WO2022124760A1 - Composition for inducing or enhancing generation of cones or cone-like rods - Google Patents

Abstract

Provided is a composition for inducing or enhancing the generation of cones or cone-like rods, the composition comprising an asymmetric RNAi-inducing nucleic acid molecule to inhibit the expression of the neural retina leucine zipper (NRL) gene.

Description

Compositions for inducing or enhancing the production of cone cells or cone-like rod cells

The present invention relates to a composition for inducing or enhancing the production of cone cells or cone-like rod cells, and more particularly, to a composition comprising an asymmetric RNAi-inducing nucleic acid molecule that inhibits the expression of a Neural retina leucine zipper (NRL) gene. It relates to a composition for inducing or enhancing the production of cone cells or cone cell-like rod cells. This patent application claims priority to Korean Patent Application No. 10-2020-0169854 filed with the Korean Intellectual Property Office on December 07, 2020, the disclosure of which is incorporated herein by reference.

Rod cells are very sensitive to light, so they can detect small amounts of light in dim conditions. Conversely, cone cells are less sensitive, so they can process large amounts of light during the day and continuously transmit visual signals. It is known that in many mammalian species, including mice and humans, the number of rods mediating vision under dim light greatly exceeds the number of cones. However, in an industrialized world where lighting forces cones to work all day, rod-mediated vision is less important. A number of patients have been identified who lack rod cell function from birth, and there is a report that they were virtually unable to recognize their abnormal visual acuity (Dryja, 2000). Conversely, when there is a dysfunction of the cone cells, the patient always shows symptoms and often suffers from visual handicap depending on the degree of their cone dysfunction. Also, in some cases, cone cells are lost or dysfunction occurs, and rods remain relatively conserved. For example, in patients with complete color blindness (achromatopsia), a case of severe hereditary retinal dystrophy (retinal dystrophy) having a normal rod function despite the complete absence of cone function from birth has been reported (Hess et al, 1986) (Hess et al, 1986) ; Nishiguchi et al, 2005). Even in the case of age related macular degeneration (AMD), visual impairment is mainly caused by degeneration of the cone-rich fovea in the central macula. Thus, the patient loses central vision and acuity, but often the peripheral macula is relatively well preserved, albeit limited by the lack of cones, some useful residual vision outside the fovea. (residual vision) Korean Patent Laid-Open No. 10-2018-0012737 discloses a method for improving visual acuity by extending the function of rod cells using a nucleic acid encoding a gene product regulating endogenous photosensitive signal transduction in visual cells.

On the other hand, many transcriptional regulators act in the process of retinal photoreceptor differentiation and normal physiological activity. Among them, NRL transcriptional activator was identified in Swaroop et al. 266-270 (1992)). To date, there are various research results showing that NRL plays a very important function in the differentiation process of rod and cone cells.

However, there are still no research results on a therapeutic agent for improving eyesight that can induce or enhance the generation of cone cells or expand the function of rod cells by regulating the NRL gene.

In order to solve the above problems, the inventors of the present invention developed a nucleic acid molecule for inducing asymmetric RNAi that inhibits the expression of the NRL gene, and the nucleic acid molecule for inducing asymmetric RNAi is a cone cell or cone-like rod cell. By confirming that the nucleic acid molecule for inducing asymmetric RNAi can be applied to a therapeutic agent for improving eyesight by confirming that it can induce or enhance the production of , the present invention has been completed.

One object of the present invention is to provide a composition for inducing or enhancing the production of cones or cone-like rods, which includes a nucleic acid molecule for inducing asymmetric RNAi that suppresses the expression of NRL gene.

Another object of the present invention is to provide a nucleic acid molecule for inducing asymmetric RNAi or a pharmaceutical composition for improving eyesight, a pharmaceutical composition for improving or treating ocular or retinal diseases, or a composition for cell culture comprising the composition.

Another object of the present invention is to provide a method for inducing or enhancing the generation of cone cells or cone-like rod cells using the asymmetric RNAi-inducing nucleic acid molecule or the composition, or a method for improving or treating ocular or retinal diseases. do.

Another object of the present invention is the use of the nucleic acid molecule for inducing asymmetric RNAi or a composition comprising the same, for inducing or enhancing the production of cone cells or cone-like rods, for improving visual acuity, or for ocular or An object of the present invention is to provide a use for improving or treating retinal diseases.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

In order to achieve the above object, the present invention provides a composition for inducing or enhancing the production of cones or cone-like rods, comprising a nucleic acid molecule for inducing asymmetric RNAi that inhibits the expression of NRL gene.

The present invention also provides a nucleic acid molecule for inducing asymmetric RNAi or a pharmaceutical composition for improving eyesight, or a pharmaceutical composition for improving or treating ocular or retinal diseases, comprising the composition.

The present invention also provides a composition for cell culture for inducing or enhancing the production of the asymmetric RNAi-inducing nucleic acid molecule or a cone or cone-like rod comprising the composition.

The present invention also provides a method for inducing or enhancing the production of cone cells or cone-like rods using the nucleic acid molecule for inducing asymmetric RNAi or the composition.

The present invention also provides a method for improving or treating an ocular or retinal disease, comprising administering the nucleic acid molecule for inducing asymmetric RNAi or the composition to a subject.

The present invention also relates to the use of the nucleic acid molecule for inducing asymmetric RNAi or a composition comprising the same, for inducing or enhancing the production of cone cells or cone-like rods, for improving visual acuity, or for ocular or retinal diseases. Provides a use for improving or treating

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

Definitions of key terms used in the detailed description of the present invention are as follows.

"RNAi (RNA interference)" refers to double-stranded RNA (dsRNA) composed of a strand having a sequence homologous to the mRNA of a target gene and a strand having a sequence complementary to this by introducing into a cell, etc. the target gene mRNA. It refers to a mechanism for suppressing the expression of a target gene by inducing degradation.

"Nucleic acid molecules inducing RNAi" refers to any nucleic acid molecule capable of inhibiting or down-regulating gene expression or viral replication by mediating said RNA interference in a sequence-specific manner. The term may refer to both an individual nucleic acid molecule, a plurality of said nucleic acid molecules, or a pool of said nucleic acid molecules. In one embodiment, the nucleic acid molecule for inducing RNAi may be siRNA.

“Small interfering RNA (siRNA)” refers to a short double-stranded RNA (dsRNA) that mediates sequence-specifically efficient gene silencing.

An "antisense strand" is a polynucleotide substantially or 100% complementary to a target nucleic acid of interest, for example, messenger RNA (mRNA), a non-mRNA RNA sequence (e.g., microRNA, piwiRNA). , tRNA, rRNA, and hnRNA), or coding or non-coding DNA sequences, in whole or in part.

The term "sense strand" is a polynucleotide having the same nucleic acid sequence as a target nucleic acid, wherein the mRNA (messenger RNA), non-mRNA RNA sequence (e.g., microRNA, piwiRNA, tRNA, rRNA, and hnRNA), or coding or Refers to a polynucleotide identical in whole or in part to a non-coding DNA sequence.

A “gene” is to be taken in its broadest sense and may encode a structural protein or a regulatory protein. In this case, the regulatory protein includes a transcription factor, a heat shock protein, or a protein involved in DNA/RNA replication, transcription, and/or translation. In the present invention, the target gene to be suppressed is inherent in the viral genome, and may be integrated into an animal gene or exist as an extrachromosomal component. For example, the gene of interest may be a gene on the HIV genome. In this case, the siRNA molecule is useful for inactivating translation of an HIV gene in a mammalian cell.

"NRL (Neural retina leucine zipper)" is a transcription factor that attaches to the promoter of a gene that has characteristics of rod cells, such as rhodosin, so that retinal precursor cells are differentiated into rod cells. NRL prevents retinal progenitor cells from differentiating into cones either directly or through downstream Nr2e3. Therefore, NRL is an important factor that allows retinal progenitor cells to differentiate into rod cells.

"Cone cell" refers to photoreceptor cells in the retina of the eye, which are densely packed in the center of the macula even in the retina and have a plump shape. The cone cells can sense bright light of about 0.1 Lux or more, can distinguish colors, and are also referred to as cone cells.

"Rod cell" refers to a photoreceptor cell in the retina of the eye, which is widely distributed in the periphery of the retina and has an elongated shape sensitive to weak light. The rod cells sense the light and shade and the shape of the object, but cannot distinguish the color, and can sense a weak light of about 0.1 Lux or less.

"Cone cell-like rod cell" refers to a rod cell having the properties of a cone cell due to loss or reduction in the original properties of the rod cell. The cone cell-like rod cells may be generated during the production process of rod cells, or may be generated when completely generated rod cells change their properties and are converted into cone cell-like rod cells.

Color blindness refers to a genetic trait that does not properly distinguish colors due to abnormalities in the photoreceptor cells of the retina, and is also called color vision abnormality. In many cases, color blindness is due to congenital causes, but it can also be acquired. Most color blindness is caused by abnormalities in the cone cells that can distinguish colors. Specifically, in patients with complete color blindness (achromatopsia), the case of severe hereditary retinal dystrophy (retinal dystrophy) with a complete absence of cone function from birth but normal rod function has been reported (Hess et al, 1986; Nishiguchi et al, 2005). Therefore, there is a possibility to improve or treat the symptoms or diseases of color blindness by inducing or enhancing the production of cone cells or cone cell-like rod cells.

In the present invention, the nucleic acid molecule for inducing RNAi may be characterized in that the sense strand has a length of 15 to 17 nt and the antisense strand has a length of 16 nt or more. Although not limited thereto, the antisense strand may be characterized as having a length of 16 to 31 nt, preferably having a length of 19 to 26 nt. More preferably, the length of the sense strand is 16 nt, and the length of the antisense strand complementary thereto may be characterized in that it is 19 nt, 24 nt, 25 nt, or 26 nt, but is not limited thereto.

The 3' end of the sense strand and the 5' end of the antisense strand form a blunt end. The 3' end of the antisense strand may include, for example, an overhang of 1 to 16 nt.

In the present invention, the sense strand or the antisense strand of the nucleic acid molecule for inducing RNAi may include one or more chemical modifications.

General siRNA cannot pass through the cell membrane for reasons such as high negative charge and high molecular weight due to the phosphate backbone structure, and it is rapidly degraded and removed from the blood, so it is difficult to deliver a sufficient amount for RNAi induction to the actual target site. Currently, in the case of in vitro delivery, many high-efficiency delivery methods using cationic lipids and cationic polymers have been developed, but in vivo, it is difficult to deliver siRNA as high as in vitro, and it is difficult to There is a problem in that the siRNA delivery efficiency is reduced due to the interaction.

Accordingly, the present inventors introduced a chemical modification to the asymmetric siRNA structure to develop an asiRNA construct (cp-asiRNA) with self-delivery ability that can be effectively and intracellularly delivered without a separate carrier.

In the present invention, the chemical modification in the sense strand or the antisense strand may include one or more selected from the group consisting of:

-OH group at the 2' carbon position of the sugar structure in the nucleotide is -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine), -O-2-methoxyethyl-O-propyl ( propyl), -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; replacement of oxygen in the nucleotide structure with sulfur; nucleotide linkages are modified with phosphorothioate, boranophosphate, or methyl phosphonate; transformation into peptide nucleic acid (PNA), locked nucleic acid (LNA), or unlocked nucleic acid (UNA) form; and a phosphate group, a lipophilic compound, or a cell penetrating peptide bond.

In the present invention, the lipophilic compound is cholesterol, tocopherol, stearic acid, retinoic acid, DHA (docosahexaenoic acid), palmitic acid, linoleic acid ), linolenic acid, and any one or more selected from the group consisting of long-chain fatty acids having 10 or more carbon atoms. Preferably, it may be characterized as cholesterol, but is not limited thereto.

In one embodiment, the sense strand may comprise one or more chemical modifications selected from: 2 to 4 nucleotide bonds adjacent to the 3' end are phosphorothioate, boranophosphate, or modified with methyl phosphonate; -OH group at the 2' carbon position of the sugar structure within 2 or more nucleotides is -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine), -O-2-methoxyethyl-O substituted with -propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; and binding of a lipophilic compound or a cell penetrating peptide to the 3' end.

In one embodiment, the antisense strand may contain any one or more chemical modifications selected from the following: 3 to 5 nucleotide bonds adjacent to the 3' end are phosphorothioate, boranophosphate ), or modified with methyl phosphonate; -OH group at the 2' carbon position of the sugar structure within 2 or more nucleotides is -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine), -O-2-methoxyethyl -O substituted with -propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; and binding of a phosphate group or a cell penetrating peptide to the 5' end.

In another embodiment, in the nucleic acid molecule for inducing RNAi, the -OH group at the 2' carbon position of the sugar structure within two or more nucleotides of the sense strand or the antisense strand is replaced with -OCH ₃ (methoxy) or -F (fluorine) being transformed; at least 10% of the nucleotide linkages in the sense strand or the antisense strand are modified to phosphorothioate; cholesterol binding to the 3' end of the sense strand; and one or more modifications selected from the group consisting of a phosphate group bond to the 5' end of the antisense strand.

Exemplary nucleic acid molecules for inducing RNAi may include the following sense strands:

mC(2'-F-G)mG(2'-F-C)mG(2'-F-C)mU(2'-F-G)mG(2'-F-U)mC(2'-F-U)mC(2'-F-G)* mA*(2'-F-U)*-Chol.

In addition, exemplary nucleic acid molecules for inducing RNAi may include the following antisense strands:

PmA(2'-F-U)mC(2'-F-G)mA(2'-F-G)mA(2'-F-C)mC(2'-F-A)mG(2'-F-C)mG(2'-F-C)mC (2'-F-G)mC(2'-F-G)mU(2'-F-C)mG(2'-F-G)*mA*(2'-F-A)*mA*(2'-F-A).

In the above, * is a phosphorothioate bond (phosphorothioated bond) modification, m is 2'-O-methyl (Methyl) substitution, 2'-F- is 2'-Fluoro substitution, -chol denotes a bond with 3'-cholesterol, and P denotes a bond with a 5'-phosphate group.

In the present invention, one to three phosphate groups may be bonded to the 5' end of the antisense strand, but the present invention is not limited thereto.

In the present invention, the nucleic acid molecule for inducing RNAi may be characterized in that it inhibits the expression of the NRL gene. The nucleic acid molecule for inducing RNAi may be characterized in that it inhibits the expression of the NRL gene by complementary binding to the mRNA encoding the NRL. Accordingly, the NRL gene, for example, the mRNA encoding the NRL may include a target sequence targeted by the RNAi-inducing nucleic acid molecule.

In another aspect, the present invention relates to a composition for inducing or enhancing the production of cones or cone-like rods comprising the nucleic acid molecule for inducing RNAi.

In one embodiment, the RNAi-inducing nucleic acid molecule can induce a decrease in the number of rod cells and an increase in the number of cone cells among photoreceptor cells. Specifically, the RNAi-inducing nucleic acid molecule can suppress the expression of the NRL gene, and thus, the original properties of rod cells are lost or reduced in the process of rod cell generation, and thus cone cell-like properties with cone-like properties. It can induce the production of rod cells. In addition, the RNAi-inducing nucleic acid molecule can inhibit the expression of the NRL gene, thereby changing the properties of previously generated rod cells to those of cone cells, thereby converting rod cells into cone-like rod cells. can In addition, the RNAi-inducing nucleic acid molecule can inhibit the expression of the NRL gene, thereby inducing a decrease in the number of rod cells and an increase in the number of cone cells. The decrease in the number of rod cells may be due to reduced differentiation into rod cells or promotion of rod cell death. In addition, the increase in the number of the cone cells may be due to promotion of differentiation or proliferation into cone cells.

Accordingly, the composition comprising the RNAi-inducing nucleic acid molecule can induce or enhance the production of cone cells or cone-like rod cells. Specifically, the composition can inhibit the expression of the NRL gene, whereby the original properties of the rod cells are lost or reduced in the process of generating rod cells, thereby preventing the production of cone-like rod cells having cone-like properties. induce; converting rod cells into cone-like rod cells by changing the properties of previously generated rod cells to those of cone cells; It can induce an increase in the number of cone cells themselves.

Accordingly, the RNAi-inducing nucleic acid molecule or a composition comprising the same induces or enhances the production of cone cells or cone-like rod cells in a state in which cone cells are lost or dysfunctional, thereby supplementing the dysfunction of cone cells. Since it can contribute, it can be utilized as an active ingredient of a pharmaceutical composition for improving eyesight, or a pharmaceutical composition for improving or treating eye or retinal diseases.

Accordingly, in another aspect, the present invention relates to a pharmaceutical composition for improving eyesight comprising the RNAi-inducing nucleic acid molecule, and inducing or enhancing the production of cone cells or cone-like rod cells.

In another aspect, the present invention relates to a pharmaceutical composition for improving or treating ocular or retinal diseases, including the RNAi-inducing nucleic acid molecule, and inducing or enhancing the production of cone cells or cone-like rod cells.

The ocular or retinal disease is a condition in which cone cells are lost or malfunctioning, by inducing or enhancing the production of cone cells or cone cell-like rod cells, thereby compensating or supplementing the functional abnormality of cone cells. It may include any disease that can be treated. Preferably, the ocular or retinal disease may be a disease in which cone cells are lost or malfunctioning, while rod cells are normally present.

Most preferably, the ocular or retinal disease may be a disease accompanying color blindness or color blindness. Specifically, the color blindness may be congenital or acquired. In addition, the color blindness may be complete color blindness, partial color blindness, or color weakness. The complete color blindness refers to a case in which cone cells that discriminate colors do not exist in the retina at all in achromatopsia, and refers to a symptom or disease that cannot distinguish colors at all, unlike other color blindness. The partial color blindness is caused by a lack of cone cells that recognize the three primary colors of red, green, and blue in the retina, and refers to a symptom or disease in which some colors cannot be distinguished. The partial color blindness may be at least one selected from the group consisting of a first color vision or more, a second color vision or more, and a third color vision or more. The first color vision abnormality refers to a symptom or disease in which there is no L cone cell (ρ cell) for recognizing red, red and green cannot be distinguished, and red is recognized as a dark color. The second color vision abnormality does not have M cone cells (Г cells) that recognize green and cannot distinguish red from green like the first color vision abnormality, but in this case, unlike the first color vision abnormality, green is recognized as a dark color. means a symptom or disease. The third color vision abnormality refers to a symptom or disease in which S cone cells (β cells) that recognize blue do not exist, cannot distinguish between blue and yellow, and recognize blue as dark green and yellow as pale red. . The color weakness refers to a symptom or disease in which a low-saturation color cannot be recognized or distinguished in a short time.

The pharmaceutical composition may be prepared by including one or more pharmaceutically acceptable carriers in addition to the nucleic acid molecule for inducing RNAi as an active ingredient. A pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or two or more of these ingredients may be used by mixing, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, or the like. In particular, it is preferable to provide the formulation in a lyophilized form. For the preparation of the freeze-dried formulation, a method commonly known in the art to which the present invention pertains may be used, and a stabilizer for freeze-drying may be added.

The method of administering the pharmaceutical composition may be determined by a person skilled in the art based on the symptoms of the patient and the severity of the disease. In addition, it may be formulated in various forms such as powders, tablets, capsules, liquids, injections, ointments, syrups, etc., and may be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles. .

The pharmaceutical composition of the present invention can be administered orally or parenterally. The route of administration of the composition according to the present invention is not limited thereto, but for example, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual , or topical administration is possible. The dosage of the composition according to the present invention varies according to the patient's weight, age, sex, health status, diet, administration time, method, excretion rate, or severity of disease, etc., and a person of ordinary skill in the art can be easily determined. In addition, the composition of the present invention may be formulated into a suitable dosage form for clinical administration using known techniques.

In another aspect, the present invention relates to a cell culture composition for inducing or enhancing the production of the RNAi-inducing nucleic acid molecule or cone cells or cone-like rod cells comprising the composition.

The cell culture composition comprises culturing any one or more cells selected from the group consisting of stem cells, retinal progenitor cells, retinal organoid cells, photoreceptor progenitor cells, cone cells, or rod cells to obtain cone cells or cone cells. - It is for inducing or enhancing the production of rod-like cells, and may be provided in the form of a medium composition or a medium raw material composition.

The stem cells may be induced pluripotent stem cells (iPS cells). The retinal precursor cells may refer to cells just before stem cells are differentiated into retinal cells. The retinal organoid cells may refer to cells in which stem cells are grown in vitro to implement a tissue such as a human retinal structure. The photoreceptor progenitor cells may refer to cells just before stem cells are differentiated to become photoreceptor cells, that is, cone cells or rod cells.

The composition for cell culture is a medium containing components capable of differentiating or proliferating cells, but is not limited thereto, but is not limited thereto, but is not limited thereto, but is not limited thereto, but is DMEM (Dulbecco's Modified Eagle's Medium), 80% knockout DMEM, MEM (Minimal Essential Medium), BME (Basal). Medium Eagle), RPMI 1640, F-10, F-12, B27, DMEM-F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MEM Non-Essential Amino Acids Solution, MacCoy's 5A Medium, AmnioMax, AminoMaxII complete Medium, Chang's Medium MesemCult-XF Medium, Neural induction medium, and Neural Retinal Differentiation Medium It may contain ingredients or components of the medium. In addition, the composition for cell culture is 20% knockout serum replacer (Gibco), glutamine, mercaptoethanol, non-essential amino acids, basic fibroblast growth factor (bFGF), vitronectin recombinant human protein (Vitronectin Recombinant Human Protein) ), N2 Supplement, heparin, fetal bovine serum, taurine, glutamax, blebbistatin, and the like may be additionally included.

The composition for cell culture for inducing or enhancing the production of the cone cells or cone cell-like rod cells contains about 0.01 to 100 μM, about 0.01 to 50 μM, about 0.01 to 10 μM, about the RNAi-inducing nucleic acid molecule. It may be included in a concentration of 0.01 to 5 μM, about 0.01 to 1 μM, about 0.01 to 0.5 μM, about 0.05 to 0.5 μM, or about 0.1 to 0.2 μM. According to one embodiment, when the composition for cell culture for inducing or promoting the production of the cone cells or cone cell-like rod cells contains the RNAi-inducing nucleic acid molecule at a concentration outside the numerical range, cone cells or The effect of inducing or enhancing the production of cone-like rods may be reduced.

In another aspect, the present invention relates to a method for inducing or enhancing the production of cone cells or cone-like rod cells using the RNAi-inducing nucleic acid molecule or the composition. The method may be performed in vitro.

In the method, the RNAi-inducing nucleic acid molecule or the composition is added to any one or more cell culture medium selected from the group consisting of stem cells, retinal progenitor cells, retinal analogue cells, photoreceptor progenitor cells, cone cells, and rod cells in vitro. to do; Or in vitro, any one or more cells selected from the group consisting of stem cells, retinal progenitor cells, retinal analog cells, photoreceptor progenitor cells, cone cells, or rod cells in a medium containing the RNAi-inducing nucleic acid molecule or the composition It may include the step of culturing.

In the method, in the step of adding the RNAi-inducing nucleic acid molecule or the composition to the cell culture medium, the RNAi-inducing nucleic acid molecule is added to the cell culture medium at about 0.01 to 100 μM, about 0.01 to 50 μM, about 0.01 It may be added at a concentration of 10 μM to 10 μM, about 0.01 to 5 μM, about 0.01 to 1 μM, about 0.01 to 0.5 μM, about 0.05 to 0.5 μM, or about 0.1 to 0.2 μM. Alternatively, in the method, in the step of culturing the cell in a medium containing the RNAi-inducing nucleic acid molecule or the composition, the RNAi-inducing nucleic acid molecule is added to the cell culture medium at about 0.01 to 100 μM, about 0.01 to 50 It may be included in a concentration of μM, about 0.01 to 10 μM, about 0.01 to 5 μM, about 0.01 to 1 μM, about 0.01 to 0.5 μM, about 0.05 to 0.5 μM, or about 0.1 to 0.2 μM. According to one embodiment, in the method, when the RNAi-inducing nucleic acid molecule is added to or included in the cell culture medium at a concentration outside the numerical range, the effect of inducing or enhancing the production of cone cells or cone-like rods may decrease.

In another aspect, the present invention relates to a method of improving or treating an ocular or retinal disease, comprising administering the RNAi-inducing nucleic acid molecule or the composition to a subject.

Since the configuration included in the method according to the present invention is the same as the configuration included in the above-described invention, the above description is equally applicable to the method according to the present invention.

In another aspect, the present invention provides a nucleic acid molecule for inducing RNAi or a composition comprising the same for inducing or enhancing the production of cone cells or cone-like rod cells, use for improving visual acuity, or ocular or It relates to use for improving or treating retinal diseases.

Since the configuration included in the use according to the present invention is the same as the configuration included in the invention described above, the above description can be equally applied to the use according to the present invention.

According to the present invention, a cone cell or cone cell-like rod cell is generated using a nucleic acid molecule for inducing asymmetric RNAi that can efficiently suppress the expression of the NRL gene, which plays a very important function in the differentiation process of rod cells and cone cells. can induce or promote For this reason, the nucleic acid molecule for inducing asymmetric RNAi may be usefully utilized as a therapeutic agent capable of improving vision or improving or treating ocular or retinal diseases by supplementing the loss or dysfunction of cone cells.

1 shows rhodosin (Rhodosin) and L/M-opsin (L/M-opsin) antibodies to tissue sections of retinal organoids treated with cp-asiNRL and control retinal analogs not treated with cp-asiNRL. It is a diagram showing the results of immunofluorescence staining using (Scale bar = 100 μm). In FIG. 1 , a portion expressed in a relatively low brightness indicates a cell nucleus stained by Hoechst 33342, and a portion expressed in a relatively high brightness indicates a cell fluorescently stained by a rhodopsin antibody or an L/M-opsin antibody.

2 is a schematic diagram of each photoreceptor cell fluorescently stained with rhodopsin antibody and L/M-opsin antibody from immunofluorescent staining images for retinal analogs treated with cp-asiNRL and control retinal analogs not treated with cp-asiNRL. It is a graph showing the analysis result.

Figure 3 shows rhodopsin, L/M-opsin, and S-opsin, which are proteins extracted from the retinal analogs treated with cp-asiNRL and the control retinal analogs not treated with cp-asiNRL, Western blot analysis. It is a drawing showing the result.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of a nucleic acid molecule for inducing asymmetric RNAi having cell-penetrating ability to target NRL

The sequence and chemical modification of cp-asiNRL, which is a nucleic acid molecule for inducing asymmetric RNAi, which has cell-penetrating ability to target NRL, has already been disclosed in WO2020/179702, and its preparation was also prepared as disclosed in the same patent document.

Specifically, Table 1 shows the base sequence of asiNRL targeting NRL.

No.	Sequence (5'->3')		SEQ ID NO:
#One	S (16mer)	CGGCGCUGGUCUCGAU	One
	AS (26mer)	AUCGAGACCAGCGCCGCGUCGGAAAA	2

Modification was performed to make asiNRL of Table 1 into cp-asiNRL having cell penetrating ability and resistance to nucleolytic enzymes. Table 2 shows the modifications of cp-asiNRL with cell penetrating ability.

cp-asiRNA	No	Sequence (5'→3')
cp-asiNRL	#One	sense	mC(2'-FG)mG(2'-FC)mG(2'-FC)mU(2'-FG)mG(2'-FU)mC(2'-FU)mC (2'-FG)*mA*(2'-FU)*-Chol
		antisense	PmA(2'-FU)mC(2'-FG)mA(2'-FG)mA(2'-FC)mC(2'-FA)mG(2'-FC) mG(2'-FC)mC(2'-FG)mC(2'-FG)mU(2'-FC)mG(2'-FG)*mA*(2'-FA) *mA*(2'-FA)

On the other hand, the chemical modifications indicated by "*", "m", "2'-F-", "-chol", and "P" in Table 2 are as shown in Table 3.

notation	introduced chemical modifications
*	phosphorothioate bond
m	2'-O-methyl (Methyl)
2'-F-	2'-Fluoro
-chol	3'-cholesterol
P	5'-phosphate group

Specifically, in Table 3, "*" means a form in which the existing phosphodiester bond is substituted with a phosphorothioate bond, and "m" indicates that the existing 2'-OH is 2 It means a form substituted with '-O-methyl (Methyl). In addition, "2'-F-" means, for example, in the case of 2'-F-G, the 2'-OH of the existing G (guanine) is substituted with fluorine (Fluoro), and "-Chol" denotes a form in which cholesterol is added to the 3'-terminus, and "P" denotes a form in which the 5'-terminus is phosphorylated (eg, phosphate modification or phosphorothioate modification is added to the 5' end of the antisense strand) will do

Cholesterol attached to the 3' end of the sense strand allows it to penetrate the cell membrane. In addition, the substitution of phosphorothioate for the phosphate backbone close to the 3' end of the sense and antisense strands increases resistance to exohydrolase, cellular uptake and in vivo bioavailability. In addition, if 2' of some sugars are modified with O-methyl, resistance to nucleases is increased, and siRNA immunogenicity and off-target effect are reduced. Finally, the 2' modification of some sugars with fluorine stabilizes the double-stranded RNA duplex, increases stability in seurm, and enables efficient silencing in vitro and in vivo.

In addition, 5'-phosphorylation of the antisense strand is required for the strand complementary to the target mRNA in the siRNA duplex for loading into the RNA-induced silencing complex (RISC), which is essential for gene silencing. Therefore, in most cases, when synthetic siRNA enters the cell, phosphorylation occurs. However, for more reliable RISC-loading, phosphate modification was performed at the 5' end of the antisense strand.

As shown in Table 2 above, cp-asiNRL, a nucleic acid molecule for inducing asymmetric RNAi having cell-penetrating ability to target NRL, was obtained in this example.

Reference Example 1. Experimental materials and methods for the analysis of photoreceptor cell generation by cp-asiNRL

1-1. Production of normal human-derived induced pluripotent stem cells (iPS cells)

Induced pluripotent stem cells (iPS cells) were prepared from mononuclear cells isolated from the blood of a 43- or 62-year-old normal human. After culturing about 0.5 x 10 ⁶ mononuclear cells in StemSpan™ SFEM II (Stemcell Technologies) medium containing SFEM II Supplement (Stemcell Technologies) for about 7 days, plasmid pCXLE-hOCToct3/4-shp53 with reprogramming genes inserted -F, pCXLEe-hSK, and pCXLEe-hUL, and pCXLEe-hOEBNA1, which promote gene expression, were injected into cells using electroporation. Cells injected with the plasmid were grown for about 8 to 10 days using a reprogramming medium (StemFit ^® Basic02, AJINOMOTO) in a culture dish coated with i-MATIRX 511 (Takara), and induced pluripotent stem cell colony was formed. At this starting point, the stem cell culture medium (Essential 8™ Medium, ThermoFisher scientific) was replaced and cultured for about 10 to 12 days, and then the cell population was collected. The collected induced pluripotent stem cells were passaged about 20 to 24 times in a culture dish coated with Vitronectin Recombinant Human Protein (ThermoFisher scientific), and then used to prepare organoids.

1-2. Preparation of retinal organoids and processing of cp-asiNRL

About 50 to 70 colonies of induced pluripotent stem cells in a 60 cm ² culture dish were separated into single cells using TrypLE™ Select Enzyme (ThermoFisher scientific), and then transferred to an ultra-low attachment 6 well plate, about 10 μM (-)-Blebbistatin ((-)-Blebbistatin) was cultured for one day in an ultra-low attachment dish (Corning, NY, USA) containing stem cell culture medium. After that, the embryoid body (Neural induction medium; DMEM/F12 (1:1), MEM Non-Essential Amino Acids Solution, N2 Supplement, about 0.2% Heparin) was gradually replaced and cultured for about 6 days ( Embryoid body) was fabricated. The embryoid bodies of about 20 pieces/cm ² were cultured in a culture dish coated with Matrigel™ GFR Membrane Matrix (Corning) together with a nerve induction medium for about 15 days. About 13 to 15 days after the culture in which the neural structure is formed, it was replaced with a neural retinal differentiation medium (DMEM/F12 (3:1), B27, MEM Non-Essential Amino Acids Solution) and cultured. , Cell bodies showing neural retinal structures were collected about 25 to 30 days after culture. After culturing the collected cell bodies in an ultra-low attachment dish containing neural retina medium for about 5 days, the medium was cultured with about 10% Fetal bovine serum, about 100 μM Taurine, and 1X Glutamax. (Glutamax) was replaced with the added neural retinal medium and then cultured for about 160 days to obtain a retinal analogue.

In order to evaluate the effect of cp-asiNRL, at about 142 days after the neural retinal medium replacement culture, that is, at a time point where rods and cones have already been formed, cp-asiNRL was added to a culture medium containing retinal analogues at about 48 hour intervals. was treated about 3 times. At this time, it was treated so that the final concentration of cp-asiNRL contained in the culture medium containing the retinal analogue was about 0.1 or 0.2 μM. About 30 retinal analogues were used to evaluate the effectiveness of cp-asiNRL.

1-3. Immunofluorescence staining analysis of retinal analogues

About 18 days after the first treatment with cp-asiNRL on the retinal analog, about 4% paraformaldehyde (PFA) was used for the retinal analog treated with cp-asiNRL and the control retinal analog not treated with cp-asiNRL. and fixed at about 4°C for about 12 hours. In order to suppress cryo damage to the fixed retinal analogs, about 30% sucrose was infiltrated, and the retinal analogs were embedded in liquid nitrogen using an optimal cutting temperature compound (ThermoFisher scientific). ) was done. The frozen tissue was sectioned to a thickness of about 15 μm and mounted on a glass slide. For immunochemical staining, frozen tissue sections were fixed in about 4% PFA for about 15 minutes, softened in about 0.5% Triton X-100, washed with PBS, and then washed with about 2% bovine serum albumin. (bovine serum albumin) (Gibco, Dublin, Ireland) and about 5% normal goat serum (Jackson Immunoresearch, PA, USA) were blocked at about 4°C for about 12 hours. Thereafter, the tissue sections were reacted with rabbit rhodopsin (Millipore) and mouse L/M opsin (Millipore) antibodies at about 4° C. for about 12 hours, and then washed with PBS about 3 times. . After the washed tissue sections were reacted with Alexa Fluor ^TM 488 antibody or a secondary antibody to which Cy3 is bound at room temperature (about 15 to 25° C.) for about 1 hour, cell nuclei were stained using Hoechst 33342 dye. The stained tissue sections were photographed with a fluorescence microscope equipped with an AxioCam camera (Zeiss, Jena, Germany) to obtain fluorescence images.

1-4. Western blot analysis of retinal analogues

After about 18 days from the time when the retinal analog was first treated with cp-asiNRL, the protein was extracted from the retinal analog using RIPA buffer. Equal amounts of protein (about 20 μg) were separated by SDS-PAGE (Sodium Dodecyl Sulfate-Poly Acrylamide Gel Electrophoresis) and blotted with polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA). After the membrane was reacted in TBS containing about 5% bovine serum albumin and about 0.1% Tween 20 at room temperature (about 15 to 25° C.) for about 2 hours, rabbit rhodopsin (Millipore) , mouse L/M opsin (Millipore), and rabbit S-opsin (S-opsin) (Millipore) antibodies were incubated over-night at about 4°C. Thereafter, the membrane was washed with TBST, and then incubated for about 1 hour with a secondary antibody (ThermoFisher scientific) bound to Horse Radish Peroxidase (HRP). After incubation, the membrane immunoactive protein was chemically reacted using a luminescence substrate (Clarity™ Western ECL Substrate; Bio-Rad Laboratories Inc, Hercules, CA), and the results were recorded with a digital imaging system (ChemiDoc Touch Imager; Bio -Rad) was used for visualization.

Experimental Example 1. Analysis of photoreceptor cell generation by cp-asiNRL

1-1. Immunofluorescence staining analysis of photoreceptor cell generation by cp-asiNRL

In this experimental example, when the expression of the NRL gene is suppressed by cp-asiNRL during the generation of photoreceptors, it is possible to induce a decrease in rod cells and an increase in cone cells among the photoreceptors. Immunofluorescence staining analysis was performed to confirm that it can.

Specifically, the retinal analogues prepared from induced pluripotent stem cells were treated with cp-asiNRL at a concentration of about 0.1 μM. The cp-asiNRL treatment was performed at about 142 days after culturing the retinal analog, which is a time point at which rod cells and cone cells were already formed (refer to Reference Example 1-2 above). About 18 days after cp-asiNRL administration (about 160 days after culturing retinal analogues), the production patterns of rods and cones were analyzed using immunofluorescence staining. Cells fluorescently stained with rhodopsin antibody in retinal analogues represent rod cells, and cells fluorescently stained with L/M-opsin antibody represent cone cells. As a control, retinal analogues not treated with cp-asiNRL were used. Specific test materials and test methods were described in detail in the reference example above.

1 is a diagram showing the results of immunofluorescence staining using rhodopsin and L/M-opsin antibody for tissue sections of retinal analogs treated with cp-asiNRL and control retinal analogs not treated with cp-asiNRL (Scale bar) = 100 μm). In FIG. 1 , a portion expressed in a relatively low brightness indicates a cell nucleus stained by Hoechst 33342, and a portion expressed in a relatively high brightness indicates a cell fluorescently stained by a rhodopsin antibody or an L/M-opsin antibody.

As a result, as shown in FIG. 1, when the retinal analogue was treated with cp-asiNRL at a concentration of about 0.1 μM, the number of rods fluorescently stained with the rhodopsin antibody was reduced compared to the control, whereas the L/M-opsin antibody It was confirmed that the number of fluorescently stained cone cells increased.

In addition, quantitative analysis was performed from images randomly obtained after immunofluorescence staining for 4 retinal analogs treated with cp-asiNRL at a concentration of about 0.1 μM and 5 control retinal analogs not treated with cp-asiNRL.

2 is a schematic diagram of each photoreceptor cell fluorescently stained with rhodopsin antibody and L/M-opsin antibody from immunofluorescent staining images for retinal analogs treated with cp-asiNRL and control retinal analogs not treated with cp-asiNRL. It is a graph showing the analysis result.

As a result, the number of rod cells stained by the rhodopsin antibody in the retinal analogs treated with cp-asiNRL showed a decrease in the number of 19 ± 1.85 per 0.2 mm ² compared to the control, whereas by the L/M-opsin antibody It was confirmed that the number of stained cone cells showed an increase in the number of 19 ± 1.85 per 0.2 mm ² compared to the control.

1-2. Analysis of marker protein expression level in photoreceptor cells by cp-asiNRL

In this experimental example, in order to analyze the production patterns of rods and cones among photoreceptors when the expression of the NRL gene is suppressed by cp-asiNRL during the generation of photoreceptors, each of rods and cones The expression levels of the markers rhodopsin and L/M-opsin were analyzed.

Specifically, after treatment with cp-asiNRL at a concentration of about 0.1 μM or about 0.2 μM to the retinal analog, the protein was extracted from the retinal analog at about 18 days (160 days after retinal analog culture). That is, proteins from 7 retinal analogues treated with cp-asiNRL at a concentration of about 0.1 μM, 7 retinal analogues treated with cp-asiNRL at a concentration of about 0.2 μM, and 7 control retinal analogues not treated with cp-asiNRL were isolated. extracted. Western blot analysis was performed on the extracted proteins using antibodies against rhodopsin, L/M-opsin, and S-opsin. Specific test materials and test methods were described in detail in the reference example above.

3 is a view showing the results of western blot analysis for rhodopsin, L/M-opsin, and S-opsin, which are proteins extracted from retinal analogs treated with cp-asiNRL and control retinal analogs not treated with cp-asiNRL. .

As a result, as shown in Figure 3, as the concentration of cp-asiNRL treated on the retinal analog increased, the expression of rhodopsin protein decreased, while the expression of L/M-opsin and S-opsin protein increased. did.

Through this experimental example, it was confirmed that when the expression of the NRL gene was suppressed by cp-asiNRL during the generation of photoreceptors, it was possible to induce a decrease in the number of rod cells and an increase in the number of cone cells among the photoreceptors. .

These experimental results show that the time point of cp-asiNRL treatment is the time point at which the cell fates of rods and cones among photoreceptor cells are determined and the formation of each cell has already taken place (eg, after differentiation into rod or cone cells has begun). In view of the time point or time point when differentiation into rod or cone cells is completed), cp-asiNRL is a cone-like rod having cone-like properties rather than the original properties of rod cells in the process of rod cell generation. By inducing the production of cells or changing the properties of already generated healthy rods to those of cones, rods can be converted into cone-like rods, or the proliferation of healthy cones that have already been generated can be increased. This suggests that it can induce a decrease in the number of rod cells and an increase in the number of cone cells. That is, cp-asiNRL suggests that it can enhance the production of cone cells or induce or enhance the production of cone-like rod cells.

Therefore, cp-asiNRL can contribute to replenishing the dysfunction of cone cells by inducing or enhancing the production of cone cells or cone-like rods in a state in which cone cells are lost or dysfunctional. It can be used as an active ingredient of a pharmaceutical composition for improving or treating eye or retinal diseases for improving eyesight.

As the specific parts of the present invention have been described in detail above, for those of ordinary skill in the art, these specific descriptions are only preferred embodiments, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (10)

1. A sense strand comprising the nucleotide sequence of SEQ ID NO: 1 and an antisense strand comprising the nucleotide sequence of SEQ ID NO: 2, wherein the 5' end of the antisense strand and the 3' end of the sense strand form a blunt end A composition for inducing or enhancing the production of cones or cone cells-like rods, comprising a nucleic acid molecule for inducing RNAi to that.
2. The method according to claim 1, wherein the sense strand or the antisense strand comprises at least one chemical modification, the composition for inducing or enhancing the production of cone cells or cone-like rod cells.
3. The method according to claim 2, wherein the chemical modification comprises one or more selected from the group consisting of, cone cells or cone cell-like composition for inducing or enhancing the production of rods:

   -OH group at the 2' carbon position of the sugar structure in the nucleotide is -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine), -O-2-methoxyethyl-O-propyl ( propyl), -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl;

   replacement of oxygen in the nucleotide structure with sulfur;

   nucleotide linkages are modified with phosphorothioate, boranophosphate, or methyl phosphonate;

   transformation into peptide nucleic acid (PNA), locked nucleic acid (LNA), or unlocked nucleic acid (UNA) form; and

   A phosphate group, a lipophilic compound, or a cell penetrating peptide bond.
4. The method according to claim 3, wherein the lipophilic compound is cholesterol, tocopherol, stearic acid, retinoic acid, docosahexaenoic acid (DHA), palmitic acid, linoleic acid, linolenic acid ( linolenic acid), and any one or more selected from the group consisting of a long-chain fatty acid having 10 or more carbon atoms, a composition for inducing or enhancing the production of cones or cone cells-like rods.
5. The method according to claim 2, wherein the nucleic acid molecule for inducing RNAi is

   a modification in which the -OH group is substituted with -OCH ₃ or -F at the 2' carbon position of the sugar structure within two or more nucleotides of the sense strand or the antisense strand;

   at least 10% of the nucleotide linkages in the sense strand or antisense strand are modified to phosphorothioate;

   cholesterol binding to the 3' end of the sense strand; and

   A composition for inducing or enhancing the production of cones or cone cells-like rods, comprising one or more modifications selected from the group consisting of a phosphate group at the 5' end of the antisense strand.
6. The method according to claim 2, wherein the nucleic acid molecule for inducing RNAi comprises the following sense strand,

   mC(2'-F-G)mG(2'-F-C)mG(2'-F-C)mU(2'-F-G)mG(2'-F-U)mC(2'-F-U)mC(2'-F-G)* mA*(2'-F-U)*-Chol,

   In the above, * is a phosphorothioate bond (phosphorothioated bond) modification, m is 2'-O-methyl (Methyl) substitution, 2'-F- is 2'-Fluoro substitution, -chol is 3'- that means the binding of cholesterol, cone cells or cone cells-like rod cell production induction or enhancement composition.
7. The method according to claim 2, wherein the nucleic acid molecule for inducing RNAi comprises the following antisense strand,

   PmA(2'-F-U)mC(2'-F-G)mA(2'-F-G)mA(2'-F-C)mC(2'-F-A)mG(2'-F-C)mG(2'-F-C)mC (2'-F-G)mC(2'-F-G)mU(2'-F-C)mG(2'-F-G)*mA*(2'-F-A)*mA*(2'-F-A),

   In the above, * denotes a phosphorothioate bond, m denotes a substitution with 2'-O-methyl, 2'-F- denotes a substitution with 2'-fluoro, and P denotes a bond with a 5'-phosphate group. The composition for inducing or enhancing the production of cone cells or cone cells-like rod cells.
8. A composition for cell culture for inducing or promoting the production of cone cells or cone cells-like rod cells comprising the composition of any one of claims 1 to 7.
9. A method for inducing or enhancing the production of cones or cone-like rods using the composition of any one of claims 1 to 7.
10. 10. The method of claim 9, wherein the method

    In vitro, the composition of any one of claims 1 to 7 in any one or more cell culture medium selected from the group consisting of stem cells, retinal progenitor cells, retinal organoid cells, photoreceptor progenitor cells, cone cells, or rod cells. adding; or

    Any one or more cells selected from the group consisting of stem cells, retinal progenitor cells, retinal analog cells, photoreceptor progenitor cells, cone cells, or rod cells in vitro are cultured in a medium containing the composition of any one of claims 1 to 7 A method comprising the step of:

Images