포함하는 RPMI에서 220rpm 으로 37 ℃에서 60 분 동안 진탕 배양기에서 분해(digest)했다. 분해 샘플을 40 ㎛ 세포 스트레이너를 통해 여과한 다음 300 xg 에서 5 분 동안 원심분리했다. 분리된 세포를 CD11b, F4/80, CD206 및 아르기나제 1 (arginase 1, BD Biosciences)에 대한 형광 표지 항체로 염색하고 유세포 분석으로 분석했다.Specifically, 3% DSS-colitis mice (n = 2 to 4 mice per group) were sacrificed on day 10 and colonic tissues were obtained, and then the levels of Th1, Th2, Th17 and Treg cells in the colon tissues were evaluated. Lamina propria cells were isolated from the intestine. Colon tissue was cut into small pieces (3 mm × 3 mm) and incubated in a shaking incubator with HBSS buffer containing 2 mM EDTA (Sigma) at 220 rpm for 30 minutes. After removing the epithelium at 37 °C, the tissue was digested in RPMI containing 5% FBS, 1 mg/ml Collagenase D (Sigma) and 0.1 mg/ml DNase I (Sigma) at 220 rpm in a shaking incubator at 37 °C for 60 min ( digest). The lysed samples were filtered through a 40 μm cell strainer and then centrifuged at 300×g for 5 minutes. The isolated cells were stained with fluorescently labeled antibodies to CD11b, F4/80, CD206 and arginase 1 (arginase 1, BD Biosciences) and analyzed by flow cytometry.
그 결과, Th1(T-bet), Th2(GATA3) 및 Th17(RORγ계통 전사 인자의 발현 수준은 GW-CM 처리 마우스의 결장 조직에서 증가했지만 엑소좀 처리 마우스에서는 감소했다. 특히, GATA3 발현은 CTL-Exo 처리된 마우스에 비해 TSG-Exo 처리된 마우스에서 더 유의하게 감소하였다. Foxp3 및 Treg 전사 인자는 CTL-Exo 처리된 마우스와 비교하여 TSG-Exo 처리된 마우스에서 유의하게 증가하였다(도 11 A). As a result, the expression levels of Th1 (T-bet), Th2 (GATA3) and Th17 (RORγ lineage transcription factors) were increased in colonic tissues of GW-CM-treated mice, but decreased in exosome-treated mice. In particular, GATA3 expression was expressed in CTL -Exo treated mice compared to TSG-Exo treated mice were more significantly decreased.Foxp3 and Treg transcription factors were significantly increased in TSG-Exo treated mice compared to CTL-Exo treated mice (Fig. 11A) ).
또한, CXCL9, MCP1 및 iNOS의 M1 형 마커 발현은 GW-CM 처리 마우스에 비해 CTL-Exo- 및 TSG-Exo 처리 마우스에서 감소하였다. CXCL9 수준은 CTL-Exo 처리된 마우스에 비해 TSG-Exo 처리된 마우스에서 현저하게 감소하였다. Arg1 및 CD206의 M2 형 마커 발현은 엑소좀 처리에서 증가하였으며, 이 효과는 TSG-Exo 처리군에서 유의하게 더 컸다(도 11 B). In addition, the expression of M1-type markers of CXCL9, MCP1 and iNOS was decreased in CTL-Exo- and TSG-Exo-treated mice compared to GW-CM-treated mice. CXCL9 levels were significantly reduced in TSG-Exo treated mice compared to CTL-Exo treated mice. M2-type marker expression of Arg1 and CD206 was increased in exosome treatment, and this effect was significantly greater in TSG-Exo treatment group ( FIG. 11B ).
DSS로 유도된 대장염 마우스는 음성 대조군 마우스와 비교하여 대장의 고유판에서 F4/80+CD11b+ 세포(대식세포)의 비율이 유의하게 증가한 것으로 나타났다(도 12 C, D). 엑소좀 처리는 F4/80+CD11b+ 세포의 비율에 영향을 미치지 않았지만(도 12 C, D), 결장 대식세포에서 CD206 및 아르기나제 1의 발현 수준은 TSG-프라이밍된 엑소좀 처리 마우스에서 유의하게 상승했다(도 12 E). 이러한 데이터는 TSG-프라이밍된 엑소좀이 조절 T 세포를 유도하고 M2 형 대식세포를 분극화함으로써 점막 염증을 약화시킨다는 것을 시사한다.DSS-induced colitis mice showed a significant increase in the proportion of F4/80+CD11b+ cells (macrophages) in the lamina propria of the colon compared with the negative control mice ( FIGS. 12C, D ). Although exosome treatment did not affect the proportion of F4/80+CD11b+ cells (Fig. 12 C, D), the expression levels of CD206 and arginase 1 in colonic macrophages were significantly lower in TSG-primed exosome-treated mice. rose (Fig. 12E). These data suggest that TSG-primed exosomes attenuate mucosal inflammation by inducing regulatory T cells and polarizing M2-type macrophages.
[실시예 6] [Example 6]
ER 스트레스 유도된 WJ-MSC 또는 엑소좀 분석 ER stress-induced WJ-MSC or exosome analysis
<6-1> ER 스트레스 유도된 WJ-MSC 특징 확인 <6-1> Confirmation of ER stress-induced WJ-MSC characteristics
인간 MSC의 면역조절 특성에 대한 소포체 스트레스(ER-stress)의 영향을 조사하고자 ER-stress 유도 물질로서 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin, Tu), 브레펠딘 A(Brefeldin A, BFA), 디티오트레이톨(DTT, dithiothreitol) 또는 MG132(MG) 을 상기 실시예 <1-2> 와 동일한 방법으로 각각 처리하여 ER 스트레스가 유도된 WJ-MSC 에서 ER 스트레스 마커 및 염증 유전자의 발현을 확인하였다. To investigate the effect of ER-stress on the immunomodulatory properties of human MSC, thapsigargin (TSG, thapsigargin), tunicamycin (Tu), and Brefeldin A as ER-stress inducers , BFA), dithiothreitol (DTT, dithiothreitol), or MG132 (MG) were treated in the same manner as in Example <1-2>, respectively, to induce ER stress markers and inflammatory genes in WJ-MSCs. Expression was confirmed.
그 결과, [도 13] 에서 나타나는 바와 같이 ER-stress 마커인 GRP94와 CHOP은 인간 MSC에서 ER-stress 유도 물질들을 처리한 후 유의하게 증가하였다. 또한, ER-stress 유발 물질들을 처리한 MSC는 처리하지 않은 MSC보다 항염증성 사이토카인 COX2, IDO 및 IL-10의 발현 수준이 유의하게 높았지만 IL-1β, IFNγ 및 TNFα 포함한 전염증성 사이토카인의 발현은 더 낮음을 확인하였다. As a result, as shown in [Fig. 13], ER-stress markers GRP94 and CHOP were significantly increased after treatment with ER-stress-inducing substances in human MSC. In addition, MSCs treated with ER-stress inducing substances had significantly higher expression levels of anti-inflammatory cytokines COX2, IDO and IL-10 than untreated MSCs, but the expression of pro-inflammatory cytokines including IL-1β, IFNγ and TNFα was found to be lower.
<6-2> ER 스트레스 유도된 WJ-MSC 의 면역 조절 효과 확인-T 세포 증식 억제<6-2> Confirmation of immunomodulatory effect of ER stress-induced WJ-MSC-Inhibition of T cell proliferation
T 세포 증식에서 소포체 스트레스(ER-stress) 유발 물질들이 처리된 MSC의 면역조절 특성을 평가하기 위해서 PBMC과 MSC를 상기 실시예 <1-2> 와 동일한 방법으로 공동배양하였다. In order to evaluate the immunomodulatory properties of MSCs treated with ER-stress-inducing substances in T cell proliferation, PBMCs and MSCs were co-cultured in the same manner as in Example <1-2>.
그 결과, [도 14] 에서 나타나는 바와 같이 ER-stress 유발 물질(TSG, Tu, BFA, DTT, MG)이 처리된 MSC는 처리하지 않은 MSC에 비해 총 T, CD4+, CD8+ T 세포 증식 억제 효과가 더 증가한 것을 확인할 수 있었다. As a result, as shown in [Fig. 14], MSCs treated with ER-stress-inducing substances (TSG, Tu, BFA, DTT, MG) exhibited an inhibitory effect on the proliferation of total T, CD4+, and CD8+ T cells compared to untreated MSCs. It could be seen that there was a further increase.
이러한 결과는 ER-stress 유발 물질들에 의해 ER stress를 받은 MSC가 항염증성 사이토카인 생산을 증가시켜 T 세포 증식 억제를 강화하는데 효과적인 기능을 나타냄을 보여준다.These results show that MSCs subjected to ER stress by ER-stress-inducing substances exhibit an effective function in enhancing the inhibition of T cell proliferation by increasing the production of anti-inflammatory cytokines.
<6-3> ER 스트레스 유도된 WJ-MSC 에서 분비된 엑소좀의 면역 조절 효과 확인-T 세포 증식 억제<6-3> Confirmation of immunomodulatory effect of exosomes secreted from ER stress-induced WJ-MSC-Inhibition of T cell proliferation
ER stress 유발 물질들(TSG, Tu, BFA, DTT, MG)을 처리한 MSC에서 분비된 엑소좀의 면역억제 효과를 확인하기 위해서 PBMC과 엑소좀을 상기 [실시예 2] 와 동일한 방법으로 공동배양하였다. In order to confirm the immunosuppressive effect of exosomes secreted from MSCs treated with ER stress-inducing substances (TSG, Tu, BFA, DTT, MG), PBMCs and exosomes were co-cultured in the same manner as in [Example 2] above. did
그 결과, [도 15] 에서 나타나는 바와 같이 TSG, BFA, Tu 가 처리된 엑소좀이 대조군(cont-exo)에 비해 총 T, CD4　+　T 및 CD8　+　T 세포 증식을　더 강력하게 억제하는 것을 확인할 수 있었다. As a result, as shown in [Fig. 15], it was confirmed that the exosomes treated with TSG, BFA and Tu more strongly inhibited the proliferation of total T, CD4　+　T and CD8　+　T cells compared to the control (cont-exo). could
이러한 결과는 ER-stress 유발 물질들이 MSC에서 개선된 면역 조절 특성을 갖는 엑소좀을 생성할 수 있음을 나타낸다.These results indicate that ER-stress-inducing substances can generate exosomes with improved immunomodulatory properties in MSCs.
[통계 분석][statistical analysis]
통계 분석은 GraphPad Prism v8.0.1 (GraphPad Software, San Diego, CA)을 사용하여 일원 분산 분석(ANOVA)과 Tukey의 다중 비교 테스트를 사용하여 수행되었다. 모든 데이터는 평균 ± S.D로 표시되었다. P-값<0.05는 통계적으로 유의한 것으로 간주되었다.Statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey's multiple comparison test using GraphPad Prism v8.0.1 (GraphPad Software, San Diego, CA). All data are presented as mean ± S.D. P-values <0.05 were considered statistically significant.
본 발명에 따라 소포체 스트레스 유발 물질을 처리한 중간엽 줄기세포 유래 엑소좀(TSG-Exo)은 항 염증 사이토카인, 조절 T 세포 내지 M2 유형 대식세포의 수준이 증가되고, 전 염증 사이토카인, 도움 T 세포 내지 M1 유형 대식세포 수준이 감소되는 등 면역 조절 능력이 증가되며, 대장염 마우스 모델에서 효과적으로 염증을 완화시켰다. 따라서, 본 발명은 염증성 질환 예방 또는 치료용 조성물 내지 면역 조절용 조성물로서 효과적으로 사용될 수 있어 산업상 이용가능성이 있다. Mesenchymal stem cell-derived exosomes (TSG-Exo) treated with ER stress-inducing substances according to the present invention increase the levels of anti-inflammatory cytokines, regulatory T cells to M2-type macrophages, and pro-inflammatory cytokines, helper T Immunomodulatory ability was increased, such as a decrease in the cell to M1-type macrophage level, and inflammation was effectively alleviated in a mouse model of colitis. Therefore, the present invention can be effectively used as a composition for preventing or treating inflammatory diseases or as a composition for immune modulation, and thus has industrial applicability.
서열번호 1 은 hCOX-2 의 정방향 프라이머 서열에 해당한다. SEQ ID NO: 1 corresponds to the forward primer sequence of hCOX-2.
서열번호 2 는 hCOX-2 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 2 corresponds to the reverse primer sequence of hCOX-2.
서열번호 3 은 hIDO 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 3 corresponds to the forward primer sequence of hIDO.
서열번호 4 는 hIDO 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 4 corresponds to the reverse primer sequence of hIDO.
서열번호 5 는 hIFNγ 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 5 corresponds to the forward primer sequence of hIFNγ.
서열번호 6 은 hIFNγ 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 6 corresponds to the reverse primer sequence of hIFNγ.
서열번호 7 은 hIL-10 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 7 corresponds to the forward primer sequence of hIL-10.
서열번호 8 은 hIL-10 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 8 corresponds to the reverse primer sequence of hIL-10.
서열번호 9 는 hIL-1β 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 9 corresponds to the forward primer sequence of hIL-1β.
서열번호 10 은 hIL-1β 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 10 corresponds to the reverse primer sequence of hIL-1β.
서열번호 11 은 hNOS2 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 11 corresponds to the forward primer sequence of hNOS2.
서열번호 12 는 hNOS2 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 12 corresponds to the reverse primer sequence of hNOS2.
서열번호 13 은 hTGFβ 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 13 corresponds to the forward primer sequence of hTGFβ.
서열번호 14 는 hTGFβ 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 14 corresponds to the reverse primer sequence of hTGFβ.
서열번호 15 는 hTNFα 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 15 corresponds to the forward primer sequence of hTNFα.
서열번호 16 은 hTNFα 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 16 corresponds to the reverse primer sequence of hTNFα.
서열번호 17 은 mArg1 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 17 corresponds to the forward primer sequence of mArg1.
서열번호 18 은 mArg1 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 18 corresponds to the reverse primer sequence of mArg1.
서열번호 19 는 mCD206 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 19 corresponds to the forward primer sequence of mCD206.
서열번호 20 은 mCD206 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 20 corresponds to the reverse primer sequence of mCD206.
서열번호 21 은 mCXCL9 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 21 corresponds to the forward primer sequence of mCXCL9.
서열번호 22 는 mCXCL9 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 22 corresponds to the reverse primer sequence of mCXCL9.
서열번호 23 은 mFoxp3 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 23 corresponds to the forward primer sequence of mFoxp3.
서열번호 24 는 mFoxp3 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 24 corresponds to the reverse primer sequence of mFoxp3.
서열번호 25 는 mGATA3 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 25 corresponds to the forward primer sequence of mGATA3.
서열번호 26 은 mGATA3 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 26 corresponds to the reverse primer sequence of mGATA3.
서열번호 27 은 miNOS 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 27 corresponds to the forward primer sequence of miNOS.
서열번호 28 은 miNOS 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 28 corresponds to the reverse primer sequence of miNOS.
서열번호 29 는 mMCP1 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 29 corresponds to the forward primer sequence of mMCP1.
서열번호 30 은 mMCP1 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 30 corresponds to the reverse primer sequence of mMCP1.
서열번호 31 은 mRORγ 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 31 corresponds to the forward primer sequence of mRORγ.
서열번호 32 는 mRORγ 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 32 corresponds to the reverse primer sequence of mRORγ.
서열번호 33 은 mT-bet 의 정방향 프라이머 서열에 해당한다.SEQ ID NO: 33 corresponds to the forward primer sequence of mT-bet.
서열번호 34 는 mT-bet 의 역방향 프라이머 서열에 해당한다.SEQ ID NO: 34 corresponds to the reverse primer sequence of mT-bet.

Claims (10)

  1. 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물. A pharmaceutical composition for preventing or treating inflammatory diseases comprising exosomes derived from mesenchymal stem cells treated with an endoplasmic reticulum stress-inducing substance.
  2. 제1항에 있어서, 상기 소포체 스트레스 유발 물질은, 탑시가르긴(TSG, thapsigargin), 튜니카마이신(Tunicamycin), 브레펠딘 A(Brefeldin A), 디티오트레이톨(DTT, dithiothreitol) 및 MG132 으로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 약학적 조성물. According to claim 1, wherein the endoplasmic reticulum stress-inducing substance, thapsigargin (TSG, thapsigargin), tunicamycin (Tunicamycin), brefeldin A (Brefeldin A), dithiothreitol (DTT, dithiothreitol) and MG132 consisting of Pharmaceutical composition, characterized in that any one or more selected from the group.
  3. 제1항에 있어서, 상기 중간엽 줄기세포는 지방 조직, 골수, 제대혈, 양수, 와튼 젤리(Wharton's jelly), 태반, 말초 혈액, 나팔관, 각막 기질, 폐, 근육 및 태아 간 으로 이루어진 군에서 선택되는 어느 하나 이상의 조직에서 수득된 중간엽 줄기세포인 것을 특징으로 하는 약학적 조성물. According to claim 1, wherein the mesenchymal stem cells are selected from the group consisting of adipose tissue, bone marrow, umbilical cord blood, amniotic fluid, Wharton's jelly, placenta, peripheral blood, fallopian tubes, corneal stroma, lung, muscle and fetal liver. A pharmaceutical composition, characterized in that the mesenchymal stem cells obtained from any one or more tissues.
  4. 제1항에 있어서, 상기 엑소좀의 크기는 10 내지 200 nm 인 것을 특징으로 하는 약학적 조성물. The pharmaceutical composition according to claim 1, wherein the size of the exosome is 10 to 200 nm.
  5. 제1항에 있어서, 상기 염증성 질환은 급성 또는 만성 염증질환, 만성 기관지염, 비염, 관절염, 자가면역질환, 이식거부 및 염증성 장 질환 으로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 약학적 조성물. The pharmaceutical composition according to claim 1, wherein the inflammatory disease is at least one selected from the group consisting of acute or chronic inflammatory disease, chronic bronchitis, rhinitis, arthritis, autoimmune disease, transplant rejection, and inflammatory bowel disease.
  6. 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 면역 조절용 조성물.A composition for immune regulation comprising exosomes derived from mesenchymal stem cells treated with an endoplasmic reticulum stress-inducing substance.
  7. 제6항에 있어서, 상기 면역 조절은 항-염증 사이토카인(anti-inflammatory cytokine), 조절 T 세포(regulatory T cell) 및 M2 유형 대식세포(M2-type macrophage)의 수준을 증가시키고, 전-염증 사이토카인(pro-inflammatory cytokine), 도움 T 세포(helper T cell) 및 M1 유형 대식세포(M1-type macrophage)은 감소시키는 면역 조절인 것을 특징으로 하는 조성물. The method of claim 6, wherein the immune modulation increases the levels of anti-inflammatory cytokines, regulatory T cells and M2-type macrophages, and pro-inflammatory Cytokines (pro-inflammatory cytokine), helper T cells (helper T cells) and M1-type macrophages (M1-type macrophage) is a composition, characterized in that the immune modulation to reduce.
  8. 소포체 스트레스 유발 물질을 중간엽 줄기세포에 처리하는 단계를 포함하는 중간엽 줄기세포 유래 엑소좀의 생산 촉진 방법.A method for promoting production of mesenchymal stem cell-derived exosomes comprising the step of treating the endoplasmic reticulum stress-inducing substance to the mesenchymal stem cells.
  9. 염증성 질환 환자에게 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환의 치료 방법. A method of treating an inflammatory disease comprising administering a composition comprising a mesenchymal stem cell-derived exosome treated with an endoplasmic reticulum stress-inducing substance to an inflammatory disease patient.
  10. 염증성 질환 예방 또는 치료에 사용하기 위한 소포체 스트레스 유발 물질로 처리된 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물의 용도. Use of a composition comprising mesenchymal stem cell-derived exosomes treated with an endoplasmic reticulum stress-inducing substance for use in the prevention or treatment of inflammatory diseases.
PCT/KR2021/018961 2020-12-14 2021-12-14 Exosomes derived from cells treated with material inducing endoplasmic reticulum stress, and use thereof WO2022131742A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2023536117A JP2023554034A (en) 2020-12-14 2021-12-14 Exosomes derived from cells treated with endoplasmic reticulum stress inducers and their uses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200174576 2020-12-14
KR10-2020-0174576 2020-12-14

Publications (1)

Publication Number Publication Date
WO2022131742A1 true WO2022131742A1 (en) 2022-06-23

Family

ID=82059275

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/018961 WO2022131742A1 (en) 2020-12-14 2021-12-14 Exosomes derived from cells treated with material inducing endoplasmic reticulum stress, and use thereof

Country Status (3)

Country Link
JP (1) JP2023554034A (en)
KR (1) KR20220085036A (en)
WO (1) WO2022131742A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117224575A (en) * 2023-10-26 2023-12-15 山东第一医科大学附属眼科研究所(山东省眼科研究所、山东第一医科大学附属青岛眼科医院) Application of regulatory T cell exosome in preparation of medicine for promoting cornea damage repair

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180116163A (en) * 2017-04-14 2018-10-24 서울대학교산학협력단 A Method for Reducing Differentiation or Activity of Th17 Cells Comprising EID3 or EID3 Expressing MSC-Exosome
KR20190103166A (en) * 2016-11-30 2019-09-04 더 리전트 오브 더 유니버시티 오브 캘리포니아 Extracellular vesicles and methods and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190103166A (en) * 2016-11-30 2019-09-04 더 리전트 오브 더 유니버시티 오브 캘리포니아 Extracellular vesicles and methods and uses thereof
KR20180116163A (en) * 2017-04-14 2018-10-24 서울대학교산학협력단 A Method for Reducing Differentiation or Activity of Th17 Cells Comprising EID3 or EID3 Expressing MSC-Exosome

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JOO HANSOL, OH MI-KYUNG, KANG JI YEON, PARK HYUN SUNG, CHAE DONG-HOON, KIM JIEUN, LEE JONG-HEE, YOO HEE MIN, CHOI UIMOOK, KIM DO-K: "Extracellular Vesicles from Thapsigargin-Treated Mesenchymal Stem Cells Ameliorated Experimental Colitis via Enhanced Immunomodulatory Properties", BIOMEDICINES, vol. 9, no. 2, pages 209, XP055944284, DOI: 10.3390/biomedicines9020209 *
JOO HYEON SU, JU HUN SUH, HYEON JI LEE, EUN SONG BANG, JUNG MIN LEE: "Current Knowledge and Future Perspectives on Mesenchymal Stem Cell-Derived Exosomes as a New Therapeutic Agent", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 21, no. 3, 22 January 2020 (2020-01-22), XP055862542, DOI: 10.3390/ijms21030727 *
WANG JING-HUA, LIU XIAO-LING, SUN JIAN-MEI, YANG JING-HAN, XU DONG-HUA, YAN SHU-SHAN: "Role of mesenchymal stem cell derived extracellular vesicles in autoimmunity: A systematic review", WORLD JOURNAL OF STEM CELLS, BEIJING BAISHIDENG BIOMED SCIENTIFIC CO., LTD, CN, vol. 12, no. 8, 26 August 2020 (2020-08-26), CN , pages 879 - 896, XP055944283, ISSN: 1948-0210, DOI: 10.4252/wjsc.v12.i8.879 *
YANG RUILI, HUANG HUAMING, CUI SHENGJIE, ZHOU YIKUN, ZHANG TING, ZHOU YANHENG: "IFN-γ promoted exosomes from mesenchymal stem cells to attenuate colitis via miR-125a and miR-125b", CELL DEATH & DISEASE, vol. 11, no. 7, 1 July 2020 (2020-07-01), XP055944282, DOI: 10.1038/s41419-020-02788-0 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117224575A (en) * 2023-10-26 2023-12-15 山东第一医科大学附属眼科研究所(山东省眼科研究所、山东第一医科大学附属青岛眼科医院) Application of regulatory T cell exosome in preparation of medicine for promoting cornea damage repair

Also Published As

Publication number Publication date
KR20220085036A (en) 2022-06-21
JP2023554034A (en) 2023-12-26

Similar Documents

Publication Publication Date Title
WO2018074758A2 (en) Method for sorting highly effective stem cells for treating immune disorder
WO2018097540A9 (en) Serum-free immune cell-culturing medium-added kit, method for culturing immune cells by using same kit, serum-free immune cell culture obtained by same kit or culturing method, and cosmetic composition comprising same culture
WO2016048107A1 (en) Pharmaceutical composition for preventing or treating immune diseases or inflammatory diseases, comprising interferon-gamma or interleukin-1 beta treated stem cell or culture thereof
WO2019198995A1 (en) Exosome-based conversion method for immune cells
WO2019117633A1 (en) Cosmetic composition and pharmaceutical composition for alleviating atopic dermatitis, hair loss, and wounds or reducing skin wrinkles
WO2022131742A1 (en) Exosomes derived from cells treated with material inducing endoplasmic reticulum stress, and use thereof
KR20150144679A (en) Composition for preventing or treating immune disease comprising mesenchymal stem cell treated stat3 inhibitor
WO2017146538A1 (en) Pharmaceutical composition for preventing or treating regulatory t cell-mediated diseases
Dong et al. Mesenchymal stem cells inhibited dendritic cells via the regulation of STAT1 and STAT6 phosphorylation in experimental autoimmune uveitis
Pereira et al. Effects of bone marrow mesenchymal stromal cell therapy in experimental cutaneous leishmaniasis in BALB/c mice induced by Leishmania amazonensis
AU2020203955B2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2019035668A9 (en) Composition for treatment of thyroid associated ophthalmopathy, comprising mesenchymal stem cell
WO2022092915A1 (en) Composition for preventing and treating immune diseases containing gdf15 as active ingredient
WO2019103436A9 (en) Composition for culturing nk cells and method for culturing nk cells using same
WO2015199402A1 (en) Method for preparing dendritic cells with increased specific gene expression, and composition for treating or preventing autoimmune diseases, containing dendritic cells prepared using same
WO2016117960A1 (en) Mesenchymal stem cells over-expressed by grim19 efficacious in treating immune disease, and use thereof
WO2022108165A1 (en) Method for producing exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cells, and use thereof
WO2015023147A1 (en) Mtor/stat3 signal inhibitor-treated mesenchymal stem cell having immunomodulatory activity, and cell therapy composition comprising same, for preventing or treating immune disorders
WO2021187911A1 (en) Cord blood plasma-derived exosome or mimetic thereof and pharmaceutical use thereof
WO2019027214A9 (en) Allogeneic mesenchymal stem cell and use thereof
WO2015023165A1 (en) Inflammation-controlling composite and stabilized mesenchymal stem cells having optimized immunity control function by blocking stat3 signal molecule
WO2015194710A1 (en) Composition comprising mesenchymal stem cells treated with stat3 inhibitor as active ingredient for preventing or treating immune diseases
WO2019212123A1 (en) Method for increasing dendritic cell migration ability, and use thereof
WO2020106097A1 (en) Composition, comprising mesenchymal stem cells, for inhibiting adipogenesis
WO2024143863A1 (en) Method for culturing dendritic cells having enhanced immunogenicity mediated by adjacent immune cells activated by interleukin-33, and method for activating cytotoxic t cells using dendritic cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21907046

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023536117

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21907046

Country of ref document: EP

Kind code of ref document: A1