WO2022124702A1 - Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물 - Google Patents

Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물 Download PDF

Info

Publication number
WO2022124702A1
WO2022124702A1 PCT/KR2021/018197 KR2021018197W WO2022124702A1 WO 2022124702 A1 WO2022124702 A1 WO 2022124702A1 KR 2021018197 W KR2021018197 W KR 2021018197W WO 2022124702 A1 WO2022124702 A1 WO 2022124702A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
natural killer
expression
liver
tm4sf5
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2021/018197
Other languages
English (en)
French (fr)
Inventor
이정원
김은미
선현승
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Publication of WO2022124702A1 publication Critical patent/WO2022124702A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/18—Sulfonamides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention relates to a composition for regulating natural killer cell activity comprising TSAHC or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the liver performs many functions in our body, such as metabolism of lipids, detoxification, excretion of bile, storage of various nutrients, hematopoiesis or blood coagulation, and regulation of circulating blood volume. Therefore, when a liver disorder occurs, various functions are lowered, and in the worst case, it becomes difficult to maintain life.
  • the liver has the function of managing energy metabolism, so that all nutrients such as carbohydrates, fats, and proteins including amino acids absorbed from food are metabolized into substances that can produce energy in the liver, so that the whole body supplied or stored.
  • Third, as a detoxification and decomposition function the liver detoxifies drugs, alcohol, toxic substances, etc., so hepatocytes are easily damaged in this process. Therefore, liver disease caused by drugs, poisons or alcohol can occur frequently.
  • the liver functions to excrete various metabolites into the duodenum and plays an important role in maintaining life as it has immune functions and the like.
  • Liver disease can be divided into viral liver disease, alcoholic liver disease, drug toxic liver disease, fatty liver, autoimmune liver disease, metabolic liver disease and others according to the cause. Liver disease is the leading cause of death not only in Korea but also in the world because liver disease has no early symptoms and is only discovered after a fairly advanced stage. Accordingly, there is a need for research on a method for effectively diagnosing or treating liver disease.
  • Inflammation of the human liver is the etiology and characteristic of several chronic liver diseases.
  • Chronic damage to hepato-epithelial cells due to alcohol, viral infection, toxin accumulation, and metabolic abnormalities and inflammatory responses accompanying cell death play an important role in inducing and deepening additional liver disease.
  • too much inflammatory response acts as the etiology, but when liver resection and liver transplantation are attempted as a way to treat the worsening of the liver disease, the hyperinflammatory reaction may cause problems. There is a need for immunosuppression.
  • nonalcoholic fatty liver due to chronic hepatic cell stimulation/damage and metabolic function abnormality is accompanied by inflammation due to cell damage and death, which intensifies into steatohepatitis, and furthermore, accumulation of extracellular matrix and cells It can intensify with symptoms of fibrosis and cirrhosis that cause abnormal proliferation of Metabolic-inflammatory environment changes and interactions between epithelial cells or hepatic stellate cells in the liver and immune cells including macrophages, T cells and NK (natural killer cells) cells. This carcinogenesis can be inhibited or promoted.
  • TM4SF5 Transmembrane 4 L six family member 5
  • TM4SF5 Transmembrane 4 L six family member 5
  • It is a tetraspanin whose expression is increased in hepato-epithelial cells and macrophages due to the action of various cytokines and chemokines following chronic hepato-epithelial cell damage. It was confirmed Therefore, the interaction of hepatic epithelial cells and macrophages depends on the expression of TM4SF5 to remodel the inflammatory response and immune environment of the liver, leading to liver fibrosis or cirrhosis beyond steatohepatitis.
  • TM4SF5 in epithelial cells enables the immune escape process to suppress the anticancer activity of immune cells including macrophages, T cells and NK cells. It can effectively increase the cancer incidence rate or increase the cancer incidence rate.
  • a small molecule compound or antibody is used as an inhibitor to inhibit the expression of TM4SF5 or to regulate the function of TM4SF5, it can inhibit the interaction between hepatic epithelial cells and immune cells in the liver tissue, thereby reducing the aggravation of steatohepatitis and fibrosis/sclerosis. It is expected that the means of immunotherapy for liver cancer will be created by being able to suppress and control, and ultimately to remove the function of avoiding the anticancer immune activity of cells including NK cells or T cells.
  • the present inventors suppressed the interaction between hepato-epithelial cells and immune cells in liver tissue to suppress and control steatohepatitis, fibrosis, or sclerosis, and ultimately, a TM4SF5 inhibitor to remove the function of avoiding the anticancer immune activity of NK cells
  • TM4SF5 expression decreased the spleen or liver NK cell or CD4 + positive helper T-cell population
  • TSAHC treatment inhibited TM4SF5 activity, resulting in an increase in NK cell population in the spleen or liver.
  • the present invention provides a composition for regulating natural killer cell activity comprising 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof as an active ingredient in order to increase the killing effect of NK cells is intended to provide
  • the present invention provides a composition for regulating natural killer cell activity comprising 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention relates to a composition for regulating natural killer cell activity comprising 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof as an active ingredient, wherein TM4SF5 is It was confirmed that the inhibition of the NK cell population in the spleen or liver increased, the expression of NK cell activating ligand was increased, and ultimately the cytotoxic activity of NK cells was increased, 4'-(p-toluenesulfonyl).
  • a composition comprising amino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof as an active ingredient may be usefully used as an NK cell activity modulator.
  • FIG. 1 is a diagram confirming the degree of liver damage and immune cell density (inflammation) by H&E staining of liver tissue of a mouse model of liver damage and liver cancer following treatment with diethylnitrosamine ( DEN ).
  • FIG. 2 is a diagram illustrating the measurement of survival rates over time in liver injury and liver cancer mouse models.
  • Figure 3 shows the expression level of laminin, STAT3 (signal transducer and activator of transcription 3), TM4SF5, phosphorylation of STAT3 Tyr705 (pY 705 STAT3) and ERK1/2 using liver tissue of a liver injury and liver cancer mouse model. It is a diagram confirming phosphorylation (p-Erk) through western blot.
  • FIG. 4 is a diagram confirming the expression levels of TM4SF5, STAT3, pY705 STAT3 (phosphorylation of STAT3 Tyr705), collagen, laminin, and laminin ⁇ 2 through H&E and immunohistochemistry in a liver injury and liver cancer mouse model.
  • FIG. 5 is a diagram schematically showing DEN ⁇ TSAHC drug treatment to secure liver damage and liver cancer mouse model.
  • FIG. 6 is a view confirming the degree of tumor formation in the liver damage and liver cancer mouse model of the animals of the control group and the treatment group.
  • FIG. 7 is a diagram analyzing the number (a) and total volume (b) of tumors with a diameter of 1.0 mm or more, and the maximum tumor size (c) in each animal in a liver injury and liver cancer mouse model.
  • FIG. 8 shows H&E staining to observe tumors in liver tissue of a liver injury and liver cancer mouse model, nucleoprotein Ki67 indicating cell proliferation, and DAB (3,3'-) for expression of ⁇ -feto protein (AFP), a liver cancer marker.
  • AFP ⁇ -feto protein
  • FIG. 9 is a diagram confirming the liver/weight ratio (a), plasma ALT (b), total cholesterol (c), and plasma glucose (d) amounts of each mouse in a liver injury and liver cancer mouse model.
  • FIG. 10 is a diagram illustrating the degree of granulomatous inflammation in which immune cells are concentrated along with AFP ( ⁇ -fetoprotein) staining in liver tissue of a liver injury and liver cancer mouse model.
  • FIG. 11 shows the spleen of each mouse from liver injury and liver cancer mouse models of control and treated animals through flow cytometry after immunostaining (a), helper T cells (b), cytotoxic T cells (c) and natural It is a diagram confirming the cluster of killer cells NK cells (d).
  • liver injury and liver cancer mouse model by securing the liver tissue of each mouse through flow cytometry after immunostaining (a), helper T cells (b), cytotoxic T cells (c) and NK cells (d) It is the road that confirmed the cluster.
  • FIG. 13 is a diagram confirming the generation of cytokines (a, b) and granules (c) secreted from NK cells by securing the liver tissue of each mouse in a liver injury and liver cancer mouse model through immunostaining and flow cytometry analysis.
  • TM4SF5 expression in target cells made by infecting Huh7 hepatic epithelial cells with non-specific shRNA (NS) and shTM4SF5 (#2 and #4 sequences) using a lentivirus (a), and the target cells and It is a diagram confirming the degree of cytotoxicity of NK92 cells according to the culture ratio of NK92 cells, which are effector cells (b).
  • NS 15 is a lentivirus using non-specific shRNA (NS) and shTM4SF5 (#2 and #4 sequences) to infect hepatic epithelial cells Huh7(a), Hep3B(b) and HepG2(c), each It is a diagram confirming the mRNA expression level of various ligand membrane proteins related to cytotoxic activation of NK cells in cells.
  • NS non-specific shRNA
  • shTM4SF5 #2 and #4 sequences
  • Figure 16 is a lentivirus after infecting non-specific shRNA (NS) and shTM4SF5 (#2 and #4 sequences) into hepato-epithelial cells, after co-culture with hepato-epithelial cells and NK92 cells, NK in NK92 cells It is a diagram confirming the expression level of mRNA (a) of various receptor membrane proteins and cytokines or granules (b) related to cytotoxic activation of cells.
  • NS non-specific shRNA
  • shTM4SF5 #2 and #4 sequences
  • TM4SF5 shows TM4SF5, SLAMF7 (Signaling lymphocytic activation molecule F7), MICA (MHC Class I Polypeptide-) in normal liver tissue and liver cancer tissue using 'Analyze with GEO2R' from the Gene Expression Omnibus (GEO) database (accession numbers GSE14520).
  • GEO Gene Expression Omnibus
  • NK92 cells which are effector cells. It is a diagram confirming the expression of TM4SF5 in cells (a) and the degree of cytotoxicity of NK92 cells (b).
  • Figure 19 shows the co-culture ratio of target cells and effector cells, NK92 cells, made by infecting HepG2 liver epithelial cells with non-specific shRNA (NS) and shTM4SF5 (#2 and #4 sequences) using lentivirus, NK A diagram confirming the degree of phosphorylation of ERK1/2 in cells.
  • NS non-specific shRNA
  • shTM4SF5 #2 and #4 sequences
  • FIG. 20 is a diagram confirming the degree of apoptosis of Huh7 hepatic epithelial cells co-cultured with NK92 cells according to the concentration of TSAHC treatment.
  • Figure 21 shows the NK cells in Huh7 hepatic epithelial cells or SNU449 cells after infection with non-specific shRNA (NS), shTM4SF5 (#2 and #4 sequences) or empty vector (EV) using a lentivirus. It is a diagram confirming the expression level of various ligand membrane proteins related to cytotoxic activation.
  • NS non-specific shRNA
  • shTM4SF5 #2 and #4 sequences
  • EV empty vector
  • FIG. 23 shows SNU449 cells infected with a retrovirus expressing EV (control vector) or TM4SF5 vector (TM4SF5) (a), or Huh7-KO cell line with TM4SF5 suppressed expression EV (control vector) or TM4SF5 vector It is a diagram confirming the expression of a membrane protein ligand capable of activating NK92 cells by securing the cell extract of the cell line (b) obtained by injecting .
  • Figure 24 is a human NK cell line, NK92 cells, EV (control vector) or TM4SF5 vector expressing (TM4SF5) retrovirus-infected cells (left) or TM4SF5 suppressed Huh7-KO cell line EV or TM4SF5 vector
  • PD-1 programmeed cell death protein- 1
  • PDL-1 Proteinmed Death Ligand 1 receptor
  • FIG. 25 shows cells obtained by injecting EV or TM4SF5 vector into a Huh7-KO cell line in which TM4SF5 expression is suppressed (a) or cells infected with a retrovirus expressing EV or TM4SF5 vector in NK92 cells, a human NK cell line (TM4SF5); It is a diagram confirming the mRNA level of each gene related to NK cell cytotoxicity by performing qRT-PCR using (b).
  • the present invention provides a composition for regulating natural killer cell (NK cell) activity comprising 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof as an active ingredient do.
  • NK cell natural killer cell
  • the term "4'-(p-toluenesulfonylamino)-4-hydroxychalcone [4'-(p-toluenesulfonylamido-4-hydroxychalcone)]" is a chalcone-based compound prepared through synthesis.
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone has the structure of Formula 1 below.
  • TM4SF5 transmembrane 4 L6 family member 5 protein
  • TM4SF transmembrane 4 super family
  • the TM4SF5 protein shares a structure including four hydrophobic sites that are biochemically presumed to be transmembrane domains.
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof may inhibit liver damage, aggregation of immune cells, or inflammation.
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof is the density of immune cells in liver tissue, the expression level of Ki67 or AFP protein, and the formation level of granulomatous inflammation. can reduce
  • the present inventors in order to confirm the effect of TSAHC treatment on the degree of liver damage and inflammatory response, an animal model for liver tissue damage through a control group treated with PBS and diethylnitrosamine treatment As a result of confirming the degree of liver damage in the groups, the degree of liver damage and the density of immune cells were remarkable in the liver tissue of the DEN-treated group compared to the control group treated with PBS. In the case of the group, it was confirmed that the degree of damage to the liver and the density of immune cells or inflammation was reduced compared to the DEN-treated group (see FIG. 1).
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof inhibits the expression of TM4SF5 or laminin in liver tissue, or Tyrosine 705 of STAT3 or It is possible to inhibit the increase in phosphorylation of ERK1/2.
  • the present inventors using the mouse liver tissue of Experimental Example 1-1, TM4SF5, STAT3, STAT3 Tyr705 phosphorylation, ERK1/2 phosphorylation and laminin expression levels were confirmed through Western blot.
  • pY705-STAT3, p-Erk, and laminin which are characteristics of immune cells such as macrophages and NK
  • the expression level of TM4SF5 was not significantly different from that of the DEN-treated group, but the expression of pY705-STAT3 and laminin was lowered, and it was confirmed that the level of pY705-STAT3 was lower than that of the DEN-treated group in the DEN+TSAHC2 group (see FIG. 3 ).
  • liver damage was increased in the DEN-treated group compared to the PBS-treated group, TM4SF5, Tyr705-phosphorylated STAT3, collagen, laminin and laminin ⁇ 2 expression were improved, but the expression of It was confirmed that the effect decreased with treatment with TSAHC (see FIG. 4 ).
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof can reduce the formation of tumors in the liver, the number and/or tumor volume and maximum tumor size in the liver. can be reduced
  • the present inventors in order to confirm the correlation between liver damage and liver cancer, generated many large and small tumors in WT mice treated with DEN in a mouse model of liver damage and liver cancer, but tumors in the group treated with TSAHC at the same time It was confirmed that this is much smaller and less generated (see FIG. 6 ). In addition, closely, it was confirmed that the number and total volume of tumors and the maximum tumor size in each animal also tended to decrease in the group treated with TSAHC simultaneously compared to the WT mice treated with DEN (see FIGS. 7a to 7c ).
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof may lower ALT, cholesterol or glucose levels in the isolated sample.
  • the separated sample may be any one or more selected from the group consisting of blood, whole blood, serum and plasma, and preferably, the separated sample may be serum, but is not limited thereto.
  • the present inventors measured the amounts of ALT, cholesterol and glucose by separating the serum from liver damage and liver cancer mouse models in order to confirm the association between the onset of liver cancer and the regulation of metabolic function.
  • the liver/weight ratio, ALT liver level, and cholesterol and glucose levels in the blood increased, and the function of TM4SF5 was inhibited by KO mice or TSAHC treatment, so their values were low in the group with less cancer. (see FIGS. 9a to 9d), indicating that there is a correlation between the onset of liver cancer and TM4SF5 and inflammation-metabolic functions.
  • the WT+DEN+TSAHC group showed a high degree of AFP staining and granulomatous inflammation, but the degree of staining decreased with TSAHC treatment. , it was confirmed that the inhibition of the infiltration of immune cells and the slowing of inflammation and tumor formation were correlated with each other (see FIG. 10 ).
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof may increase the population of natural killer cells in the spleen.
  • the present inventors treated two-week-old C57BL/6 normal WT mice and Tm4sf5-/- KO mice with vehicle or (Age-matched control group), treated by IP injection of DEN (25 mg/kg body weight) once, and DMSO (40% DMSO) or TSAHC (5 mg/kg body weight/40% DMSO) IP injection twice a week did After 45 weeks, immune cells such as T cells and NK cells in the spleen and liver were examined by immunostaining and flow cytometry as described in Example 6. As a result, in the case of the WT+DEN group with large and frequent liver cancer, the helper T cell population was decreased, so a tumor would have occurred due to the decrease in the helper T cells.
  • T cells did not significantly contribute to liver damage and cancer (see FIGS. 11A to 11D ).
  • the WT+DEN group had a decreased population of NK cells compared to the control group.
  • the NK cell population increased in the KO+DEN group in which DEN treatment was performed but the gene Tm4sf5 was knocked out (KO) or the experimental group in which TM4SF5 protein activity was suppressed by TSAHC treatment. This suggests that liver damage and cancer development following TM4SF5-dependent DEN treatment are significantly associated with the NK cell population in the spleen.
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof may contain MICA, MICB, CADM1 (cell adhesion molecule 1), SLAMF6, SLAMF7, ULBP1, It is possible to increase the expression of any one or more selected from the group consisting of ULBP2, ULBP3, Nectin-1 (CD111) and Nectin-2 (CD112).
  • the target cell may be a damaged liver cell or a liver cancer cell, but is not limited thereto.
  • the present inventors co-cultured liver cancer cells and NK92 cells after the present inventors co-cultured liver cancer cells and NK92 cells, the mRNA levels of receptor membrane proteins for activation in the NK92 cell line were confirmed by qRT-PCR, (MICA of target cells and mRNA expression of NKG2D, SLAMF6 and SLAMF7 (binding to SLAMFs of target cells) of NK92 cells (binding to MICB) was higher than that of cells in which TM4SF5 expression was maintained.
  • NK92 When co-cultured with hepatocellular carcinoma cells (target cells), NK92 It was confirmed that the cells were higher (see FIGS. 16A and 16B ).
  • control shRNA NS
  • Huh7 cell line expressing TM4SF5 or suppressed by injection of shTM4SF5 #2 or #4 sequence target
  • control expression vector into SNU449 cells SNU449Cp
  • TM4SF5 vector-expressing SNU449Tp or SNU449T7-expressing cells
  • SNU449Tp or SNU449T7 expressing cell extracts were obtained from cells infected with lentivirus and Western blot was performed.
  • membrane protein ligands SLAMF7 and MICA/B, etc.
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof is PRF1 (Perforin-1), GZMB (Granzyme B), CD107a (Cluster of Differentiation 107a, or lysosomal-associated membrane protein 1, LAMP1), TNF- ⁇ (Tumor necrosis factor- ⁇ ), FasL (Fas ligand) and TRAIL (TNF-related apoptosis-inducing ligand) to increase the expression of any one or more selected from the group consisting of can
  • PRF1 Perforin-1
  • GZMB Gramzyme B
  • CD107a Cluster of Differentiation 107a, or lysosomal-associated membrane protein 1, LAMP1
  • TNF- ⁇ Tumor necrosis factor- ⁇
  • FasL FasL
  • TRAIL TNF-related apoptosis-inducing ligand
  • the present inventors after co-culture of liver cancer cells and NK92 cells, the present inventors analyzed cytokines and granules secreted by NK92 cells by qRT-PCR to determine the degree of activation in the NK92 cell line, It was confirmed that mRNAs of PRF1, GZMB, CD107a, TNF- ⁇ , FasL, and TRAIL were higher in NK92 cells when co-cultured with hepatocellular carcinoma cells (target cells) with suppressed expression than cells with high TM4SF5 expression ( 16a and 16b).
  • the 4'-(p-toluenesulfonylamino)-4-hydroxychalcone or a pharmaceutically acceptable salt thereof is CD112 (Nectin-2), CD111 (Nectin-1), PD-L1 in hepatic epithelial cells. suppresses the expression of CD112R (CD112 receptor), TIGIT (T Cell Immunoreceptor With Ig And ITIM Domains), CD96 (Cluster of Differentiation 96) and PD-1 (programmed cell death protein-1) expression in natural killer cells. can be suppressed.
  • the present inventors found that the membrane protein ligands CD112, CD111, and PD-L1 increase in TM4SF5-expressing hepatic epithelial cells (Huh7), and the receptors CD112R, TIGIT, CD96 and PD- in NK cells It was confirmed that each increases by 1 (see FIGS. 24A to 25B ).
  • the SNU449 cell line that does not express TM4SF5 was infected with a retrovirus expressing TM4SF5 (SNU449Tp and SNU449T 7 ) and the SNU449Cp cell line infected with a control virus.
  • TM4SF5 Hep3B, HepG2, Huh7
  • human embryonic kidney cell lines HEK293 and HEK293T, KCLB, Korea, HEK293FT, Thermo, USA
  • 10% FBS and antibiotics Invitrogen, CA
  • DMEM or RPMI-1640 culture medium WelGene, Daegu Korea
  • hepatocytes were isolated from C57BL/6 normal WT or Tm4sf5 -/- KO mice, and 10% FBS (GenDEPOT) in DMEM (Dulbecco's Modified Eagle's medium) or RPMI-1640 (Roswell Park Memorial Institute Medium, Hyclone), 1% penicillin/streptomycin (GenDEPOT), and 1 x GlutaMax (Invtrogen, USA) were added and cultured in the same manner as above.
  • FBS FBS
  • DMEM Dulbecco's Modified Eagle's medium
  • RPMI-1640 Roswell Park Memorial Institute Medium, Hyclone
  • penicillin/streptomycin GeneDEPOT
  • 1 x GlutaMax Invtrogen, USA
  • NK92 cell line Human natural killer cell (NK cell) NK92 cell line is ⁇ -MEM (Invitrogen) containing 200.0 U/ml recombinant human IL-2 (Peprotech), 12.5% FBS and 12.5% fetal horse serum (GenDEPOT) It was cultured using the culture medium.
  • TM4SF5 To suppress the expression of TM4SF5 in hepatic epithelial cells, pLKO.1-shRNA (control sequence, TM4SF5 #2 or #4 sequence) was transfected for 48 hours or infected with lentivirus.
  • the human TM4SF5 gene was transfected by constructing an expression vector in which genes for various tags were linked (Cell Metabolism 2019, Vol 29: 1306-1319), or TM4SF5-targeting retrovirus or lentivirus was secured and infected.
  • the shRNA sequences for suppressing the expression of the TM4SF5 gene are shown in Table 1 below.
  • TM4SF5 gene knockout (Knock Out, KO) mouse production
  • RGEN site [sgRNA sequence for mouse Tm4sf5 Exon 1 target (5'-3'): sgRNA1 GAGGTTGCCGTCCGTCCAGGTGG (SEQ ID NO: 5), sgRNA2 GCTGAGGTTGCCGTCCGTCCAGG (SEQ ID NO: 6) and Tm4sf5 Exon 3 target (SEQ ID NO: RG1-GCGGATTGG (SEQ ID NO: RGGAGCGGCTCC) 7), RG2-TTAAGCATTTGGGTCCAATTCGG (SEQ ID NO: 8), RG3-TGAGAAATCCTGTTTGATCTTGG (SEQ ID NO: 9), RG4-AGGTATTAGGGGTGGCCTATGGG (SEQ ID NO: 10)] using various bp (29, 240, 502, 510, 522 and 538 bp) Deletion mice were obtained.
  • Mouse TM4SF5 primer [Forward- GTAGTATGCGGGAGGCACTG (SEQ ID NO: 11), Reverse- GGGTGACCACTCAGACTTCC (SEQ ID NO: 12)] through T7E1 assay by observing the heteroduplex formation between WT / mutant PCR products to find a mutant mouse, and accurately KO'ed mice were used for the experiment.
  • mice in which 29bp including Exon 1 containing Threonine at amino acid number 36 where extracellular loop 2 of mouse TM4SF5 begins (Tm4sf5 Exon1 -/- ) is deleted (Tm4sf5 Exon1 -/- ) is mouse- Tm4sf5 gene primer [forward 5'- CCAAGCCTCCCACCTGTTA-3' (SEQ ID NO: 13), reverse 5'-GCTCCAGCATTCTCACCATC-3' (SEQ ID NO: 14)] was used to confirm the genotype.
  • DEN diethylnitrosamin
  • DEN 25 mg/kg body weight
  • TSAHC-treated group was IP-injected twice a week at a concentration of 5 mg/kg body weight (40% DMSO). After 45 weeks, the animals were sacrificed to determine the extent of liver tissue damage and cancer.
  • mice splenocyte isolation After sacrificing by cervical dislocation, the mouse spleen was aseptically extracted, washed with RPMI 1640 culture medium, and crushed using a sterile glass rod to release the cells.
  • the separated cell suspension was passed through a 70 ⁇ m nylon mesh (Sigma Chemical Co., St. Louis, MO, USA), washed twice with the culture solution, and centrifuged at 3,000 rpm for 10 minutes, followed by Tris-buffered ammonium chloride (NH 4 Cl, pH 7.2) was suspended in distilled water and treated for 5 minutes to remove red blood cells.
  • Tris-buffered ammonium chloride NH 4 Cl, pH 7.2
  • a cell suspension was obtained through physical grinding through a 100 ⁇ m nylon mesh. Immune cells were obtained through 37.5% percoll (GE Healthcare) gradient centrifugation. Erythrocytes were lysed using RBC lysis buffer (Inivitrogen). For population analysis according to immune cell types, immunostaining was performed using CD3, CD45, CD4, CD8, and NK1.1 antibodies, followed by LSR flow cytometry (FACS LSR FortessaTM X-20, BD Biosciences), respectively. Cell populations in the spleen or liver tissue of helper T cells, T cells and NK cells were measured.
  • NK cells IFN- ⁇ , PRF1 and GZMB expression of NK cells was measured.
  • Cells were reacted with 5.0 ng/mL PMA (Sigma), 500.0 ng/mL ionomycin (Sigma), and 10.0 ng/mL monensin (Sigma) at 37.0° C. and 5.0% CO 2 for 4 hours.
  • Lymphocytes FcgII/III receptors were blocked with Fc BlockTM (BD), and surface antigens were stained with a monoclonal antibody conjugated with an appropriate fluorescent dye or biotinylated. Cells were then fixed with Cytofix/CytopermTM (BD) and permeabilized.
  • BD Cytofix/CytopermTM
  • Intracellular antigens such as IFN- ⁇ , PRF1 and GZMB were also stained with monoclonal antibodies conjugated with appropriate fluorescent dyes or biotinylated.
  • data were acquired using a FACS LSR FortessaTM X-20 (BD) and analyzed using FlowJo version 10.6.1.
  • TM4SF5-expressing hepatic epithelial cell lines Huh7 and Hep3B were either not treated with TSAHC (0 ⁇ M) or treated with various concentrations (0.02, 0.1, 0.5, and 2.5 ⁇ M), then cells were harvested and qRT-PCR was performed.
  • cells or tissues were disrupted using Qiazol (Qiagen, USA), chloroform was added, and centrifuged at 12,000 x g , 4 °C for 15 minutes to separate the upper organic layer.
  • RNA was precipitated by adding isopropanol to the separated organic layer, followed by washing with 70% ethanol.
  • RNA pellet was separated by centrifugation at 7,500 x g for 5 minutes, ethanol was evaporated for 10 minutes, and the solution was dissolved in 30 ⁇ l DEPC-water.
  • the solution RNA is reverse transcribed after removal of gDNA using a reverse transcription kit (Toyobo, Japan) to obtain cDNA.
  • Expression of the obtained cDNA was measured by real-time PCR (Biorad, USA) using 2x Eva green master mix (Labopass, Korea) and 0.4 ⁇ M forward/reverse primer. Expression amount was calculated using Pfaffl's modified delta-delta Ct method.
  • Table 2 The sequences of primers for RT-PCR or qRT-PCR in the present invention are shown in Table 2 below.
  • DEN+TSAHC1 a group treated with DEN and TSAHC
  • DEN+TSAHC2 a group treated with TSAHC after 10 weeks of DEN treatment
  • mice were bred in a pathogen-free laboratory with well-controlled temperature and humidity, and each treatment group was grouped into groups of 5 to 7 animals, and normal breeding through free feeding of a normal diet. while measuring the survival rate.
  • the DEN-treated group showed the lowest survival rate, and the DEN+TSAHC2 group had a higher survival rate than the DEN-treated group, but the survival rate was lower than that of the DEN+TSAHC1 group and the PBS-treated control group (100% survival) (Fig. 2). ).
  • extracts were obtained from liver tissues of animals in each of the control and treatment groups. After washing the liver tissue twice with PBS, SDS, Na 3 O in lysis buffer [50 mM Tris-HCl, pH 7.4, 1% NP40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA (based on 500 ml)] 4 V, protease inhibitor cocktails (GenDepot) were added and treated at 4°C for 15 minutes.
  • a protease inhibitor cocktail (GenDEPOT) was added to the lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl, 0.25% sodium deoxycholate, pH 7.4).
  • the expression of pY 705 STAT3, p-Erk and laminin in the DEN-treated group increased with the improvement of TM4SF5 expression compared to the PBS-treated control group. Although there was no significant difference, the expression of pY 705 STAT3 and laminin was lowered, and the level of pY 705 STAT3 was lower in the DEN+TSAHC2 group than in the DEN-treated group ( FIG. 3 ).
  • liver damage was increased in the DEN-treated group compared to the PBS-treated group, and the expression of TM4SF5, Tyr705-phosphorylated STAT3, collagen, laminin, and laminin ⁇ 2 was improved.
  • the effect of this DEN decreased as the treatment with TSAHC (Fig. 4).
  • H&E staining or immunohistochemistry was performed to observe tumors in each group's liver tissue.
  • liver tissue of a representative animal was photographed with a digital camera (left), and the stained tissue was scanned with a digital tissue scanner (middle panel) to express tumor (T) and normal (N) tissue regions of the image (right panel) ) was done.
  • the purpose of this study was to express the border region with the normal tissue of a large tumor generated in DEN-treated normal mice.
  • Ki67 and ⁇ -fetoprotein (AFP) were immunostained to examine the proliferative capacity of liver cancer tissues and the expression level of biomarkers ( FIG. 8 ).
  • liver tissue was obtained from the mouse of Experimental Example 2-1, and then the liver/weight ratio of the mouse was measured.
  • the blood obtained from the mouse was centrifuged at 1,500x g and 4° C. for 15 minutes to separate the serum, and the separated serum was analyzed using a blood analyzer (Dri- Chem 4000, Fuji, Japan) was used to measure the amounts of ALT (Alanine aminotransferase), cholesterol (T-CHO) and glucose (Glucose).
  • the WT+DEN group which is a normal mouse treated with DEN, had higher liver/weight ratio, ALT, T-CHO, and glucose levels compared to the age-matched control group, but the DEN-treated KO mouse (KO +DEN group) or mice treated with TSAHC (WT+DEN+TSAHC group) tended to decrease the above values ( FIGS. 9A to 9D ).
  • the liver/body weight ratio, ALT liver level, and cholesterol and glucose levels in the blood were increased, and the function of TM4SF5 was suppressed due to KO mice or TSAHC treatment, so that their cancer was less in the animal group.
  • the low values indicate that there is a correlation between liver damage and liver cancer development and TM4SF5 and inflammation-metabolic function.
  • liver tissue was obtained from the mouse of Experimental Example 2-1, and then H&E staining was performed in the same manner as in Experimental Example 1-1, and AFP ( Immunostaining was performed with ⁇ -fetoprotein).
  • helper T cells with high CD4 CD4+
  • cytotoxic T cells with high CD8 CD8+
  • CD3 The population of immune cells including NK cells with low expression and high expression of NK1.1 was investigated.
  • the helper T cell population did not change significantly ( FIG. 11b ), and the cytotoxic T cell population rather increased, making the T cells significant in cancer development. It was confirmed that it does not contribute to (Fig. 11c).
  • the WT+DEN group had a decreased population of NK cells compared to the control group.
  • the NK cell population increased in the KO+DEN group in which DEN treatment was performed but the gene Tm4sf5 was knocked out (KO) or the experimental group in which TM4SF5 protein activity was suppressed by TSAHC treatment ( FIG. 11d ).
  • KO the gene Tm4sf5 was knocked out
  • TM4SF5 protein activity was suppressed by TSAHC treatment
  • the WT+DEN group As a result of examining the population of helper T cells, cytotoxic T cells and NK cells in the liver tissue of each experimental group through the above method, the WT+DEN group with large and frequent liver cancer In the case of , the population of helper T cells was significantly lowered (FIG. 12b), but rather the population of cytotoxic T cells was excessively increased, so that, unlike helper T cells, the cytotoxic T cells significantly contributed to cancer pathogenesis. It was confirmed that not (Fig. 12c). In addition, in the case of NK cells, the WT + DEN group increased the population of NK cells compared to the control group, and it could not be estimated that the function of NK cells present in liver tissue was regulated, thereby regulating the onset of cancer ( FIG. 12d ).
  • cytokines and granules secreted from NK cells present in liver tissue were subjected to the immunostaining method and flow cytometry described in Example 6 above. It was investigated through the analysis method.
  • IFN- ⁇ , perforin (PRF1) and granzymes (GZMB) were secreted much lower in the WT+DEN group with large and frequent cancer compared to the control group without cancer ( FIGS. 13a to 13c ).
  • PRF1 perforin
  • GZMB granzymes
  • NK92 LDH (lactate dehydrogenase) Cytotoxicity Assay Kit (Cytotoxicity Detection Kit Plus (ROCHE)) was used.
  • Huh7 or HepG2 liver epithelial cells or hepatocellular carcinoma cells were prepared as target cells (RPMI-1640 with 1.0% FBS) in 3 replicates in 96 well-plate at 0.5 ⁇ 10 4 cells/well (50 ⁇ l).
  • IL-2 pretreated NK92 cells were prepared as effector cells at 1.0 ⁇ 10 6 cells/ml, and various concentrations of NK cells (1.0 ⁇ 10 6 , 0.5 ⁇ 10 6 , 0.25 ⁇ 10 6 , and 0.125 ⁇ 10 6 ) were prepared.
  • E:T 1.25:1, 2.5:1, 5:1 or 10:1
  • E:T 1.25:1, 2.5:1, 5:1 or 10:1
  • E:T 1.25:1, 2.5:1, 5:1 or 10:1
  • E:T 1.25:1, 2.5:1, 5:1 or 10:1
  • Cells were incubated in 96-well plates at 37.0° C. and 5.0% CO 2 for 4 hours.
  • target TSAHC 4'-( p -toluenesulfonylamido-4-hydroxychalcone), 1.0 or 5.0 ⁇ M] or a negative control compound (4'-methoxy-4-dihydroxychalcone, 1.0 ⁇ M) for 1 hour in advance.
  • NK92 cells After treatment, the cells were co-cultured with NK92 cells and maintained for 4 hours. The absorbance of LDH secreted from the killed target cells was measured at 492-690 nm using an ELISA reader. The degree (%) of apoptosis by NK92 cells was calculated by the following formula:
  • NK92 cells or target liver cancer cells were isolated and qRT-PCR or Western blot was performed.
  • non-specific shRNA (NS) and shTM4SF5 (#2 or #4 sequence) were infected with lentivirus in Huh7 hepatic epithelial cells endogenously expressing TM4SF5, and then TM4SF5 mRNA level was confirmed by qRT-PCR. By doing so, the efficacy of shTM4SF5 for inhibiting the expression of TM4SF5 was confirmed (FIG. 14a).
  • hepatocellular carcinoma cells in which TM4SF5 expression is maintained (NS) or suppressed (shTM4SF5 #2 or #4) as Target (Target, T) cells (0.5 ⁇ 10 4 cells) are put in a 96-well plate, and Effector (E) As cells, NK92 cells were mixed at a given ratio (E:T ratio; effector to target cell number) and incubated at 37°C 5% CO 2 for 4 hours, and then ELISA reader was used with LDH (lactate dehydrogenase) assay kit (Abcam).
  • LDH lactate dehydrogenase
  • TM4SF5 endogenously expressing non-hepatocellular or hepatocellular carcinoma cell lines (Huh8, Hep3B and HepG2).
  • liver cancer cells target cells
  • shTM4SF5 target #4 sequence
  • ligands whose expression increased by 1.5 times or more in the target cell line in which the expression of TM4SF5 was suppressed compared to the target cell line injected with NS were displayed in white, and MICA in at least two cell lines among the three target cell line types.
  • MICB CADM1 , SLAMF6 , SLAMF7 , ULBP1 , ULBP3 , Nectrin-1 and Nectrin-2 were confirmed to have increased expression.
  • NK92 cells binding MICA and MICB of target cells
  • SLAMF6 binding to SLAMFs of target cells
  • SLAMF7 SLAMF7 of NK92 cells
  • NK92 cell line was analyzed by qRT-PCR of cytokines and granules secreted by NK92 cells.
  • PRF1 perforin
  • GZMB granzyme
  • CD107a Cluster of Differentiation 107a, or lysosomal-associated membrane protein 1, LAMP1
  • TNF- ⁇ tumor necrosis factor- ⁇
  • FasL Fas ligand
  • TRAIL TNF-related apoptosis -inducing ligand
  • TM4SF5 expression when TM4SF5 expression is suppressed in target cells, the ligands and receptors capable of activating NK cells are also increased in liver cancer cells, which are target cells, and NK92 cells, which are effector cells, respectively, and target by cytotoxic activity of NK cells. It was confirmed that cell death was induced.
  • ⁇ 4-3> Confirmation of mRNA expression levels of TM4SF5, SLAMF7, MICA, and ULBP1 and ULBP2 in liver cancer (HCC) tissue
  • TM4SF5 was detected in liver cancer among normal and liver cancer patients using 'Analyze with GEO2R' from the public database Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) database (accession numbers GSE14520).
  • GEO Gene Expression Omnibus
  • MICA MHC class I polypeptide-related sequence A
  • ULBP1 UL16 Binding Protein 1
  • TM4SF5 mRNA expression of TM4SF5 was significantly increased in the liver tissue of liver cancer patients compared to normal liver, and the mRNA expression of SLAMF7, MICA and ULBP1 was statistically significantly decreased. Accordingly, the expression of TM4SF5 and these genes was antagonistic or It was found that the control was performed in a negative correlation relationship (FIG. 17).
  • non-specific shRNA NS
  • shTM4SF5 #2 or #4 sequence
  • TM4SF5 mRNA levels were checked in HepG2 cells by qRT-PCR, confirming that shTM4SF5 effectively inhibited the expression of TM4SF5 ( FIG. 18a ).
  • FIG. 18b After co-culture, when the degree of apoptosis of the target cells was confirmed, it was confirmed that the level of death was higher when the expression of TM4SF5 was suppressed (by NK92 cells) ( FIG. 18b ).
  • NK92 cells After co-culture, intact NK92 cells were isolated by centrifugation (850 ⁇ g, 5 minutes) after taking a portion of the culture medium to obtain NK92 cells, which are non-adherent cells, separately from adherent hepatocarcinoma cells. Western blotting was performed by obtaining an extract of the isolated NK92 cells to confirm the intracellular signaling activity for enhancing receptor expression in target cells for NK cell line activation.
  • Control shRNA was injected into the Huh7 cell line expressing TM4SF5 to suppress expression, or shTM4SF5 (#2 or #4 sequence target) was injected to suppress TM4SF5 expression (left), control for SNU449 cells
  • Western blotting was performed by obtaining cell extracts from cells infected with a lentivirus expressing an expression vector (SNU449C p ) or a TM4SF5 vector (SNU449T p or SNU449T 7 ).
  • TM4SF5 membrane protein ligands (SLAMF7 and MICA/B) (which can activate NK92 cells) decreased in the cells expressing TM4SF5 ( FIG. 21 ). That is, it was estimated that when the function or activity of TM4SF5 is inhibited by TSAHC treatment, stimulatory ligands increase and ultimately NK cell activation is possible, thereby inhibiting cancer formation.
  • SLAMF7 and MICA/B membrane protein ligands
  • cells infected with a retrovirus expressing the control expression vector (EV) or TM4SF5 vector (TM4SF5) in SNU449 cells were not treated with TSAHC or treated with (0), 0.5, 1.0, or 2.0 ⁇ M for 24 hours. After that, the cell extract was obtained and western blotting was performed on the SLAMF protein.
  • EV control expression vector
  • TM4SF5 vector TM4SF5 vector
  • Western blot was performed for a membrane protein ligand capable of activating NK92 cells.
  • TSAHC treatment can be an immune checkpoint inhibitor of NK cells as a drug that inhibits the immune checkpoint TM4SF5.
  • the human NK cell line NK92 cells
  • NK92 cells was newly injected with EV or TM4SF5 vector into cells infected with retrovirus expressing EV or TM4SF5 vector (TM4SF5) (left) or Huh7-KO cell line knocked out with TM4SF5 expression.
  • TM4SF5 vector retrovirus expressing EV or TM4SF5 vector
  • Huh7-KO cell line knocked out with TM4SF5 expression was obtained from the obtained cells (right), a cell extract was obtained and western blotting was performed for membrane protein ligands and receptors capable of inhibiting NK92 cell activation.
  • PD-L1 programmed death-ligand 1
  • a membrane protein ligand which can inhibit NK92 cell activation
  • a receptor, programmed cell death protein (PD-1) -1) increased, respectively.
  • FIGS. 24A and 24B show that the expression of TM4SF5 increases the expression of PD-L1 in hepatic epithelial cells and increases the expression of its receptor, PD-1, in NK92 cells, thereby reducing the activity of NK cells, and ultimately, the target cells of NK cells.
  • the immune evasion function which enables the survival/proliferation of target cells, occurs by lowering the cytotoxic activity against
  • the membrane protein ligand CD112 [Nectin-2, Poliovirus receptor-related 2 (PVRL2)], CD111 [ Nectin-1, Poliovirus receptor-related 1 (PVRL1)] and the receptors CD112R (CD112 receptor), TIGIT (T cell immunoglobulin and ITIM domain), CD96 (Tactile, T Cell-Activated Increased Late Expression Protein) and PD-1 increased, respectively ( FIGS. 25A and 25B ).
  • CD226 Cluster of Differentiation 2266, which is known to enhance NK cell activity without inhibiting it, tends to increase.
  • TM4SF5 increases ligands for inhibition of NK cell activation in hepato-epithelial cells and increases the expression of its receptors in NK92 cells, which ultimately leads to a decrease in NK cell activity, which leads to NK cell target cells. This suggests that the immune evasion function that enables the survival/proliferation of target cells occurs by lowering the toxic activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명의 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 면역세포 활성 조절용 조성물에 관한 것으로, TSAHC 처리에 의해 TM4SF5가 억제되어 비장에 존재하는 NK 세포의 군집이 증가되고, 간상피세포에서의 NK 세포 활성화 리간드의 발현이 증가되며, 궁극적으로 NK 세포의 세포 독성 활성이 증가되는 것을 확인하였는 바, 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 조성물은 NK 세포 활성 조절제로 유용하게 사용될 수 있다.

Description

TSAHC 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물
본 발명은 TSAHC 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물에 관한 것이다.
간은 우리 몸에서 지질 등의 대사 작용, 해독, 담즙의 배설, 각종 영양소의 저장, 조혈이나 혈액응고 및 순환 혈액량의 조절 등 많은 기능을 한다. 따라서, 간에 장애가 발생하면 여러 가지 기능이 저하되고, 최악의 경우에는 생명의 유지가 곤란해진다.
간의 기능을 보다 구체적으로 살펴보면, 첫째, 에너지 대사를 관리하는 기능이 있어 음식물로부터 흡수된 탄수화물, 지방, 및 아미노산을 포함하는 단백질 등의 모든 영양소들이 간에서 에너지를 생산할 수 있는 물질로 대사되어 전신에 공급되거나 저장된다. 둘째, 간에 존재하는 약 2,000여 종의 효소, 알부민, 응고인자들이 혈청 단백질, 담즙산, 인지질, 콜레스테롤 등의 지방을 합성하고 저장 및 분배한다. 셋째, 해독 및 분해 기능으로서, 간에서 약물, 술, 독성물질 등을 해독시키므로 이 과정에서 간세포가 손상되기 쉽다. 따라서, 약물, 독 또는 알코올에 의한 간질환이 흔히 발생할 수 있다. 넷째, 간은 각종 대사산물을 십이지장으로 배설하는 기능을 하며 면역기능 등이 있어 생명 유지에 중요한 역할을 한다.
간질환은 원인에 따라 바이러스성 간질환, 알코올성 간질환, 약물 독성 간질환, 지방간, 자가면역성 간질환, 대사성 간질환 및 기타로 구분할 수 있다. 간질환은 초기 자각증상이 없어 상당히 진행된 뒤에서야 발견되기 때문에 우리나라뿐만 아니라 세계적으로 사망원인의 수위를 차지하고 있다. 이에, 간질환을 효과적으로 진단하거나 치료하는 방법에 관한 연구가 필요하다.
인간의 간(liver)에 염증이 생기는 현상은 여러 만성적 간 질환의 병인이면서 특성이라고 할 수 있다. 알코올, 바이러스 감염, 독소 축적 및 대사 기능(metabolism) 이상으로 인한 간상피세포의 만성적 손상과 세포의 사멸에 기인하여 동반되는 염증 반응은 추가적인 간질환의 유발 및 심화에 중요한 작용을 한다. 이러한 간질환의 발병 및 심화과정에서도 염증반응의 과잉이 병인으로서 작용하기도 하지만, 그 간질환의 심화에 따른 치료를 위한 방편으로 간절제술 및 간이식을 시도할 경우, 과다염증반응이 문제가 생길 수 있어 면역억제의 필요성이 생긴다.
정상 간에서 만성적 간 세포 자극/손상 및 대사 기능의 이상으로 인한 비알콜성지방간은 세포의 손상과 사멸로 인한 염증이 동반되어 지방간염으로 심화되고, 나아가 세포외기질(extracellular matrix)의 축적과 세포의 이상 증식을 초래하는 섬유화 및 간경화 증상으로 심화될 수 있다. 간에 존재하는 상피세포 혹은 간성상세포와, 대식세포, T세포 및 NK(자연살상세포) 세포를 포함하는 면역세포 간의 상호작용에 따른 대사-염증 환경의 변화 및 상호작용에 따라 섬유화/경화된 간 조직이 암화(carcinogenesis)되는 것이 억제되거나 촉진될 수 있다.
TM4SF5(Transmembrane 4 L six family member 5)는 세포막을 4번 통과하는 테트라스파닌(tetraspanin)으로서 만성적 간상피세포의 손상에 따른 다양한 사이토카인 및 케모카인의 작용으로 간상피세포 및 대식세포에서 발현이 높아지는 것이 확인되었다. 따라서, 간상피세포와 대식세포의 상호작용은 TM4SF5의 발현에 의존하여 간의 염증 반응 및 면역 환경을 재구성(remodeling)하여 지방간염을 넘어서 간 섬유화 또는 간 경화를 유발할 수 있다. 궁극적으로 암화가 이루어질 즈음에는 상피세포의 TM4SF5 발현이, 대식세포, T세포 및 NK 세포 등을 포함하는 면역세포의 항암 활성 기능을 억제할 수 있도록 하는 면역회피(immune escape)의 과정을 가능하도록 하여 효과적 암화내지는 암발병률을 높일 수 있다.
따라서, TM4SF5의 발현을 억제하거나 TM4SF5의 기능을 조절하는 억제제로써 소분자화합물 또는 항체를 이용한다면, 간 조직에서 간상피세포와 면역세포 간의 상호작용을 조절 억제하여 지방간염, 섬유화/경화로의 심화를 억제 조절할 수 있을 것이고, 또한 궁극적으로 NK 세포 또는 T세포들 등을 포함하는 세포의 항암 면역 활성을 회피하고자 하는 기능을 제거할 수 있음으로써 간암에 대한 면역 치료의 수단이 생길 수 있을 것으로 예상된다.
이에, 본 발명자들은 간조직에서 간상피세포와 면역세포 간의 상호작용을 억제하여 지방간염, 섬유화 또는 경화를 억제 조절하고, 궁극적으로 NK 세포의 항암 면역 활성을 회피하고자 하는 기능을 제거하기 위한 TM4SF5 억제제에 대하여 연구하던 중, TM4SF5 발현에 의해 비장 혹은 간에 존재하는 NK 세포 혹은 CD4+ 양성 보조 T세포의 군집이 감소하고, TSAHC 처리에 의해 TM4SF5의 활성이 억제되어 비장 혹은 간에 존재하는 NK 세포의 군집이 증가되고, NK 세포 활성화 리간드의 발현이 증가되며, 궁극적으로 NK 세포의 세포 독성 활성이 증가되는 것을 확인함으로써, 본 발명을 완성하였다.
본 발명은 NK 세포의 살상 효과를 높여주기 위해, 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물을 제공하는 것을 목적으로 한다.
상기 목적을 달성하기 위하여,
본 발명은 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물을 제공한다.
본 발명의 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물에 관한 것으로, TSAHC 처리에 의해 TM4SF5가 억제되어 비장 혹은 간에 존재하는 NK 세포의 군집이 증가되고, NK 세포 활성화 리간드의 발현이 증가되며, 궁극적으로 NK 세포의 세포 독성 활성이 증가되는 것을 확인하였는 바, 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 조성물은 NK 세포 활성 조절제로 유용하게 사용될 수 있다.
도 1은 디에틸니트로사민(diethylnitrosamine,　DEN)처리에 따른 간의 손상 및 간암 마우스 모델의 간조직을 H&E 염색하여 간의 손상 및 면역세포 밀집(염증) 정도를 확인한 도이다.
도 2는 간의 손상 및 간암 마우스 모델에서 시간에 따른 생존율을 측정한 도이다.
도 3은 간의 손상 및 간암 마우스 모델의 간조직을 이용하여 라미닌(Laminin), STAT3(signal transducer and activator of transcription 3), TM4SF5의 발현수준, STAT3 Tyr705의 인산화(pY705STAT3) 및 ERK1/2의 인산화(p-Erk)을 웨스턴블랏(western blot)을 통해 확인한 도이다.
도 4는 간의 손상 및 간암 마우스 모델에서 TM4SF5, STAT3, pY705STAT3 (STAT3 Tyr705의 인산화), 콜라젠, 라미닌 및 라미닌 γ2의 발현 정도를 H&E 및 immunohistochemistry를 통해 확인한 도이다.
도 5는 간의 손상 및 간암 마우스 모델을 확보하기위한 DEN ± TSAHC 약물처리 등을 개략적으로 나타낸 도이다.
도 6은 대조군 및 처리군 동물의 간의 손상 및 간암 마우스 모델에서 종양 형성 정도를 확인한 도이다.
도 7은 간의 손상 및 간암 마우스 모델에서 지름이 1.0 mm 이상인 종양의 숫자(a) 및 총 부피(b), 각 동물에서 최대 종양의 크기(c)를 분석한 도이다.
도 8은 간의 손상 및 간암 마우스 모델의 간조직에서 종양을 관찰하기 위하여 H&E 염색, 세포증식을 나타내는 핵단백질 Ki67 및 간암 마커인 α-feto protein(AFP)의 발현을 위한 DAB(3,3'-diaminobenzidine) immunohistochemistry을 수행한 결과를 나타낸 도이다.
도 9는 간의 손상 및 간암 마우스 모델에서 각 마우스의 간/체중 비율(a), 혈장 내 ALT(b), 총 콜레스테롤(c) 및 혈장 글루코스(d) 양을 확인한 도이다.
도 10은 간의 손상 및 간암 마우스 모델의 간조직을 AFP(α-fetoprotein) 염색과 더불어 면역세포들이 밀집된 육아종염증(granulomatous inflammation) 형성 정도를 확인한 도이다.
도 11은 대조군 및 처리군 동물의 간의 손상 및 간암 마우스 모델에서 각 마우스의 비장을 확보하여 면역염색후 유세포분석을 통하여(a), 보조 T세포(b), 세포 독성 T세포(c) 및 자연살상세포 NK 세포(d)의 군집을 확인한 도이다.
도 12는 간의 손상 및 간암 마우스 모델에서 각 마우스의 간조직을 확보하여 면역염색후 유세포분석을 통하여(a), 보조 T세포(b), 세포 독성 T세포(c) 및 NK 세포(d)의 군집을 확인한 도이다.
도 13는 간의 손상 및 간암 마우스 모델에서 각 마우스의 간조직을 확보하여 NK 세포로부터 분비되는 싸이토카인(a, b) 및 과립(c)들의 생성 정도를 면역염색 및 유세포분석을 통하여 확인한 도이다.
도 14는 렌티바이러스를 이용하여 non-specific shRNA(NS) 및 shTM4SF5(#2 및 #4 sequence)를 Huh7 간상피세포에 감염시켜 만든 target 세포에서 TM4SF5 발현을 확인하고(a), 그 target 세포 및 Effector 세포인 NK92 세포의 배양 비율에 따른, NK92 세포의 세포 독성(cytotoxicity) 정도를 확인(b)한 도이다.
도 15는 렌티바이러스를 이용하여 non-specific shRNA(NS) 및 shTM4SF5(#2 및 #4 sequence)를 간상피세포인 Huh7(a), Hep3B(b) 및 HepG2(c)에 감염시킨 후, 각 세포에서 NK 세포의 세포 독성 활성화와 관련된 여러 리간드(ligand) 막단백질의 mRNA 발현 정도를 확인한 도이다.
도 16은 렌티바이러스를 이용하여 non-specific shRNA(NS) 및 shTM4SF5(#2 및 #4 sequence)를 간상피세포에 감염시킨 후, 간상피세포와 NK92 세포와의 공동배양 후, NK92 세포에서 NK 세포의 세포 독성 활성화와 관련된 여러 수용체(receptor) 막단백질의 mRNA(a) 및 살상 관련 싸이토카인 혹은 과립(b)들의 발현 정도를 확인한 도이다.
도 17은 Gene Expression Omnibus (GEO) database (accession numbers GSE14520)로부터 'Analyze with GEO2R'를 이용하여 정상간 조직과 간암 조직에서의 TM4SF5, SLAMF7(Signaling lymphocytic activation molecule F7), MICA(MHC Class I Polypeptide-Related Sequence A) 및 ULBP1(UL16 Binding Protein 1) 및 ULBP2(UL16 Binding Protein 2)의 mRNA 발현 수준을 확인한 도이다.
도 18은 렌티바이러스를 이용하여 non-specific shRNA(NS) 및 shTM4SF5(#2 및 #4 sequence)를 HepG2 간상피세포에 감염시켜 만든 Target 세포 및 Effector 세포인 NK92 세포의 공동배양 비율에 따른, Target 세포에서의 TM4SF5 발현(a) 및 NK92 세포의 세포 독성 정도(b)를 확인한 도이다.
도 19는 렌티바이러스를 이용하여 non-specific shRNA(NS) 및 shTM4SF5(#2 및 #4 sequence)를 HepG2 간상피세포에 감염시켜 만든 Target 세포 및 Effector 세포인 NK92 세포의 공동배양 비율에 따른, NK 세포의 ERK1/2의 인산화 정도를 확인한 도이다.
도 20은 TSAHC 처리 농도에 따른 NK92 세포와 공동배양된 Huh7 간상피세포의 세포 사멸 정도를 확인한 도이다.
도 21은 렌티바이러스를 이용하여 non-specific shRNA(NS), shTM4SF5(#2 및 #4 sequence) 또는 공벡터(EV)를 Huh7 간상피세포 또는 SNU449 세포에 감염시킨 후, 각 세포에서 NK 세포의 세포 독성 활성화와 관련된 여러 리간드 막단백질의 발현 정도를 확인한 도이다.
도 22는 SNU449 세포에 대조 발현 벡터 (EV) 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들에 TSAHC를 처리하지 않거나 (0), 0.5, 1.0, 또는 2.0 μM로 24 시간 동안 처리한 후, 세포추출액을 확보하여 SLAMF6((Signaling lymphocytic activation molecule F6), SLAMF7 및 MICA/B(MHC Class I Polypeptide-Related Sequence A/B) 단백질들의 발현을 확인한 도이다.
도 23은 SNU449 세포에 EV(대조군 벡터) 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시키거나(a), TM4SF5의 발현을 억제한 Huh7-KO 세포주에 다시 EV(대조군 벡터) 혹은 TM4SF5 벡터를 주입하여 얻은 세포주(b)의 세포추출액을 확보하여 NK92 세포를 활성화시킬 수 있는 막단백질 리간드의 발현을 확인한 도이다.
도 24는 인간 NK세포주인 NK92 세포에 EV(대조군 벡터) 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들(왼쪽) 혹은 TM4SF5를 발현을 억제한 Huh7-KO 세포주에 EV 혹은 TM4SF5 벡터를 주입하여 얻은 세포들(오른쪽) 로부터, 세포추출액을 확보하여 NK92 세포를 활성화를 억제할 수 있는 막단백질 PD-1(programmed cell death protein-1) 수용체와 PDL-1(Programmed Death Ligand　1) 수용체(a)와 리간드(b)의 발현을 확인한 도이다.
도 25는 TM4SF5를 발현을 억제한 Huh7-KO 세포주에 EV 혹은 TM4SF5 벡터를 주입하여 얻은 세포 (a) 혹은 인간 NK 세포주인 NK92 세포에 EV 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들(b)를 이용하여 qRT-PCR을 수행하여 NK세포의 세포독성과 관련된 각 유전자들의 mRNA 수준을 확인한 도이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포(Natural killer cell, NK cell) 활성 조절용 조성물을 제공한다.
본 명세서에서 사용된 용어, "4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘[4'-(p-toluenesulfonylamido-4-hydroxychalcone)]"은 칼콘계 화합물로 합성을 통해 제조된 것일 수 있다. 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘은 TSAHC으로 사용될 수 있으며, 녹는점은 106 ~ 107℃이고, 1H NMR (300 MHz; MeOD) d 225 (3H, s), 682 (2H, d, J = 86 Hz), 723 (4H, m), 742 (1H, d, J = 155 Hz), 751(2H, d, J = 86 Hz), 766 (1H, d, J = 155 Hz), 773 (2H, d, J = 83 Hz), 790 (2H, dd, J1 = 87, J2 = 20 Hz) 및 HERIMS m/z 3931035 [M+] (calcd for C22H19NO4S, 3931034)의 특징을 가지는 화합물이다.
상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘은 하기 화학식 1의 구조를 가진다.
[화학식 1]
Figure PCTKR2021018197-appb-img-000001
본 명세서에서 사용된 용어, "TM4SF5(transmembrane 4 L6 family member 5) 단백질"이란, 세포막을 4번 통과하는 막수용체 그룹인 테트라스패닌, 테트라스판 또는 TM4SF(transmembrane 4 super family)에 포함되는 단백질로서, 세포막을 4번 통과하는 서로 유사한 구조로 이루어진다. 상기 TM4SF5 단백질은 생화학적으로 막횡단영역(transmembrane domain)으로 추정되는 4개의 소수성 부위를 포함하는 구조를 공유하고 있다.
상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간의 손상, 면역세포의 밀집 또는 염증을 억제할 수 있다.
상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간조직에서의 면역세포의 밀집 정도, Ki67 또는 AFP 단백질의 발현 정도 및 육아종염증의 형성 정도를 감소시킬 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들이 TSAHC 처리가 간의 손상 정도 및 염증 반응에 미치는 영향을 확인하기 위하여, PBS를 처리하는 대조군과 디에틸나이트로사민 처리를 통한 간 조직의 손상을 위한 동물 모델 그룹들의 간 손상 정도를 확인한 결과, DEN 처리군의 간 조직에서는 PBS를 처리한 대조군에 비하여 간의 손상 정도와 면역세포의 밀집이 두드러졌으며, TSAHC를 동시에 또는 차순으로 처리한 DEN+TSAHC1 및 DEN+TSAHC2 군의 경우, DEN 처리군에 비하여 간의 손상 및 면역세포의 밀집 또는 염증 정도가 감소하였음을 확인하였다(도 1 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간조직에서의 TM4SF5 또는 라미닌(Laminin)의 발현을 억제하거나, STAT3의 Tyrosine 705 또는 ERK1/2의 인산화의 증가를 억제할 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들이 실험예 1-1의 마우스의 간조직을 이용하여, TM4SF5, STAT3, STAT3 Tyr705의 인산화, ERK1/2의 인산화 및 라미닌의 발현 정도를 웨스턴블랏을 통해 확인한 결과, PBS를 처리한 대조군에 대비하여 DEN 처리군에서 대식세포 및 NK 등 면역세포의 특성인 pY705-STAT3, p-Erk 및 라미닌의 발현이 TM4SF5 발현 향상과 더불어 높았으며, DEN+TSAHC1 군에서의 TM4SF5의 발현 수준은 DEN 처리군과 큰 차이가 없었으나, pY705-STAT3 및 라미닌의 발현이 낮아졌으며 DEN+TSAHC2 군에서는 pY705-STAT3의 수준이 DEN 처리군보다 낮아진 것을 확인하였다(도 3 참조). 또한, H&E 및 immunohistochemistry를 수행한 결과, PBS 처리군과 대비하여 DEN 처리군에서는 간의 손상이 증가하였고, TM4SF5, Tyr705가 인산화된 STAT3, 콜라젠, 라미닌 및 라미닌 γ2의 발현이 향상되었으나, 이러한 DEN에 의한 효과는 TSAHC를 처리함에 따라 감소함을 확인하였다(도 4 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간에서 종양의 형성, 종양의 숫자 및/또는 종양의 부피 및 최대 종양의 크기를 감소시킬 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 간 손상 및 간암 발병 상관성 확인하기 위하여 간의 손상 및 간암 마우스 모델에서 DEN을 처리한 WT 마우스에서는 크고 작은 종양들이 많이 생성되었으나, TSAHC를 동시에 처리한 그룹에서는 종양이 훨씬 작고 적게 생기는 것을 확인하였다 (도 6 참조). 또한, 밀접하게도 종양의 숫자 및 총 부피, 각 동물에서 최대 종양의 크기도 DEN을 처리한 WT 마우스에 비해 TSAHC를 동시에 처리한 그룹에서 감소하는 경향이 있음을 확인하였다 (도 7a 내지 7c 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 분리된 시료 내 ALT, 콜레스테롤 또는 글루코스 수치를 낮출 수 있다.
상기 분리된 시료는 혈액, 전혈, 혈청 및 혈장으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있고, 바람직하게는 상기 분리된 시료는 혈청일 수 있으나, 이에 제한되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들은 간암 발병과 대사 기능 조절 사이의 연관성을 확인하기 위해 간의 손상 및 간암 마우스 모델의 혈청을 분리하여 ALT, 콜레스테롤 및 글루코스의 양을 측정하였고, DEN 처리 때문에 간의 손상 및 암이 생길 경우에, 간/체중의 비율, ALT 간수치, 혈액 속에 콜레스테롤 및 glucose의 수준이 높아지고, KO 마우스 혹은 TSAHC 처리 때문에 TM4SF5의 기능이 억제되어 암이 적게 생긴 그룹에서는 그들의 값들이 낮게 확인하였는데 (도 9a 내지 9d 참조), 이는 간암발병과 TM4SF5 및 염증-대사 기능과의 상관성이 있음을 나타낸다.
또한, 면역세포 침투와 종양 형성 사이의 상관성 확인한 결과, WT+DEN+TSAHC 군은 AFP의 염색 정도와 육아종염증(granulomatous inflammation)의 정도가 동반하여 높았으나, TSAHC 처리에 따라 그 염색들의 정도가 낮아져, 면역세포들이 침투가 억제되는 것과 염증 및 종양 형성이 둔화된 것이 서로 상호관계가 있음을 확인할 수 있었다 (도 10 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 비장 내 자연 살상 세포의 군집을 증가시킬 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 TSAHC 처리 여부에 따른 비장 내 면역세포 군집의 상태를 확인하기 위해, 2주령의 C57BL/6 정상 WT 마우스 및 Tm4sf5-/- KO 마우스 수컷에 vehicle을 처리하거나(Age-matched 대조군), DEN(25 mg/kg 체중)을 1회 IP 주사하고, 1주일에 2회씩 DMSO(40% DMSO) 혹은 TSAHC(5 mg/kg 체중/40% DMSO) IP 주사하여 처리하였다. 45주가 지난 후, 비장 및 간에서의 T세포 및 NK 세포 등의 면역세포들을 실시예 6에 기재된 면역염색법과 유세포분석법을 통하여 면역세포들을 조사하였다. 그 결과, 간암이 크고 많이 생긴 WT+DEN 군의 경우, 보조 T세포의 군집은 감소하였으므로 보조 T세포의 감소로 종양이 생겼을 것이고, 세포독성 T세포의 경우는 오히려 군집이 증가하여, 상기 세포독성 T세포가 간 손상 및 암 발병에 유의적으로 기여하지 않음을 확인하였다(도 11a 내지 11d 참조). 그러나, NK 세포의 경우, WT+DEN 군은 대조군과 대비하여 NK 세포의 군집이 감소하였다. 또한, DEN 처리하였으나 유전자 Tm4sf5가 낙아웃(KO)된 KO+DEN 군이나 TSAHC 처리에 따라 TM4SF5 단백질 활성이 억제된 실험군은 NK 세포의 군집이 증가하였다. 이는, TM4SF5-의존적 DEN 처리에 따른 간의 손상 및 암 발병은 비장에 존재하는 NK 세포의 군집과 유의적인 연관성이 있음을 시사한다.
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 표적 세포에서 MICA, MICB, CADM1(cell adhesion molecule 1), SLAMF6, SLAMF7, ULBP1, ULBP2, ULBP3, Nectin-1(CD111) 및 Nectin-2(CD112)으로 이루어진 군으로부터 선택되는 어느 하나 이상의 발현을 증가시킬 수 있다.
상기 표적 세포는 손상된 간 세포 또는 간암세포일 수 있으나, 이에 제한되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들이 간암세포와 NK92 세포를 공동배양을 한 후에, NK92 세포주에서의 활성화를 위한 수용체 막단백질들의 mRNA 수준을 qRT-PCR로 확인한 결과, (target 세포의 MICA 및 MICB와 결합하는) NK92 세포의 NKG2D, (target 세포의 SLAMFs와 결합하는) SLAMF6 및 SLAMF7의 mRNA 발현이 TM4SF5가 발현이 유지된 세포보다 발현이 억제된 간암세포(target 세포)와 공동배양되었을 때 NK92 세포에서 더 높아짐을 확인하였다(도 16a 및 16b 참조).
또한, TM4SF5를 발현하는 Huh7 세포주에 대조 shRNA(NS)를 주입하여 발현 억제를 하지 않거나 shTM4SF5(#2 혹은 #4 서열 표적)를 주입하여 억제한 세포들로부터(왼쪽), SNU449 세포에 대조 발현 벡터(SNU449Cp) 또는 TM4SF5 벡터를 발현(SNU449Tp 혹은 SNU449T7)하는 렌티바이러스로 감염시킨 세포들로부터 세포추출액을 확보하여 웨스턴블랏을 수행한 결과, TM4SF5가 발현하는 세포들의 경우에서 (NK92 세포를 활성화시킬 수 있는) 막단백질 리간드(SLAMF7 및 MICA/B 등)가 감소하였다(도 21 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 PRF1(Perforin-1), GZMB(Granzyme B), CD107a(Cluster of Differentiation 107a, 혹은 lysosomal-associated membrane protein 1, LAMP1), TNF-α(Tumor necrosis factor-α), FasL(Fas ligand) 및 TRAIL(TNF-related apoptosis-inducing ligand)로 이루어진 군으로부터 선택되는 어느 하나 이상의 발현을 증가시킬 수 있다.
본본 발명의 구체적인 실시예에서, 본 발명자들이 간암세포와 NK92 세포의 공동배양을 한 후에, NK92 세포주에서의 활성화 정도를 NK92 세포가 분비하는 싸이토카인 및 과립(granule)들을 qRT-PCR로 분석한 결과, PRF1, GZMB, CD107a, TNF-α, FasL, 및 TRAIL의 mRNA들이, TM4SF5가 발현이 높은 세포보다 발현이 억제된 간암세포(target 세포)와 공동배양되었을 때, NK92 세포에서 더 높아짐을 확인하였다(도 16a 및 16b 참조).
또한, 상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간상피세포에서 CD112 (Nectin-2), CD111 (Nectin-1), PD-L1의 발현을 억제시키고, 자연 살상 세포에서 CD112R(CD112 receptor), TIGIT(T Cell Immunoreceptor With Ig And ITIM Domains), CD96(Cluster of Differentiation 96) 및 PD-1(programmed cell death protein-1)의 발현을 억제시킬 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 TM4SF5를 발현하는 간상피세포 (Huh7)에서 막단백질 리간드인 CD112, CD111, PD-L1이 증가하고, NK세포에서 수용체인 CD112R, TIGIT, CD96 및 PD-1이 각각 증가하는 것을 확인하였다 (도 24a 내지 도 25b 참조).
이하, 본 발명을 다음 실시예 및 실험예에 의해 상세히 설명한다. 단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.
<실시예 1> 세포의 배양
마우스 정상세포인 AML12, 인간 간암 세포 중 TM4SF5를 발현하지 않는 SNU449 세포주에 TM4SF5를 발현하는 레트로바이러스(retrovirus)를 감염시켜 만든 세포주(SNU449Tp 및 SNU449T7)와 대조군 바이러스(control virus)를 감염시킨 SNU449Cp 세포주, TM4SF5를 원래 내인성으로(endogenous) 발현(Hep3B, HepG2, Huh7)하는 세포, 인간 배아 신장 세포주(HEK293과 HEK293T, KCLB, 대한민국, HEK293FT, Thermo, 미국)는 10%의 FBS와 항생제(Invitrogen, CA, 미국)가 포함된 DMEM 혹은 RPMI-1640 배양액(WelGene, 대구 대한민국)으로 37℃ 5% CO2 세포 배양기에서 배양하였다. 일차 간세포(Primary hepatocytes)는 C57BL/6 정상 WT 혹은 Tm4sf5-/- KO 마우스에서 분리하여 DMEM(Dulbecco's Modified Eagle's medium) 혹은 RPMI-1640(Roswell Park Memorial Institute Medium, Hyclone)에 10% FBS(GenDEPOT), 1% penicillin/streptomycin(GenDEPOT), 그리고 1 x GlutaMax(Invtrogen, 미국)를 첨가하여 위와 같은 방법으로 배양하였다. 인간 자연 살상 세포(natural killer cell, NK cell) NK92 세포주는 재배합 인간 IL-2(Peprotech) 200.0 U/ml, 12.5% FBS 및 12.5% fetal horse serum(GenDEPOT)가 포함된 α-MEM(Invitrogen) 배양액을 사용하여 배양하였다.
<실시예 2> 유전자 주입 및 발현 억제
공벡터(Empty vector, EV) 혹은 포유동물 발현 플라스미드(expression plasmids)에 포함된 cDNA를 세포주에 lipofectamine 3000(Thermo Fisher Scientific Inc.)을 이용하여 형질감염(transfection)시키거나, 공벡터나 cDNA를 포함하는 렌티바이러스 벡터를 숙주세포에 감염시켜 얻은 렌티바이러스를 감염시켜, 연구대상 세포주에 유전자를 인위적으로 발현하도록 하였다. 한편, siRNA 및 pLKO.1-shRNA(control 서열 혹은 표적하는 유전자의 특정서열을 표적하는 서열)을 48시간 동안 Lipofectamine RNAiMAX Transfection Reagent(Thermo Fisher Scientific Inc.)를 이용하여 형질감염 시키거나 렌티바이러스를 감염시켰다.
<실시예 3> TM4SF5 발현 억제 및 유도
간상피세포에서 TM4SF5의 발현을 억제하기 위하여 pLKO.1-shRNA(control 서열, TM4SF5 #2 혹은 #4 서열)를 48시간동안 형질감염 시키거나 렌티바이러스를 감염시켰다. 인간 TM4SF5 유전자에 여러 tag를 위한 유전자가 연결된 발현 벡터를 제작(Cell Metabolism 2019, Vol 29: 1306-1319)하여 형질감염하거나 TM4SF5-표적 레트로바이러스 또는 렌티바이러스를 확보하여 감염시켰다. TM4SF5 유전자를 발현 억제를 위한 shRNA 서열을 하기 표 1과 같다.
Figure PCTKR2021018197-appb-img-000002
<실시예 4> TM4SF5 유전자가 녹아웃(Knock Out, KO)된 마우스 제작
C57BL/6 마우스를 이용하여 cas9/RGEN KO 마우스를 제작하였다. RGEN site[마우스 Tm4sf5 Exon 1 표적을 위한 sgRNA 서열 (5'-3'): sgRNA1 GAGGTTGCCGTCCGTCCAGGTGG(서열번호 5), sgRNA2 GCTGAGGTTGCCGTCCGTCCAGG(서열번호 6) 그리고 Tm4sf5 Exon 3 표적을 위한 서열: RG1-GCGGGAGCTGGGCTCCGAATTGG(서열번호 7), RG2-TTAAGCATTTGGGTCCAATTCGG(서열번호 8), RG3-TGAGAAATCCTGTTTGATCTTGG (서열번호 9), RG4-AGGTATTAGGGGTGGCCTATGGG(서열번호 10)]을 이용하여 여러 가지 bp(29, 240, 502, 510, 522 및 538bp)가 결실(deletion)된 마우스를 얻었다. Mouse TM4SF5 프라이머[Forward- GTAGTATGCGGGAGGCACTG (서열번호 11), Reverse- GGGTGACCACTCAGACTTCC(서열번호 12)]를 이용하여 T7E1 assay를 통해 WT/mutant PCR 생산물 간의 heteroduplex formation을 관찰하여 돌연변이 마우스(mutant mouse)를 찾고, 정확하게 KO된 마우스를 실험에 사용하였다. 마우스 TM4SF5의 extracellular loop 2가 시작되는 아미노산 36번 트레오닌(Threonine)이 존재하는 Exon 1을 포함하는 29bp가 결실되어 있는 (Tm4sf5 Exon1-/-) 마우스는 mouse-Tm4sf5 유전자를 위한 프라이머[forward 5'-CCAAGCCTCCCACCTGTTA-3' (서열번호 13), reverse 5'-GCTCCAGCATTCTCACCATC-3'(서열번호 14)]이용한 PCR 방법으로 유전형을 확인을 수행하였다.
<실시예 5> 간의 손상 및 간암 마우스 모델 제조
2주령의 동물에 디에틸나이트로사민(Diethylnitrosamin, DEN)을 처리하여 간의 손상 및 간암 모델을 유발하는 경우에는, 50 mg/kg의 DEN(Sigma-Aldrich)은 28주 혹은 45주동안 1주일에 1회 복강 내 주사(Intraperitoneal injection, IP injection)하였다. DEN을 각각 처리하면서 TSAHC(40% DMSO/60% PBS에 용해)를 같이 처리한 실험에서는 위와 동일하되 TSAHC를 50 mg/kg 일주일에 2-3번을 복강 내 주입하였다. DEN를 28주동안 처리한 경우에는, 동시에 함께 처리하거나(DEN+TSAHC1), DEN을 처리하고 나서 10주가 지난 다음부터 함께 처리한(DEN+TSAHC2) 방법으로 두 가지 프로토콜로 나누었다.
2주령의 수컷 정상 WT 혹은 Tm4sf5-/- KO 마우스에 DEN(25 mg/kg 체중)을 1회 복강에 주사하였다. TSAHC 처리군은 5 mg/kg 체중(40% DMSO)의 농도로 1주일에 2회씩 IP 주사하였다. 45주가 지난 후, 동물을 희생시켜 간조직의 손상 및 암 발병 정도를 확인하였다.
<실시예 6> 동물로부터 면역세포 분리 및 유세포분석
마우스 비장세포 분리는 경추 탈골법으로 희생시킨 후 마우스의 비장을 무균적으로 적출하여 RPMI 1640 배양액으로 씻은 후 멸균 유리봉을 이용하여 분쇄하여 세포를 유리시켰다. 분리된 세포 현탁액을 70 μm nylon mesh(Sigma Chemical Co., St. Louis, MO, USA)에 통과시켜 배양액으로 2번 세척하고, 3,000 rpm에서 10분간 원심분리과정을 거친 후 이것을 Tris-buffered ammonium chloride(NH4Cl, pH 7.2)와 증류수에 현탁시켜 5분간 처리하여 적혈구를 제거하였다.
마우스 간조직을 확보하여 100 μm nylon mesh를 통하여 물리적 분쇄를 통하여 세포 현탁액을 얻었다. 면역세포들은 37.5% percoll(GE Healthcare) 농도구배 원심분리를 통해 확보하였다. 적혈구(Erythrocyte)는 RBC lysis buffer(Inivitrogen)를 이용하여 용해시켰다. 면역세포 종류에 따른 군집(population) 분석을 위하여 CD3, CD45, CD4, CD8 및 NK1.1 항체를 이용하여 면역염색한 후 LSR 유세포분석기(FACS LSR Fortessa™ X-20, BD Biosciences)를 이용하여 각각 보조 T세포, T세포 및 NK 세포의 비장 혹은 간조직 내의 세포 군집을 측정하였다.
NK 세포들의 활성화 측정을 위하여, NK 세포의 IFN-γ, PRF1 및 GZMB 발현을 측정하였다. 세포들을 5.0 ng/mL PMA(Sigma), 500.0 ng/mL ionomycin(Sigma), 10.0 ng/mL monensin(Sigma)와 4시간동안 37.0℃및 5.0% CO2에서 반응시켰다. Lymphocytes FcgII/III 수용체를 Fc Block™(BD)로 blocking하고, surface antigen들은 알맞은 형광 염료와 접합(conjugated)되거나 비오틴이 부착된(biotinylated) 단일클로날 항체로 염색하였다. 그 후 세포들은 Cytofix/Cytoperm™(BD)로 고정하고 스며들게 하였다(permeabilize). IFN-γ, PRF1 및 GZMB와 같은 Intracellular antigens도 알맞은 형광 염료와 접합(conjugated)되거나 비오틴이 부착된(biotinylated) 단일클로날 항체로 염색하였다. 유세포분석은 FACS LSR Fortessa™ X-20(BD)을 이용하여 데이터를 얻고 FlowJo version 10.6.1를 이용하여 분석하였다.
<실시예 7> qRT-PCR 분석
TM4SF5를 발현하는 간상피세포 Huh7 및 Hep3B 세포주에 TSAHC를 처리하지 않거나 (0 μM) 다양한 농도(0.02, 0.1, 0.5, 및 2.5 μM)로 처리한 후 세포를 수거하여 qRT-PCR을 수행하였다. qRT-PCR을 수행하기 위하여 세포 또는 조직을 Qiazol (Qiagen, 미국)을 이용하여 세포파쇄한 후 클로로포름 (chloroform)을 첨가하여 12,000 x g, 4 ℃에서 15분간 원심분리하여 상부의 유기층을 분리하였다. 분리된 유기층에 이소프로판올 (isopropanol)을 첨가하여 RNA을 침강시킨 후 70% 에탄올로 세척하였다. 7,500 x g에서 5분간 원심분리하여 RNA 펠렛을 분리하여 10분간 에탄올을 증발시키고 30 μl DEPC-water에 용액화시켰다. 용액화시킨 RNA는 역전사 kit(Toyobo, 일본)를 이용하여 gDNA 제거 후 역전사하여 cDNA를 얻는다. 얻어진 cDNA는 2x Eva green master mix(Labopass, 대한민국)와 0.4 μM forward/reverse primer를 이용하여 실시간 PCR (Biorad, 미국)로 발현을 측정했다. 발현양의 계산은 Pfaffl의 modified delta-delta Ct 방법을 이용하였다. 본 발명에서 RT-PCR 또는 qRT-PCR을 위한 primer들의 서열은 하기의 표 2에 나타내었다.
Gene name 정방향 서열(5'-3') 서열번호 역방향 서열 (5'-3') 서열번호
TM4SF5 CTTGCTCAACCGCACTCTAT 15 ATCCCACACAGTACTATCTCCA 16
SLAMF6 GTCCAGAAATCCACGTGACTAA 17 GTAAGAGCCTGTGTCTTCCATC 18
SLAMF7 TGGGTCTGCAGAGCAATAAG 19 CAGGGCCTTCCAGGTATAAAT 20
MICA CCTTGGCCATGAACGTCAGG 21 CCTCTGAGGCCTCGCTGCG 22
MICB ACCTTGGCTATGAACGTCACA 23 CCCTCTGAGACCTCGCTGCA 24
ULBP1 TTTCCTTAAAGGGCAACTGCT 25 AGGAACTGCCAAGATCCTCT 26
ULBP2 CATTACTTCTCAATGGGAGACTGT 27 TGTGCCTGAGGACATGGCGA 28
ULBP3 CTGATGCACAGGAAGAAGAG 29 TATGGCTTTGGGTTGAGCTAA 30
ULBP5 GACTCGCGTGACTTTACCTATC 31 GGCTGCGCCGTTATTTATTG 32
CD111(Nectin-1) ATCCTGCTGGTGTTGATTGT 33 TGCTTCTTGGTGCTGTAGTC 34
CD112(Nectin-2) TTCCCTGGATCTAGAGGATGAG 35 CTTTGCCCTGGTAGGAATCA 36
CD113(Nectin-3) TTGCTAGAGGAAGGCGAATTAC 37 ACCGAAACTTCAGGAGCATAC 38
CD155(PVR) AGGTATCCATCTCTGGCTATGA 39 CCATGGTCGTGCTCCAATTA 40
CADM1 GCTTCTGCTGTTGCTCTTCT 41 CTCGATCACTGTCACGTCTTTC 42
Klrk1(NKG2D) CAGCAAAGAGGACCAGGATTTA 43 GTTAGTAGGTTGGGTGAGAGAATG 44
PRF1 CCCAGTGGACACACAAAGGTT 45 TCGTTGCGGATGCTACGAG 46
GZMB CTTCCTGATACGAGACGACTTC 47 CGGCTCCTGTTCTTTGATATTG 48
CD107a CGTCAGCAGCAATGTTTATGG 49 CATGTTCTTAGGGCCACTCTT 50
TNF-α GAGTGACAAGCCTGTAGCCCATGTTGTAGCA 51 GCAATGATCCCAAAGTAGACCTGCCCAGACT 52
FasL CATTTAACAGGCAAGTCCAACTC 53 CACAAGGCCACCCTTCTTAT 54
TNFSF10(TRAIL) CAGAGAGTAGCAGCTCACATAAC 55 CCTTGATGATTCCCAGGAGTTT 56
CD112R CAGAGCAGCATCTCTCTCATC 57 TCAGGGAAGGACGCAAAC 58
TIGIT AGGAATGATGACAGGCACAATA 59 GGAGGAGAGGTGACATTGTAAG 60
CD226 AGGAGAAGGAGAGAGAGAAGAG 61 GATTGGTAGGTTGACTGGTAGAG 62
CD96 TGGTCCAAGGTCACCAATAAG 63 TCTCCCATAGGCACAGTAGAA 64
PD-1 CCGCACGAGGGACAATAG 65 CCATTCCGCTAGGAAAGACAA 66
<1-1> TSAHC가 간의 손상에 미치는 영향 확인
TSAHC 처리가 간의 손상 정도 및 염증 반응에 미치는 영향을 확인하기 위하여, PBS(대조군) 및 DEN을 처리하여 간암 유발 마우스 모델에서 간 손상 정도를 확인하였다.
구체적으로, 상기 실시예 5에 기재된 방법에 의하여 제조된 DEN 처리군(28주), DEN과 TSAHC를 동시에 처리하는 군(DEN+TSAHC1), DEN 처리 10주 후 TSAHC를 처리하는 군(DEN+TSAHC2) 및 PBS를 처리한 대조군으로부터 간조직을 확보(n=5)하였다. 간조직을 파라핀(paraffin)과 분리하기 위해 60℃오븐에 20분 정도 넣어 파라핀이 녹으면 자일렌(zylene)에 5분씩 3번 담가주었다. 그리고 100%, 90%, 80%, 70% 에탄올 및 증류수 순으로 순차적으로 3분씩 넣어준 뒤 헤마톡실린(hematoxylin) 용액에 5분 담가서 반응시켰다. 수돗물로 충분히 씻어준 후에는 에오신(eosin) 용액에 20분 정도 반응시켜준 다음 다시 수돗물로 씻어주었다. 그 다음 70%, 80%, 90%, 100% 에탄올 및 자일렌 순으로 3분씩 담가주는 탈수화 과정을 거친 후에 슬라이드를 마운팅(mounting)하였고, 간조직을 관찰하였다.
그 결과, DEN 처리군의 간조직에서는 PBS를 처리한 대조군에 비하여 간의 손상과 면역세포의 밀집이 두드러졌으며, TSAHC를 동시에 또는 차순으로 처리한 DEN+TSAHC1 및 DEN+TSAHC2 군의 경우, DEN 처리군에 비하여 간의 손상 및 면역세포의 밀집(염증) 정도가 감소함을 확인하였다(도 1).
<1-2> TSAHC 처리에 따른 생존율 변화 확인
TSAHC가 생존율에 미치는 영향을 확인하기 위해, 상기 실험예 1-1의 마우스의 생존율을 28주 동안 측정하였다.
구체적으로, 상기 마우스는 온도와 습도가 잘 조절된, 병원균이 없는(pathogen-free) 실험동물실에서 사육되었으며, 각각은 처리군은 5 내지 7마리씩 그룹을 지어 정상 식이의 자유 배식을 통한 정상적인 사육을 하면서 생존율을 측정하였다.
그 결과, DEN 처리군의 경우 생존율이 가장 낮게 나타났고, DEN+TSAHC2 군은 DEN 처리군보다 생존율이 높았으나, DEN+TSAHC1 군 및 PBS 처리 대조군(100% 생존)에 비해 생존율이 낮았다(도 2).
<1-3> 간 손상 및 간암 마우스 모델에서의 TM4SF5, STAT3, pY705-STAT3, p-Erk 및 라미닌 발현 확인
추가적으로, 상기 실험예 1-1의 마우스의 간조직을 이용하여, TM4SF5, STAT3, pY705STAT3(STAT3 Tyr705의 인산화), p-Erk(ERK1/2의 인산화) 및 라미닌(Laminin)의 발현 정도를 웨스턴블랏을 통해 확인하였다.
구체적으로, 상기 각 대조군 및 처리군의 동물 간조직으로부터 추출액을 얻었다. 간조직을 PBS로 2번 세척한 후, lysis buffer[50 mM Tris-HCl, pH 7.4, 1% NP40, 0.25% sodium deoxycholate, 150 mM NaCl, 1mM EDTA(500 ml기준)]에 SDS, Na3O4V, protease inhibitor cocktails(GenDepot)를 넣고 4℃에서 15분 처리하였다. 간 세포의 추출액을 위해서는 lysis buffer(150 mM NaCl, 1% NP-40, 50 mM Tris-HCl, 0.25% sodium deoxycholate, pH 7.4)에 protease inhibitor cocktail(GenDEPOT)를 포함하여 사용하였다. 4℃ 13000 rpm으로 30분 동안 원심분리한 후, 새 microcentrifuge-tube에 상층액만을 옮겨주었다. BCA reagent(Thermo Scientifics)를 이용하여 정량해준 후, 4x sample buffer[100% glycerol 4 ml, Tris-HCl, pH6.8, 2.4 ml, SDS 0.8 g, Bromophenol blue 4 mg, beta-mercaptoethaol 0.4 ml, H2O 3.1 ml(10 ml기준)]를 넣어준 후, 5분 동안 100℃에서 끓였다. 위의 시료로 SDS-PAGE 전기영동을 수행한 뒤, Nitrocellulose Membranes Protran 니트로셀룰로오스 membrane(Whatman)에 이동시킨 후, 5% 탈지분유단백질(skim milk protein)로 1시간 동안 전처리하였고, 전처리 후, pY705STAT3(Millipore, 미국), 라미닌, STAT3(이상 Santa Cruz, 미국) 및 p-Erk의 1차 항체를 사용하여 4℃에서 15시간동안 반응시켰다. 다음날 2차 항체를 반응시키고, ECL(Pierce, 미국)을 이용하여 엑스레이 필름에 현상하였다. Anti-TM4SF5C-ter(epitope region of RKKQDTPH197)는 전문항체제작회사(Pro-Sci, Poway, CA, USA)에서 주문 제작하였다.
그 결과, PBS를 처리한 대조군에 대비하여 DEN 처리군에서 pY705STAT3, p-Erk 및 라미닌의 발현이 TM4SF5 발현 향상과 더불어 증가하였으며, DEN+TSAHC1 군에서의 TM4SF5의 발현 수준은 DEN 처리군과 큰 차이가 없었으나, pY705STAT3 및 라미닌의 발현이 낮아졌으며 DEN+TSAHC2 군에서는 pY705STAT3의 수준이 DEN 처리군보다 낮아졌다(도 3).
상기 결과는 DEN 처리에 의한 간 손상 및 간암유도 동물모델에서 TM4SF5의 발현과 더불어 STAT3 Tyr705 인산화 및 라미닌의 발현이 간 손상 및 면역세포의 밀집을 통한 염증 반응의 증가 및 마우스 생존율의 저하로 연결될 수 있음을 시사한다.
<1-4> 간 손상 및 간암 마우스 모델에서의 TM4SF5, STAT3, pY705-STAT3, 콜라젠, 라미닌 및 라미닌 γ2 발현 확인
상기 실험예 1-1의 마우스의 간조직에서 TM4SF5, STAT3, pY705STAT3 (STAT3 Tyr705의 인산화), 콜라젠, 라미닌 및 라미닌 γ2의 발현 정도를 확인하기 위하여 H&E 및 immunohistochemistry를 수행하였다.
그 결과, PBS 처리군과 대비하여 DEN 처리군에서는 간의 손상이 증가하였고, TM4SF5, Tyr705가 인산화된 STAT3, 콜라젠, 라미닌 및 라미닌 γ2의 발현이 향상되었음을 확인하였다. 또한, 이러한 DEN에 의한 효과는 TSAHC를 처리함에 따라 감소함을 확인하였다(도 4).
<실험예 2> TSAHC 처리에 따른 간 손상 및 간암 발병, 대사 기능 조절 및 면역세포 침투 사이의 상관성 확인
<2-1> TSAHC 처리에 따른 간 손상 및 간암 발병 상관성 확인
2주령의 C57BL/6 정상 WT 마우스 및 Tm4sf5-/- KO 마우스 수컷에 vehicle을 처리하거나 (Age-matched 대조군), DEN(25 mg/kg 체중)을 1회 복강(IP) 주사하고, 1주일에 2회씩 DMSO (40% DMSO) 혹은 TSAHC (5 mg/kg 체중/40% DMSO) 복강(IP) 주사하여 처리하였다 (도 5). 45 주 동안 처리한 후, 간 조직을 확보하여 이미지를 촬영하고 맨눈으로 암 결절 (nodule) 혹은 종양을 확인하고 크기와 개수를 조직마다 조사하였다.
그 결과, Age-matched 대조군의 WT 및 KO 마우스 그룹은 종양이 생성되지 않았으나, DEN을 처리한 WT 마우스(WT+DEN)에서는 크고 작은 종양들이 많이 생성되었다. 하지만, KO 마우스에서는 DEN을 처리하였음(KO+DEN)에도 불구하고 종양이 생성이 훨씬 미약하였으며, DEN을 처리한 WT 마우스에 TSAHC를 동시에 처리한 그룹(WT+DEN+TSAHC)에서는 종양의 형성이 TSAHC를 처리하지 않은 그룹에 비하여 훨씬 작고 적게 생겼다(도 6).
또한, 지름이 1.0 mm 이상인 종양의 숫자 및 총 부피, 각 동물에서 최대 종양의 크기를 분석하였을 경우, DEN을 처리한 WT 마우스의 경우 가장 그 값들이 컸고 KO+DEN 마우스의 경우는 통계적으로 유의미하게 감소하였다. 그리고 WT+DEN+TSAHC에서는 WT+DEN보다 감소하는 경향이 있음을 확인하였다(도 7a 내지 7c).
또한 각 그룹의 간조직에서의 종양을 관찰하기 위하여 H&E 염색 또는 immunohistochemistry를 수행하였다.
구체적으로, 대표적인 동물의 간조직을 디지털카메라로 촬영하였고(좌측) digital tissue scanner로 염색된 조직을 scanning(중간 패널)하여 그 이미지의 종양(T) 및 정상(N) 조직 부위를 표현(오른쪽 패널)하였다. DEN 처리된 정상마우스에서 생긴 큰 종양의 정상조직과의 경계 부위를 표현하고자 하였다. 그뿐만 아니라, H&E 염색에 이어, 간암 조직의 증식력과 바이오마커의 발현 정도를 조사하기 위하여 Ki67 및 α-fetoprotein (AFP)를 면역염색하였다(도 8).
<2-2> TSAHC 처리에 따른 간 손상 및 암 발병과 대사 기능 조절 사이의 상관성 확인
TSAHC 처리에 따른 간 손상 및 암 발병과 대사 기능 조절 사이의 상관성 확인하기 위해 상기 실험예 2-1의 마우스로부터 간조직을 확보한 후, 마우스의 간/체중의 비율을 측정하였다. 또한, 상기 마우스로부터 얻어진 혈액을 1 M EDTA coating된 1.5 ml tube에 8 μl 1 M EDTA 첨가 후 1,500x g, 4℃에서 15분간 원심분리하여 혈청을 분리하였고, 분리된 혈청은 혈액 분석기 (Dri-chem 4000, Fuji, Japan)를 이용해 ALT (Alanine aminotransferase), 콜레스테롤(T-CHO) 및 글루코스 (Glucose)의 양을 측정하였다.
그 결과, DEN을 처리한 정상 마우스인 WT+DEN 군은 age-matched 대조군과 대비하여 간/체중의 비율, ALT, T-CHO 및 글루코스의 수치가 모두 높았으나, DEN을 처리한 KO 마우스(KO+DEN 군)나 TSAHC와 함께 처리된 마우스(WT+DEN+TSAHC 군)는 상기 수치들이 대체로 낮아지는 경향을 보였다(도 9a 내지 9d).
즉, DEN 처리 때문에 암이 생긴 경우에, 간/체중의 비율, ALT 간수치, 혈액 속에 콜레스테롤 및 글루코스의 수준이 높아지고, KO 마우스 혹은 TSAHC 처리 때문에 TM4SF5의 기능이 억제되어 암이 적게 생긴 동물 그룹에서 그들의 값들이 낮게 확인된 것은 간 손상 및 간암 발병과 TM4SF5 및 염증-대사 기능과의 상관성이 있음을 나타낸다.
<2-3> 면역세포 침투와 종양 형성 사이의 상관성 확인
면역세포 침투와 종양 형성 사이의 상관성을 확인하기 위해, 상기 실험예 2-1의 마우스로부터 간조직을 확보한 후, 실험예 1-1에 기재된 방법과 동일한 방법으로 H&E 염색을 수행하였으며, AFP(α-fetoprotein)으로 면역염색을 수행하였다.
그 결과, 정상마우스에 DEN만을 처리한 WT+DEN 군에서는 면역세포의 침투 및 밀집을 나타내는 육아종염증(noninfectious granulomatous inflammation with immune cell infiltrates)이 확연히 관찰되었고, 주변에 AFP의 염색 정도가 높음을 확인하였다(도 10). 그러나, WT+DEN+TSAHC 군은 AFP의 염색 정도가 다소 낮고 육아종염증(granulomatous inflammation)의 부분들이 심각하게 관찰되지 않아, TSAHC 처리에 따라 면역세포들이 침투가 억제되는 것과 염증 및 종양 형성이 둔화된 것이 서로 상호관계가 있음을 확인할 수 있었다.
<실험예 3> TSAHC가 NK 세포의 군집 또는 이로부터 분비되는 싸이토카인 혹은 과립(granule)들에 미치는 영향 확인
<3-1> TSAHC가 비장 내 면역세포 군집에 미치는 영향 확인
TSAHC 처리 여부에 따른 비장 내 면역세포 군집의 상태를 확인하기 위해, 2주령의 C57BL/6 정상 WT 마우스 및 Tm4sf5-/- KO 마우스 수컷에 vehicle을 처리하거나(Age-matched 대조군), DEN(25 mg/kg 체중)을 1회 IP 주사하고, 1주일에 2회씩 DMSO(40% DMSO) 혹은 TSAHC(5 mg/kg 체중/40% DMSO) IP 주사하여 처리하였다. 45주가 지난 후, 비장에서의 T세포 및 NK 세포 등의 면역세포들을 상기 실시예 6에 기재된 면역염색법과 유세포분석법을 통하여 면역세포들을 조사하였다.
상기 방법을 통해, CD3가 높게 발현하는 세포들 중 CD4가 높게 존재(CD4+)하는 보조 T세포(Helper T cell), CD8이 높게 존재(CD8+)하는 세포독성 T세포(cytotoxic T cell) 또는 CD3의 발현이 낮고 NK1.1의 발현이 높은 NK 세포를 포함하여 면역세포의 군집(population)을 조사하였다. 그 결과, 간암이 크고 많이 생긴 WT+DEN 군의 경우, 보조 T세포의 군집은 크게 변하지 않았고(도 11b), 세포독성 T세포의 경우 오히려 군집이 증가하여, 상기 T세포가 암 발병에 유의적으로 기여하지 않음을 확인하였다(도 11c). 그러나, NK 세포의 경우, WT+DEN 군은 대조군과 대비하여 NK 세포의 군집이 감소하였다. 또한, DEN 처리하였으나 유전자 Tm4sf5가 낙아웃(KO)된 KO+DEN 군이나 TSAHC 처리에 따라 TM4SF5 단백질 활성이 억제된 실험군은 NK 세포의 군집이 증가하였다(도 11d). 이는, TM4SF5-의존적 DEN 처리에 따른 간의 손상과 간암 발병은 비장에 존재하는 NK 세포의 군집과 유의적인 연관성이 있음을 시사한다.
<3-2> TSAHC가 간조직 내 면역세포 군집에 미치는 영향 확인
TSAHC 처리 여부에 따른 간조직 내 면역세포 군집의 상태를 확인하기 위해, 2주령의 C57BL/6 정상 WT 마우스 및 Tm4sf5-/- KO 마우스 수컷에 vehicle을 처리하거나(Age-matched 대조군), DEN(25 mg/kg 체중)을 1회 IP 주사하고, 1주일에 2회씩 DMSO(40% DMSO) 혹은 TSAHC(5 mg/kg 체중/40% DMSO) IP 주사하여 처리하였다. 45주가 지난 후, 비장에서의 T세포 및 NK 세포 등의 면역세포들을 상기 실시예 6에 기재된 면역염색법과 유세포분석법을 통하여 면역세포들을 조사하였다.
상기 방법을 통해, 각 실험군의 간조직 내의 보조 T세포(Helper T cell), 세포독성 T세포(cytotoxic T cell) 및 NK 세포의 군집(population)을 조사한 결과, 간암이 크고 많이 생긴 WT+DEN 군의 경우에, 보조 T세포의 군집은 크게 낮아졌지만(도 12b), 오히려 세포독성 T세포의 군집은 과도하게 증가하여, 보조 T세포와는 달리 상기 세포독성 T세포가 암 발병에 유의적으로 기여하지 않음을 확인하였다(도 12c). 또한, NK 세포의 경우에는, WT+DEN 군이 대조군에 비하여 NK 세포의 군집이 증가하여, 간조직에 존재하는 NK 세포의 기능이 조절되어 암 발병이 조절되었다고 추정할 수 없었다(도 12d). 그러나, DEN을 처리하였을지라도 유전자 Tm4sf5가 KO 되었거나 TM4SF5 단백질이 TSAHC 처리 때문에 억제된 경우에는 NK 세포의 군집이 다소 감소하였다. 이로 인해 TM4SF5-의존적 DEN 처리에 따른 간암 발병은 간조직에 존재하는 NK 세포의 군집과는 관련이 없거나 미약함을 확인하였다. 한편, 유전자 Tm4sf5가 낙아웃(KO)되었을 경우에는 CD4+한 보조 T세포 군집이 증가하여 간 손상과 암을 억제할 수 있었던 것으로 추정되었다.
<3-3> TSAHC가 간조직 내 자연 살상 세포로부터 분비되는 싸이토카인 혹은 과립(granule)들에 미치는 영향 확인
간조직에 존재하는 NK 세포의 활성과 간암 발병률과의 상관성을 확인하기 위하여, 간조직에 존재하는 NK 세포로부터 분비되는 싸이토카인(cytokine) 및 과립(granule)을 상기 실시예 6에 기재된 면역염색법 및 유세포분석법을 통하여 조사하였다.
그 결과, 암이 크고 많이 생긴 WT+DEN 군에서는 암이 생기지 않은 대조군에 대비하여 IFN-γ, perforin(PRF1) 및 granzymes(GZMB)이 훨씬 낮게 분비되었다(도 13a 내지 13c). 특히, DEN을 처리하였을지라도 TSAHC 처리에 따라 TM4SF5 단백질의 활성이 억제된 경우에는, NK 세포의 PRF1 수준이 통계적으로 유의미하게 높아짐으로써 (그래서 활성화된 NK 세포가 암세포를 표적하여 죽이는 기능이 높아져) 암의 발병이 억제될 수 있었던 것으로 추정되었다. 그러나, IFN-γ 및 granzymes(GZMB) 경우에서는 그렇게 유의미한 차이를 나타내지 않았다.
<실험예 4> TSAHC 처리에 의한 NK 세포의 세포 독성(cytotoxicity) 활성화 유도 가능성 확인
<4-1> TM4SF5 발현 억제가 NK 세포의 세포 살상 기능에 미치는 영향 확인
NK 세포인 NK92의 세포 살상 기능 분석을 위하여 LDH(lactate dehydrogenase) Cytotoxicity Assay Kit(Cytotoxicity Detection Kit Plus (ROCHE))을 사용하였다. Huh7 혹은 HepG2 간상피세포 또는 간암세포를 target 세포(RPMI-1640 with 1.0% FBS)로써 0.5 Х 104 cells/well(50 μl)로 96 well-plate에 3 반복으로 준비하였다. IL-2를 미리 처리한 NK92 세포를 effector 세포로서 1.0 Х 106 cells/ml로 준비하여, 다양한 농도의 NK 세포(1.0 Х 106, 0.5 Х 106, 0.25 Х 106, 및 0.125 Х 106 cells/ml)를 공동배양하기 위해 준비하였다. 준비된 농도의 NK 세포 용액을 96 well-plate에 존재하는 target 세포에 첨가하여 transwell chamber system에서 effector 대비 target 세포 비율(E:T = 1.25:1, 2.5:1, 5:1 또는 10:1)가 되도록 옮겨 담았다. 세포들은 96-well plates에서 4시간 동안 37.0℃및 5.0% CO2에서 배양하였다. 경우에 따라서, TSAHC[4'-(p-toluenesulfonylamido-4-hydroxychalcone), 1.0 혹은 5.0 μM] 혹은 대조군 화합물(negative control compound; 4'-methoxy-4-dihydroxychalcone, 1.0 μM)를 미리 1시간동안 target 세포에 처리한 후, NK92 세포와 공동배양 4시간동안 유지되었다. 사멸된 target 세포로부터 분비된 LDH을 ELISA reader를 이용하여 492-690 nm에서 흡광도를 측정하였다. NK92 세포에 의한 세포 사멸의 정도(%)는 하기의 식으로 계산되었다:
Figure PCTKR2021018197-appb-img-000003
경우에 따라서, transwell chamber system을 공동배양 후, NK92 세포 혹은 target 간암세포를 분리하여 qRT-PCR 혹은 웨스턴블랏을 수행하였다.
먼저, TM4SF5가 내인성(endogenous)으로 발현하는 Huh7 간상피세포에 non-specific shRNA (NS), shTM4SF5(#2 혹은 #4 sequence)를 렌티바이러스로 감염시킨 후, qRT-PCR로 TM4SF5 mRNA 수준을 확인함으로써, TM4SF5의 발현을 억제하기 위한 shTM4SF5의 효능을 확인하였다(도 14a). 또한, 96-well 플레이트에 Target(표적, T) 세포(0.5 Х 104 cells)로서 TM4SF5의 발현이 유지되거나(NS) 억제된(shTM4SF5 #2 혹은 #4) 간암세포를 넣고, Effector (E) 세포로서 NK92 세포를 주어진 비율(E:T 비율; effector 대비 target 세포 수)로 섞어 4시간동안 37℃ 5% CO2에서 배양한 후, LDH(lactate dehydrogenase) assay kit(Abcam)로 ELISA reader를 이용해서, 각 조건마다 492-690 nm에서의 세포의 사멸에 따라 생성된 formazan(LDH)의 양을 흡광도로 측정함으로써 비교 측정하였다.
그 결과, 각 E:T 비율에서 TM4SF5의 발현이 유지된 세포보다 억제된 표적세포의 사멸이 더욱더 높음을 확인하였다(도 14b). 이로써, TM4SF5가 발현되지 않을 경우 NK 세포의 세포 독성(cytotoxicity)이 활성화된 것으로 추정되었다.
<4-2> TM4SF5 발현 억제가 NK 세포의 세포 독성 활성화 리간드에 미치는 영향 확인
TM4SF5의 발현 억제가 NK 세포의 세포 독성 활성화와 관련된 리간드(Ligand)에 미치는 영향을 확인하기 위해, TM4SF5를 내인성(endogenous)으로 발현하는 간상피세포 또는 간암 세포주(Huh8, Hep3B 및 HepG2)들에 non-specific control shRNA(NS) 또는 shTM4SF5(#4 서열 표적)을 발현하는 렌티바이러스로 감염시킨 간암세포(target 세포)들에서, NK 세포의 세포 독성 활성화에 관련한 여러 리간드 막단백질들을 qRT-PCR로 확인 비교하였다.
도 15a 내지 15c와 같이, NS가 주입된 target 세포주와 비교해 TM4SF5의 발현이 억제된 target 세포주에서 발현이 1.5배 이상 높아진 리간드들은 흰색으로 표시되었고, 3가지 target 세포주 종류 중 최소한 2가지 이상의 세포주에서 MICA, MICB, CADM1, SLAMF6, SLAMF7, ULBP1, ULBP3, Nectrin-1 및 Nectrin-2들이 발현이 높아진 것을 확인하였다.
간상피세포 또는 간암세포와 NK92 세포를 공동배양을 한 후에, NK92 세포주에서의 활성화를 위한 수용체 막단백질들의 mRNA 수준을 qRT-PCR로 확인한 결과, (target 세포의 MICA 및 MICB와 결합하는) NK92 세포의 NKG2D, (target 세포의 SLAMFs와 결합하는) SLAMF6 및 SLAMF7의 mRNA 발현이 TM4SF5가 발현이 유지된 세포보다 발현이 억제된 간암세포(target 세포)와 공동배양되었을 때 NK92 세포에서 더 높아짐을 확인하였다(도 16a).
또한, 간상피세포 또는 간암세포와 NK92 세포의 공동배양을 한 후에, NK92 세포주에서의 활성화 정도를 NK92 세포가 분비하는 싸이토카인(cytokine) 및 과립(granule)들을 qRT-PCR로 분석한 결과, PRF1(perforin), GZMB(granzyme), CD107a(Cluster of Differentiation 107a, 혹은 lysosomal-associated membrane protein 1, LAMP1), TNF-α(tumor necrosis factor-α), FasL(Fas ligand), 및 TRAIL(TNF-related apoptosis-inducing ligand)의 mRNA들이, TM4SF5가 발현이 높은 간암세포보다 발현이 억제된 간암세포(target 세포)와 공동배양되었을 때, NK92 세포에서 더 높아짐을 확인하였다(도 16b).
이로써, target 세포에 TM4SF5 발현이 억제되면, NK 세포를 활성화시킬 수 있는 상기 리간드들과 리셉터들이 각각 target 세포인 간암세포 및 effector 세포인 NK92 세포에서도 함께 높아지게 되어, NK 세포의 세포 독성 활성에 의한 target 세포의 사멸이 유도됨을 확인할 수 있었다.
<4-3> 간암(HCC) 조직에서의 TM4SF5, SLAMF7, MICA 및 ULBP1 및 ULBP2의 mRNA 발현 수준 확인
공개적인 데이터베이스 Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) database (accession numbers GSE14520)로부터 'Analyze with GEO2R'를 이용하여 정상 및 간암환자들 중에 TM4SF5가 간암에서 높게 발현되는 경우(각각 n=143)의 SLAMF7 (SLAM Family Member 7), MICA(MHC class I polypeptide-related sequence A) 및 ULBP1(UL16 Binding Protein 1) 및 ULBP2의 mRNA 발현 수준을 비교하였다.
그 결과, 정상간에 대비하여 간암환자의 간조직에서 TM4SF5의 mRNA 발현이 의미있게 증가하였고, SLAMF7, MICA 및 ULBP1의 mRNA 발현은 통계적으로 유의미하게 감소하였으며, 이에 TM4SF5와 이들 유전자의 발현이 길항적 혹은 음의 상관 (negative correlation) 관계로 조절된다는 것을 알 수 있었다(도 17).
<4-4> target 세포의 리간드 발현 향상을 위한 세포 내부 신호전달 활성 확인
Target 세포의 리간드 발현 향상을 위한 세포 내부 신호전달 활성을 확인하기 위하여, TM4SF5가 내인성(endogenous)으로 발현하는 HepG2 세포에게 non-specific shRNA(NS), shTM4SF5(#2 혹은 #4 sequence)를 렌티바이러스로 감염시킨 후 NK92 세포와 4시간 동안 공동배양하였다. 공동배양하기 전, qRT-PCR로 TM4SF5 mRNA 수준을 HepG2 세포에서 확인하여 shTM4SF5가 효율적으로 TM4SF5의 발현을 억제함을 확인하였다 (도 18a). 공동배양한 후, target 세포의 사멸 정도를 확인하였을 경우, TM4SF5가 발현이 억제되었을 때 (NK92 세포에 의해) 사멸되는 수준이 더 높음을 확인하였다(도 18b).
공동배양한 후, 부착세포인 간암세포와 별도로, 비부착세포인 NK92 세포를 구하기위해, 배양액 부분을 취하여 원심분리함(850 Х g, 5분간)으로써 온전한 NK92 세포를 분리하였다. 분리된 NK92 세포의 추출액을 얻어 웨스턴블랏을 수행하여, NK 세포주 활성화를 위한 target 세포에서의 receptor 발현 향상을 위한 세포 내부 신호전달 활성을 확인하고자 하였다.
그 결과, TM4SF5의 발현이 억제된 target 세포와 공동배양을 하였던 NK92 세포에서 ERK1/2(extracellular signal-regulated kinase 1과 2)의 인산화가 증가함을 확인할 수 있었다(도 19). 즉, 높아진 ERK1/2의 활성에 따라 NK92 세포의 리간드 발현이 향상될 수 있었음을 추정할 수 있었다.
또한, 공동배양을 통해 NK92 세포에 의한 Huh7 target 세포의 사멸 유도를, TM4SF5의 억제제인 TSAHC를 공동배양 1시간 전에 target 세포에 처리한 후 6시간에 걸친 공동배양을 통해 확인하였다. Vehicle 처리에 대비하여 negative control compound(4'-methoxy-4-dihydroxychalcone)는 차이가 별로 없었으나, TSAHC를 처리하면 농도-의존적으로 유의하게 NK92 세포와 공동배양된 target 세포의 사멸이 증가함을 확인하였다(도 20).
<4-5> TSAHC 처리에 의한 NK 세포 활성화 가능성 확인
TM4SF5를 발현하는 Huh7 세포주에 대조 shRNA (NS)를 주입하여 발현 억제를 하지 않거나 shTM4SF5(#2 혹은 #4 서열 표적)를 주입하여 TM4SF5의 발현을 억제한 세포들로부터(왼쪽), SNU449 세포에 대조 발현 벡터(SNU449Cp) 또는 TM4SF5 벡터를 발현(SNU449Tp 혹은 SNU449T7)하는 렌티바이러스로 감염시킨 세포들로부터 세포추출액을 확보하여 웨스턴블랏을 수행하였다.
그 결과, TM4SF5가 발현하는 세포들의 경우에서 (NK92 세포를 활성화시킬 수 있는) 막단백질 리간드(SLAMF7 및 MICA/B)가 감소함을 확인하였다(도 21). 즉, 이는 TSAHC 처리에 따라 TM4SF5의 기능 내지는 활성이 억제될 경우, 촉진성 리간드(stimulatory ligand)들이 증가하여 궁극적으로 NK 세포의 활성화가 가능하게 되어 암의 형성이 억제될 것으로 추정되었다.
또한, SNU449 세포에 대조 발현 벡터 (EV) 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들에 TSAHC를 처리하지 않거나 (0), 0.5, 1.0, 혹은 2.0 μM로 24 시간 동안 처리한 후, 세포추출액을 확보하여 SLAMF 단백질에 대한 웨스턴블랏을 수행하였다.
그 결과, TSAHC를 처리하지 않은 경우에는 TM4SF5가 발현된 경우에 SLAMF6가 발현하지 않는 경우에 대비하여 감소하지만, TSAHC를 처리하면 TM4SF5가 발현하지 않는 세포에서는 SLAMF6가 증가하지 않지만, TM4SF5를 발현하는 세포에서는 TSAHC를 처리하지 않은 경우에 대비하여 TSAHC 처리한 경우 SLAMF6가 증가함을 확인하였다. 즉, 상기의 결과는 TM4SF5의 기능 혹은 활성을 억제하는 TSAHC 처리가 자연살상 세포를 활성화하는 리간드의 발현을 향상시켜 자연살상세포의 항암면역 기능을 높일 수 있음을 시사한다 (도 22).
또한, SNU449 세포에 EV 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시키거나, TM4SF5의 발현을 억제한 Huh7-KO 세포주에 다시 EV(대조군 벡터) 혹은 TM4SF5 벡터를 주입하여 얻은 세포주의 세포추출액을 확보하여 NK92 세포를 활성화시킬 수 있는 막단백질 리간드에 대한 웨스턴블랏을 수행하였다.
그 결과, TM4SF5가 발현하는 세포들의 경우에서 (NK92 세포를 활성화시킬 수 있는) 막단백질 리간드들 [SLAMF6, SLAMF7 및 MICA/B (MHC Class I Polypeptide-Related Sequence A/B) 등]의 발현이 감소하였다(도 23a 및 23b). 상기의 결과는 TM4SF5의 발현이 NK세포의 면역관문(immune check point)으로 추정됨을 시사한다. 이는 NK 세포 활성화를 위한 리간드들(NKG2D 및 SLAMF6/7)의 발현이 낮아지게 되어, 궁극적으로 이에 상응하는 NK 세포에 존재하는 수용체들의 발현 또는 활성이 저하되게 되고, 이는 NK 세포의 target 세포에 대한 세포 독성 활성의 저하로 이어져 target 세포의 생존/증식이 가능해지는 면역회피 기능이 생기는 것이라고 추정할 수 있다.
이로써, TM4SF5가 간암 상피세포에 발현하면, MICA/B 및 SLAMF6/7과 같은 리간드들이 간암 target 세포에서 낮아지고, 이는 NK 세포 활성화를 위한 리간드들(NKG2D 및 SLAMF6/7)의 발현이 ERK1/2 신호전달 활성의 저하에 따라 NK 세포에서 발현이 낮아져, 궁극적으로 NK 세포의 target 세포의 사멸 활성이 저하됨으로써 target 세포의 생존 및 증식이 가능해지는, 면역회피 기능이 생긴다고 추정할 수 있었다. 따라서, TSAHC 처리는 면역관문인 TM4SF5를 억제하는 약물로서 NK 세포의 면역관문억제제가 될 수 있다.
또한, 인간 NK세포주인 NK92 세포에 EV 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들(왼쪽) 혹은 TM4SF5를 발현을 낙아웃시킨 Huh7-KO 세포주에 새로이 EV 혹은 TM4SF5 벡터를 주입하여 얻은 세포들로부터(오른쪽), 세포추출액을 확보하여 NK92 세포를 활성화를 억제할 수 있는 막단백질 리간드와 수용체에 대한 웨스턴블랏을 수행하였다.
그 결과, TM4SF5를 발현하는 NK세포 및 간상피세포에서 (NK92 세포를 활성화를 억제할 수 있는) 막단백질 리간드인 PD-L1(programmed death-ligand 1)과 수용체인 PD-1(programmed cell death protein-1)이 각각 증가하였다(도 24a 및 24b). 상기의 결과는 TM4SF5의 발현이 간상피세포에서 PD-L1의 발현을 증가시키고 NK92 세포에서 그 수용체인 PD-1의 발현을 증가시켜, NK 세포의 활성이 저하되고, 궁극적으로 NK 세포의 target 세포에 대한 세포 독성 활성이 저하됨으로써 target 세포의 생존/증식이 가능해지는, 면역회피 기능이 생긴다고 추정할 수 있다.
또한, TM4SF5를 발현을 낙아웃시킨 Huh7-KO 세포주에 새로이 EV 혹은 TM4SF5 벡터를 주입하여 얻은 세포 (위 패널) 혹은 인간 NK세포주인 NK92 세포에 EV 혹은 TM4SF5 벡터를 발현(TM4SF5)하는 레트로바이러스로 감염시킨 세포들(아래 패널)를 이용하여 qRT-PCR을 수행하여 각 유전자들의 mRNA 수준을 확인하였다.
그 결과, TM4SF5를 발현하는 간상피세포 (Huh7) 및 NK92 세포에서 (NK92 세포를 활성화를 억제할 수 있는) 막단백질 리간드인 CD112 [Nectin-2, Poliovirus receptor-related 2 (PVRL2)], CD111 [Nectin-1, Poliovirus receptor-related 1 (PVRL1)] 과 수용체인 CD112R (CD112 receptor), TIGIT (T cell immunoglobulin and ITIM domain), CD96 (Tactile, T Cell-Activated Increased Late Expression Protein) 및 PD-1이 각각 증가하였다(도 25a 및 25b). 그러나, NK세포의 활성을 억제하지 않고 향상시킨다고 알려진 CD226 (Cluster of Differentiation 226)의 발현은 증가하는 경향이 있었다. 이는 TM4SF5의 발현이 NK 세포 활성화 억제를 위한 리간드들을 간상피세포에서 증가시키고, NK92 세포에서 그 수용체들의 발현을 증가시킴을 확인한 것으로, 궁극적으로 NK 세포의 활성 저하로 이어져, NK 세포의 target 세포에 대한 독성 활성이 저하됨으로써 target 세포의 생존/증식이 가능해지는 면역회피 기능이 생긴다는 것을 시사한다.

Claims (16)

  1. 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포(Natural killer cell, NK cell) 활성 조절용 조성물.
  2. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간의 손상, 면역세포의 밀집 또는 염증을 억제하는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  3. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간조직에서의 면역세포의 밀집 정도, Ki67 또는 AFP(Alpha-fetoprotein) 단백질의 발현 정도, 또는 육아종염증의 형성을 감소시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  4. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간조직에서의 TM4SF5 또는 콜라젠 (collagen), 라미닌(Laminin), 라미닌 γ2 (Laminin γ2)의 발현을 억제하거나, STAT3(Signal transducer and activator of transcription 3)의 Tyrosine 705 또는 ERK1/2의 인산화의 증가를 억제하는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  5. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 분리된 시료 내 ALT(Alanine aminotransferase), 콜레스테롤(Cholesterol) 또는 글루코스(Glucose) 수치를 낮추는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  6. 제5항에 있어서,
    상기 분리된 시료는 혈액, 전혈, 혈청 및 혈장으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  7. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 비장 내 자연 살상 세포의 군집을 증가 또는 간 조직내의 살상 세포를 활성화시키는 것 혹은 CD4(cluster of differentiation 4)+ 양성 보조 T 세포의 군집을 증가시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  8. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간에서 종양의 형성, 종양의 숫자, 종양의 부피 및 최대 종양의 크기로 이루어진 군으로부터 선택되는 어느 하나 이상을 감소시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  9. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 표적 세포에서 MICA(MHC class I polypeptide-related sequence A), MICB(MHC class I polypeptide-related sequence B), CADM1(Cell adhesion molecule 1), SLAMF6(SLAM family member 6), SLAMF7(SLAM family member 7), ULBP1(UL16-binding protein 1), ULBP2(UL16-binding protein 2), ULBP3(UL16-binding protein 3), Nectin-1(Nectin Cell Adhesion Molecule 1) 및 Nectin-2(Nectin Cell Adhesion Molecule 2) 로 이루어진 군으로부터 선택되는 어느 하나 이상의 발현을 증가시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  10. 제8항에 있어서,
    상기 표적 세포는 손상된 간 세포, 조직, 또는 간암세포인 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  11. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 자연 살상 세포에서 NKG2D(natural killer receptor group 2 member D), SLAMF6 또는 SLAMF7로 이루어진 군으로부터 선택되는 어느 하나 이상의 발현을 증가시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  12. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 자연 살상 세포에서 PRF1(Perforin), GZMB(Granzyme B), CD107a(Cluster of Differentiation 107a, 혹은 lysosomal-associated membrane protein 1, LAMP1), TNF-α(Tumor necrosis factor-α), FasL(Fas ligand) 및 TRAIL(TNF-related apoptosis-inducing ligand)로 이루어진 군으로부터 선택되는 어느 하나 이상의 발현을 증가시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  13. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 간상피세포에서 CD112 [Nectin-2, Poliovirus receptor-related 2 (PVRL2)], CD111 [Nectin-1, Poliovirus receptor-related 1 (PVRL1)], PD-L1(programmed death-ligand　1)의 발현을 억제시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  14. 제1항에 있어서,
    상기 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염은 자연 살상 세포에서 CD112R (CD112 receptor), TIGIT (T cell immunoglobulin and ITIM domain), CD96 (Tactile, T cell activation, increased late expression), PD-1(programmed cell death protein-1)의 발현을 억제시키는 것을 특징으로 하는, 자연 살상 세포 활성 조절용 조성물.
  15. 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는 자연 살상 세포(Natural killer cell, NK cell) 활성 조절 방법.
  16. 자연 살상 세포(Natural killer cell, NK cell) 활성 조절에 사용하기 위한 4'-(p-톨루엔설포닐아미노)-4-하이드록시칼콘 또는 이의 약학적으로 허용가능한 염의 용도.
PCT/KR2021/018197 2020-12-09 2021-12-03 Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물 Ceased WO2022124702A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200170934 2020-12-09
KR10-2020-0170934 2020-12-09

Publications (1)

Publication Number Publication Date
WO2022124702A1 true WO2022124702A1 (ko) 2022-06-16

Family

ID=81974719

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/018197 Ceased WO2022124702A1 (ko) 2020-12-09 2021-12-03 Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물

Country Status (2)

Country Link
KR (1) KR102796640B1 (ko)
WO (1) WO2022124702A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116942839A (zh) * 2023-06-14 2023-10-27 西湖实验室(生命科学和生物医学浙江省实验室) Nk纳米药物制剂及其制备方法和应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102772263B1 (ko) 2023-12-11 2025-02-21 이병설 진료비 청구 분석 시스템

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120022504A (ko) * 2010-07-30 2012-03-12 서울대학교산학협력단 간 질환의 진단, 치료 및 예방용 조성물

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100934706B1 (ko) * 2006-12-07 2009-12-31 재단법인서울대학교산학협력재단 Ｔｍ４ｓｆ５의 기능을 저해하는 항암물질의 스크리닝 방법및 칼콘계 화합물을 함유하는 항암조성물
KR102643622B1 (ko) * 2020-11-06 2024-03-05 서울대학교산학협력단 Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 면역억제제

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120022504A (ko) * 2010-07-30 2012-03-12 서울대학교산학협력단 간 질환의 진단, 치료 및 예방용 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AHN HYE-MI, RYU JIHYE, SONG JIN MYEONG, LEE YUNHEE, KIM HYE-JIN, KO DONGJOON, CHOI INPYO, KIM SANG JICK, LEE JUNG WEON, KIM SEMI: "Anti-cancer Activity of Novel TM4SF5-Targeting Antibodies through TM4SF5 Neutralization and Immune Cell-Mediated Cytotoxicity", THERANOSTICS, IVYSPRING INTERNATIONAL PUBLISHER, AU, vol. 7, no. 3, 1 January 2017 (2017-01-01), AU , pages 594 - 613, XP055941689, ISSN: 1838-7640, DOI: 10.7150/thno.15629 *
JUNG JAE WOO, MACALINO STEPHANI JOY Y., CUI MINGHUA, KIM JI EON, KIM HYE-JIN, SONG DAE-GEUN, NAM SEO HEE, KIM SEMI, CHOI SUN, LEE : "Transmembrane 4 L Six Family Member 5 Senses Arginine for mTORC1 Signaling", CELL METABOLISM, CELL PRESS, UNITED STATES, vol. 29, no. 6, 1 June 2019 (2019-06-01), United States , pages 1306 - 1319.e7, XP055941686, ISSN: 1550-4131, DOI: 10.1016/j.cmet.2019.03.005 *
LEE BORAM, WU ZHEXUE, LEE TAEHO, TAN XUE FEI, PARK KI HUN, LIU KWANG-HYEON: "In vitro characterization of 4′-(p-toluenesulfonylamide)-4-hydroxychalcone using human liver microsomes and recombinant cytochrome P450s", XENOBIOTICA, vol. 46, no. 4, 2 September 2015 (2015-09-02), UK , pages 350 - 356, XP009537631, ISSN: 0049-8254, DOI: 10.3109/00498254.2015.1081306 *
LEE JUNG WEON: "TM4SF5-mediated protein-protein networks and tumorigenic roles", BMB REPORTS, KOREAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, KR, vol. 47, no. 9, 30 September 2014 (2014-09-30), KR , pages 483 - 487, XP055941684, ISSN: 1976-6696, DOI: 10.5483/BMBRep.2014.47.9.146 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116942839A (zh) * 2023-06-14 2023-10-27 西湖实验室(生命科学和生物医学浙江省实验室) Nk纳米药物制剂及其制备方法和应用

Also Published As

Publication number Publication date
KR102796640B1 (ko) 2025-04-18
KR20220081913A (ko) 2022-06-16

Similar Documents

Publication Publication Date Title
Goriely et al. Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)-and TLR3-induced IL-12p35 gene activation
Sugita et al. T-cell suppression by programmed cell death 1 ligand 1 on retinal pigment epithelium during inflammatory conditions
Li et al. TLR2 limits development of hepatocellular carcinoma by reducing IL18-mediated immunosuppression
Zhu et al. Progressive depletion of peripheral B lymphocytes in 4-1BB (CD137) ligand/I-Eα-transgenic mice
McDonald et al. CC chemokine receptor 6 expression by B lymphocytes is essential for the development of isolated lymphoid follicles
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
Kojima et al. Localization of Fas ligand in cytoplasmic granules of CD8+ cytotoxic T lymphocytes and natural killer cells: participation of Fas ligand in granule exocytosis model of cytotoxicity
Barington et al. EBI2 in splenic and local immune responses and in autoimmunity
Lin et al. Gut-Derived Lipopolysaccharide Promotes T-Cell–Mediated Hepatitis in Mice through Toll-Like Receptor 4
Du et al. Estrogen receptor‐β ligand treatment modulates dendritic cells in the target organ during autoimmune demyelinating disease
KR102796640B1 (ko) Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 자연 살상 세포 활성 조절용 조성물
Li et al. Fish requires FasL to facilitate CD8+ T-cell function and antimicrobial immunity
Leroux et al. Parasite manipulation of the invariant chain and the peptide editor H2-DM affects major histocompatibility complex class II antigen presentation during Toxoplasma gondii infection
Féral et al. Blockade of α4 Integrin Signaling Ameliorates the Metabolic Consequences of High-Fat Diet–Induced Obesity
Cheng et al. MANF inhibits Sjögren's syndrome salivary gland epithelial cell apoptosis and antigen expression of Ro52/SSA through endoplasmic reticulum stress/autophagy pathway
Liang et al. CD8+ T cells actively penetrate hepatocytes via the CD44/p‐ERM/F‐actin pathway in autoimmune hepatitis
WO2021158091A2 (ko) 케모카인 억제제, 콜로니 자극 인자 억제제 및 면역항암제를 포함하는 암의 예방 또는 치료용 조성물 및 병용 요법
WO2023063804A1 (ko) Pellino1-pkcθ 신호 축을 타겟으로 하는 항-종양 cd8+ t 림프구 개선 방법
Li et al. Negative regulation of hepatic inflammation by the soluble resistance-related calcium-binding protein via signal transducer and activator of transcription 3
Meloni et al. Cellular activities during a mixed leucocyte reaction in the teleost sea bass Dicentrarchus labrax
Zhan et al. SOCS1 negatively regulates the production of Foxp3+ CD4+ T cells in the thymus
Liu et al. TPN10466 ameliorates Concanavalin A‐induced autoimmune hepatitis in mice via inhibiting ERK/JNK/p38 signaling pathway
Kesse et al. MDSC-targeted liposomal all-trans retinoic acid suppresses mMdscs and improves immunotherapy in HBV infection
Jiang et al. Inhibition of Toll-like receptor 4 with vasoactive intestinal peptide attenuates liver ischemia-reperfusion injury
WO2018212503A1 (ko) 조혈모세포의 항상성 유지에 관여하는 cotl1 단백질 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21903748

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21903748

Country of ref document: EP

Kind code of ref document: A1