WO2022120370A2 - Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy - Google Patents
Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy Download PDFInfo
- Publication number
- WO2022120370A2 WO2022120370A2 PCT/US2021/072715 US2021072715W WO2022120370A2 WO 2022120370 A2 WO2022120370 A2 WO 2022120370A2 US 2021072715 W US2021072715 W US 2021072715W WO 2022120370 A2 WO2022120370 A2 WO 2022120370A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- gene
- immune cells
- edited
- population
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4225—Growth factors
- A61K40/4229—Transforming growth factor [TGF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001111—Immunoglobulin superfamily
- A61K39/001112—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/34—Antigenic peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/35—Cytokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/421—Immunoglobulin superfamily
- A61K40/4211—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4231—Cytokines
- A61K40/4232—Tumor necrosis factors [TNF] or CD70
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4718—Cytokine-induced proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5443—IL-15
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0646—Natural killers cells [NK], NKT cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/104—Aminoacyltransferases (2.3.2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/50—Cellular immunotherapy characterised by the use of allogeneic cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- Several embodiments disclosed herein relate to methods and compositions comprising genetically engineered cells for cancer immunotherapy, in particular combinations of engineered immune cell types.
- the present disclosure relates to cells engineered to express chimeric antigen receptors.
- further engineering is performed to enhance the efficacy and/or reduce potential side effects when the cells are used in cancer immunotherapy.
- Immunotherapy presents a new technological advancement in the treatment of disease, wherein immune cells are engineered to express certain targeting and/or effector molecules that specifically identify and react to diseased or damaged cells. This represents a promising advance due, at least in part, to the potential for specifically targeting diseased or damaged cells, as opposed to more traditional approaches, such as chemotherapy, where all cells are impacted, and the desired outcome is that sufficient healthy cells survive to allow the patient to live.
- One immunotherapy approach is the recombinant expression of chimeric receptors in immune cells and further engineering or genetically editing the cells to avoid adverse immune responses against the therapeutic cells in order to achieve the efficient and persistent targeted recognition and destruction of aberrant cells of interest.
- a population of genetically engineered and gene edited immune cells comprising genetically engineered immune cells that express a cytotoxic receptor comprising that targets a tumor marker expressed by a target tumor cell, wherein the immune cells are genetically edited at one or more target locations in a CISH gene that encodes a CIS protein, wherein the edits yield reduced expression and/or function of CIS as compared to an immune cell not edited at the location or locations in the CISH gene, wherein the immune cells are genetically edited at one or more target locations in an additional gene encoding an additional protein, wherein the edits to the additional gene yield reduced expression and/or function of the additional protein as compared to an immune cell not edited at the location or locations in the additional gene; and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, enhanced persistence, or other beneficial characteristic, as compared to immune cells that do not comprise said genetic edits at the CISH and additional genes.
- the cells are edited at an additional target site in a Cbl protooncogene B protein (CBLB) gene.
- CBLB Cbl protooncogene B protein
- TGFBR2 transforming growth factor receptor beta 2
- cells are edited at an additional target site in a TIGIT gene.
- Combinations of edits are provided for as well, such as cells edited at CISH/CBLB/TGFBR2, CISH/CBLB/TIGIT, CISH/TGFBR2/TIGIT, and the like.
- a guide sequence of any of SEQ ID NO: 153-157 or 562-565 is used to target the CISH gene.
- a guide sequence of any of SEQ ID NO: 164 to 166 or 552-555 is used to target the CBLB gene.
- a guide sequence of any of SEQ ID NO: 147 to 152 or 544-547 is used to target the TGFBR2 gene.
- a guide sequence of any of SEQ ID NO: 507-510 is used to target the TIGIT gene.
- the cells are further edited at one or more additional target sites in a gene encoding ADARA2, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, NKG2A, SOCS2, B2M, PD-1 , TIM-3, CD38, or TCR alpha.
- the cells are further edited at one or more of: (i) a gene encoding NKG2A and wherein a guide sequence of any of SEQ ID NO: 548-551 is used to target the NKG2A gene, (ii) a gene encoding SOCS2 and wherein a guide sequence of any of SEQ ID NO: 556-561 is used to target the SOCS2 gene, (iii) a gene encoding B2M and wherein a guide sequence of any of SEQ ID NO: 199-208 is used to target the B2M gene, (iv) a gene encoding PD-1 and wherein a guide sequence of any of SEQ ID NO: 51 1 -514 is used to target the PD-1 gene, (v) a gene encoding TIM-3 and wherein a guide sequence of any of SEQ ID NO: 515-518 is used to target the TIM-3 gene, and (vi) a gene encoding TCR alpha and wherein a guide
- the cells are further edited at one or more of: (i) a gene encoding an adenosine A2 receptor and a guide sequence of any of SEQ ID NO: 503-506 is used to target the adenosine A2 receptor gene, (ii) a gene encoding SMAD3 and wherein a guide sequence of any of SEQ ID NO: 491 - 493 is used to target the SMAD3 gene, (iii) a gene encoding MAPKAPK3 and wherein a guide sequence of any of SEQ ID NO: 494-496 is used to target the MAPKAPK3 gene, (iv) a gene encoding CEACAM1 and wherein a guide sequence of any of SEQ ID NO: 497-499 is used to target the CEACAM1 gene, (v) a gene encoding DDIT4 and wherein a guide sequence of any of SEQ ID NO: 500-502 is used to target the DDIT4 gene, and (vi) a gene encoding
- the cytotoxic receptor targets one or more of ligands of NKG2D, CD19, CD70, BCMA, CD38, GPRC5D, CD138, DLL3, EGFR, PSMA, FLT3, KREMEN2, or any combination thereof expressed by target tumor cells.
- the cells are not engineered to express a cytotoxic receptor complex that targets CD70.
- the cells are not engineered to express a cytotoxic receptor complex that targets CD19.
- the cells are not engineered to express a cytotoxic receptor complex that targets ligands of an NKG2D receptor.
- the genetically engineered immune cells are engineered to express membrane bound IL-15.
- a fusion of mblL15 with a native receptor e.g.,. an IL-15 receptor unit or subunit
- the genetically engineered and edited immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease and/or with greater cytotoxicity directed against the tumor cells (thereby resulting in a more efficacious therapy).
- Methods for treatment of cancer in a subject comprise administering to the subject at least a portion of a population of genetically engineered and gene edited immune cells as provided for herein. Also provided for is the use of genetically engineered and edited immune cells as provided for herein for the treatment of cancer and/or for the preparation of a medicament for the treatment of cancer.
- Also provided for herein are methods of manufacturing a population of genetically edited immune cells for cancer immunotherapy comprising contacting the population of immune cells with a first gene editing complex, wherein the first gene editing complex edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene, and contacting the population of immune cells with a second gene editing complex, wherein the second gene editing complex edits at one or more target sites in an additional gene of the immune cell to yield reduced levels of expression of a protein encoded by the additional gene as compared to an immune cell not edited at the additional gene, and wherein the genetically edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
- the wherein the second gene editing complex edits at one or more target sites in CBLB gene of the immune cell to yield reduced levels of expression of CBLB protein encoded by the CBLB gene as compared to an immune cell not edited at the CBLB gene.
- the second gene editing complex edits at one or more target sites in a TGFBR2 gene of the immune cell to yield reduced levels of expression of TGFBR2 protein encoded by the TGFBR2 gene as compared to an immune cell not edited at the TGFBR2 gene.
- the second gene editing complex edits at one or more target sites in a TIGIT gene of the immune cell to yield reduced levels of expression of TIGIT protein encoded by the TIGIT gene as compared to an immune cell not edited at the TIGIT gene.
- combinations of edits are provided for as well.
- the method further comprise contacting at least a portion of the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the cytotoxic receptor targets one or more of ligands of NKG2D, CD19, CD70, BCMA, CD38, GPRC5D, CD138, DLL3, EGFR, PSMA, FLT3, KREMEN2, or any combination thereof expressed by target tumor cells.
- the cytotoxic receptor does not target CD70, does not target CD19, and/or does not target NKG2D ligands.
- the method does not comprise editing a gene encoding CD70.
- a method for treating cancer in a subject comprising, administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited at one or more target locations in a CISH gene that encodes a CIS protein, wherein the edits yield reduced expression and/or function of CIS as compared to an immune cell not edited at the location or locations in the CISH gene, wherein the immune cells are edited at one or more a CBLB gene, a TGFBR2 gene, and/or a TIGIT gene, to yield reduced levels of expression or activity of a CBLB protein, a TGFBR2 protein and/or a TIGIT protein as compared to an immune cell not edited at a CBLB gene, a TGFBR2 gene or a TIGIT gene, and wherein the genetic
- the method further comprises editing the immune cells at least one additional target gene.
- the at least one additional target gene is not a gene encoding CD70.
- the additional target gene encodes ADAR2A, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, NKG2A, SOCS2, B2M, PD-1 , TIM-3, CD38, or TCR alpha.
- the cytotoxic receptor expressed by the immune cells binds to one or more epitopes of CD19, CD70, BCMA, CD38, GPRC5D, CD138, DLL3, EGFR, PSMA, FLT3, KREMEN2, or combinations thereof.
- the cytotoxic receptor expressed by the immune cells does not target any of CD19, CD70 or ligands of NKG2D.
- the immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- the immune cells comprise a mixture of NK cells and T cells or a mixture of iPSC- derived NK cells and T cells.
- the immune cells comprise a purified or substantially purified population of NK cells.
- the administered immune cells are allogeneic with respect the subject.
- the method further comprises administering IL2.
- a population of genetically engineered and gene edited immune cells comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker expressed by a target tumor cell, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
- the immune cells are genetically edited at a target site in a gene encoding an adenosine A2 receptor to yield reduced levels of adenosine receptor A2 expression as compared to a non-edited immune cell, and wherein a guide sequence of any of SEQ ID NO: 503-506 is used to target the adenosine receptor A2 gene.
- the cells are further edited at a gene encoding one or more of CISH, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2R, NKG2A, SOCS2, CBLB, B2M, TIGIT, PD-1 , TIM-3, CD38, and TCR alpha.
- the cells are further edited at: (i) a gene encoding CIS and wherein a guide sequence of any of SEQ ID NO: 562-565 is used to target the gene encoding CIS, (ii) a gene encoding SMAD3 and wherein a guide sequence of any of SEQ ID NO: 491 -493 is used to target the SMAD3 gene, (iii) a gene encoding MAPKAPK3 and wherein a guide sequence of any of SEQ ID NO: 494- 496 is used to target the MAPKAPK3 gene, (iv) a gene encoding CEACAM1 and wherein a guide sequence of any of SEQ ID NO: 497-499, (v) a gene encoding DDIT4 and wherein a guide sequence of any of SEQ ID NO: 500-502 is used to target the DDIT4 gene, (vi) a gene encoding TGFBR2 and wherein a guide sequence of any of SEQ ID NO: 54
- the extracellular ligand binding domain comprises a receptor that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- the cytotoxic receptor expressed by the NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z costimulatory subdomain.
- the cytotoxic receptor targets one or more of NKG2D receptor ligands, CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, or KREMEN2 expressed by target tumor cells.
- the cytotoxic signaling complex comprises an 0X40 subdomain or a 4-1 BB domain, and a CD3zeta subdomain.
- the population of immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- the immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease and/or are suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells. Methods for treatment of cancer by administering such cells are provided for herein, as is the use of such cells for the treatment of cancer or for the preparation of a medicament for the treatment of cancer.
- a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex; contacting the population of immune cells with a gene editing complex; wherein the gene editing complex edits at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
- an edit is made in a gene encoding one or more of CISH, ADARA2, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2R, NKG2A, SOCS2, CBLB, B2M, TIG IT, PD-1 , TIM-3, CD38, and TCR alpha.
- Also provided for is a method for treating cancer in a subject comprising, administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the cytotoxic signaling complex comprises an OX-40 subdomain and a CD3zeta subdomain, wherein the cells are engineered to express membrane bound IL-15, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
- the cells are edited at least two genes selected from those genes encoding CISH, ADAR2A, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2R, NKG2A, SOCS2, CBLB, B2M, TIG IT, PD-1 , TIM-3, CD38, or TCR alpha.
- the cytotoxic receptor comprises (i) an NKG2D ligand-binding domain or a binding domain that binds to one or more epitopes of CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, or KREMEN2 expressed by target tumor cells, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 costimulatory subdomain and a CD3z co-stimulatory subdomain.
- the immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof. Additionally, in several embodiments, the administered immune cells are allogeneic with respect the subject.
- NK Natural Killer
- iPSCs induced pluripotent stem cells
- iPSC-derived NK cells NK-92 cells
- the administered immune cells are allogeneic with respect the subject.
- a population of genetically engineered immune cells for cancer immunotherapy comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15, wherein the genetically engineered immune cells are engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
- the population comprises one or more of genetically engineered NK cells and genetically engineered T cells.
- the suppressive cells comprise host cells or one or more of non-engineered natural killer cells, non-engineered T cells, or suppressive engineered cells.
- the cells that do not comprise said immunosuppressive effector are either non-engineered or engineered cells.
- the genetically engineered immune cells are also genetically edited to reduce expression of beta-2 microglobulin (B2M), and wherein the reduced expression of B2M enables the immune cells to be used in allogeneic cancer immunotherapy with reduced host versus graft rejection as compared to immune cells expressing endogenous levels of B2M.
- B2M beta-2 microglobulin
- the at least one immunosuppressive effector comprises a viral ly- derived peptide, optionally derived from a retrovirus, optionally derived from an envelope protein of a retrovirus.
- the at least one immunosuppressive effector is bound to an extracellular membrane of the immune cells, wherein the at least one immunosuppressive effector comprises a transmembrane protein, and wherein the transmembrane protein is selected from CD8a, CD4, CD3e, CD3y, CD35, CD3 , CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, FceRly, and a T-cell receptor.
- the immunosuppressive effector comprises one or more peptides having at least 90% sequence identity to one or more of SEQ ID NOs: 199-215, 219, 220, 223, 225, 228, 230, 235, 238, 240, 243, 250, or 253.
- the at least one immunosuppressive effector comprises at least a portion of a human protein and/or at least a portion of a human protein complex.
- the immunosuppressive effector comprises a peptide having at least 90% sequence identity to one or more of SEQ ID NO: 248, 245, 273, 276, 278, 279, 286, 287, 288, and 289.
- the at least one immunosuppressive effector comprises a chimeric construct comprises at least one virally-derived peptide and at least a portion of a human protein and/or at least a portion of a human protein complex.
- the chimeric immunosuppressive effector construct comprises: (i) two or more of a truncated human CD47, a p15E peptide, an HIV peptide, and an HTLV peptide, (ii) a truncated human CD47 domain and at least one p15E peptide, an HIV peptide, and an HTLV peptide, (iii) a truncated human CD47 domain and at least one HIV peptide, (iv) a truncated human CD47 domain and at least HTLV peptide, (v) a sequence having at least 95% sequence identity to one or more of SEQ ID Nos: 256, 259, 262, 265, 268, 271 , (vi)
- the chimeric immunosuppressive effector construct comprises a viral UL18 protein and has a sequence having at least 95% sequence identity to SEQ ID NO: 280, or wherein the chimeric immunosuppressive effector construct comprises a viral UL18 protein and a human B2M domain and comprises a sequence having at least 95% sequence identity to SEQ ID NO: 283 or 285.
- the immunosuppressive effector construct is integrated into the cytotoxic receptor between the transmembrane domain and the extracellular ligand-binding domain, within the extracellular ligand-binding domain, into a linker region of an scFv when the extracellular ligand-binding domain comprises an scFv and the chimeric immunosuppressive effector construct is integrated into a linker region of the scFv, within an N-terminal region of the cytotoxic receptor distally positioned from the extracellular ligand-binding domain, or at a plurality of locations within an extracellular region of the cytotoxic receptor.
- the at least one chimeric immunosuppressive effector construct is bound to an extracellular membrane of the immune cells.
- the cytotoxic receptor comprises at least one immunosuppressive effector and the genetically engineered immune cells express at least one membrane-bound immunosuppressive effector.
- the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease. In additional embodiments, the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells.
- a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, contacting the population of immune cells with an additional polynucleotide encoding at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said at least one immunosuppressive effector.
- Also provided is a method of engineering a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex and encoding at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said at least one immunosuppressive effector.
- the polynucleotide further encodes membrane-bound IL15.
- the method further comprises contacting the population of immune cells with a polynucleotide encoding a membrane-bound immunosuppressive effector.
- a method of reducing fratricide among a mixed population of genetically engineered immune cells for cancer immunotherapy comprising contacting a first subpopulation of immune cells from a population of mixed immune cells with a polynucleotide encoding at least one immunosuppressive effector, wherein expression of the at least one immunosuppressive effector by the first subpopulation of immune cells reduces suppressive activity of a second subpopulation of immune cells that are directed against the first subpopulation of immune cells and contacting the second subpopulation from a population of mixed immune cells with a polynucleotide encoding at least an additional immunosuppressive effector, wherein expression of the at least an additional immunosuppressive effector by the second subpopulation of immune cells reduces suppressive activity of the first subpopulation of immune cells that are directed against the second subpopulation of immune cells, and wherein the expression of the immunosuppressive effector by the first subpopulation and the second subpopulation reduces fratricide among the
- a method of engineering a population of genetically engineered immune cells for enhanced allogeneic cancer immunotherapy comprises, in several embodiments, genetically editing a mixed population of immune cells comprising NK cells and T cells to reduce expression Human Leukocyte Antigen (HLA) on the surface of the immune cells, wherein reduced expression of HLA on the surface of the immune cells reduces T cell-mediated cytotoxicity against the edited population of immune cells, wherein reduced expression of HLA on the surface of the cells renders the edited population of immune cells susceptible to NK-mediated cytotoxicity against the edited immune cells; and genetically engineering the edited cells to express one or more immunosuppressive effectors that reduce NK-mediated cytotoxicity against the mixed population of immune cells, wherein the one or more immunosuppressive effectors comprises one or more of a viral immunosuppressive peptide, a viral protein that is an HLA homolog, HLA-E, HLA-G, a human protein or fragment thereof that reduces phagocytosis of cells, a chi
- HLA Human Leukocyte
- the method further comprises genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- a population of genetically engineered and gene edited immune cells comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cells are genetically edited at one or more target locations in a CISH gene that encodes a CIS protein, wherein the edits yield reduced expression and/or function of CIS as compared to an immune cell not edited at the location or locations in the CISH gene, wherein the immune cells are edited at one or more additional target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, wherein the edits to the CISH gene and the one or more additional target sites are made using a Crispr/Cas9 system,
- the cells are edited at an additional target site in a CBLB gene to yield cells comprising edits within at least CISH and CBLB.
- a guide sequence of any of SEQ ID NO: 164 to 166 or 552-555 is used to target the CBLB gene.
- the cells are edited at an additional target site in a TGFBR2 gene to yield cells comprising edits within at least CISH and TGFBR2.
- a guide sequence of any of SEQ ID NO: 147 to 152 or 544-547 is used to target the TGFBR2 gene.
- the cells are edited at an additional target site in a TIGIT gene to yield cells comprising edits within at least CISH and TIGIT.
- a guide sequence of any of SEQ ID NO: 507-510 is used to target the TIGIT gene.
- the population of genetically engineered and gene edited immune are not edited at a CD70 gene target site. In several embodiments, however, they are edited at CD70 and also at one or more additional genes, for example CD70/CISH/CBLB, CD70/CISH/TGFBR2, CD70/CISH/TIGIT, and the like. Any combination of target genes may be edited according to embodiments disclosed herein
- At least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15.
- the population of genetically engineered and gene edited immune cells are not engineered to express a cytotoxic receptor complex that targets CD70.
- the cells are not engineered to express a cytotoxic receptor complex that targets CD19.
- the cells are not engineered to express a cytotoxic receptor complex that targets ligands of an NKG2D receptor.
- the cells are engineered to express an anti-CD70 CAR encoded by a polynucleotide at least 95% identical to one or more of SEQ ID NOs: SOO- 382.
- the polynucleotide encodes an amino acid sequence at least 95% identical to one or more of SEQ ID NO: 383-465.
- the cells are engineered to express an anti-CD70 CAR at least 95% identical to one or more of SEQ ID NO: 912-985. In several embodiments, the cells are engineered to express an anti-CD19 CAR encoded by a polynucleotide at least 95% identical to one or more of SEQ ID NOs: 175, 177, 179, 181 , 183, 185, 187, 189, 191 , 193, 195, or 197. In several embodiments, the cells are engineered to express an anti-CD19 CAR at least 95% identical to one or more of SEQ ID NO: 900-91 1 .
- the cells are engineered to express a chimeric receptor that targets NKG2D ligands encoded by a polynucleotide at least 95% identical to SEQ ID NO: 475. In several embodiments, the cells are engineered to express a chimeric receptor that targets NKG2D ligands at least 95% identical to SEQ ID NO. 899.
- the cells are further edited at a one or more genes encoding an adenosine A2 receptor, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2R, NKG2A, SOCS2, B2M, TIGIT, PD-1 , TIM-3, CD38, or TCR alpha.
- the cells are further edited at a gene encoding an adenosine A2 receptor and the nuclease is guided to the adenosine A2 receptor target sequence of any of SEQ ID NO: 503-506.
- the cells are further edited at a gene encoding SMAD3 and the nuclease is guided to the target sequence of any of SEQ ID NO: 491 -493.
- the cells are further edited at a gene encoding MAPKAPK3 and the nuclease is guided to the target sequence of any of SEQ ID NO: 494-496.
- the cells are further edited at a gene encoding CEACAM1 and the nuclease is guided to the target sequence of any of SEQ ID NO: 497-499.
- the cells are further edited at a gene encoding DDIT4 and the nuclease is guided to the target sequence of any of SEQ ID NO: 500-502.
- the cells are further edited at a gene encoding NKG2A and the nuclease is guided to the target sequence of any of SEQ ID NO: 548-551 .
- the cells are further edited at a gene encoding SOCS2 and the nuclease is guided to the target sequence of any of SEQ ID NO: 556-561 .
- the cells are further edited at a gene encoding B2M and the nuclease is guided to the target sequence of any of SEQ ID NO: 290-299.
- the cells are further edited at a gene encoding PD-1 and the nuclease is guided to the target sequence of any of SEQ ID NO: 51 1 -514.
- the cells are further edited at a gene encoding TIM-3 and the nuclease is guided to the target sequence of any of SEQ ID NO: 515- 518.
- the cells are further edited at a gene encoding CD38 and the nuclease is guided to the target sequence of any of SEQ ID NO: 519-522.
- the cells are further edited at a gene encoding TOR alpha and the nuclease is guided to the target sequence of any of SEQ ID NO: 566-569.
- the population of genetically engineered and gene edited immune cells may comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC- derived NK cells, NK-92 cells, or combinations thereof.
- NK Natural Killer
- iPSCs induced pluripotent stem cells
- iPSC- derived NK cells NK-92 cells
- the genetically engineered and edited immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease.
- Also provided for herein is a method for the treatment of cancer in a subject comprising administering to the subject at least a portion of population of immune cells according to embodiments discussed herein.
- a method for the treatment of cancer in a subject comprising administering to the subject at least a portion of population of immune cells according to embodiments discussed herein.
- a method for the treatment of cancer in a subject comprising administering to the subject at least a portion of population of immune cells according to embodiments discussed herein.
- use of use of genetically engineered and edited immune cells provided for herein for the treatment of cancer and/or for the preparation of a medicament for the treatment of cancer.
- a method of manufacturing a population of genetically edited immune cells for cancer immunotherapy comprising contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and contacting the population of immune cells with a second RNP complex, wherein the second RNP edits at one or more target sites in CBLB gene of the immune cell to yield reduced levels of expression of CBLB protein encoded by the CBLB gene as compared to an immune cell not edited at the CBLB gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof and wherein the genetically edited immune cells exhibit one or more of enhanced expansion
- RNP Cas-gRNA
- a method of manufacturing a population of genetically edited immune cells for cancer immunotherapy comprising contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and contacting the population of immune cells with a second RNP complex, wherein the second RNP edits at one or more target sites in a TGFBR2 gene of the immune cell to yield reduced levels of expression of TGFBR2 protein encoded by the TGFBR2 gene as compared to an immune cell not edited at the TGFBR2 gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof and wherein the genetically edited immune cells exhibit
- RNP Cas-gRNA
- a method of manufacturing a population of genetically edited immune cells for cancer immunotherapy comprising contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and contacting the population of immune cells with a second RNP complex, wherein the second RNP edits at one or more target sites in a TIGIT gene of the immune cell to yield reduced levels of expression of TIGIT protein encoded by the TIGIT gene as compared to an immune cell not edited at the TIGIT gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof and wherein the genetically edited immune cells exhibit one or more of
- a method of manufacturing a population of genetically edited immune cells for cancer immunotherapy comprising contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and contacting the population of immune cells with a second RNP complex, wherein the second RNP edits at one or more target sites in an additional gene of the immune cell to yield reduced levels of expression of a protein encoded by the additional gene as compared to an immune cell not edited at the additional gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and wherein the genetically edited immune cells exhibit one or more of enhanced expansion capability, enhanced cyto
- the methods further comprise contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the cytotoxic receptor does not target CD70.
- the cytotoxic receptor does target CD70.
- the methods do not comprise editing a gene encoding CD70.
- at least CD70 is edited.
- the cytotoxic receptor does not target CD19.
- the cytotoxic receptor does target CD19.
- the cytotoxic receptor does not target NKG2D ligands.
- the cytotoxic receptor does target NKG2D ligands.
- the method further comprises making an additional edit in one or more genes encoding one of ADARA2, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2R, NKG2A, SOCS2, B2M, PD-1 , TIM-3, CD38, or TCR alpha.
- the cytotoxic receptor targets one or more of ligands of NKG2D, CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, KREMEN2, or any combination thereof expressed by target tumor cells.
- the immune cells can comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- a method for treating cancer in a subject comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited at one or more target locations in a CISH gene that encodes a CIS protein, wherein the edits yield reduced expression and/or function of CIS as compared to an immune cell not edited at the location or locations in the CISH gene, wherein the immune cells are edited at one or more a CBLB gene, a TGFBR2 gene, and/or a TIGIT gene, to yield reduced levels of expression or activity of a CBLB protein, a TGFBR2 protein and/or a TIGIT protein as compared to an immune cell not edited at a CBLB gene, a TGFBR2 gene or a TIGIT gene, wherein the edits are made using
- the RNA-guided endonuclease is a Crispr/CasX, Crispr/CasY, or Crispr/Cas9 system.
- the method further comprises editing the immune cells at least one additional target gene.
- the at least one additional target gene is not a gene encoding CD70.
- the cells are edited at an additional target gene encoding ADAR2A, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, NKG2A, SOCS2, B2M, PD-1 , TIM-3, CD38, or TCR alpha.
- the cytotoxic receptor expressed by the immune cells does not target CD70, does not target CD19, or does not target NKG2D ligands. However, in several embodiments, the cytotoxic receptor expressed by the immune cells binds to one or more epitopes of CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, KREMEN2, or combinations thereof.
- the immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- the immune cells comprise a mixture of NK cells and T cells or a mixture of iPSC- derived NK cells and T cells.
- the administered immune cells are allogeneic with respect the subject.
- the method further comprises administering IL2.
- a population of genetically engineered immune cells for cancer immunotherapy comprising genetically engineered immune cells that express a cytotoxic receptor, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein encoded by the edited gene, wherein the genetically engineered immune cells are also engineered to express at least one immunosuppressive effector that exerts suppressive effects on the cytotoxic activity of natural killer cells and/or T cells, and wherein the resulting genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector and said edited gene.
- a population of genetically engineered immune cells for cancer immunotherapy comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein the genetically engineered immune cells are engineered to express a cytotoxic receptor, herein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by an edited gene (or genes), wherein the genetically engineered immune cells are further genetically engineered to express at least one immunosuppressive effector that exerts suppressive effects on the cytotoxic activity of undesired cells, such as non-engineered natural killer cells, non-engineered T cells, or undesired engineered cells, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector and said edited gene.
- a population of genetically engineered immune cells for cancer immunotherapy comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the immune cells are also genetically edited at one or more target sites in the genome to yield reduced levels of expression of a protein which is encoded by an edited gene which comprises an edited target site as compared to a non-edited immune cell, wherein immune cells are further genetically engineered to express at least one immunosuppressive effector configured to produce suppressive effects on undesired cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
- the suppressive cells comprise host cells.
- the suppressive cells comprise one or more of non-engineered natural killer cells, nonengineered T cells, or suppressive engineered cells.
- the suppressive engineered cells comprise the genetically engineered immune cells (e.g., other cells within the population of cells to be used for therapy).
- the cells that do not comprise said immunosuppressive effector are either non-engineered (e.g., host cells) or engineered cells (other engineered cells that were not edited or engineered with the immunosuppressive effector).
- the cytotoxic receptor expressed by the cells is a chimeric antigen receptor or other chimeric receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the cytotoxic signaling complex comprises an 0X40 subdomain or a 4-1 BB domain, and a CD3zeta subdomain.
- the cytotoxic receptor targets one or more of NKG2D, CD19, BCMA, CD70, and CD38 expressed by target tumor cells.
- the edits are made using a targeted endonuclease.
- the endonuclease is an RNA-guided endonuclease.
- the edits are made using a Crispr/Cas system.
- the genetically engineered immune cells are also genetically edited to reduce expression of beta-2 microglobulin (B2M).
- B2M beta-2 microglobulin
- the reduced expression of B2M enables the immune cells to be used in allogeneic cancer immunotherapy with reduced host versus graft rejection as compared to immune cells expressing endogenous levels of B2M.
- the at least one immunosuppressive effector comprises a virally- derived peptide.
- the immunosuppressive effector comprises a peptide derived from a retrovirus, such as a peptide derived from an envelope protein of a retrovirus.
- the at least one immunosuppressive effector comprises at least a portion of a human protein and/or at least a portion of a human protein complex.
- the at least one immunosuppressive effector comprises at least a portion of human protein.
- the at least one immunosuppressive effector comprises a chimeric construct comprises at least one virally- derived peptide and at least a portion of a human protein and/or at least a portion of a human protein complex.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor at one or more positions within the receptor.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor between the transmembrane domain and the extracellular ligand-binding domain.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor within the extracellular ligandbinding domain.
- the at least one immunosuppressive effector is integrated into a linker region of the scFv.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor within an N-terminal region of the cytotoxic receptor distally positioned from the extracellular ligand-binding domain. In some embodiments, the at least one immunosuppressive effector is integrated into the cytotoxic receptor at a plurality of locations within an extracellular region of the cytotoxic receptor, for example, multiple copies of the effector are positioned at various locations within the receptor, inducing enhanced immunosuppressive effects.
- the at least one immunosuppressive effector is bound to an extracellular membrane of the immune cells.
- the at least one immunosuppressive effector comprises a transmembrane protein.
- transmembrane proteins that can be used according to embodiments disclosed herein are CD8a, CD4, CD3e, CD3y, CD35, CD3 , CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, FceRly, and a T-cell receptor. Combinations of transmembrane domains are used, according to several embodiments.
- the transmembrane protein comprises a CD8a transmembrane protein.
- the at least one immunosuppressive effector is expressed on the immune cells by a disulfide trap single chain trimer (dtSCT).
- dtSCT disulfide trap single chain trimer
- the immunosuppressive effector is encoded by a nucleic acid or comprises a peptide having at least 85% sequence identity to one or more of the nucleotide or amino acid sequences of SEQ ID NOs: 683-894. In several embodiments, the immunosuppressive effector comprises a peptide having at least 95% sequence identity to SEQ ID NO: 689. In several embodiments, the immunosuppressive effector is encoded by a nucleic acid having at least 95% sequence identity to SEQ ID NO: 690.
- the genetically engineered immune cells comprise genetically engineered Natural Killer (NK) cells, genetically engineered T cells, or combinations thereof.
- NK Natural Killer
- the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease.
- the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells.
- at least a portion (e.g., at least 50%, at least 60%, at least 75%, or more) of the genetically engineered immune cells are engineered to express membrane bound IL-15.
- at least about 60% of the NK cells are positive for NKG2A.
- NK cells are positive for NKG2A.
- the elevated expression levels of NKG2A enhance the efficacy of the engineered and edited cells in cancer immunotherapy by virtue of reduced cytotoxicity within the cells of the population administered to a subject.
- methods for the treatment of cancer in a subject comprising administering to the subject the genetically engineered and edited immune cells according to embodiments disclosed herein.
- methods for the use of the genetically engineered and edited immune cells according embodiments discussed herein for the treatment of cancer or for the preparation of a medicament for the treatment of cancer comprising administering to the subject the genetically engineered and edited immune cells according to embodiments disclosed herein.
- a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with an RNA-guided endonuclease to genetically edit one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell; contacting the population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex; contacting the population of immune cells with an additional polynucleotide encoding at least one immunosuppressive effector, wherein the immunosuppressive effector is encoded by a nucleic acid or comprises a peptide having at least 85% sequence identity to one or more of the nucleotide or amino acid sequences of SEQ ID NOs: 683-8
- the target of the genetic editing is one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- Also provided for herein are methods of engineering a population of genetically engineered immune cells for enhanced allogeneic cancer immunotherapy comprising genetically editing a mixed population of immune cells comprising NK cells and T cells to disrupt Beta-2 microglobulin (B2M) expression and coordinately reduce expression Human Leukocyte Antigen (HLA) on the surface of the immune cells, wherein reduced expression of HLA on the surface of the immune cells reduces T cell- mediated cytotoxicity against the edited population of immune cells, wherein reduced expression of HLA on the surface of the cells renders the edited population of immune cells susceptible to NK-mediated cytotoxicity against the edited immune cells, and genetically engineering the edited cells to express one or more immunosuppressive effectors that reduce NK-mediated cytotoxicity against the mixed population of immune cells, wherein the one or more immunosuppressive effectors comprises one or more of a viral immunosuppressive peptide, a viral protein that is an HLA homolog, HLA-E, HLA-G, a human protein or fragment thereof that reduces
- the method further comprises contacting the mixed population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the polynucleotide encodes a cytotoxic receptor targeting one or more of NKG2D, CD19, CD70, BCMA, and CD38 expressed by target tumor cells.
- the method further comprises genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- the gene editing to reduce expression or the gene editing to induce expression is made using a CRISPR-Cas system.
- the Cas is Cas9, Cas12, Cas13, CasX or CasY.
- a population of genetically engineered immune cells comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein at least about 70% of the genetically engineered NK cells express NKG2A, wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector derived from a Human Leukocyte Antigen (HLA), wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein, optionally, the genetically engineered immune cells are further engineered to express one or more of the following: IL-15, mblL-15, at least one viral immunosuppressive peptide integrated within an extracellular region, or extracellular regions,
- HLA Human Leukocyte Antigen
- a population of genetically engineered and gene edited immune cells wherein the cells are genetically engineered in one or more respects and wherein the cells are also gene edited in one or respects.
- the cells are genetically engineered to express one or more cytotoxic receptor that targets a tumor marker expressed by a target tumor cell.
- the engineered immune cells are genetically edited at one or more target sites in the immune cell genome of the immune cell to yield reduced levels of expression of the protein which is encoded by the target gene which comprises an edited target site as compared to a nonedited immune cell, thereby altering one or more of the genotype, phenotype or function of the cell.
- the genetic edits are made using a guided nuclease.
- a population of genetically engineered and gene edited immune cells comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker expressed by a target tumor cell.
- the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell.
- the genetic edits are made using a CRISPR/CasX system.
- the genetic edits are made using a CRISPR/CasY system. In several embodiments, the genetic edits are made using a CRISPR/Cas9 system. In several embodiments, the CRISPR/Cas systems used herein are configured to reduce potentially deleterious off-target effects. In several embodiments, the genetic edits are made using a non-Cas guided nuclease.
- At least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15.
- the genetically engineered and gene edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise genetically edited target site or sites.
- the cells are edited at a gene encoding one or more of an adenosine A2 receptor CISH, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2, NKG2A, SOCS2, CBLB, B2M, TIG IT, PD-1 , TIM-3, CD38, and TCR alpha to yield reduced levels of expression as compared to a non-edited immune cell.
- the nuclease is guided to the adenosine A2 receptor target sequence of any of SEQ ID NOs: 503-506.
- the cells are edited at a gene encoding CIS and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 562-565. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding SMAD3 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 491 -493. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding MAPKAPK3 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 494-496.
- the cells are edited at a gene encoding CEACAM1 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 497-499.
- the cells are edited at a gene encoding DDIT4 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 500-502.
- the cells are edited at a gene encoding TGFBR2 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 544-547.
- the cells are edited at a gene encoding NKG2A and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 548-551 .
- the cells are edited at a gene encoding SOCS2 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 556-561 .
- the cells are edited at a gene encoding CBLB and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 552-555.
- the cells are edited at a gene encoding B2M and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 290-299. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding TIGIT and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 507- 510. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding PD-1 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 51 1 -514.
- the cells are edited at a gene encoding TIM-3 and the nuclease is guided to the target sequence of any of the SEQ ID NOs: 515-518. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding CD38 and the nuclease is guided to the target sequence of any of the SEQ ID NO: 519-522. In several embodiments, within the population of immune cells, the cells are edited at a gene encoding TCR alpha and the nuclease is guided to the target sequence of any of the SEQ ID NO: 566-569.
- the extracellular ligand binding domain comprises a receptor that is directed against at least one tumor marker selected from MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- the cytotoxic receptor expressed by NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex.
- the cytotoxic signaling complex comprises an 0X40 subdomain and/or a 4-1 BB domain, and a CD3zeta subdomain.
- the cytotoxic receptor targets one or more of NKG2D, CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, ALPPL2, CLDN4, CLDN6, or KREMEN2 expressed by target tumor cells.
- the population of immune cells can comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- NK Natural Killer
- iPSCs induced pluripotent stem cells
- iPSC-derived NK cells NK-92 cells
- the population of immune cells comprise engineered and edited immune cells suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease.
- the population of immune cells comprise engineered and edited immune cells suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells.
- the population of immune cells comprise engineered and edited immune cells for the treatment of cancer, or the preparation of a medicament for the treatment of cancer.
- methods for treating cancer in a subject comprising, administering to the subject a population of genetically engineered and gene edited immune cells.
- the vector comprises a polynucleotide, wherein the polynucleotide encodes a cytotoxic receptor.
- the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the method further includes contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP).
- RNP Cas-gRNA ribonucleoprotein complex
- the RNP edits at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell.
- Also provided for herein is a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy, comprising contacting a population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, and contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or combinations thereof, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells not comprising genetically edited target sites.
- a vector
- the method further includes gene edits that are made in a gene encoding one or more of CISH, ADARA2, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2, NKG2A, SOCS2, CBLB, B2M, TIGIT, PD-1 , TIM-3, CD38, and TCR alpha.
- the population of immune cells is contacted with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain comprises a receptor directed against a tumor marker selected from a group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- a tumor marker selected from a group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- the population of immune cells is contacted with a vector comprising a polynucleotide encoding a cytotoxic receptor, wherein the cytotoxic receptor expressed by the NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the population of immune cells is contacted with a vector comprising a polynucleotide encoding a cytotoxic receptor, wherein the cytotoxic receptor targets one or more of NKG2D, CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, ALPPL2, CLDN4, CLDN6, or KREMEN2 expressed by target tumor cells.
- the methods further include contacting a population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the cytotoxic signaling complex comprises an 0X40 subdomain and/or a 4-1 BB domain, and a CD3zeta subdomain.
- the methods further include contacting a population of immune cells with a vector comprising a polynucleotide, wherein the polynucleotide bicistronically encodes membrane bound IL15.
- the vector is a retroviral vector.
- the methods further include contacting a population of immune cells, wherein the immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- NK Natural Killer
- iPSCs induced pluripotent stem cells
- iPSC-derived NK cells NK-92 cells, or combinations thereof.
- a method of treating cancer in a subject comprising administering to the subject a population of genetically engineered and/or genetically edited immune cells.
- the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the cytotoxic signaling complex comprises an OX-40 subdomain, and a CD3zeta subdomain.
- the method further includes where cells are engineered to express membrane bound IL-15.
- the immune cells are genetically edited.
- the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell.
- the edits are made using a Crispr/CasX, Crispr/CasY, or Crispr/Cas9 system, or a combination thereof.
- the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells without or not comprising genetically edited target sites.
- Some embodiments relate to a method wherein immune cells are edited at a gene encoding one or more of CISH, ADAR2A, SMAD3, MAPKAPK3, CEACAM1 , DDIT4, TGFBR2, NKG2A, SOCS2, CBLB, B2M, TIGIT, PD-1 , TIM-3, CD38, and TCR alpha.
- the cytotoxic receptor expressed by the immune cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the cytotoxic receptor expressed by immune cells comprises (i) a binding domain that binds to one or more epitopes of CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, ALPPL2, CLDN4, CLDN6, or KREMEN2 expressed by target tumor cells, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z costimulatory subdomain.
- a method of treating cancer in a subject comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells comprise Natural Killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or combinations thereof.
- the population of genetically engineered immune cells comprise a mixture of NK cells and T cells, or a mixture of iPSC-derived NK cells and T cells.
- the method further provides that the NK cells and/or the iPSC- derived NK cells are edited at least to reduce CISH expression, and/or the T cells target CD19 or NKG2D.
- method includes administering immune cells wherein the immune cells are allogeneic with respect to the subject.
- the method includes further administering IL2.
- host immune responses against administered cells can limit the efficacy and persistence of the administered cells.
- a mixed population of immune cells are used for immunotherapy. In such cases, not only does the host immune response present a challenge, but so does the potential for the administered cells to act on one another in a manner that suppresses the efficacy of the immunotherapy, as well as against the host tissues (e.g., off target effects).
- a mixed cell immunotherapy approach therefore requires additional engineering and/or gene editing in order to reduce graft versus host effects, host versus graft rejection, and maintenance of compatibility between the mixed immune cell types in the therapeutic.
- an engineered T cell expressing a CAR can cause graft versus host rejection because the T cell recognizes host cells as non-self cells. This recognition occurs through the graft T cell receptor interacting with host cell HLA.
- gene editing to disrupt the T cell receptor can eliminate T cell-based graft versus host rejection.
- the host T cells recognize the graft immune cells (e.g., NK cell and/or T cells) as non-self and destroy the administered cells, thus reducing the persistence and efficacy of the immunotherapy.
- the graft immune cells e.g., NK cell and/or T cells
- Beta-2 microglobulin (B2M) gene editing/knockout is used to accomplish this, according to several embodiments disclosed herein.
- B2M knockout if B2M knockout is complete, this renders the edited cells susceptible to NK cell cytotoxicity, not only from host NK cells, but from NK cells within the administered immune cells (host versus graft and fratricide). This is because editing to remove B2M expression causes loss of all HLA molecules, including the normally expressed signals that would function to inhibit NK cell activity (KIR molecules).
- NK cells both host and allogeneic cells
- various proteins can be expressed on the surface of the allogeneic immune cells that inhibits their being target by NK cells (both host and allogeneic cells). For example “don’t eat me” signals that ordinarily allow cells to avoid being phagocytosed by macrophages can be expressed on allogeneic CAR- expressing NK and/or T cells to decrease targeting by NK cells.
- Other approaches that provide multiple benefits are also disclosed herein, for example reducing NK cell-mediated suppression while also enhancing the persistence of engineered NK cells.
- immune cells e.g., CAR expressing T cells
- HLA-E a temporary inhibition of NK cell activity, whether host or engineered allogeneic NK cells.
- this suppression reduces the host NK cell activity against the T cells and allows the T cells to act against target tumor cells.
- the temporary suppression of the engineered allogeneic NK cells helps prevent NK cell exhaustion, as the engineered allogeneic NK cells has a period of reduced cytotoxic activity (e.g., a rest period).
- the suppressive effects actually serve to enhance the persistence of the allogeneic NK cells in a mixed immune cell population for immunotherapy.
- peptides or proteins derived from viruses can be expressed by the engineered allogeneic cells to temporarily exert suppressive activity on NK cells (both host and those engineered NK cells within the mixed population) and thus increase the overall persistence of the allogeneic mixed immune cell population.
- the combined acute activity of the engineered NK cells (even with the periods of suppression) and longer duration activity of the engineered T cells results in cytotoxic lysis of tumor cells.
- Resulting tumor debris is processed by host immune cells (e.g., dendritic cells) and tumor antigens are thus presented to T cells, thereby recruiting host immune cells to fight the tumor.
- engineered cells are designed to undergo a temporary suppression (e.g., a period of reduced cytotoxic activity or a rest period). This suppression can be a reduction of cytotoxic or other activity by at least 10-90% (e.g., 10-30%, 30-50%, 50-70%, 70-90% and overlapping ranges therein). In one embodiment, over 90% suppression is achieved.
- Temporary can include, for example, minutes, hours, or days. Cells may be permanently suppressed in one embodiment.
- a population of genetically engineered immune cells for cancer immunotherapy comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered immune cells are engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of natural killer cells and/or T cells, wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
- a population of genetically engineered immune cells for cancer immunotherapy comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein the genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of undesired cells, wherein the undesired cells comprise one or more of non-engineered natural killer cells, non-engineered T cells, or undesired engineered cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
- a population of genetically engineered immune cells for cancer immunotherapy comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
- a population of genetically engineered immune cells comprising one or more of genetically engineered NK cells and genetically engineered T cells, wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, and wherein, optionally, the genetically engineered immune cells are further engineered to express one or more of the following: IL-15, mblL-15, at least one viral immunosuppressive peptide integrated within an extracellular region, or extracellular regions, of the cytotoxic receptor, at least one viral immunosuppressive peptide expressed on a cell membrane of the genetically engineered immune cells, at least
- the suppressive cells comprise host cells (e.g., NK cells and/or T cells).
- the suppressive cells comprise one or more of non-engineered natural killer cells, non-engineered T cells, or suppressive engineered cells.
- the suppressive engineered cells comprise the genetically engineered immune cells (e.g. those to be administered to a patient for cancer immunotherapy.
- the cells that do not comprise said immunosuppressive effector are either non-engineered or engineered cells.
- the immunosuppressive effector exerts transient immunosuppressive effects.
- the transient immunosuppressive effects are beneficial for reducing the potential exhaustion of one or more of the genetically engineered immune cells.
- the immunosuppressive effector are not engineered to be expressed in a matched manner across the various cell types within the genetically engineered immune cells.
- a T cell may be engineered to express a certain immunosuppressive effector (or effectors) while an NK cells is not so engineered and expresses a different profile of immunosuppressive effector (or effectors).
- the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the cytotoxic receptor targets one or more of NKG2D, CD19, and CD70 expressed by target tumor cells.
- the cytotoxic signaling complex comprises an 0X40 subdomain or a 4-1 BB domain, and a CD3zeta subdomain, or any combination thereof (including replicates of one or more subdomains).
- NK cells are engineered to express membrane bound IL15. In several embodiments, a portion of the cells are not engineered to express membrane-bound IL15.
- NK cells are engineered to express mblL15, while T cells are not. In several embodiments, both NK and T cells are engineered to express mblL15. In several embodiments, T cells, not NK cells are engineered to express mblL15, but NK cells are not. In several embodiments, NK cells and/or T cells are engineered to express soluble IL15, in addition to, or in place of mblL15.
- the mblL15 is encoded by the nucleic acid sequence of SEQ ID NO: 489, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 489.
- the mblL15 has the amino acid sequence of SEQ ID NO: 490, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 490.
- the genetically engineered immune cells are also genetically edited to reduce expression of beta-2 microglobulin (B2M).
- B2M beta-2 microglobulin
- the reduced expression of B2M enables the immune cells to be used in allogeneic cancer immunotherapy with reduced host versus graft rejection as compared to immune cells expressing endogenous levels of B2M.
- the at least one immunosuppressive effector comprises a virally- derived peptide. In some embodiments, the at least one immunosuppressive effector comprises a peptide derived from a retrovirus. In several embodiments, the at least one immunosuppressive effector comprises a peptide derived from an envelope protein of a retrovirus. In several embodiments, the at least one immunosuppressive effector comprises at least a portion of a human protein and/or at least a portion of a human protein complex. In some embodiments, the at least one immunosuppressive effector comprises at least a portion of human protein.
- the at least one immunosuppressive effector comprises a chimeric construct comprises at least one virally-derived peptide and at least a portion of a human protein and/or at least a portion of a human protein complex.
- the chimeric immunosuppressive effector construct comprises two or more of a truncated human CD47, a p15E peptide, an HIV peptide, and an HTLV peptide.
- the chimeric immunosuppressive effector construct comprises a truncated human CD47 domain and at least one of p15E peptide, an HIV peptide, and an HTLV peptide.
- the chimeric immunosuppressive effector construct comprises a truncated human CD47 domain and at least one HIV peptide. In several embodiments, the chimeric immunosuppressive effector construct comprises a truncated human CD47 domain and at least HTLV peptide. In several embodiments, the chimeric immunosuppressive effector construct comprises a viral UL18 protein. In several embodiments, the chimeric immunosuppressive construct comprises a human B2M domain.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor. In several embodiments, the at least one immunosuppressive effector is integrated into the cytotoxic receptor between the transmembrane domain and the extracellular ligand-binding domain. In several embodiments, the at least one immunosuppressive effector is integrated into the cytotoxic receptor within the extracellular ligand-binding domain. In several embodiments, the extracellular ligand-binding domain comprises an scFv and the at least one immunosuppressive effector is integrated into a linker region of the scFv.
- the at least one immunosuppressive effector is integrated into the cytotoxic receptor within an N-terminal region of the cytotoxic receptor distally positioned from the extracellular ligand-binding domain.
- an immunosuppressive effector is integrated into the cytotoxic receptor at a plurality of locations within an extracellular region of the cytotoxic receptor.
- the immunosuppressive effector in a first location is different from the immunosuppressive effector at a different location(s).
- the same immunosuppressive effector is integrated at multiple locations.
- different immunosuppressive effectors are integrated at various locations.
- the at least one immunosuppressive effector is bound to an extracellular membrane of the immune cells.
- the at least one immunosuppressive effector comprises a transmembrane protein.
- the transmembrane protein is selected from CD8a, CD4, CD3e, CD3y, CD35, CD3 , CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, FceRly, and a T-cell receptor.
- the transmembrane protein comprises a CD8a transmembrane protein.
- the genetically engineered immune cells include a cytotoxic receptor comprising at least one immunosuppressive effector and at least one membrane-bound immunosuppressive effector.
- a spacer sequence (also referred to as a hinge) is used to separate the immunosuppressive effector, or the CAR, from the transmembrane domain.
- the spacer is selected from a CD8a, lgG1 , lgG2, lgG3, lgG4, or CD28 spacer or is derived from CD8a, IgG 1 , lgG2, lgG3, lgG4, CD28, or can be a fully synthetic sequence.
- the hinge region comprises one or more of SEQ ID NOs: 479-487.
- the hinge region comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: 479-486.
- the immunosuppressive effector comprises one or more peptides having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to one or more of SEQ ID NOs: 199-215. In several embodiments, the immunosuppressive effector comprises a peptide having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 199. In several embodiments, the immunosuppressive effector comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 219.
- the immunosuppressive effector comprises a peptide having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to one or more of SEQ ID NO: 220, 225, 230, 235, and 250.
- the immunosuppressive effector comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to one or more of SEQ ID NO: 223, 228, 233, 238, and 253.
- the immunosuppressive effector comprises a peptide having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 240. In several embodiments, the immunosuppressive effector comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 243.
- the immunosuppressive effector comprises a peptide having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to one or more of SEQ ID NO: 245, 273, 276, 278, 279, 286, 287, 288, and 289.
- the immunosuppressive effector comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 248.
- the immunosuppressive effector comprises a chimeric immunosuppressive effector construct that is membrane bound and comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to one or more of SEQ ID Nos: 256, 259, 262, 265, 268, and 271 .
- the chimeric immunosuppressive effector construct comprises a viral UL18 protein and comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 280.
- the chimeric immunosuppressive effector construct comprises a viral UL18 protein and a human B2M domain and comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 94%, or at least about 95% sequence identity to SEQ ID NO: 283 or 285.
- the genetically engineered immune cells comprise genetically engineered Natural Killer (NK) cells, genetically engineered T cells, or combinations thereof. Other immune cells may be included as well, in some embodiments.
- the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease.
- the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells.
- Also provided for herein is a method for the treatment of cancer in a subject comprising administering to the subject genetically engineered immune cells according to embodiments of the present disclosure. Also provided is the use of genetically engineered immune cells according to embodiments of the present disclosure for the treatment of cancer as well their use in the preparation of a medicament for the treatment of cancer.
- a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with a polynucleotide encoding a cytotoxic receptor, and contacting the population of immune cells with an additional polynucleotide encoding at least one immunosuppressive effector.
- a method of engineering a population of genetically engineered immune cells for cancer immunotherapy comprising contacting a population of immune cells with a polynucleotide encoding a cytotoxic receptor and encoding at least one immunosuppressive effector.
- the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of suppressive cells and in several embodiments, the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said at least one immunosuppressive effector.
- the method further comprises genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- the polynucleotide optionally further encodes membranebound IL15.
- the method further comprises contacting the population of immune cells with a polynucleotide encoding a membrane-bound immunosuppressive effector.
- the expression of the at least one immunosuppressive effector by the first subpopulation of immune cells reduces, at least temporarily, suppressive activity of a second subpopulation of immune cells that are directed against the first subpopulation of immune cells and expression of the at least an additional immunosuppressive effector by the second subpopulation of immune cells reduces, at least temporarily, suppressive activity of the first subpopulation of immune cells that are directed against the second subpopulation of immune cells.
- the method further comprises contacting the population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the method optionally further comprises genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- a method of engineering a population of genetically engineered immune cells for enhanced allogeneic cancer immunotherapy comprising genetically editing a mixed population of immune cells comprising NK cells and T cells to reduce expression Human Leukocyte Antigen (HLA) on the surface of the immune cells and genetically engineering the edited cells to express one or more immunosuppressive effectors that reduce NK-mediated cytotoxicity against the mixed population of immune cells.
- HLA Human Leukocyte Antigen
- the reduced expression of HLA on the surface of the immune cells reduces T cell-mediated cytotoxicity against the edited population of immune cells.
- the reduced expression of HLA on the surface of the cells renders the edited population of immune cells susceptible to NK-mediated cytotoxicity against the edited immune cells.
- the one or more immunosuppressive effectors comprises one or more of a viral immunosuppressive peptide, a viral protein that is an HLA homolog, HLA-E, HLA-G, a human protein or fragment thereof that reduces phagocytosis of cells, a chimeric construct comprising a viral immunosuppressive peptide and a human protein or fragment thereof that reduces phagocytosis of cells, or combinations thereof.
- the reduced T cell-mediated cytotoxicity reduces, at least temporarily, engineered T cell-mediated fratricidal cytotoxicity against engineered NK cells and, upon administration, host T-cell mediated cytotoxicity against engineered NK cells.
- the reduced NK cell-mediated cytotoxicity reduces, at least temporarily, engineered NK cell-mediated fratricidal cytotoxicity against engineered T cells and, upon administration, host NK cell-mediated cytotoxicity against engineered NK and engineered T cells, thereby allowing for enhanced persistence of the engineering mixed population of immune cells upon administration to an allogeneic subject and allowing for enhanced allogeneic cancer immunotherapy.
- the method further comprises contacting the mixed population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
- the polynucleotide encodes a cytotoxic receptor targeting one or more of NKG2D, CD19, and CD70 expressed by target tumor cells.
- the cytotoxic signaling complex comprises an 0X40 subdomain or a 4-1 BB domain, and a CD3zeta subdomain, or any combination thereof.
- the method further comprising genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
- the gene editing to reduce expression or the gene editing to induce expression is made using a CRISPR-Cas system.
- the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, CasX, CasY and combinations thereof.
- the Cas is Cas9.
- cells for immunotherapy are genetically modified to enhance one or more characteristics of the cells that results in a more effective therapeutic.
- one or more of the expansion potential, cytotoxicity and/or persistence of the genetically modified immune cells is enhanced.
- the immune cells are also engineered to express a cytotoxic receptor that targets a tumor.
- a population of genetically engineered natural killer (NK) cell for cancer immunotherapy comprising a plurality of NK cells, wherein the plurality of NK cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the NK cells are genetically edited to express reduced levels of a cytokine-inducible SH2-containing (CIS) protein encoded by a CISH gene as compared to a non-engineered NK cell, wherein the reduced CIS expression was engineered through editing of a CISH gene, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to NK cells expressing native levels of CIS.
- a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex
- the NK cells are genetically edited to express reduced levels of a
- the cytotoxic signaling complex comprises an OX-40 subdomain and a CD3zeta subdomain.
- the NK cells are engineered to express membrane bound IL-15.
- T cells are engineered and used in place of, or in addition to NK cells.
- NKT cells are not included in the engineered immune cell population.
- the population of immune cells comprises, consists of, or consists essentially of engineered NK cells.
- the extracellular ligand binding domain comprises a receptor that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- the cytotoxic receptor expressed by the NK cells comprises, consists of, or consists essentially of (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the cytotoxic receptor is encoded by a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 145. In several embodiments, the cytotoxic receptor has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 174 or 899.
- the cytotoxic receptor expressed by the NK cells comprises a chimeric antigen receptor (CAR) that comprises, consists of, or consists essentially of (i) an tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- CAR chimeric antigen receptor
- the anti-CD19 antibody comprises a variable heavy (VH) domain of a single chain Fragment variable (scFv) and a variable light (VL) domain of a scFv, wherein the VH domain comprises the amino acid sequence of SEQ ID NO: 120, and wherein the encoded VL domain comprises the amino acid sequence of SEQ ID NO: 1 18.
- the CAR expressed by the T cells has at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- the anti-CD19 antibody fragment is designed (e.g., engineered) to reduce potential antigenicity of the encoded protein and/or enhance one or more characteristics of the encoded protein (e.g., target recognition and/or binding characteristics)
- the anti-CD19 antibody fragment does not comprise certain sequences.
- the anti-CD19 antibody fragment is not encoded by SEQ ID NO: 1 16, nor does it comprise the VL regions of SEQ ID NO: 105 or 107, or the VH regions of SEQ ID NO: 104 or 106.
- the anti- CD19 antibody fragment does not comprise one or more CDRs selected from SEQ ID NO: 108 to 1 15.
- the expression of CIS is substantially reduced as compared to a non-engineered NK cell.
- gene editing can reduce expression of a target protein, like CIS (or others disclosed herein) by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- the gene is completely knocked out, such that expression of the target protein is undetectable.
- immune cells e.g., NK cells
- the NK cells are further genetically engineered to express a reduced level of a transforming growth factor beta receptor (TGFBR) as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of the TGFBR. In several embodiments, the NK cells are further genetically edited to express a reduced level of beta-2 microglobulin (B2M) as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of B2M surface protein.
- TGFBR transforming growth factor beta receptor
- B2M beta-2 microglobulin
- the NK cells are further genetically edited to express a reduced level of CIITA (class II major histocompatibility complex transactivator) as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of CIITA. In several embodiments, the NK cells are further genetically edited to express a reduced level of a Natural Killer Group 2, member A (NKG2A) receptor as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of NKG2A.
- CIITA class II major histocompatibility complex transactivator
- the NK cells are further genetically edited to express a reduced level of a Cbl protooncogene B protein encoded by a CBLB gene as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of Cbl protooncogene B protein. In several embodiments, the NK cells are further genetically edited to express a reduced level of a tripartite motif-containing protein 29 protein encoded by a TRIM29 gene as compared to a non-engineered NK cell. In several embodiments, at least 50% of the population of NK cells do not express a detectable level of TRIM29 protein.
- the NK cells are further genetically edited to express a reduced level of a suppressor of cytokine signaling 2 protein encoded by a SOCS2 gene as compared to a non-engineered NK cell.
- at least 50% of the population of NK cells do not express a detectable level of SOCS2 protein.
- any combination of the above-referenced target proteins/genes can be edited to a desired level, including in combination with CIS, including such that the proteins are not expressed at a detectable level.
- the positive effects imparted to the engineered immune cell e.g., NK cell or T cell
- the positive effects imparted to the engineered immune cell remain and serve to enhance one or more anti-cancer aspects of the cells.
- the NK cells are further genetically edited to disrupt expression of at least one immune checkpoint protein by the NK cells.
- the at least one immune checkpoint protein is selected from CTLA4, PD-1 , lymphocyte activation gene (LAG-3), NKG2A receptor, KIR2DL-1 , KIR2DL-2, KIR2DL-3, KIR2DS-1 and/or KIR2DA-2, and combinations thereof.
- gene editing is used to “knock in” or otherwise enhance expression of a target protein.
- expression of a target protein can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- the NK cells are further genetically edited to express CD47.
- the NK cells are further genetically engineered to express HLA-E. Any genes that are knocked in can be knocked in in combination with any of the genes that are knocked out or otherwise disrupted.
- the population of genetically engineered NK cells further comprises a population of genetically engineered T cells.
- the population of T cells is at least partially, if not substantially, non-alloreactive.
- the non-alloreactive T cells comprise at least one genetically edited subunit of a T Cell Receptor (TCR) such that the non- alloreactive T cells do not exhibit alloreactive effects against cells of a recipient subject.
- TCR T Cell Receptor
- the population of T cells is engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker, wherein the tumor marker is one or more of CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , EGFR. Combinations of two or more of these tumor markers can be targeted, in some embodiments.
- the CAR expressed by the T cells is directed against CD19.
- the CAR expressed by the T cells has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- the CAR targets CD19.
- the CAR is designed (e.g., engineered) to reduce potential antigenicity of the encoded protein and/or enhance one or more characteristics of the encoded protein (e.g., target recognition and/or binding characteristics)
- anti-CD19 CAR does not comprise certain sequences.
- the anti-CD19 CAR does not comprise by SEQ ID NO: 1 16, SEQ ID NO: 105, 107, 104 or 106.
- the anti-CD19 antibody fragment does not comprise one or more CDRs selected from SEQ ID NO: 108 to 1 15.
- the TCR subunit of the T cells modified is TCRa.
- the modification to the TCR of the T cells results in at least 80%, 85%, or 90% of the population of T cells not expressing a detectable level of the TCR.
- the T cells are further genetically edited to reduce expression of one or more of CIS, TGFBR, B2M, CIITA, TRIM29 and SOCS2 as compared to non-engineered T cells, or to express CD47 or HLA-E.
- the T cells are further genetically edited to disrupt expression of at least one immune checkpoint protein by the T cells, wherein the at least one immune checkpoint protein is selected from CTLA4, PD-1 , and lymphocyte activation gene (LAG-3).
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a CRISPR-Cas system.
- the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, and combinations thereof.
- the Cas is Cas9.
- the CRISPR-Cas system comprises a Cas selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1 , Cse2, Csy1 , Csy2, Csy3, GSU0054, Casi o, Csm2, Cmr5, Casi o, Csx1 1 , Csx10, Csf1 , and combinations thereof.
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a zinc finger nuclease (ZFN).
- ZFN zinc finger nuclease
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a Transcription activator-like effector nuclease (TALEN).
- TALEN Transcription activator-like effector nuclease
- the genetically engineered NK cells and/or engineered T cells have an 0X40 subdomain encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 5.
- the genetically engineered NK cells and/or genetically engineered T cells have a CD3 zeta subdomain encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 7.
- the genetically engineered NK cells and/or genetically engineered T cells have an mblL15 encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 1 1 or 489.
- a population of genetically engineered NK cells and/or a population of genetically engineered T cells
- a population of genetically engineered NK cells as disclosed herein in the treatment of cancer.
- a method for treating cancer in a subject comprising administering to the subject a population of genetically engineered immune cells, comprising (i) a plurality of NK cells, wherein the plurality of NK cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the NK cells are genetically edited to express reduced levels of cytokine-inducible SH2-containing (CIS) protein encoded by a CISH gene by the cells as compared to a non-engineered NK cell, wherein the reduced CIS expression was engineered through genetic editing of a CISH gene, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to NK cells expressing native levels of CIS; and optionally (ii) a plurality of T cells.
- a population of genetically engineered immune cells comprising (i) a plurality of NK cells
- the cytotoxic signaling complex comprises an OX-40 subdomain and a CD3zeta subdomain.
- the NK cells are also engineered to express membrane bound IL-15.
- the plurality of T cells are substantially non- alloreactive.
- the non-alloreactive T cells comprise at least one modification to a subunit of a T Cell Receptor (TCR) such that the non-alloreactive T cells do not exhibit alloreactive effects against cells of a recipient subject.
- the T cells are also engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker, which can be selected from CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , EGFR, and combinations thereof.
- CAR chimeric antigen receptor
- the cytotoxic receptor expressed by the NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the cytotoxic receptor is encoded by a polynucleotide having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 145.
- the cytotoxic receptor has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 174 or 899.
- the cytotoxic receptor expressed by the NK cells is directed against CD19. In several embodiments, the cytotoxic receptor expressed by the NK cells has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 . In several embodiments, the CAR expressed by the T cells is directed against CD19. In several embodiments, the CAR expressed by the T cells (and or the NK cells) comprises (i) an tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the polynucleotide encoding the CAR also encodes for membrane bound IL15.
- the anti-CD19 antibody fragment comprises a variable heavy (VH) domain of a single chain Fragment variable (scFv) and a variable light (VL) domain of a scFv.
- VH domain comprises the amino acid sequence of SEQ ID NO: 120 and wherein the VL domain comprises the amino acid sequence of SEQ ID NO: 1 18.
- the NK cells and/or the T cells are further genetically edited to reduce expression of one or more of CIS, TGFBR, B2M, CIITA, TRIM29 and SOCS2 as compared to a non-engineered T cells, or to express CD47 or HLA-E.
- the NK cells and/or the T cells are further genetically edited to disrupt expression of at least one immune checkpoint protein by the cells, wherein the at least one immune checkpoint protein is selected from CTLA4, PD-1 , and lymphocyte activation gene (LAG-3), NKG2A receptor, KIR2DL-1 , KIR2DL-2, KIR2DL-3, KIR2DS-1 and/or KIR2DA-2.
- the at least one immune checkpoint protein is selected from CTLA4, PD-1 , and lymphocyte activation gene (LAG-3), NKG2A receptor, KIR2DL-1 , KIR2DL-2, KIR2DL-3, KIR2DS-1 and/or KIR2DA-2.
- the 0X40 subdomain is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 5.
- the CD3 zeta subdomain is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 7.
- mblL15 is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 1 1 .
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a CRISPR-Cas system.
- the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, and combinations thereof.
- the Cas is Cas9.
- the CRISPR- Cas system comprises a Cas selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1 , Cse2, Csy1 , Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx1 1 , Csx10, Csf1 , and combinations thereof.
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a zinc finger nuclease (ZFN).
- ZFN zinc finger nuclease
- the gene editing of the NK cells and/or the T cells in order to reduce expression and/or the gene editing to induce expression is made using a Transcription activator-like effector nuclease (TALEN).
- TALEN Transcription activator-like effector nuclease
- a mixed population of engineered immune cells for cancer immunotherapy comprising a plurality of NK cells, wherein the plurality of NK cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the NK cells are genetically edited to express reduced levels of cytokine-inducible SH2-containing (CIS) protein encoded by a CISH gene by the cells as compared to a non-engineered NK cell, wherein the reduced CIS expression was engineered through genetic editing of a CISH gene, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to NK cells expressing native levels of CIS, and a plurality of T cells that are substantially non-alloreactive through at least one modification to a subunit of a T Cell Receptor (TCR), wherein the population of T cells is engine
- the cytotoxic signaling complex of the cytotoxic receptor and/or CAR comprises an OX-40 subdomain and a CD3zeta subdomain.
- the NK cells and/or the T cells are engineered to express membrane bound IL-15.
- the cytotoxic receptor expressed by the NK cells has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 174 or 899.
- the cytotoxic receptor expressed by the NK cells has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- the CAR expressed by the T cells has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a cytokine-inducible SH2-containing protein encoded by a CISH gene by the immune cell, genetically modified to reduce the expression of a transforming growth factor beta receptor by the immune cell, genetically modified to reduce the expression of a Natural Killer Group 2, member A (NKG2A) receptor by the immune cell, genetically modified to reduce the expression of a Cbl protooncogene B protein encoded by a CBLB gene by the immune cell, genetically modified to reduce the expression of a tripartite motif-containing protein 29 protein encoded by a TRIM29 gene by the immune cell, and/or genetically modified to reduce the expression of a suppressor of cytokine signaling 2 protein encoded by a SOCS2 gene by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a
- the population comprises, consists of, or consists essentially of Natural Killer cells. In several embodiments, the population further comprises T cells. In several embodiments, the CAR is directed against CD19. In several embodiments, the CAR comprises one or more humanized CDR sequences. In several embodiments, the CAR is directed against an NKG2D ligand. In several embodiments, the genetic modification to the cells is made using a CRISPR-Cas system. In several embodiments, the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, and combinations thereof.
- the Cas is Cas9.
- the modification is to CISH and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 153, 154, 155, 156, or 157;
- the modification is to the TGFBR2 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 147, 148, 149, 150 ,151 , or 152;
- the modification is to NKG2A and the CRISPR- Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO.
- the modification is to CBLB and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 164, 165, or 166; the modification is to TRIM29 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 167, 168, or 169, and/or the modification is to SOCS2 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 171 , 172, or 173.
- the genetic modification(s) is made using a zinc finger nuclease (ZFN). In several embodiments, the genetic modification(s) is made using a Transcription activator-like effector nuclease (TALEN).
- ZFN zinc finger nuclease
- TALEN Transcription activator-like effector nuclease
- the genetically altered immune cells exhibit increased cytotoxicity, increased viability and/or increased anti-tumor cytokine release profiles as compared to unmodified immune cells.
- the genetically altered immune cells have been further genetically modified to reduce alloreactivity against the cells when administered to a subject that was not the donor of the cells.
- a mixed population of immune cells for cancer immunotherapy comprising a population of T cells that are substantially non-alloreactive through at least one modification to a subunit of a T Cell Receptor (TCR) selected from TCRa, TCRp, TCRy, and TCR5 such that the TCR does not recognize major histocompatibility complex differences between the T cells of a recipient subject to which the mixed population of immune cells was administered, wherein the population of T cells is engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker, wherein the tumor marker is selected from the group consisting of CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , EGFR, and combinations thereof; and a population of natural killer (NK) cells, wherein the population of NK cells is engineered to express a chimeric receptor comprising an extracellular ligand binding domain, a transmembrane domain, a cytotoxic
- TCR T Cell Receptor
- the T cells and/or the NK cells are modified such that they express reduced levels of MHC I and/or MHC II molecules and thereby induce reduced immune response from a recipient subject’s immune system to which the NK cells and T cells are allogeneic.
- the MHC I and/or MHC II molecule is beta-microglobulin and/or CIITA (class II major histocompatibility complex transactivator).
- the T cells and/or the NK cells further comprise a modification that disrupts expression of at least one immune checkpoint protein by the T cells and/or the NK cells.
- the at least one immune checkpoint protein is selected from CTLA4, PD-1 , lymphocyte activation gene (LAG-3), NKG2A receptor, KIR2DL-1 , KIR2DL-2, KIR2DL- 3, KIR2DS-1 and/or KIR2DA-2, and combinations thereof.
- the NK cells and/or T cells are further modified to reduce or substantially eliminate expression and/or function of CIS.
- the NK cells are further engineered to express membrane bound IL-15.
- the CAR expressed by the T cells comprises (i) an tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the T cells also express membrane bound IL15.
- mblL15 is encoded by the same polynucleotide encoding the CAR.
- the anti-CD19 antibody comprises a variable heavy (VH) domain of a single chain Fragment variable (scFv) and a variable light (VL) domain of a scFv.
- VH domain comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 120.
- the encoded VL domain comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 1 18.
- the 0X40 subdomain is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 5.
- the CD3 zeta subdomain is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 7.
- mblL15 is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 1 1 .
- the CAR expressed by the T cells has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- chimeric receptor expressed by the NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the NK cells are further engineered to express membrane bound IL15 (which is optionally encoded by the same polynucleotide encoding the chimeric receptor).
- the chimeric receptor is encoded by a polynucleotide having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 145.
- the chimeric receptor has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 174 or 899.
- the modification to the TOR results in at least 80% of the population of T cells not expressing a detectable level of the TOR, but at least 70% of the population of T cells express a detectable level of the CAR.
- the T cells and/or NK cells are further modified to reduce expression of one or more of a B2M surface protein, a cytokine-inducible SH2-containing protein (CIS) encoded by a CISH gene, a transforming growth factor beta receptor, a Natural Killer Group 2, member A (NKG2A) receptor, a Cbl proto-oncogene B protein encoded by a CBLB gene, a tripartite motif-containing protein 29 protein encoded by a TRIM29 gene, a suppressor of cytokine signaling 2 protein encoded by a SOCS2 gene by the T cells and/or NK cells.
- a B2M surface protein a cytokine-inducible SH2-containing protein (CIS) encoded by a CISH gene, a transforming growth factor
- gene editing can reduce expression of any of these target proteins by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- the gene is completely knocked out, such that expression of the target protein is undetectable.
- target protein expression can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- the T cells and/or NK cells are further genetically edited to express CD47.
- the NK cells are further genetically engineered to express HLA-E. Any genes that are knocked in can be knocked in in combination with any of the genes that are knocked out or otherwise disrupted.
- the modification(s) to the TCR, or the further modification of the NK cells or T cells is made using a CRISPR-Cas system.
- the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, and combinations thereof.
- the Cas is Cas9.
- the CRISPR- Cas system comprises a Cas selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1 , Cse2, Csy1 , Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx1 1 , Csx10, Csf1 , and combinations thereof.
- the modification(s) to the TCR, or the further modification of the NK cells or T cells is made using a zinc finger nuclease (ZFN).
- ZFN zinc finger nuclease
- the modification(s) to the TCR, or the further modification of the NK cells or T cells is made using a Transcription activator-like effector nuclease (TALEN).
- a mixed population of immune cells for cancer immunotherapy comprising a population of T cells that are substantially non-alloreactive due to at least one modification to a subunit of a T Cell Receptor (TCR) such that the non-alloreactive T cells do not exhibit alloreactive effects against cells of a recipient subject, wherein the population of T cells is engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker selected from CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , EGFR, and combinations thereof, and a population of natural killer (NK) cells, wherein the population of NK cells is engineered to express a chimeric receptor comprising an extracellular ligand binding domain, a transmembrane domain, a cytotoxic signaling complex and wherein the extracellular ligand binding domain a that is directed against a tumor marker selected from the group consisting of MICA, MICB,
- methods of treating cancer in a subject without inducing graft versus host disease comprising administering to the subject the mixed population of immune cells according to the present disclosure.
- uses of the mixed population of immune cells according to the present disclosure in the treatment of cancer comprising use of the mixed population of immune cells according to the present disclosure in the manufacture of a medicament for the treatment of cancer.
- a method for treating cancer in a subject comprising administering to the subject at least a first dose of a mixed population of immune cells, wherein the mixed population of cells comprises a population of substantially non-alloreactive T cells engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker selected from CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , EGFR, and combinations thereof and a population of natural killer (NK) cells engineered to express a chimeric receptor comprising an extracellular ligand binding domain, a transmembrane domain, a cytotoxic signaling complex and wherein the extracellular ligand binding domain a that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- CAR chimeric antigen receptor
- NK natural killer
- the non-alloreactive T cells comprise at least one modification to a subunit of a T Cell Receptor (TCR) such that the non-alloreactive T cells do not exhibit alloreactive effects against cells of a recipient subject.
- TCR T Cell Receptor
- the CAR expressed by the T cells is directed against CD19.
- the CAR expressed by the T cells comprises (i) an tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the polynucleotide encoding the CAR also encodes membrane bound IL15.
- the anti-CD19 antibody comprises a variable heavy (VH) domain of a single chain Fragment variable (scFv) and a variable light (VL) domain of a scFv.
- VH domain comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 120 and wherein the VL domain comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 1 18.
- the CAR expressed by the T cells has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 178 or 901 .
- the chimeric receptor expressed by the NK cells comprises (i) an NKG2D ligand-binding domain, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co- stimulatory subdomain and a CD3z co-stimulatory subdomain.
- the polynucleotide encoding the chimeric receptor also encodes membrane bound IL15.
- the chimeric receptor is encoded by a polynucleotide having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 145. In several embodiments, the chimeric receptor has at least 95%80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 174 or 899. In several embodiments, the 0X40 subdomain of the CAR and/or chimeric receptor is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 5.
- the CD3 zeta subdomain of the CAR and/or chimeric receptor is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 7.
- the mblL15 expressed by the T cells and/or the NK cells is encoded by a sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO. 1 1 .
- the cytotoxic receptor expressed by immune cells targets CD19 and has at least 80%, 85%, 90%, or 95% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 179, 181 , 183, 185, 187, 189, 191 , 193, 195, and/or 197.
- the CAR expressed by the immune cells targets CD19 and has at least 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and/or any of 900-91 1 .
- a mixed population of immune cells for cancer immunotherapy wherein the mixed population comprises a population of T cells that express a CAR directed against a tumor antigen, the T cells having been genetically modified to be substantially non- alloreactive and a population of NK cells expressing a CAR directed against the same tumor antigen.
- the mixed population comprises a population of T cells that express a CAR directed against a tumor antigen, the T cells having been genetically modified to be substantially non-alloreactive and a population of NK cells expressing a CAR directed against an additional tumor antigen.
- a mixed population of immune cells for cancer immunotherapy wherein the mixed population comprises a population of T cells that are substantially non-alloreactive and a population of NK cells expressing a chimeric receptor targeting a tumor ligand.
- the non-alloreactive T cells comprise at least one modification to a subunit of a T Cell Receptor (TCR) such that the TCR recognizes an antigen without recognition of major histocompatibility complex differences between the T cells of a subject to which the mixed population of immune cells was administered.
- TCR T Cell Receptor
- the population of non-alloreactive T cells is engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker (e.g., a tumor associated antigen or a tumor antigen).
- CAR chimeric antigen receptor
- the CAR can be engineered to target one or more of CD19, CD123, CD70, Her2, mesothelin, Claudin 6 (but not other Claudins), BCMA, PD-L1 , EGFR.
- the population of NK cells is engineered to express a chimeric receptor comprising an extracellular ligand binding domain, a transmembrane domain, a cytotoxic signaling complex and wherein the extracellular ligand binding domain a that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.
- the NK cells can also be engineered to express a CAR, the CAR can be engineered to target one or more of CD19, CD123, CD70, Her2, mesothelin, Claudin 6 (but not other Claudins), BCMA, PD-L1 , EGFR (or any other antigen such that both T cells and NK cells are targeting the same antigen of interest).
- the T cells further comprise a mutation that disrupts expression of at least one immune checkpoint protein by the T cells.
- the T cells may be mutated with respect to an immune checkpoint protein selected from CTLA4, PD-1 and combinations thereof.
- blocking of B7-1/B7-2 to CTLA4 is also used to reduce T cells being maintained in an inactive state.
- T cells are modified such that they express a mismatched or mutated CTLA4, while in some embodiments, an exogenous agent can be used to, for example, bind to and/or otherwise inhibit the ability of B7-1/B7-2 on antigen presenting cells to interact with CTLA4.
- NK cells can be modified to disrupt expression of at least one checkpoint inhibitor.
- CDTLA4 or PD-1 are modified, e.g., mutated, in order to decrease the ability of such checkpoint inhibitors to reduce NK cell cytotoxic responses.
- Lymphocyte activation gene 3 (LAG-3, CD223), is disrupted in NK cells (and/or T cells).
- the inhibitory NKG2A receptor is mutated, knocked-out or inhibited, for example by an antibody.
- Monalizumab by way of non-limiting example, is used in several embodiments to disrupt inhibitory signaling by the NKG2A receptor.
- one or more of the killer inhibitory receptors (KIRs) on a NK cells is disrupted (e.g., through genetic modification) and/or blocked.
- KIRs killer inhibitory receptors
- one or more of KIR2DL-1 , KIR2DL-2, KIR2DL-3, KIR2DS-1 and/or KIR2DA-2 are disrupted or blocked, thereby preventing their binding to HLA-C MHC I molecules.
- TIM3 is modified, mutated (e.g., through gene editing) or otherwise functionally disrupted (e.g., blocked by an antibody) such that its normal function of suppressing the responses of immune cells upon ligand binding is disrupted.
- disruption of TIM3 expression or function e.g., through CRISPr or other methods disclosed herein
- disruption of one or more immune checkpoint modulator, administered T cells and/or NK cells have enhanced anti-tumor activity.
- Tim-3 participates in galectin-9 secretion, the latter functioning to impair the anti-cancer activity of cytotoxic lymphoid cells including natural killer (NK) cells.
- TIM3 is also expressed in a soluble form, which prevents secretion of interleukin-2 (IL-2).
- IL-2 interleukin-2
- the disruption of TIM3, expression, secretion, or pathway functionality provides enhanced T cell and/or NK cell activity.
- TIGIT (also called VSTM3) is modified, mutated (e.g., through gene editing) or otherwise functionally disrupted (e.g., blocked by an antibody) such that its normal function of suppressing the responses of immune cells upon ligand binding is disrupted.
- CD155 is a ligand for TIGIT.
- TIGIT expression is reduced or knocked out.
- TIGIT is blocked by a non-activating ligand or its activity is reduced through a competitive inhibitor of CD155 (that inhibitor not activating TIGIT).
- TIGIT contains an inhibit ITIM motif, which in some embodiments is excised, for example, through gene editing with CRISPr, or other methods disclosed herein. In such embodiments, the function of TIGIT is reduced, which allows for enhanced T cell and/or NK cell activity.
- the adenosine receptor A1 is modified, mutated (e.g., through gene editing) or otherwise functionally disrupted (e.g., blocked by an antibody) such that its normal function of suppressing the responses of immune cells upon ligand binding is disrupted.
- Adenosine signaling is involved in tumor immunity, as a result of its function as an immunosuppressive metabolite.
- the Adenosine Receptor A1 expression is reduced or knocked out.
- the adenosine receptor A1 is blocked by a non-activating ligand or its activity is reduced through a competitive inhibitor of adenosine (that inhibitor not activating adenosine signaling pathways).
- the adenosine receptor is modified, for example, through gene editing with CRISPr, or other methods disclosed herein to reduce its function or expression, which allows for enhanced T cell and/or NK cell activity.
- the TCR subunit modified is selected from TCRa, TCRp, TCRy, and TCR5. In several embodiments, the TCR subunit modified is TCRa.
- the modification to the TCR is made using a CRISPR-Cas system.
- the disruption of expression of at least one immune checkpoint protein by the T cells or NK cells is made using a CRISPR-Cas system.
- a Cas can be selected from Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a, Cas13b, Cas13c, and combinations thereof.
- the Cas is Cas9.
- the CRISPR-Cas system comprises a Cas selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Casl Od, Cse1 , Cse2, Csy1 , Csy2, Csy3, GSU0054, Cast 0, Csm2, Cmr5, Cast 0, Csx1 1 , Csx10, Csf1 , and combinations thereof.
- the modification to the TCR is made using a zinc finger nuclease (ZFN).
- ZFN zinc finger nuclease
- ZFN zinc finger nuclease
- the modification to the TCR is made using a Transcription activator-like effector nuclease (TALEN).
- TALEN Transcription activator-like effector nuclease
- the disruption of expression of the at least one immune checkpoint protein by the T cells or NK cells is made using a Transcription activator-like effector nuclease (TALEN). Combinations of ZFNs and TALENs (and optionally CRISPR-Cas) are used in several embodiments to modify either or both NK cells and T cells.
- either the NK cells, the non-alloreactive T cells, or both are further engineered to express membrane bound IL-15.
- the mixed cell populations are useful in the methods provided for herein, wherein cancer in a subject can be treated without inducing graft versus host disease.
- the methods comprise administering to the subject mixed population of non-alloreactive T cells expressing a CAR and engineered NK cells expressing a chimeric receptor.
- a mixed population of non-alloreactive T cells expressing a CAR and engineered NK cells expressing a chimeric receptor in the treatment of cancer and/or in the manufacture of a medicament for the treatment of cancer.
- the NK cells and T cells are allogeneic with respect to the subject receiving them.
- both the NK cells and T cells are allogeneic with respect to the subject receiving them and are engineered to express a CAR that targets the same antigen - for example CD19.
- the NK cells and T cells are configured to both target cells expressing another marker, such as CD123, CD70, Her2, mesothelin, Claudin 6 (but not other Claudins), BCMA, PD-L1 , EGFR (or any other antigen such that both T cells and NK cells are targeting the same antigen of interest).
- the modification to the TCR results in at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the population of T cells that do not express a detectable level of the TCR, while at the same time at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the population of T cells express a detectable level of the CAR.
- These cells are thus primarily non- alloreactive and armed with an anti-tumor-directed CAR.
- the engineered T cells express a detectable level of the CAR and do not express a detectable level of TCR surface protein or B2M surface protein.
- NK cells are genetically modified to reduce the immune response that an allogeneic host might develop against non-self NK cells.
- the NK cells are engineered such that they exhibit reduced expression of one or more MCH Class I and/or one or more MHC Class II molecule.
- the expression of beta-microglobulin is substantially, significantly or completely reduced in at least a portion of NK cells that express (or will be modified to express) a CAR directed against a tumor antigen, such as CD19 (or any other antigen disclosed herein).
- the expression of CIITA is substantially, significantly or completely reduced in at least a portion of NK cells that express (or will be modified to express) a CAR directed against a tumor antigen, such as CD19 (or any other antigen disclosed herein).
- a tumor antigen such as CD19 (or any other antigen disclosed herein).
- genetically modified NK cells are generated using CRISPr-Cas systems, TALENs, zinc fingers, RNAi, or other gene editing techniques.
- the NK cells with reduced allogenicity are used in combination with non-alloreactive T cells.
- NK cells are modified to express CD47, which aids in the modified NK cell avoiding detection by endogenous innate immune cells of a recipient.
- T cells are modified in a like fashion.
- both NK cells and T cells are modified to express CD47, which aids in NK and/or T cell persistence in a recipient, thus enhancing anti-tumor effects.
- NK cells are modified to express HLA-G, which aids in the modified NK cell avoiding detection by endogenous innate immune cells of a recipient.
- T cells are modified in a like fashion.
- both NK cells and T cells are modified to express HLA-G, which aids in NK and/or T cell persistence in a recipient, thus enhancing anti-tumor effects.
- T cells and NK cells with reduced al loreactivity and engineered to express CARs against the same antigen are used to treat a cancer in an allogeneic patient.
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a transforming growth factor beta receptor by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a Natural Killer Group 2, member A (NKG2A) receptor by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- NSG2A Natural Killer Group 2, member A
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a cytokine-inducible SH2-containing protein encoded by a CISH gene by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- CISH is an inhibitory checkpoint in NK cell-mediated cytotoxicity.
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a Cbl proto-oncogene B protein encoded by a CBLB gene by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- CBLB is an E3 ubiquitin ligase and a negative regulator of NK cell activation.
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a tripartite motif-containing protein 29 protein encoded by a TRIM29 gene by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- TRIM29 is an E3 ubiquitin ligase and a negative regulator of NK cell function after activation.
- a population of genetically altered immune cells for cancer immunotherapy comprising a population of immune cells that are genetically modified to reduce the expression of a suppressor of cytokine signaling 2 protein encoded by a SOCS2 gene by the immune cell, and genetically engineered to express a chimeric antigen receptor (CAR) directed against a tumor marker present on a target tumor cell.
- SOCS2 is a negative regulator of NK cell function.
- the population of genetically altered immune cells comprises NK cells, T cells, or combinations thereof.
- additional immune cell are also included, such as gamma delta T cells, NK T cells, and the like.
- the CAR is directed against CD19.
- the CAR comprises one or more humanized CDR sequences.
- the CAR is directed against CD123.
- the genetically modified cells are engineered to express more than one CAR that is directed to more than one target.
- a mixed population of T cells and NK cells is used, in which the T cell and NK cells can each express at least one CAR, which may or may not be directed against the same cancer marker, depending on the embodiment.
- the cells express a CAR directed against an NKG2D ligand.
- the cells are edited using a CRISPr-based approach.
- the modification is to TGFBR2 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 147, 148, 149, 150 ,151 , or 152 or a sequence that has at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to a sequence comprising a sequence of SEQ ID NO. 147, 148, 149, 150, 151 , or 152.
- the modification is to NKG2A and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO. 158, 159, or 160 or a sequence that has at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to a sequence comprising a sequence of SEQ ID NO. 158, 159, or 160.
- the modification is to CISH and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO.
- the modification is to CBLB and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO.
- the modification is to TRIM29 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO.
- the modification is to SOCS2 and the CRISPR-Cas system is guided by one or more guide RNAs selected from those comprising a sequence of SEQ ID NO.
- the guide RNA is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 ,14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides long.
- a method for producing an engineered T cell suitable for allogenic transplantation comprising delivering to a T cell an RNA-guided nuclease, a gRNA targeting a T Cell Receptor gene, and a vector comprising a donor template that comprises a nucleic acid encoding a CAR, wherein the CAR comprises (i) a tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain, and (iv) membrane bound IL15, wherein the nucleic acid encoding the CAR is flanked by left and right homology arms to the T Cell Receptor gene locus; and (b) expanding the engineered T cells in culture.
- an additional method for an engineered T cell suitable for allogenic transplantation comprising delivering to a T cell an RNA-guided nuclease, and a gRNA targeting a T Cell Receptor gene, in order to disrupt the expression of at least one subunit of the TCR, and delivering to the T cell a vector comprising a nucleic acid encoding a CAR, wherein the CAR comprises (i) a tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain, and (iv) membrane bound IL15 and expanding the engineered T cells in culture.
- the CAR comprises (i) a tumor binding domain that comprises an anti-CD19 antibody fragment, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimul
- a method for producing an engineered T cell suitable for allogenic transplantation comprising delivering to a T cell a nuclease capable of inducing targeted double stranded DNA breaks at a target region of a T Cell Receptor gene, in order to disrupt the expression of at least one subunit of the TCR, delivering to the T cell a vector comprising a nucleic acid encoding a CAR, wherein the CAR comprises (i) a tumor binding domain that comprises an antibody fragment that recognizes one or more of CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, PD-L1 , and EGFR, (ii) a CD8 transmembrane domain, and (iii) a signaling complex that comprises an 0X40 co-stimulatory subdomain and a CD3z co-stimulatory subdomain, and (iv) membrane bound IL15; and expanding the engineered T cells in culture.
- a tumor binding domain that comprises an antibody fragment that recognize
- the method further comprises modifying T-cells by inactivating at least a first gene encoding an immune checkpoint protein.
- the immune checkpoint gene is selected from the group consisting of: PD1 , CTLA-4, LAG3, Tim3, BTLA, BY55, TIGIT, B7H5, LAIR1 , SIGLEC10, and 2B4.
- Methods for treating cancers comprising generating T cells suitable for allogeneic transplant according embodiments disclosed herein, wherein the T cells are from a donor, transducing a population of NK cells expanded from the same donor to express an activating chimeric receptor that comprises an extracellular ligand binding domain a that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 to generate an engineered NK cell population, optionally further expanding the T cells and/or the engineered NK cell population, combining the T cells suitable for allogeneic transplant with the engineered NK cell population, and administering the combined NK and T cell population to a subject allogeneic with respect to the donor.
- Methods for treating cancers comprising generating T cells suitable for allogeneic transplant according embodiments disclosed herein, wherein the T cells are from a donor and are modified to express a CAR directed against CD19, CD123, CD70, Her2, mesothelin, Claudin 6 (but not other Claudins), BCMA, PD-L1 , or EGFR; transducing a population of NK cells expanded from the same donor to express a CAR directed against CD19, CD123, CD70, Her2, mesothelin, Claudin 6 (but not other Claudins), BCMA, PD-L1 , or EGFR to generate an engineered NK cell population, optionally further expanding the T cells and/or the engineered NK cell population, combining the T cells suitable for allogeneic transplant with the engineered NK cell population, and administering the combined NK and T cell population to a subject allogeneic with respect to the donor.
- an additional method for treating a subject for cancer comprising generating T cells suitable for allogeneic transplant according to embodiments disclosed herein, wherein the T cells are from a first donor, transducing a population of NK cells expanded from a second donor to express an activating chimeric receptor that comprises an extracellular ligand binding domain a that is directed against a tumor marker selected from the group consisting of MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 to generate an engineered NK cell population, optionally further expanding the T cells and/or the engineered NK cell population, combining the T cells suitable for allogeneic transplant with the engineered NK cell population, administering the combined NK and T cell population to a subject allogeneic with respect to the first and the second donor.
- an immune cell and also populations of immune cells, that expresses a CD19-directed chimeric receptor, the chimeric receptor comprising an extracellular anti-CD19 binding moiety, a hinge and/or transmembrane domain, and an intracellular signaling domain.
- polynucleotides as well as vectors for transfecting cells with the same) encoding a CD19-directed chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular anti-CD19 binding moiety, a hinge and/or transmembrane domain, and an intracellular signaling domain.
- a polynucleotide encoding a CD19- directed chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular anti-CD19 binding moiety, wherein the anti-CD19 binding moiety comprises a scFv, a hinge, wherein the hinge is a CD8 alpha hinge, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a CD3 zeta ITAM.
- a polynucleotide encoding a CD19- directed chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular anti-CD19 binding moiety, wherein the anti-CD19 binding moiety comprises a variable heavy chain of a scFv or a variable light chain of a scFv, a hinge, wherein the hinge is a CD8 alpha hinge, a transmembrane domain, wherein the transmembrane domain comprises a CD8 alpha transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a CD3 zeta ITAM.
- the transmembrane domain comprises a CD8 alpha transmembrane domain. In several embodiments, the transmembrane domain comprises an NKG2D transmembrane domain. In several embodiments, the transmembrane domain comprises a CD28 transmembrane domain.
- the intracellular signaling domain comprises or further comprises a CD28 signaling domain. In several embodiments, the intracellular signaling domain comprises or further comprises a 4-1 BB signaling domain. In several embodiments, the intracellular signaling domain comprises and/or further comprises 0X40 domain. In several embodiments, the intracellular signaling domain comprises or further comprises a 4-1 BB signaling domain. In several embodiments, the intracellular signaling domain comprises or further comprises a domain selected from ICOS, CD70, CD161 , CD40L, CD44, and combinations thereof.
- the polynucleotide also encodes a truncated epidermal growth factor receptor (EGFRt).
- EGFRt is expressed in a cell as a soluble factor.
- the EGFRt is expressed in a membrane bound form.
- the polynucleotide also encodes membrane-bound interleukin-15 (mblL15).
- engineered immune cells e.g., NK or T cells, or mixtures thereof
- the anti-CD19 binding moiety comprises a heavy chain variable (VH) domain and a light chain variable (VL) domain.
- VH domain has at least 95% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33.
- the VL domain has at least 95% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the anti-CD19 binding moiety is derived from the VH and/or VL sequences of SEQ ID NO: 33 or 32.
- the VH and VL sequences for SEQ ID NO: 33 and/or 32 are subject to a humanization campaign and therefore are expressed more readily and/or less immunogenic when administered to human subjects.
- the anti-CD19 binding moiety comprises a scFv that targets CD19 wherein the scFv comprises a heavy chain variable region comprising the sequence of SEQ ID NO. 35 or a sequence at least 95% identical to SEQ ID NO: 35.
- the anti-CD19 binding moiety comprises an scFv that targets CD19 comprises a light chain variable region comprising the sequence of SEQ ID NO. 36 or a sequence at least 95% identical to SEQ ID NO: 36.
- the anti-CD19 binding moiety comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively) and/or a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively).
- LC CDR1 , LC CDR2, and LC CDR3, respectively a light chain CDR comprising a first, second and third complementarity determining region
- HC CDR1 , HC CDR2, and HC CDR3, respectively a first, second and third complementarity determining region
- various combinations of the LC CDRs and HC CDRs are used.
- the anti- CD19 binding moiety comprises LC CDR1 , LC CDR3, HC CD2, and HC, CDR3.
- the LC CDR1 comprises the sequence of SEQ ID NO.
- the LC CDR2 comprises the sequence of SEQ ID NO. 38 or a or a sequence at least about 95% homologous to the sequence of SEQ NO. 38.
- the LC CDR3 comprises the sequence of SEQ ID NO. 39 or a sequence at least about 95% homologous to the sequence of SEQ NO. 39.
- the HC CDR1 comprises the sequence of SEQ ID NO. 40 or a sequence at least about 95% homologous to the sequence of SEQ NO. 40.
- the HC CDR2 comprises the sequence of SEQ ID NO.
- the HC CDR3 comprises the sequence of SEQ ID NO. 44 or a sequence at least about 95% homologous to the sequence of SEQ NO. 44.
- an anti-CD19 binding moiety that comprises a light chain variable region (VL) and a heavy chain variable region (HL), the VL region comprising a first, second and third complementarity determining region (VL CDR1 , VL CDR2, and VL CDR3, respectively and the VH region comprising a first, second and third complementarity determining region (VH CDR1 , VH CDR2, and VH CDR3, respectively.
- the VL region comprises the sequence of SEQ ID NO. 45, 46, 47, or 48 or a sequence at least about 95% homologous to the sequence of SEQ NO. 45, 46, 47, or 48.
- the VH region comprises the sequence of SEQ ID NO. 49, 50, 51 or 52 or a sequence at least about 95% homologous to the sequence of SEQ NO. 49, 50, 51 or 52.
- an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively.
- the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively.
- the LC CDR1 comprises the sequence of SEQ ID NO. 53 or a sequence at least about 95% homologous to the sequence of SEQ NO. 53.
- the LC CDR2 comprises the sequence of SEQ ID NO.
- the LC CDR3 comprises the sequence of SEQ ID NO. 55 or a sequence at least about 95% homologous to the sequence of SEQ NO. 55.
- the HC CDR1 comprises the sequence of SEQ ID NO. 56 or a sequence at least about 95% homologous to the sequence of SEQ NO. 56.
- the HC CDR2 comprises the sequence of SEQ ID NO. 57 or a sequence at least about 95% homologous to the sequence of SEQ NO. 57.
- the HC CDR3 comprises the sequence of SEQ ID NO. 58 or a sequence at least about 95% homologous to the sequence of SEQ NO. 58.
- the intracellular signaling domain of the chimeric receptor comprises an 0X40 subdomain.
- the intracellular signaling domain further comprises a CD3zeta subdomain.
- the 0X40 subdomain comprises the amino acid sequence of SEQ ID NO: 6 (or a sequence at least about 95% homologous to the sequence of SEQ ID NO. 6) and the CD3zeta subdomain comprises the amino acid sequence of SEQ ID NO: 8 (or a sequence at least about 95% homologous to the sequence of SEQ ID NO: 8).
- the hinge domain comprises a CD8a hinge domain.
- the CD8a hinge domain comprises the amino acid sequence of SEQ ID NO: 2 or a sequence at least about 95% homologous to the sequence of SEQ ID NO: 2).
- the immune cell also expresses membrane-bound interleukin-15 (mblL15).
- mblL15 comprises the amino acid sequence of SEQ ID NO: 12 or a sequence at least about 95% homologous to the sequence of SEQ ID NO: 12.
- the chimeric receptor further comprises an extracellular domain of an NKG2D receptor.
- the immune cell expresses a second chimeric receptor comprising an extracellular domain of an NKG2D receptor, a transmembrane domain, a cytotoxic signaling complex and optionally, mblL15.
- the extracellular domain of the NKG2D receptor comprises a functional fragment of NKG2D comprising the amino acid sequence of SEQ ID NO: 26 or a sequence at least about 95% homologous to the sequence of SEQ ID NO: 26.
- the immune cell engineered to express the chimeric antigen receptor and/or chimeric receptors disclosed herein is an NK cell.
- T cells are used.
- combinations of NK and T cells (and/or other immune cells) are used.
- methods of treating cancer in a subject comprising administering to the subject having an engineered immune cell targeting CD19 as disclosed herein. Also provided for herein is the use of an immune cell targeting CD19 as disclosed herein for the treatment of cancer. Likewise, there is provided for herein the use of an immune cell targeting CD19 as disclosed herein in the preparation of a medicament for the treatment of cancer. In several embodiments, the cancer treated is acute lymphocytic leukemia.
- the immune cell expresses a CD19-directed chimeric receptor comprising an extracellular anti-CD19 moiety, a hinge and/or transmembrane domain, and/or an intracellular signaling domain.
- the immune cell is a natural killer (NK) cell.
- the immune cell is a T cell.
- the hinge domain comprises a CD8a hinge domain. In some embodiments, the hinge domain comprises an Ig4 SH domain.
- the transmembrane domain comprises a CD8a transmembrane domain. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the transmembrane domain comprises a CD3 transmembrane domain.
- the signaling domain comprises an 0X40 signaling domain. In some embodiments, the signaling domain comprises a 4-1 BB signaling domain. In some embodiments, the signaling domain comprises a CD28 signaling domain. In some embodiments, the signaling domain comprises an NKp80 signaling domain. In some embodiments, the signaling domain comprises a CD16 IC signaling domain. In some embodiments, the signaling domain comprises a CD3zeta or CD3 ITAM signaling domain. In some embodiments, the signaling domain comprises an mblL-15 signaling domain. In some embodiments, the signaling domain comprises a 2A cleavage domain. In some embodiments, the mlL-15 signaling domain is separated from the rest or another portion of the CD19-directed chimeric receptor by a 2A cleavage domain.
- Some embodiments relate to a method comprising administering an immune cell as described herein to a subject in need.
- the subject has cancer.
- the administration treats, inhibits, or prevents progression of the cancer.
- Figure 1 depicts non-limiting examples of tumor-directed chimeric antigen receptors.
- Figure 2 depicts additional non-limiting examples of tumor-directed chimeric antigen receptors.
- Figure 3 depicts additional non-limiting examples of tumor-directed chimeric antigen receptors.
- Figure 4 depicts additional non-limiting examples of tumor-directed chimeric antigen receptors.
- Figure 5 depicts additional non-limiting examples of tumor-directed chimeric antigen receptors.
- Figure 6 depicts non-limiting examples of tumor-directed chimeric antigen receptors directed against non-limiting examples of tumor markers.
- Figure 7 depicts additional non-limiting examples of tumor-directed chimeric antigen receptors directed against non-limiting examples of tumor markers.
- Figures 8A-8I schematically depict various pathways that are altered through the gene editing techniques disclosed herein.
- Figure 8A shows a schematic of the inhibitory effects of TGF-beta release by tumor cells in the tumor microenvironment.
- Figure 8B shows a schematic of the CIS/CISH negative regulatory pathways on IL-15 function.
- Figure 8C depicts a non-limiting schematic process flow for generation of a engineered non-alloreactive T cells and engineered NK cells for use in a combination therapy according to several embodiments disclosed herein.
- Figure 8D shows a schematic of the signaling pathways that can lead to graft vs. host disease.
- Figure 8E shows a schematic of how several embodiments disclosed herein can reduce and/or eliminate graft vs. host disease.
- Figure 8F shows a schematic of the signaling pathways that can lead to host vs. graft rejection.
- Figure 8G shows a schematic of several embodiments disclosed herein that can reduce and/or eliminate host vs. graft rejection.
- Figure 8H shows a schematic of how edited immune cells can act against other edited immune cells in mixed cell product.
- Figure 8I shows a schematic of how several embodiments disclosed herein can reduce and/or eliminate host immune effects against edited immune cells.
- Figures 9A-9G show flow cytometry data related to the use of various guide RNAs to reduce expression of TGFBR2 by NK cells.
- Figure 9A shows control data.
- Figure 9B shows data resulting from use of guide RNA 1 ;
- Figure 9C shows data resulting from use of guide RNA 2;
- Figure 9D shows data resulting from use of guide RNA 3;
- Figure 9E shows data resulting from use of guide RNA 1 and guide RNA 2;
- Figure 9F shows data resulting from use of guide RNA 1 and guide RNA 3;
- Figure 9G shows data resulting from use of guide RNA 2 and guide RNA 3.
- Expression was evaluated 7 days after electroporation with the indicated guide RNAs.
- Figures 10A-10G show next generation sequence data related to the reduction of expression of TGFBR2 by NK cells in response to electroporation with various guide RNAs.
- Figure 10A shows control data.
- Figure 10B shows data resulting from use of guide RNA 1 ;
- Figure 10C shows data resulting from use of guide RNA 2;
- Figure 10D shows data resulting from use of guide RNA 3;
- Figure 10E shows data resulting from use of guide RNA 1 and guide RNA 2;
- Figure 10F shows data resulting from use of guide RNA 1 and guide RNA 3;
- Figure 10G shows data resulting from use of guide RNA 2 and guide RNA 3.
- Figures 1 1 A-1 1 D show data comparing the cytotoxicity of NK cells against tumor cells in the presence or absence of TGFbeta after knockdown of TGFBR2 expression by CRISPr/Cas9.
- Figure 1 1 A shows the change in cytotoxicity after TGFBR2 knockdown using guide RNAs 1 and 2.
- Figure 1 1 B shows the change in cytotoxicity after TGFBR2 knockdown using guide RNAs 1 and 3
- Figure 1 1 C shows the change in cytotoxicity after TGFBR2 knockdown using guide RNAs 2 and 3.
- Figure 1 1 D shows data for mock TGFBR2 knockdown.
- Figures 12A-12F show flow cytometry data related to the reduced expression of TGFBR2 by additional guide RNAs.
- Figure 12A shows an unstained control of the same cells expressing TGFBR2.
- Figure 12B shows positive control data for NK cells expressing TGFBR2 in the absence of electroporation with the CRISPr/Cas9 gene editing elements.
- Figure 12C shows knockdown of TGFBR2 expression when guide RNA 4 was used.
- Figure 12D shows knockdown of TGFBR2 expression when guide RNA 5 was used.
- Figure 12E shows knockdown of TGFBR2 expression when guide RNA 6 was used.
- Figure 12F shows knockdown of TGFBR2 expression when a 1 :1 ratio of guide RNA 2 and 3 was used. Data were collected at 4 days post electroporation with the CRISPr/Cas9 gene editing elements.
- Figures 13A-13F show flow cytometry data related to the expression of a non-limiting example of a chimeric antigen receptor (here an anti-CD19 CAR, NK19-1 ) by NK cells when subject to CRISPr/Cas9-mediated knockdown of TGFBR2.
- Figure 13A shows a negative control for NK cells not engineered to express NK19-1 .
- Figure 13B shows positive control data for NK cells engineered to express NK19-1 , but not electroporated with the CRISPr/Cas9 gene editing elements.
- Figure 13C shows data related to NK19-1 expression on NK cells subjected to electroporation with guide RNA 4 to knock down TGFBR2 expression.
- Figure 13D shows data related to NK19-1 expression on NK cells subjected to electroporation with guide RNA 5 to knock down TGFBR2 expression.
- Figure 13E shows data related to NK19-1 expression on NK cells subjected to electroporation with guide RNA 6 to knock down TGFBR2 expression.
- Figure 13F shows data related to NK19-1 expression on NK cells subjected to electroporation with guide RNAs 2 and 3 to knock down TGFBR2 expression. Data were collected at 4 days posttransduction with the vector encoding NK19-1 .
- Figures 14A-14D show data related to the resistance of NK cells expressing a non-limiting example of a CAR (here an anti-CD19 CAR, NK19-1 ) to TGFbeta inhibition as a result of single guide RNA knockdown of TGFBR2 expression.
- Figure 14A shows cytotoxicity of the NK cells against Nalm6 tumor cells where the NK cells were cultured with the Nalm6 cells in TGFbeta in order to recapitulate the tumor microenvironment.
- Figures 14B and 14C show control data (14C) where the TGFB2 receptor was not knocked out and Figure 14C shows selected data curves extracted from 14A in order to show the selected curves more clearly.
- FIG 14D shows a schematic of the treatment of the NK cells.
- NK cells were subject to electroporation with CRISPr/Cas9 and a single guide RNA at Day 0 and were cultured in high IL-2 media for 1 day, followed by low-IL-2 culture with feeder cells (e.g., modified K562 cells expressing, for example, 4-1 BBL and/or mblL15).
- feeder cells e.g., modified K562 cells expressing, for example, 4-1 BBL and/or mblL15.
- NK cells were transduced with a virus encoding the NK19-1 CAR construct.
- the cytotoxicity of the resultant NK cells was evaluated.
- Figures 15A-15D show data related to the enhanced cytokine secretion by primary and NK19-1 -expressing NK cells.
- Figure 15A shows data related to secretion of IFNgamma.
- Figure 15B shows data related to secretion of GM-CSF.
- Figure 15C shows data related to secretion of Granzyme B.
- Figure 15D shows data related to secretion of TNF-alpha.
- Figures 16A-16D show data related to knockout of NKG2A expression by NK cells through use of CRISPr/Cas9.
- Figure 16A shows expression of NKG2A by NK cells subjected to a mock gene editing protocol.
- Figure 16B shows NKG2A expression by NK cells after editing with CRISPr/Cas9 and guide RNA 1 .
- Figure 16C shows NKG2A expression by NK cells after editing with CRISPr/Cas9 and guide RNA 2.
- Figure 16D shows NKG2A expression by NK cells after editing with CRISPr/Cas9 and guide RNA 3.
- Figures 17A-17B show data related to the cytotoxicity of NK cells with knocked-out NKG2A expression (as compared to mock cells).
- Figure 17A shows cytotoxicity of the NKG2A-edited NK cells against REH cells at 7 days post-electroporation with the CRISPr/Cas9 gene editing elements.
- Figure 17B shows flow cytometry data related to the degree of HLA-E expression on REH cells.
- Figure 18 shows data related to the cytotoxicity of mock NK cells or NK cells where Cytokine-inducible SH2-containing protein (CIS) expression was knocked out by gene editing of the CISH gene, which encodes CIS in humans.
- CIS is an inhibitory checkpoint in NK cell-mediated cytotoxicity.
- NK- cell cytotoxicity against REH tumor cells was measured at 7 days post-electroporation with the CRISPr/Cas9 gene editing elements.
- Figures 19A-19E show data related to the impact of CISH-knockout on expression of a non-limiting example of a chimeric antigen receptor construct (here an anti-CD19 CAR, NK19-1 ) by NK cells.
- Figure 19A shows CD19 CAR expression (as measured by FLAG expression, which is included in this construct for detection purposes, while additional embodiments of the CAR do not comprise a tag) in control (untransduced) NK cells.
- Figure 19B shows anti-CD19 CAR expression in NK cells subjected to CISH knockdown using CRISPr/Cas9 and guide RNA 1 .
- Figure 19C shows anti-CD19 CAR expression in NK cells subjected to CISH knockdown using CRISPr/Cas9 and guide RNA 2.
- Figure 19D shows anti- CD19 CAR expression in NK cells subjected to mock gene-editing conditions (electroporation only).
- Figure 19E shows a Western Blot depicting the loss of the CIS protein band at 35kDa, indicating knockout of the CISH gene.
- Figures 20A-20B show data from a cytotoxicity assay using donor NK cells modified through gene editing and/or engineered to express a CAR against Nalm6 tumor cells.
- Figure 20A shows data from a single challenge assay at a 1 :2 effector:target ratio with data collected 7 days post-transduction of the indicated CAR constructs.
- Figure 20B shows data from a double challenge model, where the control, edited, and/or edited/engineered NK cells were challenged with Nalm6 tumor cells at two time points.
- Figures 21 A-21 B show data related CISH knockout NK cell survival and cytotoxicity over extended time in culture.
- Figure 21 A shows NK cell survival data over time when NK cells were treated as indicated.
- Figure 21 B shows NK cell cytotoxicity data against tumor cells after being cultured for 100 days.
- Figures 22A-22E show cytokine release data by NK cells treated with the indicated control, gene editing, or gene editing+engineered to express a CAR conditions.
- Figure 22A shows data related to interferon gamma release.
- Figure 22B shows data related to tumor necrosis factor alpha release.
- Figure 22C shows data related to GM-CSF release.
- Figure 22D shows data related to Granzyme B release.
- Figure 22E shows data related to perforin release.
- Figures 23A-23C show data from a cytotoxicity assay of mock NK cells or NK cells where either Cbl proto-oncogene B (CBLB) or tripartite motif-containing protein 29 (TRIM29) expression was knocked out by CRISPR/Cas9 gene editing.
- Figure 23A shows cytotoxicity data for NK cells knocked out with three different CBLB gRNAs, CISH gRNA 5, or mock NK cells.
- Figure 23B shows cytotoxicity data for NK cells knocked out with three different TRIM19 gRNAs, CISH gRNA 5, or mock NK cells.
- Figure 23C shows the timeline for electroporation and cytotoxicity assay.
- Figures 24A-24C show data from a time course cytotoxicity assay of mock NK cells or NK cells where either suppressor of cytokine signaling 2 (SOCS2) or CISH expression was knocked out by CRISPR/Cas9 gene editing.
- Figure 24A shows time course cytotoxicity data for NK cells knocked out with three different SOCS2 gRNAs, CISH gRNA 2, or CD45 gRNA using the MaxCyte electroporation system.
- Figure 24B shows time course cytotoxicity data for NK cells knocked out with three different SOCs2 gRNAs, CISH gRNA 2 or CD45 gRNA using the Lonza electroporation system.
- Figure 24C shows the timeline for electroporation and cytotoxicity assay.
- Figures 25A-25D show schematic depictions of non-limiting modifications made to CARs according to embodiments disclosed herein.
- Figure 25A shows a non-limiting embodiment in which a single immunosuppressive effector is integrated into the hinge domain of the CAR.
- Figure 25B shows a nonlimiting embodiment in which multiple domains are integrated into the CAR, with a first immunosuppressive effector being of a different type than a second immunosuppressive effector.
- a plurality of immunosuppressive effectors are included (e.g., 2, 3, 4, 5 or more), with the immunosuppressive effectors optionally being the same, or different, from any other immunosuppressive effector in the CAR.
- Figure 25C shows a non-limiting embodiment wherein the immunosuppressive effector is positioned the target binding region (e.g., on the linker between the heavy and light chains of an scFv).
- Figure 25D shows a non-limiting embodiment wherein the immunosuppressive effector is positioned at the N-terminus of a chimeric antigen receptor.
- Figures 26A-26J show schematic depictions of non-limiting modifications made to immune cells, which are optionally allogeneic immune cells.
- Figure 26A shows an immune cell engineered to express an immunosuppressive effector in a membrane-bound format, based on being tethered to a transmembrane protein (or fragment thereof).
- Figure 26B shows an immune cell engineered to express multiple immunosuppressive effectors in a membrane-bound format.
- Figure 26C shows an immune cell engineered to express multiple immunosuppressive effectors in a membrane-bound format, with each of the two effectors differing from one another.
- Figure 26D shows an immune cell engineered to express multiple immunosuppressive effectors tethered to a single transmembrane protein.
- Figure 26E shows an immune cell engineered to express multiple immunosuppressive effectors tethered to a single transmembrane protein, wherein the domains differ from one another.
- Figure 26F shows an immune cell engineered to express multiple immunosuppressive effectors in a membrane-bound format, with each of the two effectors tethered to one of the transmembrane proteins differing from one another.
- Figure 26G shows an immune cell engineered to express a membrane-bound immunosuppressive effector in conjunction with a CAR comprising one or more immunosuppressive effectors (though in some embodiments the CAR does not include an immunosuppressive effector domain).
- Figure 26H shows an immune cell engineered to express two immunosuppressive effectors in a membrane-bound format in conjunction with a CAR comprising one or more immunosuppressive effectors.
- Figure 26I shows an immune cell engineered to express a membrane-bound immunosuppressive effector in conjunction with a CAR comprising one or more immunosuppressive effectors and also to express one or more of HLA-E and/or HLA-G.
- the engineered cells are NK cells that have been gene edited to disrupt B2M expression.
- Figure 26J shows an immune cell engineered to express multiple immunosuppressive effectors, a CAR comprising at least one immunosuppressive effector, as well HLA-E and/or HLA-G, CD47, PD-L1 , and/or the Poliovirus Receptor (PVR). While all are depicted on a single cell, any combination of the immunosuppressive effectors, or any one alone, shown in the Figures or disclosed herein may be used.
- Figures 27A-27JJ depict schematics of non-limiting embodiments of immunosuppressive effector constructs as provided for herein.
- Figure 28 depicts a non-limiting schematic of an immune cell engineered to express a chimeric UL18-B2M construct.
- Figures 29A-29C depict schematic diagrams related to constructs and experimental design disclosed herein.
- Figure 29A shows a schematic diagram of various scenarios in which immunosuppression edits or constructs are made and the resultant self versus non-self outcome.
- Figure 29B shows a schematic of a disulfide trap single chain trimer (dtSCT) used to express various immune evasion peptides (modified from Hansen et al. Current Protocols in Immunology, 2009).
- Figure 29C shows a schematic of an experimental design to assess the efficacy of the hypoimmune constructs provided for herein
- Figures 30A-30C show data related to the survival of B2M knockout T cells (as a percentage of live T cells) after co-culturing with NK cells engineered to express a non-limiting anti-CD19 CAR.
- Figure 30A shows survival levels at an NK:T cell ration of 1 :4.
- Figure 30B shows survival at an NK:T ratio of 1 :2.
- Figure 30C shows survival at an NK:T ratio of 1 :1 .
- Figures 31 A-31 C shows additional data related to HLA-E expression and effectiveness of reducing B2M deficient T cell elimination using T cell from an additional donor.
- Figure 31 A shows T cell survival at an NK:T cell ratio of 1 :4.
- Figure 31 B shows T cell survival at an NK:T cell ratio of 1 :2.
- Figure 31 C shows T cell survival at an NK:T cell ratio of 1 :1 .
- Figure 32 shows a schematic of the pathways by which HLA-E acts on NK cells.
- Figures 33A-33D show data related to expression of NKG2A on NK cells and B2M on T cells for two donors after co-culturing the NK and T cells at various ratios.
- Figure 34 provides phenotypic characteristics around the characteristics of NK cell cells to be tested for their compatibility in a mixed cell product.
- Figure 35 provides phenotypic characteristics around the characteristics of T cells to be tested for their compatibility in a mixed cell product.
- Figures 36A-36F show data related the percentage of B2M-negative cells among live T- cells when T cells expressing an anti-CD19 CAR and engineered for immune evasion according to embodiments disclosed herein are cultured with NK cells at various NK:T cell ratios.
- Figure 36A shows data at an NK:T ratio of 0:1 ;
- Figure 36B shows an NK:T ratio of 1 :4;
- Figure 36C shows an NK:T ratio of 1 :2;
- Figure 36D shows an NK:T ratio of 1 :1 ,
- Figure 36E shows an NK:T ratio of 2:1 , and
- Figure 36F shows an NK:T ratio of 4:1 .
- Figures 36G-36L show data related the percentage of B2M-negative cells among live T- cells when T cells expressing an anti-CD19 CAR and engineered for immune evasion according to embodiments disclosed herein are cultured with NK cells also expressing an anti-CD19 CAR, at various NK:T cell ratios.
- Figure 36G shows data at an NK:T ratio of 0:1 ;
- Figure 36H shows an NK:T ratio of 1 :4;
- Figure 36I shows an NK:T ratio of 1 :2;
- Figure 36J shows an NK:T ratio of 1 :1 ,
- Figure 36K shows an NK:T ratio of 2:1 , and
- Figure 36L shows an NK:T ratio of 4:1 .
- Figures 37A-37F show data related the percentage of B2M-negative cells among live T- cells when T cells (collected from a first donor) expressing an anti-CD19 CAR and engineered for immune evasion according to embodiments disclosed herein are cultured with NK cells also expressing an anti- CD19 CAR, at various NK:T cell ratios.
- Figure 37A shows data at an NK:T ratio of 0:1 ;
- Figure 37B shows an NK:T ratio of 1 :4;
- Figure 37C shows an NK:T ratio of 1 :2;
- Figure 37D shows an NK:T ratio of 1 :1 ,
- Figure 37E shows an NK:T ratio of 2:1 , and
- Figure 37F shows an NK:T ratio of 4:1 .
- Figures 38A-38F show data related the percentage of B2M-negative cells among live T- cells when T cells (collected from a second donor) expressing an anti-CD19 CAR and engineered for immune evasion according to embodiments disclosed herein are cultured with NK cells also expressing an anti-CD19 CAR, at various NK:T cell ratios.
- Figure 38A shows data at an NK:T ratio of 0:1 ;
- Figure 38B shows an NK:T ratio of 1 :4;
- Figure 38C shows an NK:T ratio of 1 :2;
- Figure 38D shows an NK:T ratio of 1 :1 ,
- Figure 38E shows an NK:T ratio of 2:1 , and
- Figure 38F shows an NK:T ratio of 4:1 .
- Figures 39A-39F show data related the percentage of B2M-negative cells among live T- cells when T cells (collected from a third donor) expressing an anti-CD19 CAR and engineered for immune evasion according to embodiments disclosed herein are cultured with NK cells also expressing an anti- CD19 CAR, at various NK:T cell ratios.
- Figure 39A shows data at an NK:T ratio of 0:1 ;
- Figure 39B shows an NK:T ratio of 1 :4;
- Figure 39C shows an NK:T ratio of 1 :2;
- Figure 39D shows an NK:T ratio of 1 :1 ,
- Figure 39E shows an NK:T ratio of 2:1 , and
- Figure 39F shows an NK:T ratio of 4:1 .
- Figures 40A-40F show data related the percentage of B2M-negative cells among live T- cells when T cells (collected from a first donor) expressing an anti-CD19 CAR and engineered for immune evasion (either with a TCR knockout, a TCR knockout and B2M knockout, or A TCR knockout with a B2M knockout and a re-expression of an HLA) are cultured with NK cells also expressing an anti-CD19 CAR, at various NK:T cell ratios.
- Figure 40A shows data at an NK:T ratio of 0:1 ;
- Figure 40B shows an NK:T ratio of 1 :4;
- Figure 40C shows an NK:T ratio of 1 :2;
- Figure 40D shows an NK:T ratio of 1 :1 ,
- Figure 40E shows an NK:T ratio of 2:1 , and
- Figure 40F shows an NK:T ratio of 4:1 .
- Figures 41 A-41 F show data related the percentage of B2M-negative cells among live T- cells when T cells (collected from a first donor) expressing an anti-CD19 CAR and engineered for immune evasion (either with a TCR knockout, a TCR knockout and B2M knockout, or A TCR knockout with a B2M knockout and a re-expression of an HLA) are cultured with NK cells also expressing an anti-CD19 CAR, at various NK:T cell ratios.
- Figure 41 A shows data at an NK:T ratio of 0:1 ;
- Figure 41 B shows an NK:T ratio of 1 :4;
- Figure 41 C shows an NK:T ratio of 1 :2;
- Figure 41 D shows an NK:T ratio of 1 :1 ,
- Figure 41 E shows an NK:T ratio of 2:1 , and
- Figure 41 F shows an NK:T ratio of 4:1 .
- Figures 42A-42B show schematics of various approaches to reduce immune responses against engineered therapeutic cells.
- Figure 42A depicts a schematic of a CAR comprising a hypoimmune domain (HYPO) and various peptides or HLA sequences that are used to reduce immune responses against engineered therapeutic cells.
- Figure 42B depicts various peptides and combinations of peptides that are used to reduce immune responses against engineered therapeutic cells.
- HYPO hypoimmune domain
- Figure 43 shows a schematic of an experimental design that allows for the evaluation of the various hypoimmunity-inducing embodiments disclosed herein.
- Figure 44 shows cytotoxicity data to evaluate hypoimmunity-inducing constructs according to embodiments provided for herein.
- Figures 45A-45C show additional cytotoxicity data collected while evaluating hypoimmunity-inducing constructs according to embodiments provided for herein.
- Figure 45A shows cytotoxicity data using NK cells from a first donor against K562 cells expressing various hypoimmune constructs.
- Figure 45B shows cytotoxicity data using NK cells from an additional donor against K562 cells expressing various hypoimmune constructs.
- Figure 45C shows cytotoxicity data using immortalized NK92 cells against K562 cells expressing various hypoimmune constructs.
- Figure 46 depicts an analysis of NKG2A expression by donor NK cells.
- Figures 47A-47R show experimental setup and data related to cytotoxicity of various immune constructs provided for in embodiments disclosed herein.
- Figure 47A shows a non-limiting schematic of an assay procedure for assessing the immune evasion effects of various constructs provided for in embodiments herein.
- Figure 47B shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a first donor.
- Figure 47C shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47D shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a second donor.
- Figure 47E shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47F shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a third donor.
- Figure 47G shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47H shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a donor.
- Figure 47I shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47J shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a donor.
- Figure 47K shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47L shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a donor.
- Figure 47M shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47N shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a donor.
- Figure 470 shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figure 47P shows a summary tabulation of the screening of the indicated hypoimmune constructs.
- Figure 47Q shows cytotoxicity curves after hypoimmune modified K562 cells were co-cultured with activated NK cells from a donor.
- Figure 47R shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figures 48A-48B show cytotoxicity data from a variety of hypoimmune constructs as provided for herein.
- Figure 48A shows cytotoxicity curves for K562 cells modified to express the indicated immune evasion constructs that were co-cultured with activated donor NK cells.
- Figure 48B shows a histogram depicting the detection of GFP expressed by the modified K562 cells, representing the degree of expression of the indicated hypoimmune construct.
- Figures 49A-49C show data correlating the degree of expression of selected hypoimmune constructs provided for herein with immune protection.
- Figure 49A shows cytotoxicity curves for high HLA- E expressing K562NR cells and low HLA-E expressing K562NR cells as well as a summary table reflecting the relative expression of the HLA-E construct by both sets of cells.
- Figure 49B shows cytotoxicity curves for high CD47 expressing K562NR cells and low CD47 expressing K562NR cells as well as a summary table reflecting the relative expression of the CD47 construct by both sets of cells.
- Figure 49C shows cytotoxicity curves for high CD43_TM expressing K562NR cells and low CD47_TM expressing K562NR cells as well as a summary table reflecting the relative expression of the CD47_TM construct by both sets of cells.
- Figures 50A-50D show data from non-limiting embodiments of combinations of gene edits made to NK cells and the resultant cytotoxicity.
- Figure 50A shows data with the indicated edits made in NK cells and an evaluation of cytotoxicity against target 786-0 cells 14 days after the edits were made.
- Figure 50B shows data corresponding to that shown in Figure 50A, but in the presence of TGFb.
- Figure 50C shows data with the indicated edits made in NK cells and an evaluation of cytotoxicity against target 786-0 cells 21 days after the edits were made.
- Figure 50D shows data corresponding to that shown in Figure 9C, but in the presence of TGFb.
- Figures 51 A-51 D show data from non-limiting embodiments of combinations of gene edits made to NK cells and the resultant cytotoxicity.
- Figure 51 A shows data with the indicated edits made in NK cells and an evaluation of cytotoxicity against target 786-0 cells 14 days after the edits were made.
- Figure 51 B shows data corresponding to that shown in Figure 51 A, but in the presence of TGFb.
- Figure 51 C shows data with the indicated edits made in NK cells and an evaluation of cytotoxicity against target ACHN cells 21 days after the edits were made.
- Figure 51 D shows data corresponding to that shown in Figure 51 C, but in the presence of TGFb.
- Figures 52A-52B show data related to the cytotoxicity of NK cells edited at the indicated genes against target cells.
- Figure 52A shows data with the indicated edits made in NK cells and an evaluation of cytotoxicity against target 786-0 cells 21 days after the edits were made.
- Figure 52B shows data corresponding to that shown in Figure 52A, but in the presence of adenosine.
- Figures 53A-53D show data related to the cytotoxicity of NK cells edited at multiple gene targets.
- Figure 53A shows data related to NK cells edited in the indicated manner and their cytotoxicity against target 786-0 cells 14 days post-edit.
- Figure 53B shows summary data of the traces in Figure 53A.
- Figure 53C shows data related to NK cells edited in the indicated manner and their cytotoxicity against target 786-0 cells 14 days post-edit in the presence of TGFb.
- Figure 53D shows summary data of the traces in Figure 53C.
- Figures 54A-54B show data related to the cytotoxicity of NK cells edited at multiple gene targets.
- Figure 53A shows data related to NK cells edited in the indicated manner and their cytotoxicity against target ACHN cells 14 days post-edit.
- Figure 54B shows data related to NK cells edited in the indicated manner and their cytotoxicity against target ACHN cells 14 days post-edit in the presence of TGFb
- Figures 55A-55D show data related to the cytotoxicity of NK cells edited at multiple gene targets.
- Figure 55A shows data related to NK cells edited in the indicated manner and their cytotoxicity against target 786-0 cells 28 days post-edit.
- Figure 55B shows summary data of the traces in Figure 55A.
- Figure 55C shows data related to NK cells edited in the indicated manner and their cytotoxicity against target 786-0 cells 28 days post-edit in the presence of TGFb.
- Figure 55D shows summary data of the traces in Figure 55C.
- Figures 56A-56D show data related to the cytotoxicity of NK cells edited at multiple gene targets.
- Figure 56A shows data related to NK cells edited in the indicated manner and their cytotoxicity against target ACHN cells 28 days post-edit.
- Figure 56B shows summary data of the traces in Figure 56A.
- Figure 56C shows data related to NK cells edited in the indicated manner and their cytotoxicity against target ACHN cells 28 days post-edit in the presence of TGFb.
- Figure 56D shows summary data of the traces in Figure 56C.
- the engineered cells are engineered in multiple ways, for example, to express a cytotoxicity-inducing receptor complex.
- cytotoxic receptor complexes shall be given its ordinary meaning and shall also refer to (unless otherwise indicated), Chimeric Antigen Receptors (CAR), chimeric receptors (also called activating chimeric receptors in the case of NKG2D chimeric receptors).
- the cells are further engineered to achieve a modification of the reactivity of the cells against non-tumor tissue.
- non- alloreactive T cells can also be engineered to express a chimeric antigen receptor (CAR) that enables the non-alloreactive T cells to impart cytotoxic effects against tumor cells.
- CAR chimeric antigen receptor
- NK natural killer cells are also engineered to express a city-inducing receptor complex (e.g., a chimeric antigen receptor or chimeric receptor).
- combinations of these engineered immune cell types are used in immunotherapy, which results in both a rapid (NK-cell based) and persistent (T-cell based) anti-tumor effect, all while advantageously having little to no graft versus host disease.
- Some embodiments include methods of use of the compositions or cells in immunotherapy.
- anticancer effect refers to a biological effect which can be manifested by various means, including but not limited to, a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, and/or amelioration of various physiological symptoms associated with the cancerous condition.
- an immune cell such as a T cell
- an immune cell such as a T cell
- Additional embodiments relate to engineering a second set of cells to express another cytotoxic receptor complex, such as an NKG2D chimeric receptor complex as disclosed herein.
- Still additional embodiments relate to the further genetic manipulation of T cells (e.g., donor T cells) to reduce, disrupt, minimize and/or eliminate the ability of the donor T cell to be alloreactive against recipient cells (graft versus host disease).
- Targeted therapy is a cancer treatment that employs certain drugs that target specific genes or proteins found in cancer cells or cells supporting cancer growth, (like blood vessel cells) to reduce or arrest cancer cell growth.
- genetic engineering has enabled approaches to be developed that harness certain aspects of the immune system to fight cancers.
- a patient’s own immune cells are modified to specifically eradicate that patient’s type of cancer.
- Various types of immune cells can be used, such as T cells, Natural Killer (NK cells), or combinations thereof, as described in more detail below.
- CAR chimeric antigen receptors
- some embodiments include a polynucleotide, polypeptide, or vector that encodes, for example a chimeric antigen receptor directed against a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among others, to facilitate targeting of an immune cell to a cancer and exerting cytotoxic effects on the cancer cell.
- a chimeric antigen receptor directed against a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among others.
- engineered immune cells e.g., T cells or NK cells expressing such CARs.
- polynucleotides, polypeptides, and vectors that encode a construct comprising an extracellular domain comprising two or more subdomains, e.g., first CD19-targeting subdomain comprising a CD19 binding moiety as disclosed herein and a second subdomain comprising a C-type lectin-like receptor and a cytotoxic signaling complex.
- engineered immune cells e.g., T cells or NK cells
- Methods of treating cancer and other uses of such cells for cancer immunotherapy are also provided for herein.
- polynucleotides, polypeptides, and vectors that encode chimeric receptors that comprise a target binding moiety (e.g., an extracellular binder of a ligand expressed by a cancer cell) and a cytotoxic signaling complex are also provided for herein.
- some embodiments include a polynucleotide, polypeptide, or vector that encodes, for example an activating chimeric receptor comprising an NKG2D extracellular domain that is directed against a tumor marker, for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others, to facilitate targeting of an immune cell to a cancer and exerting cytotoxic effects on the cancer cell.
- engineered immune cells e.g., T cells or NK cells expressing such chimeric receptors.
- polynucleotides, polypeptides, and vectors that encode a construct comprising an extracellular domain comprising two or more subdomains, e.g., first and second ligand binding receptor and a cytotoxic signaling complex.
- engineered immune cells e.g., T cells or NK cells
- expressing such bi-specific constructs in some embodiments the first and second ligand binding domain target the same ligand.
- cells of the immune system are engineered to have enhanced cytotoxic effects against target cells, such as tumor cells.
- a cell of the immune system may be engineered to include a tumor-directed chimeric receptor and/or a tumor-directed CAR as described herein.
- white blood cells or leukocytes are used, since their native function is to defend the body against growth of abnormal cells and infectious disease.
- white bloods cells include granulocytes and agranulocytes (presence or absence of granules in the cytoplasm, respectively).
- Granulocytes include basophils, eosinophils, neutrophils, and mast cells.
- Agranulocytes include lymphocytes and monocytes.
- Cells such as those that follow or are otherwise described herein may be engineered to include a chimeric receptor, such as an NKG2D chimeric receptor, and/or a CAR, such as a CD19-directed CAR, or a nucleic acid encoding the chimeric receptor or the CAR.
- the cells are optionally engineered to co-express a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- the cells particularly T cells, are further genetically modified to reduce and/or eliminate the alloreactivity of the cells.
- Monocytes are a subtype of leukocyte. Monocytes can differentiate into macrophages and myeloid lineage dendritic cells. Monocytes are associated with the adaptive immune system and serve the main functions of phagocytosis, antigen presentation, and cytokine production. Phagocytosis is the process of uptake of cellular material, or entire cells, followed by digestion and destruction of the engulfed cellular material. In several embodiments, monocytes are used in connection with one or more additional engineered cells as disclosed herein. Some embodiments of the methods and compositions described herein relate to a monocyte that includes a tumor-directed CAR, or a nucleic acid encoding the tumor- directed CAR.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membranebound interleukin 15 (mblL15) co-stimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membranebound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membranebound interleukin 15
- Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- an activating chimeric receptor that targets a ligand on a tumor cell
- MICA activating chimeric receptor that targets a ligand on a tumor cell
- mblL15 membrane-bound interleukin 15
- Lymphocytes the other primary sub-type of leukocyte include T cells (cell-mediated, cytotoxic adaptive immunity), natural killer cells (cell-mediated, cytotoxic innate immunity), and B cells (humoral, antibody-driven adaptive immunity). While B cells are engineered according to several embodiments, disclosed herein, several embodiments also relate to engineered T cells or engineered NK cells (mixtures of T cells and NK cells are used in some embodiments, either from the same donor, or different donors).
- lymphocytes engineered to express a CAR that targets a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membranebound interleukin 15 (mblL15) co-stimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membranebound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membranebound interleukin 15
- lymphocytes engineered to express an activating chimeric receptor that targets a ligand on a tumor cell for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- an activating chimeric receptor that targets a ligand on a tumor cell
- MICA activating chimeric receptor that targets a ligand on a tumor cell
- MICB ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membrane-bound interleukin 15
- T cells are distinguishable from other lymphocytes sub-types (e.g., B cells or NK cells) based on the presence of a T-cell receptor on the cell surface.
- T cells can be divided into various different subtypes, including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cell, mucosal associated invariant T cells and gamma delta T cells.
- a specific subtype of T cell is engineered.
- a mixed pool of T cell subtypes is engineered.
- specific techniques such as use of cytokine stimulation are used to enhance expansion/collection of T cells with a specific marker profile.
- activation of certain human T cells e.g. CD4+ T cells, CD8+ T cells is achieved through use of CD3 and/or CD28 as stimulatory molecules.
- a method of treating or preventing cancer or an infectious disease comprising administering a therapeutically effective amount of T cells expressing the cytotoxic receptor complex and/or a homing moiety as described herein.
- the engineered T cells are autologous cells, while in some embodiments, the T cells are allogeneic cells.
- T cells engineered to express a CAR that targets a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others as disclosed herein, and a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others as disclosed herein, and a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membrane-bound interleukin 15
- T cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- a method of treating or preventing cancer or an infectious disease comprising administering a therapeutically effective amount of natural killer (NK) cells expressing the cytotoxic receptor complex and/or a homing moiety as described herein.
- the engineered NK cells are autologous cells, while in some embodiments, the NK cells are allogeneic cells.
- NK cells are preferred because the natural cytotoxic potential of NK cells is relatively high.
- it is unexpectedly beneficial that the engineered cells disclosed herein can further upregulate the cytotoxic activity of NK cells, leading to an even more effective activity against target cells (e.g., tumor or other diseased cells).
- NK cells engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membrane-bound interleukin 15
- NK cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- the NK cells are derived from cell line NK-92.
- NK-92 cells are derived from NK cells, but lack major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors.
- NK-92 cells described herein related to NK-92 cell engineered to silence certain additional inhibitory receptors, for example, SMAD3, allowing for upregulation of interferon-y (I FNy) , granzyme B, and/or perforin production. Additional information relating to the NK-92 cell line is disclosed in WO 1998/49268 and U.S. Patent Application Publication No. 2002-0068044 and incorporated in their entireties herein by reference.
- NK-92 cells are used, in several embodiments, in combination with one or more of the other cell types disclosed herein.
- NK-92 cells are used in combination with NK cells as disclosed herein.
- NK-92 cells are used in combination with T cells as disclosed herein.
- hematopoietic stem cells are used in the methods of immunotherapy disclosed herein.
- the cells are engineered to express a homing moiety and/or a cytotoxic receptor complex.
- HSCs are used, in several embodiments, to leverage their ability to engraft for long-term blood cell production, which could result in a sustained source of targeted anti-cancer effector cells, for example to combat cancer remissions. In several embodiments, this ongoing production helps to offset anergy or exhaustion of other cell types, for example due to the tumor microenvironment.
- allogeneic HSCs are used, while in some embodiments, autologous HSCs are used.
- HSCs are used in combination with one or more additional engineered cell type disclosed herein.
- a stem cell such as a hematopoietic stem cell engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) costimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) costimulatory domain.
- mblL15 membrane-bound interleukin 15
- hematopoietic stem cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- iPSCs induced pluripotent stem cells
- iPSCs are used in the method of immunotherapy disclosed herein.
- iPSCs are used, in several embodiments, to leverage their ability to differentiate and derive into non-pluripotent cells, including, but not limited to, CD34 cells, hemogenic endothelium cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic multipotent progenitor cells, T cell progenitors, NK cell progenitors, T cells, NKT cells, NK cells, and B cells comprising one or several genetic modifications at selected sites through differentiating iPSCs or less differentiated cells comprising the same genetic modifications at the same selected sites.
- the iPSCs are used to generate iPSC-derived NK or T cells.
- the cells are engineered to express a homing moiety and/or a cytotoxic receptor complex.
- iPSCs are used in combination with one or more additional engineered cell type disclosed herein.
- a stem cell such as a induced pluripotent stem cell engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- a tumor marker for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- mblL15 membrane-bound interleukin 15
- induced pluripotent stem cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mblL15) co-stimulatory domain.
- Additional cellular engineering strategies are provided for herein that serve to further enhance the persistence of allogeneic cellular therapy products, such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells.
- allogeneic cellular therapy products such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells.
- a population of genetically engineered immune cells for cancer immunotherapy where the genetically engineered immune cells are genetically modified (e.g., gene edited) at one, two, three or more gene loci to enhance the cytotoxic activity, persistence, or other feature of the cells, such as NK cells and/or T cells.
- NK cells are used for immunotherapy.
- gene editing of the NK cell can advantageously impart to the edited NK cell the ability to resist and/or overcome various inhibitory signals that are generated in the tumor microenvironment. It is known that tumors generate a variety of signaling molecules that are intended to reduce the anti-tumor effects of immune cells. As discussed in more detail below, in several embodiments, gene editing of the NK cell limits this tumor microenvironment suppressive effect on the NK cells, T cells, combinations of NK and T cells, or any edited/engineered immune cell provided for herein.
- gene editing is employed to reduce or knockout expression of target proteins, for example by disrupting the underlying gene encoding the protein.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- the gene is completely knocked out, such that expression of the target protein is undetectable.
- gene editing is used to “knock in” or otherwise enhance expression of a target protein.
- expression of a target protein can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- sequences provided for guide RNAs that are recited using deoxyribonucleotides refer to the target DNA and shall be considered as also referencing those guides used in practice (e.g., employing ribonucleotides, where the ribonucleotide uracil is used in lieu of deoxyribonucleotide thymine or vice-versa where thymine is used in lieu of uracil, wherein both are complementary base pairs to adenine when reciting either an RNA or DNA sequence).
- a gRNA with the sequence ATGCTCAATGCGTC shall also refer to the following sequence AUGCUCAAUGCGUC (SEQ ID NO: 996) or a gRNA with sequence AUGCUCAAUGCGUC (SEQ ID NO: 996) shall also refer to the following sequence ATGCTCAATGCGTC (SEQ ID NO: 995).
- TGF-beta is one such cytokine released by tumor cells that results in immune suppression within the tumor microenvironment. That immune suppression reduces the ability of immune cells, even engineered CAR-immune cells is some cases, to destroy the tumor cells, thus allowing for tumor progression.
- immune checkpoint inhibitors are disrupted through gene editing.
- blockers of immune suppressing cytokines in the tumor microenvironment are used, including blockers of their release or competitive inhibitors that reduce the ability of the signaling molecule to bind and inhibit an immune cell.
- Such signaling molecules include, but are not limited to TGF-beta, IL10, arginase, inducible NOS, reactive- NOS, Arg1 , Indoleamine 2,3-dioxygenase (IDO), and PGE2.
- immune cells such as NK cells, wherein the ability of the NK cell (or other cell) to respond to a given immunosuppressive signaling molecule is disrupted and/or eliminated.
- NK cells or T cells are genetically edited to become have reduced sensitivity to TGF-beta.
- TGF-beta is an inhibitor of NK cell function on at least the levels of proliferation and cytotoxicity.
- the expression of the TGF-beta receptor is knocked down or knocked out through gene editing, such that the edited NK is resistant to the immunosuppressive effects of TGF-beta in the tumor microenvironment.
- the TGFB2 receptor is knocked down or knocked out through gene editing, for example, by use of CRISPR-Cas editing. Small interfering RNA, antisense RNA, TALENs or zinc fingers are used in other embodiments.
- TGF-beta receptors e.g., TGF-beta 1 and/or TGF- beta 3 are edited in some embodiments.
- TGF-beta receptors in T cells are knocked down through gene editing.
- cytokines impart either negative (as with TGF-beta above) or positive signals to immune cells.
- IL15 is a positive regulator of NK cells, which as disclosed herein, can enhance one or more of NK cell homing, NK cell migration, NK cell expansion/proliferation, NK cell cytotoxicity, and/or NK cell persistence.
- a cytokine-inducible SH2-containing protein acts as a critical negative regulator of IL-15 signaling in NK cells.
- editing CISH enhances the functionality of NK cells across multiple functionalities, leading to a more effective and long-lasting NK cell therapeutic.
- inhibitors of CIS are used in conjunction with engineered NK cell administration.
- the CIS expression is knocked down or knocked out through gene editing of the CISH gene, for example, by use of CRISPR-Cas editing. Small interfering RNA, antisense RNA, TALENs or zinc fingers are used in other embodiments.
- CIS expression in T cells is knocked down through gene editing.
- CISH gene editing endows an NK cell with enhanced proliferative ability which in several embodiments, allows for generation of robust NK cell numbers from a donor blood sample.
- NK cells edited for CISH and engineered to express a CAR are more readily, robustly, and consistently expanded in culture.
- CISH gene editing endows an NK cell with enhanced cytotoxicity.
- the editing of CISH synergistically enhances the cytotoxic effects of engineered NK cells and/or engineered T cells that express a CAR.
- CISH gene editing activates or inhibits a wide variety of pathways.
- the CIS protein is a negative regulator of IL15 signaling by way of, for example, inhibiting JAK-STAT signaling pathways. These pathways would typically lead to transcription of IL15-responsive genes (including CISH).
- knockdown of CISH disinhibits JAK-STAT (e.g., JAK1 -STAT5) signaling and there is enhanced transcription of IL15-responsive genes.
- knockout of CISH yields enhanced signaling through mammalian target of rapamycin (mTOR), with corresponding increases in expression of genes related to cell metabolism and respiration.
- mTOR mammalian target of rapamycin
- knockout of CISH yields IL15 induced increased expression of IL-2Ra (CD25), but not IL-15Ra or IL- 2/15Rp, enhanced NK cell membrane binding of IL15 and/or IL2, increased phosphorylation of STAT-3 and/or STAT-5, and elevated expression of the antiapoptotic proteins, such as Bcl-2.
- CISH knockout results in IL15-induced upregulation of selected genes related to mitochondrial functions (e.g., electron transport chain and cellular respiration) and cell cycle.
- knockout of CISH by gene editing enhances the NK cell cytotoxicity and/or persistence, at least in part via metabolic reprogramming.
- negative regulators of cellular metabolism such as TXNIP
- TXNIP negative regulators of cellular metabolism
- promotors for cell survival and proliferation including BIRC5 (Survivin), TOP2A, CKS2, and RACGAP1 are upregulated after CISH knockout, whereas antiproliferative or proapoptotic proteins such as TGFB1 , ATM, and PTCH1 are downregulated.
- CISH knockout alters the state (e.g., activates or inactivates) signaling via or through one or more of CXCL-10, IL2, TNF, I FNg , IL13, IL4, Jnk, PRF1 , STAT5, PRKCQ, IL2 receptor Beta, SOCS2, MYD88, STAT3, STAT1 , TBX21 , LCK, JAK3, IL& receptor, ABL1 , IL9, STAT5A, STAT5B, Tcf7, PRDM1 , and/or EOMES.
- gene editing of the immune cells can also provide unexpected enhancement in the expansion, persistence and/or cytotoxicity of the edited immune cell.
- engineered cells e.g., those expressing a CAR
- the edits allow for unexpectedly improved NK cell expansion, persistence and/or cytotoxicity.
- knockout of CISH expression in NK cells removes a potent negative regulator of IL15-mediated signaling in NK cells, disinhibits the NK cells and allows for one or more of enhanced NK cell homing, NK cell migration, activation of NK cells, expansion, cytotoxicity and/or persistence.
- the editing can enhance NK and/or T cell function in the otherwise suppressive tumor microenvironment.
- CISH gene editing results in enhanced NK cell expansion, persistence and/or cytotoxicity without requiring Notch ligand being provided exogenously.
- T cells that are engineered to express a CAR or chimeric receptor are employed in several embodiments.
- T cells express a T Cell Receptor (TCR) on their surface.
- TCR T Cell Receptor
- autologous immune cells are transferred back into the original donor of the cells.
- immune cells such as NK cells or T cells are obtained from patients, expanded, genetically modified (e.g., with a CAR or chimeric receptor) and/or optionally further expanded and re-introduced into the patient.
- allogeneic immune cells are transferred into a subject that is not the original donor of the cells.
- immune cells, such as NK cells or T cells are obtained from a donor, expanded, genetically modified (e.g., with a CAR or chimeric receptor) and/or optionally further expanded and administered to the subject.
- Allogeneic immunotherapy presents several hurdles to be overcome.
- the administered allogeneic cells are rapidly rejected, known as host versus graft rejection (HvG). This substantially limits the efficacy of the administered cells, particularly their persistence.
- allogeneic cells are able to engraft.
- the administered cells comprise a T cell (several embodiments disclosed herein employ mixed populations of NK and T cells), the endogenous T cell receptor (TCR) specificities recognize the host tissue as foreign, resulting in graft versus host disease (GvHD). GvHD can lead to significant tissue damage in the host (cell recipient).
- gene edits can advantageously help to reduce and/or avoid graft vs. host disease (GvHD).
- GvHD graft vs. host disease
- Figure 8C A non-limiting embodiment of such an approach, using a mixed population of NK cell and T cells, is schematically illustrated in Figure 8C, wherein the NK cells are engineered to express a CAR and the T cells are engineered to not only express a CAR, but also edited to render the T cells non-alloreactive.
- Figure 8D schematically shows a mechanism by which graft v. host disease occurs.
- T cell and an allogeneic NK cell both engineered to express a CAR that targets the tumor, are introduced into a host.
- the T cell still bears the native T-cell receptor (TCR).
- TCR T-cell receptor
- This TCR recognizes the HLA type of the host cell as “non-self” and can exert cytotoxicity against host cells.
- Figure 8E shows a non-limiting embodiment of how graft v. host disease can be reduced or otherwise avoided through gene editing of the T cells. Briefly, as this approach is discussed in more detail below, gene editing can be performed in order to knockout the native TCR on T cells.
- T cells are subjected to gene editing to either reduce functionality of and/or reduce or eliminate expression of the native T cell.
- CRISPR is used to knockout the TCR.
- T cell receptors are cell surface receptors that participate in the activation of T cells in response to the presentation of an antigen.
- the TCR is made up of two different protein chains (it is a heterodimer).
- the majority of human T cells have TCRs that are made up of an alpha (a) chain and a beta (p) chain (encoded by separate genes).
- a small percentage of T cells have TCRs made up of gamma and delta (y/5) chains (the cells being known as gamma-delta T cells).
- T cells are activated by processed peptide fragments in association with an MHC molecule. This is known as MHC restriction.
- MHC restriction When the TCR recognizes disparities between the donor and recipient MHC, that recognition stimulates T cell proliferation and the potential development of GVHD.
- the genes encoding either the TCRa, TCRp, TCRy, and/or the TCE5 are disrupted or otherwise modified to reduce the tendency of donor T cells to recognize disparities between donor and host MHC, thereby reducing recognition of alloantigen and GVHD.
- T-cell mediated immunity involves a balance between co-stimulatory and inhibitory signals that serve to fine-tune the immune response.
- Inhibitory signals also known as immune checkpoints, allow for avoidance of auto-immunity (e.g., self-tolerance) and also limit immune-mediated damage.
- Immune checkpoint protein expression are often altered by tumors, enhancing immune resistance in tumor cells and limiting immunotherapy efficacy.
- CTLA4 downregulates the amplitude of T cell activation.
- PD1 limits T cell effector functions in peripheral tissue during an inflammatory response and also limits autoimmunity.
- Immune checkpoint blockade helps to overcome a barriers to activation of functional cellular immunity.
- antagonistic antibodies specific for inhibitory ligands on T cells including Cytotoxic-T-lymphocyte-associated antigen 4 (CTLA-4; also known as CD152) and programmed cell death protein 1 (PD1 or PDCD1 also known as CD279) are used to enhance immunotherapy.
- CTL-4 Cytotoxic-T-lymphocyte-associated antigen 4
- PD1 or PDCD1 programmed cell death protein 1
- T cells that are non- alloreactive and highly active.
- the T cells are further modified such that certain immune checkpoint genes are inactivated, and the immune checkpoint proteins are thus not expressed by the T cell. In several embodiments, this is done in the absence of manipulation or disruption of the CD3z signaling domain (e.g., the TCRs are still able initiate T cell signaling).
- genetic inactivation of TCRalpha and/or TCRbeta coupled with inactivation of immune checkpoint genes in T lymphocytes derived from an allogeneic donor significantly reduces the risk of GVHD. In several embodiments, this is done by eliminating at least a portion of one or more of the substituent protein chains (alpha, beta, gamma, and/or delta) responsible for recognition of MHC disparities between donor and recipient cells. In several embodiments, this is done while still allowing for T cell proliferation and activity.
- the receiving subject may receive some other adjunct treatment to support or otherwise enhance the function of the administered immune cells.
- the subject may be pre-conditioned (e.g., with radiation or chemotherapy).
- the adjunct treatment comprises administration of lymphocyte growth factors (such as IL-2).
- editing can improve persistence of administered cells (whether NK cells, T cells, or otherwise) for example, by masking cells to the host immune response.
- a recipient’s immune cells will attack donor cells, especially from an allogeneic donor, known as Host vs. Graft disease (HvG).
- Figure 8F shows a schematic representation of HvG, where the host T cells, with a native/functional TCR identify HLA on donor T and/or donor NK cells as non-self. In such cases, the host T-cell TCR binding to allogeneic cell HLA leads to elimination of allogeneic cells, thus reducing the persistence of the donor engineered NK/T cells.
- glucocorticoids include, but are not limited to beclomethasone, betamethasone, budesonide, cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone, among others.
- Activation of the glucocorticoid receptor in recipient’s own T cells alters expression of genes involved in the immune response and results in reduced levels of cytokine production, which translates to T cell anergy and interference with T cell activation (in the recipient).
- inventions relate to administration of antibodies that can deplete certain types of the recipients immune cells.
- One such target is CD52, which is expressed at high levels on T and B lymphocytes and lower levels on monocytes while being absent on granulocytes and bone marrow precursors.
- Immunosuppressive drugs may limit the efficacy of administered allogeneic engineered T cells. Therefore, as disclosed herein, several embodiments relate to genetically engineered allogeneic donor cells that are resistant to immunosuppressive treatment.
- immune cells such as NK cells and/or T cells are edited (in addition to being engineered to express a CAR) to extend their persistence by avoiding cytotoxic responses from host immune cells.
- gene editing to remove one or more HLA molecules from the allogeneic NK and/or T cells reduce elimination by host T-cells.
- the allogeneic NK and/or T cells are edited to knock out one or more of beta-2 microglobulin (an HLA Class I molecule) and CIITA (an HLA Class II molecule).
- Figure 8G schematically depicts this approach.
- the populations of engineered cells actually target one another, for example when the therapeutic cells are edited to remove HLA molecules in order to avoid HvG.
- Such editing of, for example CAR T cells can result in the vulnerability of the edited allogeneic CAR T cells to cytotoxic attack by the CAR NK cells as well as elimination by host NK cells. This is caused by the missing “self” inhibitory signals generally presented by KIR molecules.
- Figure 8H schematically depicts this process.
- gene editing can be used to knock in expression of one or more “masking” molecules which mask the allogeneic cells from the host immune system and from fratricide by other administered engineered cells.
- Figure 81 schematically depicts this approach.
- proteins can be expressed on the surface of the allogeneic cells to inhibit targeting by NKs (both engineered NKs and host NKs), which advantageously prolongs persistence of both allogeneic CAR-Ts and CAR-NKs.
- gene editing is used to knock in CD47, expression of which effectively functions as a “don’t eat me” signal.
- gene editing is used to knock in expression of HLA-E. HLA-E binds to both the inhibiting and activating receptors NKG2A and NKG2C, respectively that exist on the surface of NK cells.
- NKG2A is expressed to a greater degree in most human NK cells, thus, in several embodiments, expression of HLA-E on engineered cells results in an inhibitory effect of NK cells (both host and donor) against such cells edited to (or naturally expressing) HLA-E.
- one or more viral HLA homologs are knocked in such that they are expressed by the engineered NK and/or T cells, thus conferring on the cells the ability of viruses to evade the host immune system.
- these approaches advantageously prolong persistence of both allogeneic CAR-Ts and CAR-NKs.
- genetic editing is accomplished through targeted introduction of DNA breakage, and subsequent DNA repair mechanism.
- double strand breaks of DNA are repaired by non-homologous end joining (NHEJ), wherein enzymes are used to directly join the DNA ends to one another to repair the break.
- NHEJ non-homologous end joining
- double strand breaks are repaired by homology directed repair (HDR), which is advantageously more accurate, thereby allowing sequence specific breaks and repair.
- HDR uses a homologous sequence as a template for regeneration of missing DNA sequences at the break point, such as a vector with the desired genetic elements (e.g., an insertion element to disrupt the coding sequence of a TCR) within a sequence that is homologous to the flanking sequences of a double strand break. This will result in the desired change (e.g., insertion) being inserted at the site of the DSB.
- a homologous sequence as a template for regeneration of missing DNA sequences at the break point, such as a vector with the desired genetic elements (e.g., an insertion element to disrupt the coding sequence of a TCR) within a sequence that is homologous to the flanking sequences of a double strand break. This will result in the desired change (e.g., insertion) being inserted at the site of the DSB.
- the desired genetic elements e.g., an insertion element to disrupt the coding sequence of a TCR
- gene editing is accomplished by one or more of a variety of engineered nucleases.
- restriction enzymes are used, particularly when double strand breaks are desired at multiple regions.
- a bioengineered nuclease is used.
- ZFN Zinc Finger Nuclease
- TALEN transcription-activator like effector nuclease
- CRISPR/Cas9 clustered regularly interspaced short palindromic repeats
- Meganucleases are characterized by their capacity to recognize and cut large DNA sequences (from 14 to 40 base pairs).
- a meganuclease from the LAGLIDADG family is used, and is subjected to mutagenesis and screening to generate a meganuclease variant that recognizes a unique sequence(s), such as a specific site in the TCR, or CISH, or any other target gene disclosed herein.
- Target sites in the TCR can readily be identified. Further information of target sites within a region of the TCR can be found in US Patent Publication No. 2018/0325955, and US Patent Publication No. 2015/0017136, each of which is incorporated by reference herein in its entirety.
- two or more meganucleases, or functions fragments thereof are fused to create a hybrid enzymes that recognize a desired target sequence within the target gene (e.g., CISH).
- ZFNs and TALEN function based on a non-specific DNA cutting catalytic domain which is linked to specific DNA sequence recognizing peptides such as zinc fingers or transcription activator-like effectors (TALEs).
- TALEs transcription activator-like effectors
- the ZFNs and TALENs thus allow sequence-independent cleavage of DNA, with a high degree of sequence-specificity in target recognition.
- Zinc finger motifs naturally function in transcription factors to recognize specific DNA sequences for transcription. The C-terminal part of each finger is responsible for the specific recognition of the DNA sequence.
- ZFNs While the sequences recognized by ZFNs are relatively short, (e.g., ⁇ 3 base pairs), in several embodiments, combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more zinc fingers whose recognition sites have been characterized are used, thereby allowing targeting of specific sequences, such as a portion of the TCR (or an immune checkpoint inhibitor).
- the combined ZFNs are then fused with the catalytic domain(s) of an endonuclease, such as Fokl (optionally a Fokl heterodimer), in order to induce a targeted DNA break.
- Fokl optionally a Fokl heterodimer
- TALENs Transcription activator-like effector nucleases
- ZFNs Transcription activator-like effector nucleases
- TALENs are specific DNA-binding proteins that feature an array of 33 or 34-amino acid repeats.
- TALENs are a fusion of a DNA cutting domain of a nuclease to TALE domains, which allow for sequence-independent introduction of double stranded DNA breaks with highly precise target site recognition.
- TALENs can create double strand breaks at the target site that can be repaired by error-prone non-homologous end-joining (NHEJ), resulting in gene disruptions through the introduction of small insertions or deletions.
- NHEJ error-prone non-homologous end-joining
- TALENs are used in several embodiments, at least in part due to their higher specificity in DNA binding, reduced off-target effects, and ease in construction of the DNA-binding domain.
- CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
- the repeats are short sequences that originate from viral genomes and have been incorporated into the bacterial genome.
- Cas CRISPR associated proteins
- plasmids containing Cas genes and specifically constructed CRISPRs into eukaryotic cells, the eukaryotic genome can be cut at any desired position. Additional information on CRISPR can be found in US Patent Publication No. 2014/0068797, which is incorporated by reference herein.
- CRISPR is used to manipulate the gene(s) encoding a target gene to be knocked out or knocked in, for example CISH, TGFBR2, TCR, B2M, CIITA, CD47, HLA-E, etc.
- CRISPR is used to edit one or more of the TCRs of a T cell and/or the genes encoding one or more immune checkpoint inhibitors.
- the immune checkpoint inhibitor is selected from one or more of CTLA4 and PD1 .
- CRISPR is used to truncate one or more of TCRa, TCRp, TCRy, and TCR5.
- a TCR is truncated without impacting the function of the CD3z signaling domain of the TCR.
- a Class 1 or Class 2 Cas is used.
- a Class 1 Cas is used and the Cas type is selected from the following types: I, IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, HID, IV IVA, IVB, and combinations thereof.
- the Cas is selected from the group consisting of Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1 , Cse2, Csy1 , Csy2, Csy3, GSU0054, Casi o, Csm2, Cmr5, Casi o, Csx1 1 , Csx10, Csf1 , and combinations thereof.
- a Class 2 Cas is used and the Cas type is selected from the following types: II, HA, IIB, IIC, V, VI, and combinations thereof.
- the Cas is selected from the group consisting of Cas9, Csn2, Cas4, Cpf1 , C2c1 , C2c3, Cas13a (previously known as C2c2), Cas13b, Cas13c, CasX, CasY and combinations thereof.
- class 2 CasX is used, wherein CasX is capable of forming a complex with a guide nucleic acid and wherein the complex can bind to a target DNA, and wherein the target DNA comprises a non-target strand and a target strand.
- class 2 CasY is used, wherein CasY is capable of binding and modifying a target nucleic acid and/or a polypeptide associated with target nucleic acid.
- editing of CISH advantageously imparts to the edited cells, particularly edited NK cells, enhanced expansion, cytotoxicity and/or persistence.
- the modification of the TCR comprises a modification to TCRa, but without impacting the signaling through the CD3 complex, allowing for T cell proliferation.
- the TCRa is inactivated by expression of pre-Ta in the cells, thus restoring a functional CD3 complex in the absence of a functional alpha/beta TCR.
- the non-alloreactive modified T cells are also engineered to express a CAR to redirect the non-alloreactive T cells specificity towards tumor marker, but independent of MHC. Combinations of editing are used in several embodiments, such as knockout of the TCR and CISH in combination, or knock out of CISH and knock in of CD47, by way of non-limiting examples.
- ADORA2A (Adenosine 2a Receptor) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- ADORA2A is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- ADORA2A is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following ADORA2A-specific guide RNAs: SEQ ID NO: 503-506.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- Loss of expression of ADORA2A induces decreased sensitivity to adenosine, a well-established immunosuppressant for T cells and NK cells.
- gene editing ADORA2A increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- TGFBR2 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- TGFBR2 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- TGFBR2 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TGFBR2-specific guide RNAs: SEQ ID NO: 544-547.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- TGFBR2 is a potent checkpoint in NK cell-mediated tumor immunity, while for T cells, knockout of TGFBR2 rescues car T cell exhaustion induced by TGF-p1 .
- gene editing TGFBR2 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- NKG2A is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- NKG2A is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- NKG2A is disrupted and/or knocked out using a Crispr- Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following NKG2A-specific guide RNAs: SEQ ID NO: 548-551 .
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- NKG2A binds to HLA-E and is recognized as an MHC-recognizing receptor. Since NKG2A is an inhibitor receptor, loss of expression of NKG2A induces increased activation of constituent cells. In NK and T cells, loss of NKG2A leads to increased activation and cytotoxicity against HLA-E expressing tumor cells.
- gene editing NKG2A increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- the expression of Cytokine Signaling 2 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- SOCS2 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- SOCS2 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following SOCS2-specific guide RNAs: SEQ ID NO: 556-561 .
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- SOCS proteins are negative regulators of cytokine responses, and SOCS2 specifically negatively regulates the development of NK cells through inhibiting JAK2 activity. Loss of expression of SOCS2 in NK cells induces increased NK cell development and overall cytotoxicity.
- gene editing SOCS2 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- Cbl-b Casitas B-lineage lymphoma-b
- the expression of Casitas B-lineage lymphoma-b is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- Cbl-b is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- Cbl-b is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following Cbl-b-specific guide RNAs:
- the expression of Casitas B-lineage lymphoma-b (Cbl-b) is reduced and/or eliminated in order to increase overall activation in resultant T cells and NK cells.
- Cbl-b is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, but with the use of one more of the following Cbl-b-specific guide RNAs: SEQ ID NO: 552-555.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- Cbl-b is an E3 ubiquitin ligase that negatively regulates T cell activation Loss of expression of Cbl-b in NK cells and T cells demonstrate increased antitumor immunity. Moreover, Cbl-b deficient T cells and NK cells are resistant to PD-L1/PD-1 mediated suppression. Thus, according to several embodiments, gene editing Cbl-b increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein. [00292] In several embodiments, the expression of Beta-2 Microglobulin (B2-microglobulin) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- Beta-2 Microglobulin B2-microglobulin
- B2-microglobulin is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- B2-microglobulin is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following B2-microglobulin-specific guide RNAs: SEQ ID NO: 290-299.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- Loss of expression of B2-microglobulin induces greatly reduced levels of MHC class I molecules, and in both NK cells and T cells, reduction of B2-microglobulin can modulate overall cell recognition of autologous and allogenic cells.
- gene editing B2-microglobulin increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- TIGIT T cell immunoreceptor with Ig and ITIM domains
- TIGIT is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- TIGIT is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TIGIT-specific guide RNAs: SEQ ID NO: 507-510.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- TIGIT is a checkpoint receptor associated with T cell and NK cell exhaustion. Loss of expression of TIGIT in NK cells prevents NK cell exhaustion and promotes NK cell-dependent tumor immunity. Loss of expression of TIGIT in T cells can similarly lead to downstream activation of resultant T cells.
- gene editing TIGIT increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- PD-1 Programmed cell death protein-1
- the expression of Programmed cell death protein-1 (PD-1 ) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- PD-1 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- PD-1 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following PD-1 -specific guide RNAs: SEQ ID NO: 51 1 - 514.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- PD-1 plays an inhibitory role in immune regulation and down-regulates overall function by suppressing immune cell activity. Loss of expression of PD-1 in NK cells increases overall cytotoxicity due to increased secretion of interferongamma, granzyme B, and perforin. Similarly, T cells with loss of expression of PD-1 demonstrate increased cytotoxicity and overall caspase activation.
- gene editing PD-1 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- TIM-3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- TIM-3 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TIM-3-specific guide RNAs: SEQ ID NO:515-518.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- TIM-3 is an inhibitory receptor involved in immune checkpoint function. Loss of expression of TIM- 3 increases overall cytotoxicity in engineered NK and T cells as well as decreased exhaustion of NK cells and T cells, leading to increased effector function of constituent cells lacking TIM-3 expression. Thus, according to several embodiments, gene editing TIM-3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- CD38 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- CD38 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- CD38 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following CD38-specific guide RNAs: SEQ ID NO:519-522.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- CD38 plays a role in the maturation cycle of immune cells, and blood cancers can often present upregulated CD38. Loss of CD38 expression on constituent NK cells allows for greater cytotoxicity due to decreased fratricide. Wild-type NK cells selfexpress CD38, leading to downstream self-targeting effects in wild-type NK cells. For T cells, loss of CD38 expression for constituent T cells leads to increased cytotoxicity.
- gene editing CD38 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- TCR a T cell receptor alpha
- TCR a is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- TCR a is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TCR a-specific guide RNAs: SEQ ID NO:566-569.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- T cell receptors are protein complexes found on T cells responsible for recognizing MHC molecules. Loss of certain TCRs and preferential expression of other TCRs can lead to increased cytotoxicity in engineered cells due to increased selective targeting and recognition by constituent cells.
- gene editing TCRs increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- CISH is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- CISH is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- CISH is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following CISH-specific guide RNAs: SEQ ID NO: 562-565, or other guide disclosed herein.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- CISH actively silences TCR signaling to maintain tumor tolerance, and CISH has been shown to be a downstream negative regulator of IL-15 receptor signaling.
- NK and T cells CISH plays a role in checkpoint maturation and proliferation.
- gene editing CISH increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- CEACAM1 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- CEACAM1 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- CEACAM1 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following C E AC AM 1 -specific guide RNAs: SEQ ID NO: 497-499.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- CEACAM1 is a checkpoint inhibitor for both NK and T cells and can inhibit lysis of CEACAM1 -bearing tumor cell lines. Loss of expression of CEACAM1 can increase overall cytotoxicity for NK and T cells.
- gene editing CEACAM1 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- the expression of DDIT4 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- DDIT4 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- DDIT4 is disrupted and/or knocked out using a Crispr- Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following DDIT4-specific guide RNAs: SEQ ID NO: 500-502.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- DDIT4 is a negative regulator of mTORCI , which itself enhances IL-15 mediated survival and proliferation of NK cells.
- DDIT4 is upregulated by oxidative stress conditions as is common in tumor microenvironments. Loss of DDIT4 function in engineered cells may increase overall glucose metabolism leading to enhanced proliferation, as well as increasing overall NK or T cell cytotoxicity.
- gene editing DDIT4 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- MAPKAPK3 MAPKAP Kinase 3
- MAPKAPK3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- MAPKAPK3 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following MAPKAPK3-specific guide RNAs: SEQ ID NO: 494-496.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- MAPKAP Kinase 3 in expressed in both NK and T cells. Loss of MAPKAPK3 in engineered cells is expected to increase cytotoxicity, cytokine secretion, and overall NK signaling.
- gene editing MAPKAPK3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- SMAD3 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein.
- SMAD3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein.
- SMAD3 is disrupted and/or knocked out using a Crispr- Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following SMAD3-specific guide RNAs: SEQ ID NO: 491 -493.
- gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed).
- SMAD3 is a downstream mediator of TGF-Beta and Activin A signaling. Inhibition of activin A provides an effective downstream TGFBR knockout. Smad3 silenced NK cells demonstrate increased proliferation and differentiation, as well as increased cytotoxicity in engineered T and NK cells.
- gene editing SMAD3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
- genetically edited cells can be edited at a plurality of locations.
- cells e.g., NK cells or T cells, or a mixture thereof
- one of the gene edits is made at a target site in the CISH gene.
- one of the gene edits is made at a target site in the CBLB gene.
- one of the gene edits is made at a target site in the TGFBR2 gene.
- one of the gene edits is made at a target site in the TIGIT gene.
- any combination of such edits is also within the provided embodiments, for example dual TGFBR2/CBLB, dual TIGIT/TGFBR2, CISH/CBLB, CISH/TGFBR2, CISH/TIGIT, etc.
- any combination of edits of any of the target genes for editing can be made according to some embodiments.
- multiple edits may be made within a single target gene, or genes.
- gene edits are made at a target site in a CISH gene and a target site in a CBLB gene.
- a double edit e.g., CISH/ CBLB is made in NK cells and/or T cells for use in therapy.
- a combination CISH/CBLB gene edit is made in an NK cell that does not include an edit at a CD70 gene.
- a combination CISH/CBLB gene edit is made in an NK cell that does not include an edit at any additional gene.
- a combination CISH/CBLB gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti- CD19 CAR, or an anti-NKG2D chimeric receptor.
- a triple edit e.g., CD70/CISH/CBLB is made in NK cells and/or T cells for use in therapy.
- a triple edit e.g., CD70/CISH/CBLB is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
- gene edits are made at a target site in a CISH gene and a target site in a TGFBR2 gene.
- a double edit e.g., CISH/ TGFBR2 is made in NK cells and/or T cells for use in therapy.
- a combination CISH/ TGFBR2 gene edit is made in an NK cell that does not include an edit at a CD70 gene.
- a combination CISH/ TGFBR2 gene edit is made in an NK cell that does not include an edit at any additional gene.
- a combination CISH/ TGFBR2 gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti- CD19 CAR, or an anti-NKG2D chimeric receptor.
- a triple edit e.g., CD70/CISH/ TGFBR2 is made in NK cells and/or T cells for use in therapy.
- a triple edit e.g., CD70/CISH/ TGFBR2 is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
- gene edits are made at a target site in a CISH gene and a target site in a TIGIT gene.
- a double edit e.g., CISH/ TIGIT is made in NK cells and/or T cells for use in therapy.
- a combination CISH/ TIGIT gene edit is made in an NK cell that does not include an edit at a CD70 gene.
- a combination CISH/ TIGIT gene edit is made in an NK cell that does not include an edit at any additional gene.
- a combination CISH/ TIGIT gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti- CD19 CAR, or an anti-NKG2D chimeric receptor.
- a triple edit e.g., CD70/CISH/ TIGIT is made in NK cells and/or T cells for use in therapy.
- a triple edit e.g., CD70/CISH/ TIGIT is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
- Additional cellular engineering strategies are provided for herein that serve to further enhance the persistence of allogeneic cellular therapy products, such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells.
- allogeneic cellular therapy products such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells.
- the expression of B2M is reduced and/or eliminated in order to reduce the host- mediated graft rejection.
- B2M expression is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, but with the use of one more of the following B2M-specific guide RNAs: SEQ ID NO: 290 - CGCGAGCACAGCTAAGGCCA; SEQ ID NO: 291 - GAGTAGCGCGAGCACAGCTA; SEQ ID NO: 292 - GCTACTCTCTCTTTCTGGCC; SEQ ID 293 - GGCCGAGATGTCTCGCTCCG; SEQ ID NO: 294 - GGCCACGGAGCGAGACATCT; SEQ ID NO: 295 - CACAGCCCAAGATAGTTAAG; SEQ ID NO: 296 - AGTCACATGGTTCACACGGC; SEQ ID NO: 297 - AAGTCAACTTCAATGTCGGA; SEQ ID NO: 298 - ACTTGTCTTTCAGCAAGGAC; and SEQ ID NO: 299
- Loss of expression of B2M induces a complete loss of HLA expression, which can reduce, and in some embodiments, eliminate, the host T-cell mediated graft rejection. However, this can make also render the administered cells susceptible to host NK-cell mediated graft rejection (as well as to administered engineered NK cells, when a mixed NK/T cell population is used). This, as discussed above, results in loss of the KIR inhibitory signals (e.g., “missing self” signals). See Figures 8E-8I.
- various proteins can be expressed on the surface of a cell to be administered to an allogeneic recipient in order to inhibit host (or administered) NK cells from targeting the administered NK and or T cells.
- approaches involve the expression of, for example HLA-E/HLA-G expression, CD47, or one or more viral peptide/proteins, and combinations of these (among other disclosed herein).
- one or more of such viral immunosuppressive peptides are used to confer resistance to inactivation of engineered immune cells by host NK cells.
- viral immunosuppressive peptides also referred to as viral peptides
- one or more viral immunosuppressive peptides are integrated into a chimeric antigen receptor that is then expressed by a population of immune cells to be used in treating a patient.
- the immune cells are allogeneic to the patient.
- a combination of NK cells and T are engineered to express one or more CARs that comprise one or more viral immunosuppressive peptide.
- Figure 25A depicts a non-limiting embodiment of a viral immunosuppressive peptide that is incorporated into a CAR (identified generically as “Immunosuppressive effector Domain”, which shall be understood to refer to any of the viral immunosuppressive peptides or other immunosuppressive peptides/proteins disclosed herein, unless otherwise specified.
- the viral immunosuppressive peptide is integrated into the hinge/spacer domain of a CAR comprising a target binder (such as an scFv), a hinge (also referred to herein as a spacer), a transmembrane domain and one or more intracellular signaling domains.
- more than one (e.g., two, three, four, five, or more) viral immunosuppressive peptides can be introduced into the hinge/spacer region of the CAR.
- two (or more) viral immunosuppressive peptides when they are used, they can be of a different sequence or type.
- a CKS-17 peptide is integrated into the hinge region of the CAR in conjunction with, for example, a REV-A peptide.
- the inclusion of two or more viral immunosuppressive peptides creates a synergistic immunosuppressive effect.
- the length of the hinge/spacer region can be altered.
- a CD8alpha hinge/spacer region is use, but, in some embodiments, a longer or a shorter spacer is used.
- the spacer can be, depending on the embodiment, an IgG 1 , lgG2, lgG3, lgG4, or CD28 spacer domain or be derived from lgG1 , lgG2, lgG3, lgG4, CD28, or can be a fully synthetic sequence.
- IgG-based spacers are edited to reduce or eliminate the ability of the spacer to bring Fc-receptor bearing cells, which can advantageously reduce off-target activation of immune cells (such as those bearing the immunosuppressive effectors as disclosed herein).
- Non-limiting editing approaches include, but are not limited to, deletion of the heavy chain constant 2 (CH2) domain to abrogate binding to the Fc receptor, or mutating certain amino acids that are essential to Fc receptor binding.
- a longer spacer advantageously allows for enhances targeting of certain membrane- proximal epitopes expressed by cancer cells and exposure of the immunosuppressive effector such that it can interact with host and/or administered immune cells to reduce unwanted suppression of the therapeutic cells.
- a single hinge region can be made longer by including multiple hingeencoding sequences, e.g., two, three, four, or more hinges.
- multiple hinge regions can be of the same type (e.g., three CD8a hinges) or can vary (e.g., one CD8a hinge, one CD28 hinge, and a IgG 1 hinge).
- a shorter hinge is used, wherein the shorter hinge limits the ability of host phosphatases (like CD45) to attenuate signaling of a CAR expressed by the engineered immune cell.
- the hinge region comprises one or more of SEQ ID NOs: 479-487.
- the hinge region comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: 479-487.
- Figure 25C depicts an additional approach according to several embodiments disclosed herein, namely the engineering of the viral immunosuppressive peptide into the linker between the heavy chain and the light chain of an scFv.
- the viral immunosuppressive peptide can be integrated into any region of that binder that allows for exposure of the vial immunosuppressive peptide as well as maintenance of target binding capability.
- engineering the viral immunosuppressive peptide into the linker region can be done with a single peptide, or with multiple peptides.
- FIG. 25D An additional approach is shown in Figure 25D, with the viral immunosuppressive peptide engineered into the N-terminal region of the chimeric antigen receptor.
- multiple viral immunosuppressive peptides can be used.
- combinations of these positions within the CAR can be used.
- a viral immunosuppressive peptide (or more than one) can be positioned in the hinge region in combination with, for example a viral immunosuppressive peptide (or more than one) positioned in the linker region of an scFv and/or at the N-terminus of the CAR.
- the positions allow the viral immunosuppressive peptides to be exposed such that they can interact with, and thus suppress, host immune cell activity that would otherwise reduce the efficacy of the engineered immune cell expressing the CAR.
- the engineered CAR comprises one or more copies of one or more of the following amino acid or DNA sequences: SEQ ID NO: 199-216, 220-221 , 225-226, 230-231 , 235-236, 240-241 , 245-246, 250-251 , 273-274, 278, 280, 288, or 289.
- those sequences can be positioned in the hinge region, the N-terminal region or within the target binder region (e.g., within the linker of an scFv).
- the CAR comprises an amino acid sequence or DNA sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: SEQ ID NO: 199-216, 220-221 , 225-226, 230-231 , 235-236, 240-241 , 245-246, 250-251 , 273-274, 278, 280, 288, or 289.
- the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174 or 899, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 or 899 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of SEQ ID NO: 174 or 899.
- the CAR comprises an amino acid of SEQ ID NO: 174 or 899, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about
- the CAR optionally comprises an amino acid of SEQ ID NO: 174 or 899, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 or 899, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178 or 901 , or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 or 901 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199- 216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of SEQ ID NO: 178.
- the CAR optionally comprises an amino acid of SEQ ID NO: 178 or 901 , or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 or 901 , with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR is encoded by a nucleic acid sequence comprising SEQ ID NO: 466, or comprises an nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 466 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence encoded by SEQ ID NO: 466.
- the CAR optionally comprises a CAR encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
- the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465 or 912-994, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 or 912-994 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of any of SEQ ID NO: 383-465 or 912-994.
- the CAR optionally comprises an amino acid of any of SEQ ID NO: 383- 465 or 912-994, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 383-465 or 912-994, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
- the peptides can be coupled to a domain that allows them to be expressed as a membrane bound viral immunosuppressive peptide.
- Figures 26A-26J show non-limiting schematic depictions of embodiments disclosed herein.
- Figure 26A shows a single viral immunosuppressive peptide coupled to a transmembrane protein.
- Figure 26B shows two individual viral immunosuppressive peptides, each coupled to a transmembrane protein.
- Figure 26C shows a plurality of viral immunosuppressive peptides in a membrane-bound format. As shown, and described herein, both the viral immunosuppressive peptide and the transmembrane domain can vary, or can be the same.
- VIP viral immunosuppressive peptide
- TM transmembrane protein
- Figure 26D shows an additional non-limiting embodiment wherein multiple viral immunosuppressive peptides are coupled to a single transmembrane protein, with the viral immunosuppressive peptides being the same.
- Figure 26E shows an additional non-limiting embodiment with wherein multiple viral immunosuppressive peptides are coupled to a single transmembrane protein, with the viral immunosuppressive peptides being distinct from one another.
- Figure 26F shows a further non-limiting embodiment wherein multiple membrane-bound constructs are expressed on a single immune cell, one coupled to a single viral immunosuppressive peptide, and the other coupled to multiple viral immunosuppressive peptide. While not illustrated, it shall be appreciated that the transmembrane domains may differ from one another when multiple constructs are expressed by an individual cell.
- transmembrane proteins can be used, such as one or more of CD8a, CD4, CD3e, CD3y, CD35, CD3 , CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, FceRly, and a T-cell receptor.
- a portion of one or more of these domains e.g., a transmembrane domain
- the transmembrane protein comprises a CD8a transmembrane domain.
- the CD8a transmembrane domain comprises the amino acid sequence of SEQ ID NO: 4, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 4.
- the CD8a transmembrane domain is encoded by the nucleic acid sequence of SEQ ID NO: 3, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 3.
- a hinge or other linker is used to couple the viral immunosuppressive peptide to the transmembrane protein.
- a CD8a is used.
- the CD8a hinge comprises the amino acid sequence of SEQ ID NO: 2, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 2.
- the CD8a hinge comprises the amino acid sequence of SEQ ID NO: 1 , or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 1 .
- Figure 26G shows an additional schematic of a non-limiting embodiment provided for herein.
- This embodiment comprises an immune cell engineered to express a CAR as well as a membranebound viral immunosuppressive peptide.
- Figure 27G shows a non-limiting embodiment wherein the immune cell expresses a CAR along with a plurality of viral immunosuppressive peptides coupled to a transmembrane domain.
- immune cells e.g., NK cells, T cells or combinations there
- expressing a CAR and multiple membrane bound viral immunosuppressive peptides e.g., as in Figure 26F).
- the CAR comprises one or more viral immunosuppressive peptides, while some embodiments involve expression of a CAR without a viral immunosuppressive peptide.
- the immune cells engineered are allogeneic cells.
- allogeneic NK cells are used.
- allogeneic T cells are used.
- combinations e.g., a mixed population of allogeneic NK cell and allogeneic T cells are used.
- a polynucleotide encoding a synthetic CKS-17 viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 199.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 199.
- the polynucleotide comprises SEQ ID NO: 216 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 216.
- a membranebound synthetic CKS-17 viral immunosuppressive peptide In several embodiments, is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound synthetic CKS-17 viral immunosuppressive peptide comprises a CD8a signal peptide, synthetic CKS-17, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 218 or SEQ ID NO: 693.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 218 or SEQ ID NO: 693.
- the polynucleotide comprises SEQ ID NO: 219 (or SEQ ID NO: 694) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 219 (or SEQ ID NO: 694).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound synthetic CKS-17 and GFP comprises SEQ ID NO: 217 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 217.
- the polynucleotide encoding membrane-bound synthetic CKS-17, a FLAG tag, and GFP comprises SEQ ID NO: 692 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 692.
- the polynucleotide encoding membrane-bound synthetic CKS-17, a FLAG tag, and GFP encodes the amino acid sequence of SEQ ID NO: 691 or an amino acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 691 .
- a polynucleotide encoding a p15E viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 220.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 220.
- the polynucleotide comprises SEQ ID NO: 221 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 221 .
- a membranebound p15E viral immunosuppressive peptide In several embodiments, is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound p15E viral immunosuppressive peptide comprises a CD8a signal peptide, p15E, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound p15E viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 223 (or SEQ ID NO: 697).
- the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 223 (or SEQ ID NO: 697).
- the polynucleotide comprises SEQ ID NO: 224 (or SEQ ID NO: 698) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 224 (or SEQ ID NO: 698).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding mbp15E and GFP comprises SEQ ID NO: 222 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 222.
- the polynucleotide encoding mbp15E, a FLAG tag, and GFP comprises SEQ ID NO: 696 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 696.
- the membrane-bound p15E viral immunosuppressive peptide construct including GFP and a FLAG tag is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 695).
- the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 695).
- a polynucleotide encoding a HTLV viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 225.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 225.
- the polynucleotide comprises SEQ ID NO: 226 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 226.
- a membranebound HTLV viral immunosuppressive peptide In several embodiments, provided for is a membranebound HTLV viral immunosuppressive peptide. In several embodiments, the HTLV viral immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound HTLV viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound HTLV viral immunosuppressive peptide comprises a CD8a signal peptide, HTLV-1 (Gp21 ), a CD8a hinge, a and a CD8a transmembrane domain.
- the membrane-bound HTLV viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 228 (or SEQ ID NO: 701 ).
- the polynucleotide encodes an amino acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 228 (or SEQ ID NO: 701 ).
- the polynucleotide comprises SEQ ID NO: 229 (or SEQ ID NO: 702) or shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 229 (or SEQ ID NO: 702).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound HTLV and GFP comprises SEQ ID NO: 227 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 227.
- the polynucleotide encoding membrane-bound HTLV, a FLAG tag, and GFP comprises SEQ ID NO: 700 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 700.
- the membrane-bound HTLV, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 699 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 699.
- a polynucleotide encoding a modified HIV Gp41 viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 230.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 230.
- the polynucleotide comprises SEQ ID NO: 231 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 231 .
- a membranebound modified HIV Gp41 viral immunosuppressive peptide In several embodiments, is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound modified HIV Gp41 viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound modified HIV Gp41 viral immunosuppressive peptide comprises a CD8a signal peptide, modified HIV Gp41 , a CD8a hinge, a and a CD8a transmembrane domain.
- the membrane-bound modified HIV Gp41 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 233 (or SEQ ID NO: 705).
- the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 233 (or SEQ ID NO: 705).
- the polynucleotide comprises SEQ ID NO: 234 (or SEQ ID NO: 706) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 234 (or SEQ ID NO: 706).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound modified HIV Gp41 and GFP comprises SEQ ID NO: 232 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 232.
- the polynucleotide encoding membrane-bound modified HIV Gp41 , a FLAG tag, and GFP comprises SEQ ID NO: 704 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 704.
- the membrane-bound modified HIV Gp41 , FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 703 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 703.
- a polynucleotide encoding a truncated HIV Gp41 viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 235.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 235.
- the polynucleotide comprises SEQ ID NO: 236 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 236.
- a membranebound HIV Gp41 viral immunosuppressive peptide In several embodiments, the HIV Gp41 viral immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound HIV Gp41 viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound HIV Gp41 viral immunosuppressive peptide comprises a CD8a signal peptide, HIV Gp41 , a CD8a hinge, a and a CD8a transmembrane domain.
- the membrane-bound HIV Gp41 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 238 (or SEQ ID NO: 709).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 238 (or SEQ ID NO: 709).
- the polynucleotide comprises SEQ ID NO: 239 (or SEQ ID NO: 710) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 239 (or SEQ ID NO: 710).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound HIV Gp41 and GFP comprises SEQ ID NO: 237 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 237.
- the polynucleotide encoding membrane-bound HIV Gp41 , a FLAG tag, and GFP comprises SEQ ID NO: 708 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 708.
- the membrane-bound truncated HIV Gp41 , FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 707 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 707.
- a polynucleotide encoding a synthetic viral immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 240.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 240.
- the polynucleotide comprises SEQ ID NO: 241 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 241 .
- a membranebound synthetic viral immunosuppressive peptide In several embodiments, provided for is a membranebound synthetic viral immunosuppressive peptide. In several embodiments, the synthetic viral immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound synthetic viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound synthetic viral immunosuppressive peptide comprises a CD8a signal peptide, a synthetic viral immunosuppressive peptide trimer, a CD8a hinge, a and a CD8a transmembrane domain.
- the membrane-bound synthetic viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 243 (or SEQ ID NO: 713).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 243 (or SEQ ID NO: 713).
- the polynucleotide comprises SEQ ID NO: 244 (or SEQ ID NO: 714) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 244 (or SEQ ID NO: 714).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound synthetic viral immunosuppressive peptide and GFP comprises SEQ ID NO: 242 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 242.
- the polynucleotide encoding membranebound synthetic viral immunosuppressive peptide, a FLAG tag and GFP comprises SEQ ID NO: 712 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 712.
- membrane-bound synthetic viral immunosuppressive peptide, FLAG tag, GFP construct comprises the amino acid of SEQ ID NO: 712 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 712.
- viral fusion peptides are used.
- HIV initiates an immune evasive response by fusing to a target cell via a fusion peptide, a portion of which interacts with the T cell receptor on host T cells and suppresses their activation.
- a portion of a viral fusion peptide is used.
- an amino acid sequence comprising residues 5 to 13 of the HIV fusion peptide are used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain).
- amino acid sequence comprises SEQ ID NO: 467.
- the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 467.
- a modified viral fusion protein is used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain).
- that amino acid sequence comprises SEQ ID NO: 468.
- the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 468.
- one or more consensus motifs derived from a viral fusion protein are used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain).
- amino acid consensus sequence comprises GXXXG (SEQ ID NO: 473) or AXXXG (SEQ ID NO: 474), where each X independently is any amino acid.
- the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 473 or 474, while maintaining the consensus motif.
- these motifs are particularly advantageous in that they are suppressive towards T-cells and not NKs.
- these peptides allow engineered NK cells to be developed without gene editing to reduce/knock out B2M expression and still effect functional reduction in host versus graft rejection (e.g., through T cell suppression alone).
- a polynucleotide encoding a p15E viral immunosuppressive trimeric peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 250.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 250.
- the polynucleotide comprises SEQ ID NO: 251 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 251 .
- provided for is a membranebound p15E viral immunosuppressive trimeric peptide.
- the p15E viral immunosuppressive trimeric peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound p15E viral immunosuppressive trimeric peptide construct comprises one or more linker sequences (e.g., in between the peptide repeats).
- the membrane-bound p15E viral immunosuppressive trimeric peptide comprises a CD8a signal peptide, a first p15E peptide, a linker (e.g., a GS linker), a second p15E peptide, a linker (e.g., a second GS linker), a third p15E peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound p15E viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 253 (or SEQ ID NO: 721 ).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 253 (or SEQ ID NO: 721 ).
- the polynucleotide comprises SEQ ID NO: 254 (or SEQ ID NO: 722) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 254 (or SEQ ID NO: 722).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound trimeric p15E and GFP comprises SEQ ID NO: 252 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 252.
- the polynucleotide encoding membrane-bound trimeric p15E, a FLAG tag, and GFP comprises SEQ ID NO: 720 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 720.
- the membrane-bound trimeric p15E, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 719 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 719.
- Chimeric proteins that include one or more viral immunosuppressive peptides are also used, in several embodiments.
- One such chimeric protein comprises the human cytomegalovirus class I MHC homolog, UL18.
- UL18 is incorporated into a CAR, or otherwise expressed (e.g., through chimeric UL18-B2M or in a dimer/trimer construct) in order to evade host-NK cell cytotoxicity through the UL18 binding to the NK cell inhibitory receptor LIR-1 .
- certain sequence domains or even particular residues within viral immunosuppressive peptides can facilitate further engineering of chimeric antigen receptors and their expression.
- certain residues could be used to engineer CAR dimers, e.g., through disulfide bonding. Such an approach could be utilized to supplement, or replace, the use of bi-specific CARs.
- two separate CARs are engineered, each with cysteine residues positioned in a manner that allowed for the formation of di-sulfide bridges between the two CARs and thus the self-assembly of a dimerized CAR in vivo.
- the use of the viral immunosuppressive peptides can not only serve to help mute the host NK cell response against administered engineered cells, but it can be used for other purposes as well.
- an antibody directed to a viral peptide is administered to a subject who has been dosed with a cell product expressing a CAR that comprises one or more viral immunosuppressive peptides.
- the antibody functions to bind the viral peptide and induce depletion of the CAR-expressing cells (e.g., via antibody-based immune response), thus serving as a safety mechanism or a route to end a treatment.
- an immune cell comprising a CAR with an included viral immunosuppressive peptide
- antibody-based detection of the viral immunosuppressive peptide can be used to determine CAR expression levels.
- immunosuppressive peptides or polypeptides are provided for herein. Like the viral immunosuppressive peptides, these polypeptides may be included in one or more regions of a CAR, or can be expressed in a membrane-bound format. These additional immunosuppressive polypeptides can also be used in connection with one or more viral immunosuppressive peptides (see, e.g., Figures 25 and 26 and description of viral peptides above).
- endogenous “self” signals are re-purposed to impart immune evasiveness to engineered immune cells.
- One such “self” protein is CD47, which impedes phagocytosis (e.g., by macrophages) through signaling through the phagocyte receptor CD172a.
- one or more domains (or sub-domains) of CD47 are incorporated into a CAR and/or expressed in an immune cell in a membrane-bound configuration.
- the expression of CD47 functions to impart to the engineered immune cell the ability to reduce or avoid phagocytosis by host immune cells, thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
- PD-L1 also known as CD274, PDL1 , or PDCD1 L1
- an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion.
- one or more TIGIT ligands including but not limited to PVR (also known as CD155, NECL5, or NECL-5) and CD1 13 (also known as PROM1 or prominin 1 ) or an immunosuppressive portion of is expressed by an engineered immune cell through incorporation into a CAR and/or in a membranebound fashion.
- CD200 or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion.
- CD276 also known as B7-H3
- B7-H4 also known as VTCN1 , B7S1 , or B7X
- B7-H4 also known as VTCN1 , B7S1 , or B7X
- HVEM also known as TNFSF14, CD270 or ATAR
- an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion.
- CEACAM5 also known as CEA
- an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion.
- Galectin-9 also known as LGALS9 or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion.
- the expression of these immunosuppressive proteins functions to impart to the engineered immune cell the ability to reduce or avoid immune clearance by host immune cells (or other engineered immune cells), thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
- the engineered immune cells in several embodiments, are allogeneic cells.
- allogeneic NK cells are used.
- allogeneic T cells are used.
- combinations (e.g., a mixed population) of allogeneic NK cell and allogeneic T cells are used.
- the engineered CAR comprises one or more copies of one or more of the following amino acid sequences: SEQ ID NO: 245, 280, 285, 286, 288, or 289.
- the CAR includes an immunosuppressive fragment of SEQ ID NO: 287.
- those sequences can be positioned in the hinge region, the N-terminal region or within the target binder region (e.g., within the linker of an scFv).
- the CAR comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: SEQ ID NO: 245, 280, 285, 286, 288, or 289 or an immunosuppressive fragment of SEQ ID NO: 287.
- these non-viral immunosuppressive polypeptides can be coupled to a domain that allows them to be expressed as a membrane bound polypeptides.
- transmembrane proteins can be used, such as one or more of CD8a, CD4, CD3e, CD3y, CD35, CD3 , CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, FceRly, and a T-cell receptor.
- a portion of one or more of these domains e.g., a transmembrane domain
- the transmembrane protein comprises a CD8a transmembrane domain.
- the CD8a transmembrane domain comprises the amino acid sequence of SEQ ID NO: 4, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 4.
- the CD8a transmembrane domain is encoded by the nucleic acid sequence of SEQ ID NO: 3, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 3.
- a hinge or other linker is used to couple the immunosuppressive peptide to the transmembrane protein.
- a CD8a is used.
- the CD8a hinge comprises the amino acid sequence of SEQ ID NO: 2, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 2.
- the CD8a hinge comprises the amino acid sequence of SEQ ID NO: 1 , or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 1 .
- a polynucleotide encoding a truncated CD47 immunosuppressive peptide.
- the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 245.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 245.
- the polynucleotide comprises SEQ ID NO: 246 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 246.
- a membranebound truncated CD47 immunosuppressive peptide In several embodiments, the truncated CD47 immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound truncated CD47 immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound truncated CD47 immunosuppressive peptide comprises a CD8a signal peptide, a truncated CD47 peptide (e.g., positions 1 10-130 of the extracellular domain), a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound synthetic truncated CD47 immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 248 (or SEQ ID NO: 717).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 248 (or SEQ ID NO: 717).
- the polynucleotide comprises SEQ ID NO: 249 (or SEQ ID NO: 718) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 249 (or SEQ ID NO: 718).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound truncated CD47 and GFP comprises SEQ ID NO: 247 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 247.
- the polynucleotide encoding membrane-bound truncated CD47, a FLAG tag and GFP comprises SEQ ID NO: 716 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 716.
- the membrane-bound truncated CD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 715 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 715.
- any of the viral immunosuppressive peptides may be used in combination with one or more non-viral immunosuppressive peptides.
- a polynucleotide encoding a p15E viral immunosuppressive peptide truncated CD47 construct (p15E_tCD47).
- p15E_tCD47 a polynucleotide encoding a p15E viral immunosuppressive peptide truncated CD47 construct
- p15E_tCD47 p15E viral immunosuppressive peptide truncated CD47 construct
- a membrane-bound p15E_tCD47 construct is provided for a membrane-bound p15E_tCD47 construct.
- the truncated CD47 peptide comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the p15E_tCD47 construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound p15E_tCD47 construct comprises one or more linker sequences.
- the membrane-bound p15E_tCD47 construct comprises a CD8a signal peptide, a p15E peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound p15E_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 256 (or SEQ ID NO: 725).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 256 (or SEQ ID NO: 725).
- the polynucleotide comprises SEQ ID NO: 257 (or SEQ ID NO: 726) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 257 (or SEQ ID NO: 726).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound p15E_tCD47 construct and GFP comprises SEQ ID NO: 255 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 255.
- the polynucleotide encoding the membrane-bound p15E_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 724 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 724.
- the membrane-bound p15E_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 723 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 723.
- a polynucleotide encoding a p15E viral immunosuppressive peptide truncated CD47 construct (tCD47_p15E), a swap of the peptides of the construct just described.
- tCD47_p15E a viral immunosuppressive peptide truncated CD47 construct
- a swap of the peptides of the construct just described is provided for.
- a membrane-bound tCD47_p15E construct comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the tCD47_p15E construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound tCD47_p15E construct comprises one or more linker sequences.
- the membrane-bound tCD47_ p15E construct comprises a CD8a signal peptide, a truncated CD47 peptide, a linker (e.g., a GS linker), a p15E peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound tCD47_ p15E construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 259 (or SEQ ID NO: 729).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 259 (or SEQ ID NO: 729).
- the polynucleotide comprises SEQ ID NO: 260 (or SEQ ID NO: 730) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 260 (or SEQ ID NO: 730).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound tCD47_ p15E construct and GFP comprises SEQ ID NO: 258 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 258.
- the polynucleotide encoding the membrane-bound tCD47_ p15E construct, a FLAG tag, and GFP comprises SEQ ID NO: 728 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 728.
- the membrane-bound tCD47_ p15E, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 727 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 727.
- a polynucleotide encoding a modified HIV Gp41 viral immunosuppressive peptide truncated CD47 construct (HIV_L_tCD47).
- HIV_L_tCD47 modified HIV Gp41 viral immunosuppressive peptide truncated CD47 construct
- a membrane-bound HIV_L_tCD47 construct In several embodiments, provided for is a membrane-bound HIV_L_tCD47 construct.
- the truncated CD47 peptide comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the HIV_L_tCD47 construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound HIV_L_tCD47 construct comprises one or more linker sequences.
- the membrane-bound HIV_L_tCD47 construct comprises a CD8a signal peptide, a modified HIV Gp41 viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound HIV_L_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 262 (or SEQ ID NO: 733).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 262 (or SEQ ID NO: 733).
- the polynucleotide comprises SEQ ID NO: 263 (or SEQ ID NO: 734) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 263 (or SEQ ID NO: 734).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound HIV_L_tCD47 construct and GFP comprises SEQ ID NO: 261 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 261 .
- the polynucleotide encoding the membrane-bound HIV_L_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 732 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 732.
- the membrane-bound HIV_L_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 731 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 731 .
- HIV_S_tCD47 HIV Gp41 viral immunosuppressive peptide truncated CD47 construct
- HIV_S_tCD47 HIV Gp41 viral immunosuppressive peptide truncated CD47 construct
- a membrane-bound HIV_S_tCD47 construct HIV-bound HIV_S_tCD47 construct.
- the truncated CD47 peptide comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the HIV_S_tCD47 construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound HIV_S_tCD47 construct comprises one or more linker sequences.
- the membrane-bound HIV_S_tCD47 construct comprises a CD8a signal peptide, an HIV Gp41 viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound HIV_S_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 265 (or SEQ ID NO: 737).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 265 (or SEQ ID NO: 737).
- the polynucleotide comprises SEQ ID NO: 266 (or SEQ ID NO: 738) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 266 (or SEQ ID NO: 738).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound HIV_S_tCD47 construct and GFP comprises SEQ ID NO: 264 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 264.
- the polynucleotide encoding the membrane-bound HIV_S_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 736 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 736.
- the membranebound HIV_S_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 735 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 735.
- a polynucleotide encoding an HTLV viral immunosuppressive peptide truncated CD47 construct (HTLV_tCD47).
- HTLV_tCD47 HTLV viral immunosuppressive peptide truncated CD47 construct
- a membrane-bound HTLV_tCD47 construct a polynucleotide encoding an HTLV viral immunosuppressive peptide truncated CD47 construct.
- the truncated CD47 peptide comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the HTLV_tCD47 construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound HTLV_tCD47 construct comprises one or more linker sequences.
- the membrane-bound HTLV_tCD47 construct comprises a CD8a signal peptide, an HTLV viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound HTLV_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 268 (or SEQ ID NO: 741 ).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 268 (or SEQ ID NO: 741 ).
- the polynucleotide comprises SEQ ID NO: 269 (or SEQ ID NO: 742) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 269 (or SEQ ID NO: 742).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound HTLV_tCD47 construct and GFP comprises SEQ ID NO: 267 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 267.
- the polynucleotide encoding the membrane-bound HTLV_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 740 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 740.
- the membranebound HTLV_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 739 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 739.
- a polynucleotide encoding a truncated CD47 - p15E-dimer viral immunosuppressive peptide truncated CD47 construct (tCD47_p15Ex2).
- tCD47_p15Ex2 a truncated CD47 - p15E-dimer viral immunosuppressive peptide truncated CD47 construct
- tCD47_p15Ex2 a membrane-bound tCD47_p15Ex2 construct.
- the truncated CD47 peptide comprises a peptide corresponding to positions 1 10-130 of the extracellular domain of CD47.
- the tCD47_p15Ex2 construct is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound tCD47_p15Ex2 construct comprises one or more linker sequences.
- the membrane-bound tCD47_p15Ex2 construct comprises a CD8a signal peptide, a truncated CD47 peptide, a linker (e.g., a GS linker), a first p15E peptide, a linker (e.g., a GS linker), a second p15E peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound tCD47_p15Ex2 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 271 (or SEQ ID NO: 745).
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 271 (or SEQ ID NO: 745).
- the polynucleotide comprises SEQ ID NO: 272 (or SEQ ID NO: 746) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 272 (or SEQ ID NO: 746).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the membrane-bound tCD47_p15Ex2 construct and GFP comprises SEQ ID NO: 270 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 270.
- the polynucleotide encoding the membrane-bound tCD47_p15Ex2 construct, a FLAG tag, and GFP comprises SEQ ID NO: 744 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 744.
- the membrane-bound tCD47_p15Ex2, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 743 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 743.
- Figure 42A shows a non-limiting schematic of construct according to embodiments disclosed herein, in which a domain designed to reduce cytotoxic effects on a cell expressing such a construct (also referred to as a hypoimmune domain) is coupled to at least a transmembrane domain or (as shown in the non-limiting schematic), in some embodiments, integrated into a CAR construct.
- viral peptides such as those disclosed herein are integrated into the CAR (e.g., CKS-17, p15E, including p15E-long, and/or HTLV).
- multimeric formats are provided for, in several embodiments, such as doublet or triplet of p15E (including p15E- long).
- Viral and non-viral peptides may also be used in combination, such as any of a synthetic TCR blocking peptide, HIV TCR blocking peptides (including truncated formats), an inhibitory receptor peptide (such as tCD47) with any of the other viral peptides disclosed herein.
- Non-limiting examples include p15E-tCD47, tCD47-p15E, HIV-long-TCD47, HIV-short-tCD47, HTLV-tCD47, and tCD47-p15E (doublet or triplet, optionally long format).
- a polynucleotide encoding a synthetic CKS-17 viral immunosuppressive peptide.
- a membrane-bound synthetic CKS-17 viral immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound synthetic CKS- 17 viral immunosuppressive peptide comprises a CD8a signal peptide, synthetic CKS-17, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 749.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 749.
- the polynucleotide comprises SEQ ID NO: 750 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 750.
- the polynucleotide encoding membrane-bound synthetic CKS-17 also encodes GFP (without an IRES or a linker) and comprises SEQ ID NO: 748 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 748.
- the membrane-bound synthetic CKS- 17-GFP construct comprises SEQ ID NO: 747 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 747.
- a truncated CD47 immunosuppressive peptide is employed.
- a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 754.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 754.
- the polynucleotide comprises SEQ ID NO: 753 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 753.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding truncated CD47 and GFP comprises SEQ ID NO: 752 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 752.
- the truncated CD47-GFP construct comprises the amino acid sequence of SEQ ID NO: 751 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 751 .
- a polynucleotide encoding an HIV Gp41 viral immunosuppressive peptide construct that includes a native HIV transmembrane domain fGP41_HIVtm.
- the HIV Gp41 viral immunosuppressive peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is MALPVTALLLPLALLLHAARP (SEQ ID NO 895) at the amino acid level and ATGGCACTCCCCGTAACTGCTCTGCTGCTG CCGTTGGCATTGCTCCTGCACGCCGCACGCCCG (SEQ ID NO 896) at the nucleotide level).
- a CD8a signal peptide e.g., for expression purposes, the sequence of which is MALPVTALLLPLALLLHAARP (SEQ ID NO 895) at the amino acid level and ATGGCACTCCCCGTAACTGCTCTGCTGCTG CCGTTGGCATTGCTCCTGCACGCCGCACGCCCG (SEQ ID NO 89
- the HIV Gp41 viral immunosuppressive construct comprises a CD8a signal peptide and HIV Gp41 and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO:757.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 757.
- the polynucleotide comprises SEQ ID NO: 758 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 758.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker e.g., a GS linker
- the polynucleotide encoding HIV Gp41 and GFP comprises SEQ ID NO: 756 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 756.
- the fGP41_HIVtm-GFP construct comprises that amino acid sequence of SEQ ID NO: 755 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 755.
- a polynucleotide encoding a p15E transmembrane domain immunosuppressive peptide (p15Etm_sf).
- the p15E transmembrane domain is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the p15E transmembrane domain immunosuppressive construct comprises a CD8a signal peptide and the p15E transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 761 .
- the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO:761 .
- the polynucleotide comprises SEQ ID NO: 762 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 762.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- GFP detectable tag
- the polynucleotide encoding the p15E transmembrane domain and GFP comprises SEQ ID NO: 760 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 760.
- the p15E transmembrane domain-GFP construct comprises the amino acid sequence of SEQ ID NO: 759 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 759.
- a polynucleotide encoding a CD43-derived immunosuppressive peptide (fCD43_TM).
- the CD43 peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD43 immunosuppressive construct comprises a CD8a signal peptide and the CD43 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 765.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 765.
- the polynucleotide comprises SEQ ID NO: 766 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 766.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the linker is positioned between the CD43 and the tag.
- the polynucleotide encoding fCD43 and GFP comprises SEQ ID NO: 764 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 764.
- the CD43-GFP construct comprises the amino acid sequence of SEQ ID NO: 763 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 763.
- a polynucleotide encoding a latent membrane protein 1 (LMP1 ) peptide of the Epstein-Barr Virus (LMP1_TM).
- LMP1 peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the LMP1 immunosuppressive construct comprises a CD8a signal peptide and the LMP1 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 769.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 769.
- the polynucleotide comprises SEQ ID NO: 770 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 770.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- LMP1 LMP1 and the tag.
- the polynucleotide encoding fLMP1 and GFP comprises SEQ ID NO: 768 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 768.
- the LMP1 -GFP construct comprises the amino acid sequence of SEQ ID NO: 767 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 767.
- a polynucleotide encoding a glycoprotein D (gD) of the Herpes Simplex Virus (fgD_TM).
- the gD peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the gD immunosuppressive construct comprises a CD8a signal peptide and the gD peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 773.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 773.
- the polynucleotide comprises SEQ ID NO: 774 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 774.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the gD and the tag.
- the polynucleotide encoding gD and GFP comprises SEQ ID NO: 772 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 772.
- the gD-GFP construct comprises the amino acid sequence of SEQ ID NO: 771 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 771 .
- a polynucleotide encoding a lectin-like transcript 1 (LLT 1 ), which, when interacting with CD161 , inhibits Natural Killer cell activation and contributes to tumor cell immunosuppressive properties.
- the LLT 1 peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the LLT1 immunosuppressive construct comprises a CD8a signal peptide and the LLT1 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 777.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 777.
- the polynucleotide comprises SEQ ID NO: 778 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 778.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the LLT1 and the tag are positioned between the LLT1 and the tag.
- the polynucleotide encoding LLT1 and GFP comprises SEQ ID NO: 776 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 776.
- the LLT1 -GFP construct comprises the amino acid sequence of SEQ ID NO: 775 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 775.
- a polynucleotide encoding at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162).
- the CD47 domains are coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD47 immunosuppressive construct comprises a CD8a signal peptide and the CD47 extracellular and transmembrane domains (positions 19 to 162 of UniProtKB - Q08722) and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 781 .
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 781 .
- the polynucleotide comprises SEQ ID NO: 782 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 782.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the tag is positioned between the CD47 domains and the tag.
- the polynucleotide encoding CD47 and GFP comprises SEQ ID NO: 780 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 780.
- the CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 779 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 779.
- a polynucleotide encoding at least a portion of the latent membrane protein (LMP) oncogene of the Epstein-Barr virus (LMP_L_CD8HTM).
- LMP latent membrane protein
- the LMP domain is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the LMP immunosuppressive construct comprises a CD8a signal peptide, the LMP_L domain, a CD8a hinge, and a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 785.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 785.
- the polynucleotide comprises SEQ ID NO: 786 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 786.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the tag is positioned between the CD47 domains and the tag.
- the polynucleotide encoding the LMP_L domain and GFP comprises SEQ ID NO: 784 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 784.
- the LMP_L_CD8HTM -GFP construct comprises the amino acid sequence of SEQ ID NO: 783 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 783.
- a polynucleotide encoding a synthetic immunosuppressive construct comprising a multimeric repeat (e.g., dimer, trimer, quatramer, pentamer, etc.) of a peptide with immunosuppressive properties (LALLFWLx5-CD8HTM).
- the synthetic domain is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the synthetic immunosuppressive construct comprises a CD8a signal peptide, the five repeats of the synthetic peptide, a CD8a hinge, and a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 789.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 789.
- the polynucleotide comprises SEQ ID NO: 790 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 790.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the transmembrane domain and the tag.
- the polynucleotide encoding the synthetic immunosuppressive peptide and GFP comprises SEQ ID NO: 788 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 788.
- the synthetic immunosuppressive peptide-GFP construct comprises the amino acid sequence of SEQ ID NO: 787 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 787.
- FP N-terminal fusion peptide
- Env human immunodeficiency virus
- GP41 fp envelope glycoprotein
- the GP41 fp is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the GP41 fp immunosuppressive construct comprises a CD8a signal peptide, the GP41 fp peptide, and at least a portion of the GP41 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 793.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 793.
- the polynucleotide comprises SEQ ID NO: 794 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 794.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the transmembrane domain is positioned between the transmembrane domain and the tag.
- the polynucleotide encoding the GP41 fp and GFP comprises SEQ ID NO: 792 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 792.
- the GP41 fp-GFP construct comprises the amino acid sequence of SEQ ID NO: 791 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 791 .
- a polynucleotide encoding a CKS-17 viral immunosuppressive peptide In several embodiments, provided for is a membrane-bound CKS-17 viral immunosuppressive peptide. In several embodiments, the CKS-17 viral immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain. In several embodiments, the membrane-bound CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound CKS-17 viral immunosuppressive peptide comprises a CD8a signal peptide, synthetic CKS-17, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 797.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 797.
- the polynucleotide comprises SEQ ID NO: 798 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 798.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound synthetic CKS-17 and GFP comprises SEQ ID NO: 796 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 796.
- the membrane-bound synthetic CKS-17-GFP construct comprises SEQ ID NO: 795 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 795.
- a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and an HTLV-1 (Gp21 ) domain.
- a membrane-bound immunosuppressive construct comprising a CKS-17 domain and a an HTLV-1 (Gp21 ) domain (CKS_HTLV-8aTM).
- the CKS_HTLV immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound CKS_HTLV viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound CKS_HTLV viral immunosuppressive peptide comprises a CD8a signal peptide, a CKS-17 peptide, an HTLV(Gp21 ) peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound CKS_HTLV immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 801 .
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 801 .
- the polynucleotide comprises SEQ ID NO: 802 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 802.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., GFP
- the polynucleotide encoding membrane-bound CKS_HTLV and GFP comprises SEQ ID NO: 800 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 800.
- the membrane-bound CKS_HTLV-GFP construct comprises an amino acid sequence of SEQ ID NO: 799 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 799.
- a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and an LMP domain.
- a membrane-bound immunosuppressive construct comprising a CKS-17 domain and a an LMP domain (CKS_LMP-8aTM).
- the CKS_LMP immunosuppressive peptide is coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound CKS_LMP viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound CKS_LMP viral immunosuppressive construct comprises a CD8a signal peptide, a CKS-17 peptide, an LMP peptide, a CD8a hinge, and a CD8a transmembrane domain.
- the membrane-bound CKS_LMP immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 805.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 805.
- the polynucleotide comprises SEQ ID NO: 806 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 806.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding membrane-bound CKS_LMP and GFP comprises SEQ ID NO: 804 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 804.
- the membrane-bound CKS_LMP-GFP construct comprises an amino acid sequence of SEQ ID NO: 803 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 803.
- a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and a GP41 fp domain.
- a membrane-bound immunosuppressive construct comprising a CKS-17 domain and an GP41 fp domain (CKS_GP41 fptm).
- the membrane-bound CKS_GP41 fptm viral immunosuppressive peptide construct comprises one or more linker sequences.
- the membrane-bound CKS_GP41 fptm viral immunosuppressive construct comprises a CD8a signal peptide, a first portion of the GP41 fp (amino acids 1 -16), a CKS-17 peptide, a second portion of the GP41 fp (amino acids 17-70), and a gp41 transmembrane domain.
- the membrane-bound CKS_GP41 fptm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 809.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 809.
- the polynucleotide comprises SEQ ID NO: 810 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 810.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., GFP
- the polynucleotide encoding membrane-bound CKS_GP41 fptm and GFP comprises SEQ ID NO: 808 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 808.
- the membrane-bound CKS_GP41 fptm-GFP construct comprises an amino acid sequence of SEQ ID NO: 807 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 807.
- a polynucleotide encoding a truncated portion of the latent membrane protein 1 (LMP1 ) peptide of the Epstein-Barr Virus (LMP_S).
- LMP1 latent membrane protein 1
- LMP_S peptide is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- CD8a signal peptide e.g., for expression purposes, the sequence of which is provided for separately herein.
- a membranebound LMP_S immunosuppressive construct comprising an LMP_S peptide coupled to a CD8a transmembrane protein and/or CD8a hinge domain.
- the membrane-bound LMP_S immunosuppressive construct comprises one or more linker sequences.
- the membrane-bound LMP_S immunosuppressive construct comprises a CD8a signal peptide, an LMP_S peptide, an HTLV(Gp21 ) peptide, a CD8a hinge, and a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 813.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 813.
- the polynucleotide comprises SEQ ID NO: 814 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 814.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the LMP_S and the tag.
- the polynucleotide encoding LMP_S and GFP comprises SEQ ID NO: 812 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 812.
- the LMP_S- GFP construct comprises the amino acid sequence of SEQ ID NO: 81 1 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 81 1 .
- a polynucleotide encoding a chimeric immunosuppressive construct comprising at least a portion of the latent membrane protein 1 (LMP1 ) peptide of the Epstein-Barr Virus (LMP_L) coupled with at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162), together referred to as LMP_CD47tm162.
- LMP1 latent membrane protein 1
- LMP_L Epstein-Barr Virus
- CD47tm162 the extracellular and transmembrane domains of CD47
- CD47tm162 CD8a signal peptide
- the LMP_CD47tm162 construct is membrane-bound based on the portion of the CD47 transmembrane domain and comprises one or more linker sequences.
- the membrane-bound LMP_CD47tm162 immunosuppressive construct comprises a CD8a signal peptide, an LMP_L peptide, and a CD47tm162 peptide, and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 817.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 817.
- the polynucleotide comprises SEQ ID NO: 818 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 818.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- LMP_CD47tm162 the tag.
- the polynucleotide encoding LMP_CD47tm162 and GFP comprises SEQ ID NO: 816 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 816.
- the LMP_CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 815 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 815.
- a polynucleotide encoding a chimeric immunosuppressive construct comprising at least a portion of a p15E viral peptide coupled with at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162), together referred to as p15E_CD47tm162.
- the p15E_CD47tm162 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the p15E_CD47tm162 construct is membrane-bound based on the portion of the CD47 transmembrane domain and comprises one or more linker sequences.
- the membrane-bound p15E_CD47tm162 immunosuppressive construct comprises a CD8a signal peptide, a p15E peptide, and a CD47tm162 peptide, and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 821 .
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 821 .
- the polynucleotide comprises SEQ ID NO: 822 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 822.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- GFP detectable tag
- the polynucleotide encoding p15E_CD47tm162 and GFP comprises SEQ ID NO: 820 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 820.
- the p15E_CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 819 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 819.
- a polynucleotide encoding a chimeric immunosuppressive construct comprising at least one domain derived from HIV Gp41 and at least one domain from CD47 (CD47_GP41 fptm).
- the CD47_GP41 fptm is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD47_GP41 fptm construct is membrane-bound based on a gp41 transmembrane domain.
- the membrane-bound CD47_GP41 fptm immunosuppressive construct comprises a CD8a signal peptide, a first GP41 domain (amino acids 1 -16 of the extracellular domain), a CD47 domain (amino acids 2-141 ), a second GP41 domain (amino acids 17- 70 of the extracellular domain), and a GP41 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 825.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 825.
- the polynucleotide comprises SEQ ID NO: 826 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 826.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the linker is positioned between the CD47_GP41 fptm and the tag.
- the polynucleotide encoding CD47_GP41 fptm and GFP comprises SEQ ID NO: 824 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 824.
- the CD47_GP41 fptm -GFP construct comprises the amino acid sequence of SEQ ID NO: 823 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 823.
- a polynucleotide encoding an immunosuppressive construct comprising at least a portion of an antibody that targets a signal-regulatory protein a (SIRPa) (anti-SIRPa agonist_vHL), which is an innate immune checkpoint expressed on dendritic cells, macrophages, monocytes and neutrophils.
- SIRPa signal-regulatory protein a
- the constructs are engineered to be membrane-bound.
- the anti-SIRPa agonist_vHL is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the anti-SIRPa agonist_vHL construct is membrane-bound based on a CD8a hinge region and/or a CD8a transmembrane domain.
- the membrane-bound anti-SIRPa agonist_vHL immunosuppressive construct comprises a CD8a signal peptide, an anti-SIRPa heavy chain, a linker and anti-SIRPa light chain, a CD8a hinge region and, a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 833.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 833.
- the polynucleotide comprises SEQ ID NO: 834 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 834.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the anti-SIRPa agonist_vHL and the tag.
- the polynucleotide encoding anti-SIRPa agonist_vHL and GFP comprises SEQ ID NO: 832 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 832.
- the anti-SIRPa agonist_vHL-GFP construct comprises the amino acid sequence of SEQ ID NO: 831 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 831 .
- a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from HTLV GP21 (HTLV1_GP21 ).
- the HTLV1_GP21 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the HTLV1_GP21 comprises a CD8a signal peptide and a GP21 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 841 .
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 841 .
- the polynucleotide comprises SEQ ID NO: 842 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 842.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the tag is positioned between the HTLV1_GP21 and the tag.
- the polynucleotide encoding HTLV1_GP21 and GFP comprises SEQ ID NO: 840 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 840.
- the HTLV1_fGP62-GFP construct comprises the amino acid sequence of SEQ ID NO: 839 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 839.
- a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Lassa virus membrane glycoprotein 2 (LASV_fGP2).
- the LASV_fGP2 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the LASV_fGP2 comprises a CD8a signal peptide and at least a portion of a Lassa Virus GP2 domain, including a transmembrane region and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 845.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 845.
- the polynucleotide comprises SEQ ID NO: 846 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 846.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the tag is positioned between the HTLV1_GP21 and the tag.
- the polynucleotide encoding LASV_fGP2 and GFP comprises SEQ ID NO: 844 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 844.
- the LASV_fGP2-GFP construct comprises the amino acid sequence of SEQ ID NO: 843 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 843.
- a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sudan ebolavirus envelope glycoprotein (SEBOV_fGP).
- SEBOV_fGP is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the SEBOV_fGP comprises a CD8a signal peptide and at least two domains from the ebolavirus envelope.
- the SEBOV_fGP comprises a full GP1 glycoprotein sequence followed by a truncated form of GP1 (known as GP2, resulting from proteolysis of the GP1 domain).
- the GP2 domain includes a transmembrane domain.
- the SEBOV_fGP is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 849.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 849.
- the polynucleotide comprises SEQ ID NO: 850 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 850.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the SEBOV_fGP and the tag.
- the polynucleotide encoding SEBOV_fGP and GFP comprises SEQ ID NO: 848 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 848.
- the SEBOV_fGP-GFP construct comprises the amino acid sequence of SEQ ID NO: 847 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 847.
- a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sudan ebolavirus envelope glycoprotein (SEBOV_GP2).
- SEBOV_GP2 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the SEBOV_GP2 comprises a CD8a signal peptide and a GP2 domain, resulting from proteolysis of the GP1 domain.
- the GP2 domain includes a transmembrane domain.
- the SEBOV_GP2 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 853.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 853.
- the polynucleotide comprises SEQ ID NO: 854 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 854.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the SEBOV_GP2 and the tag.
- the polynucleotide encoding SEBOV_GP2 and GFP comprises SEQ ID NO: 852 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 852.
- the SEBOV_GP2-GFP construct comprises the amino acid sequence of SEQ ID NO: 851 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 851 .
- a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sars-CoV-2 spike protein (SCoV_S2).
- the SCoV_S2 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the SCoV_S2 comprises a CD8a signal peptide and a an S2 spike protein, including a transmembrane domain.
- the SCoV_S2 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 857.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 857.
- the polynucleotide comprises SEQ ID NO: 858 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 858.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- SCoV_S2 the tag.
- the polynucleotide encoding SCoV_S2and GFP comprises SEQ ID NO: 856 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 856.
- the SCoV_S2-GFP construct comprises the amino acid sequence of SEQ ID NO: 855 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 855.
- a polynucleotide encoding an immunosuppressive construct comprising at least a portion of a Galectin-3-binding protein (LGALS3BP).
- the constructs are engineered to be membrane-bound.
- the LGALS3BP is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- LGALS3BP construct is membrane-bound based on a CD8a hinge region and/or a CD8a transmembrane domain.
- the membrane-bound LGALS3BP immunosuppressive construct comprises a CD8a signal peptide, a Galectin 3 binding protein, and a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 861 .
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 861 .
- the polynucleotide comprises SEQ ID NO: 862 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 862.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- LGALS3BP LGALS3BP
- the polynucleotide encoding LGALS3BP and GFP comprises SEQ ID NO: 860 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 860.
- the LGALS3BP-GFP construct comprises the amino acid sequence of SEQ ID NO: 859 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 859.
- a polynucleotide encoding an immunosuppressive construct comprising at least a portion of CD24.
- the constructs are engineered to be membrane-bound.
- the CD24 construct comprises a CD24 signal peptide and a CD24 protein and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 865.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 865.
- the polynucleotide comprises SEQ ID NO: 866 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 866.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a T2A domain is positioned between the CD24 and the tag.
- the polynucleotide encoding CD24 and GFP comprises SEQ ID NO: 864 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 864.
- the CD24-GFP construct comprises the amino acid sequence of SEQ ID NO: 863 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 863.
- a polynucleotide encoding an immunosuppressive construct comprising at least a portion of a Hepatitis C envelope glycoprotein (HCV_E2).
- HCV_E2 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the HCV_E2 immunosuppressive construct comprises a CD8a signal peptide, and a E2 protein of HCV and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 869.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 869.
- the polynucleotide comprises SEQ ID NO: 870 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 870.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- HCV_E2 the tag
- the polynucleotide encoding HCV_E2 and GFP comprises SEQ ID NO: 868 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 868.
- the HCV_E2-GFP construct comprises the amino acid sequence of SEQ ID NO: 867 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 867.
- a polynucleotide encoding an immunosuppressive construct comprising at least a portion of an antibody that targets a signal-regulatory protein a (SIRPa) (anti-SIRPa agonist_vLH).
- the constructs are engineered to be membrane-bound.
- the anti-SIRPa agonist_vLH is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the anti-SIRPa agonist_vLH construct is membrane-bound based on a CD8a hinge region and/or a CD8a transmembrane domain.
- the membrane-bound anti-SIRPa agonist_vLH immunosuppressive construct comprises a CD8a signal peptide, an anti-SIRPa light chain, a linker, anti-SIRPa heavy chain, a CD8a hinge region and, a CD8a transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 873.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 873.
- the polynucleotide comprises SEQ ID NO: 874 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 874.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the anti-SIRPa agonist_vLH and the tag.
- the polynucleotide encoding anti-SIRPa agonist_vLH and GFP comprises SEQ ID NO: 872 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 872.
- the anti-SIRPa agonist_vLH-GFP construct comprises the amino acid sequence of SEQ ID NO: 871 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 871 .
- a polynucleotide encoding an immunosuppressive construct comprising at least CEA Cell Adhesion Molecule 1 -derived domain (CEACAM1 ).
- the constructs are engineered to be membrane-bound.
- the CEACAM1 is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CEACAM1 immunosuppressive construct comprises a CD8a signal peptide and a CEACAM1 -derived protein.
- the CEACAM1 immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 877.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 877.
- the polynucleotide comprises SEQ ID NO: 878 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 878.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the CEACAM1 and the tag.
- the polynucleotide encoding the CEACAM1 and GFP comprises SEQ ID NO: 876 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 876.
- the CEACAM1 -GFP construct comprises the amino acid sequence of SEQ ID NO: 875 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 875.
- a polynucleotide encoding an immunosuppressive construct comprising CD155 transmembrane domain (CD155tm_3M).
- the CD155tm_3M is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD155tm_3Mimmunosuppressive construct comprises a CD8a signal peptide and a CD155-derived protein.
- the CD155tm_3M immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 881 .
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 881 .
- the polynucleotide comprises SEQ ID NO: 882 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 882.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the linker is positioned between the CD155tm_3M and the tag.
- the polynucleotide encoding the CD155tm_3M and GFP comprises SEQ ID NO: 880 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 880.
- the CD155tm_3M-GFP construct comprises the amino acid sequence of SEQ ID NO: 879 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 879.
- a polynucleotide encoding an immunosuppressive construct comprising CD31 transmembrane domain CD31 tm.
- the CD31 tm is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD31 tm immunosuppressive construct comprises a CD8a signal peptide and a CD31 -derived protein.
- the CD31 tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 885.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 885.
- the polynucleotide comprises SEQ ID NO: 886 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 886.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the linker is positioned between the CD31 tm and the tag.
- the polynucleotide encoding the CD31 tm and GFP comprises SEQ ID NO: 884 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 884.
- the CD31 tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 883 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 883.
- a polynucleotide encoding an immunosuppressive construct comprising CD1 1 1 transmembrane domain (CD1 1 1 tm).
- the CD1 1 1 tm is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD1 1 1 tm immunosuppressive construct comprises a CD8a signal peptide and a CD1 1 1 tm-derived protein.
- the CD1 1 1 tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 889.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 889.
- the polynucleotide comprises SEQ ID NO: 890 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 890.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a linker e.g., a GS linker
- the linker is positioned between the CD1 1 1 tm and the tag.
- the polynucleotide encoding the CD1 1 1 tm and GFP comprises SEQ ID NO: 888 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 888.
- the CD1 1 1 tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 887 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 887.
- a polynucleotide encoding an immunosuppressive construct comprising CD200 transmembrane domain CD200tm.
- the CD200tm is coupled to a CD8a signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein).
- the CD200tm immunosuppressive construct comprises a CD8a signal peptide and a CD200tm-derived protein.
- the CD200tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 893.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 893.
- the polynucleotide comprises SEQ ID NO: 894 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 894.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the CD200tm and the tag.
- the polynucleotide encoding the CD200tm and GFP comprises SEQ ID NO: 892 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 892.
- the CD200tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 891 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 891 .
- the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271 .
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271 .
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises is encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271 .
- the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271 .
- immune cells are engineered to alter their HLA expression profile, order to interact with one or more inhibitory receptors on host immune cells.
- the alteration of the HLA expression profile of engineered cells functions to impart to the engineered immune cell the ability to reduce or avoid cytotoxicity or other immune clearance by host immune cells (or other engineered immune cells), thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
- HLA-E Human leukocyte antigen-E
- CD94/NKG2A Human leukocyte antigen-E
- an inhibitory signaling cascade is initiated, resulting in reduced NK cell activity.
- expression of HLA- E can dampen the cytotoxic effects of host NK cells against an engineered immune cell (e.g., expressing a CAR and/or immunosuppressive peptides).
- HLA-G also plays an important role in inhibiting natural killer (NK) cell function, not only in the maintenance of fetal-maternal immune tolerance but also in the context of organ or tissue transplantation.
- HLA-G can inhibit the function of many immune cells such as NK cells, CD4+ and CD8+ T cells, and dendritic cells by binding to cell surface-expressed receptors, including immunoglobulin-like transcript 2 (ILT2), ILT4 and killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4).
- immune cells as disclosed herein are engineered to express HLA-E and/or HLA-G in order to suppress host NK cell (or other engineered NK cells administered) against the engineered immune cells.
- Figures 26I- 26J show an engineered immune cell according to embodiments disclosed herein that expresses a CAR comprising an immunosuppressive domain as well as a membrane-bound immunosuppressive construct.
- expression of HLA-E and/or HLA-G is in connection with a CAR and not a membrane-bound immunosuppressive construct, or optionally with a CAR that does not include a immunosuppressive domain.
- FIG 26J schematically depicts another non-limiting embodiment wherein HLA-E and/or HLA-G are co-expressed with one or more membrane-bound immunosuppressive constructs, optionally a CAR (with or without an integrated immunosuppressive domain) and optionally one or more additional immunosuppressive proteins (non-limiting examples of with include, but are not limited to CD47, PD-L1 , and the poliovirus receptor (PVR, also known as CD155).
- CD47, PD-L1 and CD155 can operate to reduce activity of immune cells (e.g., host immune cells and/or other administered engineered immune cells). Any combination of these molecules, or any others disclosed herein can be used.
- HLA-E and or HLA-G can aid in reduce NK cell activity against immune cells engineered to express HLA-E and or HLA- G.
- this re-expression is coupled with gene editing to reduce NKG2A expression on NK cells to be administered, which limits the suppressive effect of HLA-E on the therapeutic cells themselves.
- HLA-E expression is specifically introduced only on T cells. In several embodiments, those T cells operate to suppress NK cell activity via interaction with the NKG2A receptor on NK cells.
- the activity of the engineered allogeneic NK cells is suppressed temporarily.
- the temporary suppression of engineered allogeneic NK cell activity reduces the risk of NK cell exhaustion, which prolongs the persistence of the engineered allogeneic NK cells.
- a polynucleotide encoding HLA-E encodes an HLA-E amino acid sequence comprising SEQ ID NO: 273.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 273.
- the polynucleotide comprises SEQ ID NO: 274 or shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 274.
- the encoded HLA-E is an HLA-E single chain trimer (SCT) composed of a canonical HLA-E binding peptide, mature human beta2-microglobulin, and mature HLA-E heavy chain (HLA-E trimer_SS).
- the construct comprises a CD8a signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), and an HLA-E sequence.
- the HLA-E trimer_SS construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 276 or SEQ ID NO: 689.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 276 or SEQ ID NO: 689.
- the polynucleotide comprises SEQ ID NO: 277 (or SEQ ID NO: 690) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 277 or SEQ ID NO: 690.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the HLA-E trimer_SS construct and GFP comprises SEQ ID NO: 275 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 275.
- the polynucleotide encoding the HLA-E trimer_SS construct, a FLAG tag, and GFP comprises SEQ ID NO: 688 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 688.
- the HLA-E trimer_SS construct with a FLAG tag and GFP is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 687, or having at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 687.
- HLA-G trimer_SS construct comprises a CD8a signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), and an HLA-G sequence.
- the HLA-G trimer_SS construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 279.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 279.
- the HLA-G polypeptide comprises a functional portion of SEQ ID NO: 278.
- MHC class l-restricted CD8+ cytotoxic T lymphocytes are recruited to control viral infections. These cytotoxic T lymphocytes recognize and lyse virus-infected cells through engagement of the lymphocyte T cell receptor with MHC class I molecules that present viral antigens on the surface of infected cells. MHC class I heavy chain associates with beta-2 microglobulin (B2M) to form a heterodimer, which constitutes part of the MHC class I peptide-loading complex.
- B2M beta-2 microglobulin
- Human cytomegalovirus has evolved several gene products of the unique short region protein, US2, US3, US6, and US1 1 , which interfere with antigen presentation and cell surface expression of MHC class I molecules.
- MHC class I molecules While interference in antigen presentation and MHC class I down-regulation on the cell surface allows infected cells to evade virus-specific cytotoxic T lymphocytes, the down-regulation of MHC class I molecules renders the virally infected cells more susceptible to host NK cells.
- human cytomegalovirus encodes multiple genes that function to evade NK-mediated cell lysis of infected cells, one of which is UL18.
- UL18 binds LIR-1 , an NK cell inhibitory receptor.
- UL18 shares a high level of amino acid sequence identity with MHC class I and therefore UL18 can act as an MHCI surrogate and associate with B2M.
- a chimeric UL18-B2M construct (see a non-limiting schematic at Figure 27) is expressed on engineered cells as disclosed herein, enabling UL18 interaction with the LIR-1 receptor on NK cells (either host or administered) and reduce the cytotoxic activity of those NK cells against the engineered UL18-expressing immune cell.
- a polynucleotide encoding UL18 encodes an amino acid sequence comprising SEQ ID NO: 280.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 280.
- the polynucleotide comprises SEQ ID NO: 281 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 281 .
- the encoded UL18 is an chimeric UL18-B2M single chain trimer (SCT) composed of a canonical HLA-E binding peptide, mature human beta2-microglobulin, and UL18.
- the chimeric UL18-B2M construct comprises a CD8a signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), an a UL18 sequence.
- the chimeric UL18-B2M construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 283.
- the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 283 or SEQ ID NO: 686.
- the polynucleotide comprises SEQ ID NO: 284 (or SEQ ID NO: 685) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 284 (or SEQ ID NO: 685).
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- the polynucleotide encoding the chimeric UL18-B2M construct and GFP comprises SEQ ID NO: 292 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 292.
- the polynucleotide encoding the chimeric UL18-B2M construct, a FLAG tag and GFP comprises SEQ ID NO: 684 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 684.
- the polynucleotide encoding the chimeric UL18-B2M construct with a FLAG tag and GFP encodes the amino acid sequence of SEQ ID NO: 684 or a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 684.
- the polynucleotide encoding the chimeric UL18-B2M construct encodes the amino acid sequence of SEQ ID NO: 285 or a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 285.
- the polynucleotide comprises SEQ ID NO: 281 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 285.
- the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
- the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR is encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
- the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
- HLA can be re-expressed, for example HLA-E or HLA-G.
- the re-expression of the HLA is accomplished using a disulfilde trap single chain trimer (dtSCT) is used to express HLA-E and/or HLA-G and an immunosuppressive peptide, as well as B2M (HLA-E_STE20 or HLA-E_STE15).
- dtSCT disulfilde trap single chain trimer
- a polynucleotide encoding a chimeric immunosuppressive construct comprising an HLA-G peptide, mature B2M and mature HLA-E.
- a construct comprises one or more linkers.
- the immunosuppressive construct comprises a B2M signal peptide, an HLA-G peptide (amino acids 3-1 1 of HLA-G), a disulfide-bridge containing linker (e.g., a GS linker comprising at least two cysteine residues), a mature B2M domain, an additional linker (e.g., a GS linker), and a mature HLA-E domain.
- the HLA-E_STE20 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 829.
- the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 829.
- the polynucleotide comprises SEQ ID NO: 830 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 830.
- the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP).
- a detectable tag e.g., a FLAG tag
- IVS internal ribosome entry site
- a linker (e.g., a GS linker) is positioned between the HLA-E_STE20 and the tag.
- the polynucleotide encoding HLA-E_STE20 and GFP comprises SEQ ID NO: 828 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 828.
- the HLA-E_STE20-GFP construct comprises the amino acid sequence of SEQ ID NO: 827 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 827.
- compositions and methods described herein relate to a chimeric antigen receptor that includes an extracellular domain that comprises a tumor-binding domain (also referred to as an antigen-binding protein or antigen-binding domain) as described herein.
- the tumor binding domain targets, for example CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among others.
- a chimeric receptor that includes an extracellular domain that comprises a ligand binding domain that binds a ligand expressed by a tumor cell (also referred to as an activating chimeric receptor) as described herein.
- the ligand binding domain depending on the embodiment, targets for example MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others).
- the antigen-binding domain is derived from or comprises wild-type or non-wild-type sequence of an antibody, an antibody fragment, an scFv, a Fv, a Fab, a (Fab')2, a single domain antibody (SDAB ), a vH or vL domain, a camelid VHH domain, or a non-immunoglobulin scaffold such as a DARPIN, an affibody, an affilin, an adnectin, an affitin, a repebody, a fynomer, an alphabody, an avimer, an atrimer, a centyrin, a pronectin, an anticalin, a kunitz domain, an Armadillo repeat protein, an autoantigen, a receptor or a ligand.
- a non-immunoglobulin scaffold such as a DARPIN, an affibody, an affilin, an adnectin, an
- the tumor-binding domain contains more than one antigen binding domain.
- the antigen-binding domain is operably linked directly or via an optional linker to the NH2-terminal end of a TCR domain (e.g. constant chains of TCR-alpha, TCR- betal, TCR-beta2, preTCR-alpha, pre-TCR-alpha-Del48, TCR-gamma, or TCR-delta).
- antigen-binding proteins there are provided, in several embodiments, antigen-binding proteins.
- the term “antigen-binding protein” shall be given its ordinary meaning, and shall also refer to a protein comprising an antigen-binding fragment that binds to an antigen and, optionally, a scaffold or framework portion that allows the antigen-binding fragment to adopt a conformation that promotes binding of the antigen-binding protein to the antigen.
- the antigen is a cancer antigen (e.g., CD19) or a fragment thereof.
- the antigen-binding fragment comprises at least one CDR from an antibody that binds to the antigen.
- the antigen-binding fragment comprises all three CDRs from the heavy chain of an antibody that binds to the antigen or from the light chain of an antibody that binds to the antigen. In still some embodiments, the antigen-binding fragment comprises all six CDRs from an antibody that binds to the antigen (three from the heavy chain and three from the light chain). In several embodiments, the antigen-binding fragment comprises one, two, three, four, five, or six CDRs from an antibody that binds to the antigen, and in several embodiments, the CDRs can be any combination of heavy and/or light chain CDRs.
- the antigen-binding fragment in some embodiments is an antibody fragment.
- Nonlimiting examples of antigen-binding proteins include antibodies, antibody fragments (e.g., an antigen-binding fragment of an antibody), antibody derivatives, and antibody analogs. Further specific examples include, but are not limited to, a single-chain variable fragment (scFv), a nanobody (e.g. VH domain of camelid heavy chain antibodies; VHH fragment,), a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a Fd fragment, and a complementarity determining region (CDR) fragment. These molecules can be derived from any mammalian source, such as human, mouse, rat, rabbit, or pig, dog, or camelid.
- scFv single-chain variable fragment
- a nanobody e.g. VH domain of camelid heavy chain antibodies; VHH fragment,
- Fab fragment e.g. VH domain of camelid heavy chain antibodies
- Fab' fragment e.g. VH domain of camelid heavy chain antibodies
- Antibody fragments may compete for binding of a target antigen with an intact (e.g., native) antibody and the fragments may be produced by the modification of intact antibodies (e.g. enzymatic or chemical cleavage) or synthesized de novo using recombinant DNA technologies or peptide synthesis.
- the antigen-binding protein can comprise, for example, an alternative protein scaffold or artificial scaffold with grafted CDRs or CDR derivatives.
- Such scaffolds include, but are not limited to, antibody-derived scaffolds comprising mutations introduced to, for example, stabilize the three-dimensional structure of the antigenbinding protein as well as wholly synthetic scaffolds comprising, for example, a biocompatible polymer.
- peptide antibody mimetics (“PAMs”) can be used, as well as scaffolds based on antibody mimetics utilizing fibronectin components as a scaffold.
- the antigen-binding protein comprises one or more antibody fragments incorporated into a single polypeptide chain or into multiple polypeptide chains.
- antigen-binding proteins can include, but are not limited to, a diabody; an intrabody; a domain antibody (single VL or VH domain or two or more VH domains joined by a peptide linker;); a maxibody (2 scFvs fused to Fc region); a triabody; a tetrabody; a minibody (scFv fused to CH3 domain); a peptibody (one or more peptides attached to an Fc region); a linear antibody (a pair of tandem Fd segments (VH-CH1 -VH-CH1 ) which, together with complementary light chain polypeptides, form a pair of antigen binding regions); a small modular immunopharmaceutical; and immunoglobulin fusion proteins (e.g. IgG-scFv,
- the antigen-binding protein has the structure of an immunoglobulin.
- immunoglobulin shall be given its ordinary meaning, and shall also refer to a tetrameric molecule, with each tetramer comprising two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” chain (about 50-70 kDa).
- the amino-terminal portion of each chain includes a variable region of about 100 to 1 10 or more amino acids primarily responsible for antigen recognition.
- the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
- variable (V) and constant regions (C) are joined by a “J” region of about 12 or more amino acids, with the heavy chain also including a “D” region of about 10 more amino acids.
- the variable regions of each light/heavy chain pair form the antibody binding site such that an intact immunoglobulin has two binding sites.
- Immunoglobulin chains exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs. From N-terminus to C-terminus, both light and heavy chains comprise the domains FR1 , CDR1 , FR2, CDR2, FR3, CDR3 and FR4.
- a light chain refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations.
- Kappa (K) and lambda (A) light chains refer to the two major antibody light chain isotypes.
- a light chain may include a polypeptide comprising, from amino terminus to carboxyl terminus, a single immunoglobulin light chain variable region (VL) and a single immunoglobulin light chain constant domain (CL).
- Heavy chains are classified as mu (g), delta (A), gamma (y), alpha (a), and epsilon (e), and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
- An antibody “heavy chain” refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
- a heavy chain may include a polypeptide comprising, from amino terminus to carboxyl terminus, a single immunoglobulin heavy chain variable region (VH), an immunoglobulin heavy chain constant domain 1 (CH1 ), an immunoglobulin hinge region, an immunoglobulin heavy chain constant domain 2 (CH2), an immunoglobulin heavy chain constant domain 3 (CH3), and optionally an immunoglobulin heavy chain constant domain 4 (CH4).
- VH immunoglobulin heavy chain variable region
- CH1 immunoglobulin heavy chain constant domain 1
- CH2 immunoglobulin heavy chain constant domain 2
- CH3 immunoglobulin heavy chain constant domain 3
- CH4 optionally an immunoglobulin heavy chain constant domain 4
- the IgG-class is further divided into subclasses, namely, lgG1 , lgG2, lgG3, and lgG4.
- the IgA-class is further divided into subclasses, namely lgA1 and lgA2.
- the IgM has subclasses including, but not limited to, lgM1 and lgM2.
- the heavy chains in IgG, IgA, and IgD antibodies have three domains (CH1 , CH2, and CH3), whereas the heavy chains in IgM and IgE antibodies have four domains (CH1 , CH2, CH3, and CH4).
- the immunoglobulin heavy chain constant domains can be from any immunoglobulin isotype, including subtypes.
- the antibody chains are linked together via inter-polypeptide disulfide bonds between the CL domain and the CH1 domain (e.g., between the light and heavy chain) and between the hinge regions of the antibody heavy chains.
- the antigen-binding protein is an antibody.
- antibody refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen.
- Antibodies can be monoclonal, or polyclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources.
- Antibodies can be tetramers of immunoglobulin molecules.
- the antibody may be “humanized”, “chimeric” or nonhuman.
- An antibody may include an intact immunoglobulin of any isotype, and includes, for instance, chimeric, humanized, human, and bispecific antibodies.
- an intact antibody will generally comprise at least two full-length heavy chains and two full-length light chains.
- Antibody sequences can be derived solely from a single species, or can be “chimeric,” that is, different portions of the antibody can be derived from two different species as described further below.
- the term “antibody” also includes antibodies comprising two substantially full-length heavy chains and two substantially full-length light chains provided the antibodies retain the same or similar binding and/or function as the antibody comprised of two full length light and heavy chains.
- antibodies having 1 , 2, 3, 4, or 5 amino acid residue substitutions, insertions or deletions at the N-terminus and/or C-terminus of the heavy and/ or light chains are included in the definition provided that the antibodies retain the same or similar binding and/or function as the antibodies comprising two full length heavy chains and two full length light chains.
- antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, bispecific antibodies, and synthetic antibodies. There is provided, in some embodiments, monoclonal and polyclonal antibodies.
- the term “polyclonal antibody” shall be given its ordinary meaning, and shall also refer to a population of antibodies that are typically widely varied in composition and binding specificity.
- mAb monoclonal antibody
- the antigen-binding protein is a fragment or antigen-binding fragment of an antibody.
- antibody fragment refers to at least one portion of an antibody, that retains the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen.
- antibody fragments include, but are not limited to, Fab, Fab’, F(ab’)2, Fv fragments, scFv antibody fragments, disu Ifide-li nked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either vL or vH), camelid vHH domains, multi-specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody.
- An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23: 1 126-1 136, 2005).
- Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3)(see U.S. Patent No. 6,703,199, which describes fibronectin polypeptide mini bodies).
- An antibody fragment may include a Fab, Fab’, F(ab’)2, and/or Fv fragment that contains at least one CDR of an immunoglobulin that is sufficient to confer specific antigen binding to a cancer antigen (e.g., CD19).
- Antibody fragments may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.
- Fab fragments are provided.
- a Fab fragment is a monovalent fragment having the VL, VH, CL and CH1 domains;
- a F(ab’)2 fragment is a bivalent fragment having two Fab fragments linked by a disulfide bridge at the hinge region;
- a Fd fragment has the VH and CH1 domains;
- an Fv fragment has the VL and VH domains of a single arm of an antibody;
- a dAb fragment has a VH domain, a VL domain, or an antigen-binding fragment of a VH or VL domain.
- these antibody fragments can be incorporated into single domain antibodies, single-chain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv.
- the antibodies comprise at least one CDR as described herein.
- single-chain variable fragments there is also provided for herein, in several embodiments, single-chain variable fragments.
- single-chain variable fragment (“scFv”) shall be given its ordinary meaning, and shall also refer to a fusion protein in which a VL and a VH region are joined via a linker (e.g., a synthetic sequence of amino acid residues) to form a continuous protein chain wherein the linker is long enough to allow the protein chain to fold back on itself and form a monovalent antigen binding site ).
- a “single-chain variable fragment” is not an antibody or an antibody fragment as defined herein.
- Diabodies are bivalent antibodies comprising two polypeptide chains, wherein each polypeptide chain comprises VH and VL domains joined by a linker that is configured to reduce or not allow for pairing between two domains on the same chain, thus allowing each domain to pair with a complementary domain on another polypeptide chain.
- a linker that is configured to reduce or not allow for pairing between two domains on the same chain, thus allowing each domain to pair with a complementary domain on another polypeptide chain.
- Polypeptide chains having different sequences can be used to make a diabody with two different antigen binding sites.
- tribodies and tetrabodies are antibodies comprising three and four polypeptide chains, respectively, and forming three and four antigen binding sites, respectively, which can be the same or different.
- the antigen-binding protein comprises one or more CDRs.
- CDR shall be given its ordinary meaning, and shall also refer to the complementarity determining region (also termed “minimal recognition units” or “hypervariable region”) within antibody variable sequences.
- the CDRs permit the antigen-binding protein to specifically bind to a particular antigen of interest.
- the CDRs in each of the two chains typically are aligned by the framework regions to form a structure that binds specifically to a specific epitope or domain on the target protein.
- From N-terminus to C-terminus naturally-occurring light and heavy chain variable regions both typically conform to the following order of these elements: FR1 , CDR1 , FR2, CDR2, FR3, CDR3 and FR4.
- a numbering system has been devised for assigning numbers to amino acids that occupy positions in each of these domains. This numbering system is defined in Kabat Sequences of Proteins of Immunological Interest (1987 and 1991 , NIH, Bethesda, MD), or Chothia & Lesk, 1987, J. Mol. Biol.
- CDRs Complementarity determining regions
- FR framework regions
- Other numbering systems for the amino acids in immunoglobulin chains include IMGT® (the international ImMunoGeneTics information system; Lefranc et al, Dev. Comp. Immunol. 29:185-203; 2005) and AHo (Honegger and Pluckthun, J. Mol. Biol. 309(3):657-670; 2001 ).
- One or more CDRs may be incorporated into a molecule either covalently or noncovalently to make it an antigen-binding protein.
- the antigen-binding proteins provided herein comprise one or more CDR(s) as part of a larger polypeptide chain. In some embodiments, the antigen-binding proteins covalently link the one or more CDR(s) to another polypeptide chain. In some embodiments, the antigen-binding proteins incorporate the one or more CDR(s) noncovalently. In some embodiments, the antigen-binding proteins may comprise at least one of the CDRs described herein incorporated into a biocompatible framework structure.
- the biocompatible framework structure comprises a polypeptide or portion thereof that is sufficient to form a conformationally stable structural support, or framework, or scaffold, which is able to display one or more sequences of amino acids that bind to an antigen (e.g., CDRs, a variable region, etc.) in a localized surface region.
- an antigen e.g., CDRs, a variable region, etc.
- Such structures can be a naturally occurring polypeptide or polypeptide “fold” (a structural motif), or can have one or more modifications, such as additions, deletions and/or substitutions of amino acids, relative to a naturally occurring polypeptide or fold.
- the scaffolds can be derived from a polypeptide of a variety of different species (or of more than one species), such as a human, a non-human primate or other mammal, other vertebrate, invertebrate, plant, bacteria or virus.
- the biocompatible framework structures are based on protein scaffolds or skeletons other than immunoglobulin domains. In some such embodiments, those framework structures are based on fibronectin, ankyrin, lipocalin, neocarzinostain, cytochrome b, CP1 zinc finger, PST1 , coiled coil, LACI-D1 , Z domain and/or tendamistat domains.
- antigen-binding proteins with more than one binding site.
- the binding sites are identical to one another while in some embodiments the binding sites are different from one another.
- an antibody typically has two identical binding sites, while a “bispecific” or “bifunctional” antibody has two different binding sites.
- the two binding sites of a bispecific antigen-binding protein or antibody will bind to two different epitopes, which can reside on the same or different protein targets. In several embodiments, this is particularly advantageous, as a bispecific chimeric antigen receptor can impart to an engineered cell the ability to target multiple tumor markers.
- CD19 and an additional tumor marker such as CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others, or any other marker disclosed herein or appreciated in the art as a tumor specific antigen or tumor associated antigen can be bound by a bispecific antibody.
- an additional tumor marker such as CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, MICA, MICB, ULBP1 , ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others, or any other marker disclosed herein or appreciated in the art as a tumor specific antigen or tumor associated antigen can be bound by a bispecific antibody.
- chimeric antibody shall be given its ordinary meaning, and shall also refer to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies.
- one or more of the CDRs are derived from an anti-cancer antigen (e.g., CD19, CD123, CD70, Her2, mesothelin, PD-L1 , Claudin 6, BCMA, EGFR, etc.) antibody.
- all of the CDRs are derived from an anti-cancer antigen antibody (such as an anti-CD19 antibody).
- the CDRs from more than one anti-cancer antigen antibodies are mixed and matched in a chimeric antibody.
- a chimeric antibody may comprise a CDR1 from the light chain of a first anti-cancer antigen antibody, a CDR2 and a CDR3 from the light chain of a second anti-cancer antigen antibody, and the CDRs from the heavy chain from a third anti-cancer antigen antibody.
- the framework regions of antigen-binding proteins disclosed herein may be derived from one of the same anti-cancer antigen (e.g., CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc.) antibodies, from one or more different antibodies, such as a human antibody, or from a humanized antibody.
- a portion of the heavy and/or light chain is identical with, homologous to, or derived from an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is/are identical with, homologous to, or derived from an antibody or antibodies from another species or belonging to another antibody class or subclass.
- fragments of such antibodies that exhibit the desired biological activity.
- an antigen binding protein is directed against CD38 (also known as ADP-ribosyl cyclase 1 , cADPr hydrolase 1 , Cyclic ADP-ribose hydrolase 1 , or T10).
- the CD38 antigen binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the antigen binding protein binds to an epitope of the human CD38, and in particular to an epitope of the extracellular domain of the human CD38.
- the CD38 binding protein comprises an scFv comprising a vL and vH domain.
- the anti-CD38 vL domain comprises the sequence of SEQ ID NO: 523, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 523.
- the anti-CD38 vH domain comprises the sequence of SEQ ID NO: 524, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 524.
- the anti-CD38 binding protein is an scFv that comprises the sequence of SEQ ID NO: 532, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 532.
- the anti-CD38 CAR comprises the sequence of SEQ ID NO: 525, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 525.
- the anti- CD38 binding protein comprises at least one CDR from SEQ ID NO: 526-531 or a CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 526-531 .
- the antigen binding protein is affinity matured to enhance binding to CD38.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against GPRC5D.
- the GPRC5D antigen binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the antigen binding protein binds to an epitope of the human GPRC5D.
- the anti-GPRC5D is an scFv comprising the amino acid sequence of any one of SEQ ID NOs: 621 -630, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 620-628.
- the antigen binding protein is affinity matured to enhance binding to GPRC5D.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against CD138.
- the anti-CD138 binding protein comprises a vL and/or vH chain.
- the vL chain comprises the amino acid sequence of SEQ ID NO: 533, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 533.
- the vH chain comprises the amino acid sequence of SEQ ID NO: 534, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 534.
- the anti-CD138 binding protein comprises at least one CDR from SEQ ID NO: 536-541 or a CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 536-541 .
- the anti-CD138 binding protein is an scFv comprising the amino acid sequence of SEQ ID NO: 542, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 542.
- the anti-CD138 binding protein is integrated into a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein comprising the amino acid sequence of SEQ ID NO: 535 or 543, , or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 535 or 543.
- the antigen binding protein is affinity matured to enhance binding to CD138.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against DLL3.
- the anti-DLL3 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-DLL3 antigen binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 570-581 , or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 570-581 .
- the anti-DLL3 antigen binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 582-593, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 582- 593.
- the anti-DLL3 binding protein comprises a polypeptide that targets DLL3 and comprises the amino acid sequence of any of SEQ ID NO: 594-595, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 594-595.
- the anti- DLL3 binding protein comprises an scFv comprising the sequence of any of SEQ ID NO: 596-599, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 596-599.
- the antigen binding protein is affinity matured to enhance binding to DLL3.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against the epidermal growth factor receptor EGFR.
- the anti-EGFR binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a costimulatory domain as disclosed herein.
- the anti-EGFR binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NO: 600, 606-607, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 600, 606-607.
- the anti-EGFR binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NO: 601 , 608-609, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 601 , 608-609.
- the anti-EGFR binding protein is an scFv comprising the amino acid sequence of any of SEQ ID NOs: 610-620, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 610-620.
- the anti-EGFR binding protein is incorporated into a CAR having the sequence of any of SEQ ID NOs: 602-605, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 602-605.
- the antigen binding protein is affinity matured to enhance binding to the EGFR.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against PSMA.
- the anti-PSMA binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-PSMA binding protein comprises a vL chain comprising the amino acid sequence of SEQ ID NO: 634, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 634.
- the anti-PSMA binding protein comprises a vH chain comprising the amino acid sequence of SEQ ID NO: 635, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 635.
- the anti-PSMA binding protein comprises an scFv comprising the amino acid sequence of SEQ ID NO: 632 or 633, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 632 or 633.
- the anti-PSMA binding protein comprises an antibody comprising the amino acid sequence of SEQ ID NO: 631 , or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 631 .
- the antigen binding protein is affinity matured to enhance binding to PSMA.
- the nucleotide sequence encoding the antigen binding protein is codon- optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against FLT3.
- the anti-FLT3 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-FLT3 binding protein comprises one or more CDRs from the vL and/or vH chain selected from SEQ ID NOs: 636-644, or a o CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 636-644.
- the anti-FLT3 binding protein comprises a vL chain comprising the amino acid sequence of SEQ ID NO: 645, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 645.
- the anti-FLT3 binding protein comprises a vH chain comprising the amino acid sequence of SEQ ID NO: 646, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 646.
- the antigen binding protein is affinity matured to enhance binding to FLT3.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against KREMEN2.
- the anti-KREMEN2 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-KREMEN2 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 647-651 , or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 647-651 .
- the anti- KREMEN2 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 652-656, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 652-656.
- the antigen binding protein is affinity matured to enhance binding to KREMEN2.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against ALPPL2.
- the anti-ALPPL2 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-ALPPL2 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 657-659, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 657-659.
- the anti-ALPPL2 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 660-662, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 660-662.
- the anti-ALPPL2 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 657- 662, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 657-662.
- the antigen binding protein is affinity matured to enhance binding to ALPPL2.
- the nucleotide sequence encoding the antigen binding protein is codon- optimized to enhance expression and/or stability of the protein.
- an antigen binding protein is directed against CLDN4.
- the anti-CLDN4 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-CLDN4 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 663, 664, or 667, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 663, 664, or 667.
- the anti-CLDN4 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 665, 666, or 668, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 665, 666, or 668.
- the anti-CLDN4 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 663-668, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 663-668.
- the antigen binding protein is affinity matured to enhance binding to CLDN4.
- the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
- the antigen binding protein binds to CLDN4, but not to other claudins.
- an antigen binding protein is directed against CLDN6.
- the anti-CLDN6 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein.
- the anti-CLDN6 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 669-678, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 669-678.
- the anti-CLDN6 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 679-682, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 679-682.
- the anti-CLDN6 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 669- 682, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 669-682.
- the antigen binding protein is affinity matured to enhance binding to CLDN6.
- the nucleotide sequence encoding the antigen binding protein is codon- optimized to enhance expression and/or stability of the protein.
- the antigen binding protein binds to CLDN6, but not to other claudins.
- an antigen-binding protein comprising a heavy chain variable domain having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33.
- the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VH domain amino acid sequence set forth in SEQ ID NO: 33, but retains specific binding to a cancer antigen (e.g., CD19).
- the heavy chain variable domain may have one or more additional mutations in the VH domain amino acid sequence set forth in SEQ ID NO: 33, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a light chain variable domain having at least 90% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 95% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VL domain amino acid sequence set forth in SEQ ID NO: 32, but retains specific binding to a cancer antigen (e.g., CD19).
- the light chain variable domain may have one or more additional mutations in the VL domain amino acid sequence set forth in SEQ ID NO: 32, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a heavy chain variable domain having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 90% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 95% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 96, 97, 98, or 99% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the antigen-binding protein comprises a heavy chain variable domain having the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having the VL domain amino acid sequence set forth in SEQ ID NO: 32.
- the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a light chain variable domain of SEQ ID NO: 32.
- the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with SEQ ID NO: 33.
- the light chain variable domain comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the polynucleotide sequence SEQ ID NO: 32.
- the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain in accordance with the sequence in SEQ ID NO: 32.
- the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain in accordance with the sequence in SEQ ID NO: 32.
- the heavy chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33.
- the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33.
- the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33.
- additional anti-CD19 binding constructs are provided.
- an scFv that targets CD19 wherein the scFv comprises a heavy chain variable region comprising the sequence of SEQ ID NO. 35.
- the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the HCV domain amino acid sequence set forth in SEQ ID NO: 35.
- the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the HCV domain amino acid sequence set forth in SEQ ID NO: 35.
- the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the HCV domain amino acid sequence set forth in SEQ ID NO: 35, but retains specific binding to a cancer antigen (e.g., CD19).
- the heavy chain variable domain may have one or more additional mutations in the HCV domain amino acid sequence set forth in SEQ ID NO: 35, but has improved specific binding to a cancer antigen (e.g., CD19).
- an scFv that targets CD19 comprises a light chain variable region comprising the sequence of SEQ ID NO. 36.
- the antigen-binding protein comprises a light chain variable domain having at least 95% identity to the LCV domain amino acid sequence set forth in SEQ ID NO: 36.
- the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% identity to the LCV domain amino acid sequence set forth in SEQ ID NO: 36.
- the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the LCV domain amino acid sequence set forth in SEQ ID NO: 36, but retains specific binding to a cancer antigen (e.g., CD19).
- the light chain variable domain may have one or more additional mutations in the LCV domain amino acid sequence set forth in SEQ ID NO: 36, but has improved specific binding to a cancer antigen (e.g., CD19).
- an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively.
- the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively.
- the LC CDR1 comprises the sequence of SEQ ID NO. 37.
- the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 37.
- the LC CDR2 comprises the sequence of SEQ ID NO. 38. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 38. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 39. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 39. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 40.
- the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 40.
- the HC CDR2 comprises the sequence of SEQ ID NO. 41 , 42, or 43.
- the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 41 , 42, or 43.
- the HC CDR3 comprises the sequence of SEQ ID NO. 44.
- the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 44.
- an anti-CD19 binding moiety that comprises a light chain variable region (VL) and a heavy chain variable region (HL), the VL region comprising a first, second and third complementarity determining region (VL CDR1 , VL CDR2, and VL CDR3, respectively and the VH region comprising a first, second and third complementarity determining region (VH CDR1 , VH CDR2, and VH CDR3, respectively.
- the VL region comprises the sequence of SEQ ID NO. 45, 46, 47, or 48.
- the VL region comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 45, 46, 47, or 48. In several embodiments, the VH region comprises the sequence of SEQ ID NO. 49, 50, 51 or 52. In several embodiments, the VH region comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 49, 50, 51 or 52.
- an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively.
- the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively.
- the LC CDR1 comprises the sequence of SEQ ID NO. 53.
- the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 53.
- the LC CDR2 comprises the sequence of SEQ ID NO. 54. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 54. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 55. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 55. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 56.
- the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 56.
- the HC CDR2 comprises the sequence of SEQ ID NO. 57.
- the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 57.
- the HC CDR3 comprises the sequence of SEQ ID NO. 58.
- the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 58.
- the antigen-binding protein comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable region having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% sequence identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% sequence identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104.
- the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VH domain amino acid sequence set forth in SEQ ID NO: 104, but retains specific binding to a cancer antigen (e.g., CD19).
- the heavy chain variable domain may have one or more additional mutations in the VH domain amino acid sequence set forth in SEQ ID NO: 104, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 95% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105.
- the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VL domain amino acid sequence set forth in SEQ ID NO: 105, but retains specific binding to a cancer antigen (e.g., CD19).
- the light chain variable domain may have one or more additional mutations in the VL domain amino acid sequence set forth in SEQ ID NO: 105, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a heavy chain variable domain having the VH domain amino acid sequence set forth in SEQ ID NO: 104, and a light chain variable domain having the VL domain amino acid sequence set forth in SEQ ID NO: 105.
- the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a light chain variable domain of SEQ ID NO: 105.
- the heavy-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with SEQ ID NO: 104.
- the antigen-binding protein comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 90% sequence identity to the VH amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 95% sequence identity to the VH amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 96, 97, 98, or 99% identity to the VH amino acid sequence set forth in SEQ ID NO: 106.
- the heavy chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VH amino acid sequence set forth in SEQ ID NO: 106, but retains specific binding to a cancer antigen (e.g., CD19).
- the heavy chain variable may have one or more additional mutations in the VH amino acid sequence set forth in SEQ ID NO: 106, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a light chain variable comprising the amino acid sequence of SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% sequence identity to the VL amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 95% sequence identity to the VL amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 96, 97, 98, or 99% identity to the VL amino acid sequence set forth in SEQ ID NO: 107.
- the light chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VL amino acid sequence set forth in SEQ ID NO: 107, but retains specific binding to a cancer antigen (e.g., CD19).
- the light chain variable may have one or more additional mutations in the VL amino acid sequence set forth in SEQ ID NO: 107, but has improved specific binding to a cancer antigen (e.g., CD19).
- an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively.
- the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively.
- the LC CDR1 comprises the sequence of SEQ ID NO. 108.
- the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 108.
- the LC CDR2 comprises the sequence of SEQ ID NO. 109. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 109. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 1 10. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 1 10. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 1 1 1 .
- the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 1 1 1 .
- the HC CDR2 comprises the sequence of SEQ ID NO. 1 12, 1 13, or 1 14.
- the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 1 12, 1 13, or 1 14.
- the HC CDR3 comprises the sequence of SEQ ID NO. 1 15.
- the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 1 15.
- the anti-CD19 binding moiety comprises SEQ ID NO: 1 16, or is sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 1 16.
- the antigen-binding protein comprises a light chain variable comprising the amino acid sequence of SEQ ID NO: 1 17, 1 18, or 1 19. In some embodiments, the antigenbinding protein comprises a light chain variable region having at least 90% identity to the VL amino acid sequence set forth in SEQ ID NO: 1 17, 1 18, or 1 19. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 95% identity to the VL amino acid sequence set forth in SEQ ID NO: 1 17, 1 18, or 1 19. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 96, 97, 98, or 99% identity to the VL amino acid sequence set forth in SEQ ID NO:
- the light chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VL amino acid sequence set forth in SEQ ID NO: 1 17,
- the light chain variable may have one or more additional mutations in the VL amino acid sequence set forth in SEQ ID NO: 1 17, 1 18, or 1 19, but has improved specific binding to a cancer antigen (e.g., CD19).
- the antigen-binding protein comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 120,121 , 122, or 123. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 90% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121 , 122, or 123. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 95% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121 , 122, or 123.
- the antigen-binding protein comprises a heavy chain variable having at least 96, 97, 98, or 99% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121 , 122, or 123.
- the heavy chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VH amino acid sequence set forth in SEQ ID NO: 120,121 , 122, or 123, but retains specific binding to a cancer antigen (e.g., CD19).
- the heavy chain variable may have one or more additional mutations in the VH amino acid sequence set forth in SEQ ID NO: 120,121 , 122, or 123, but has improved specific binding to a cancer antigen (e.g., CD19).
- a cancer antigen e.g., CD19
- an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1 , LC CDR2, and LC CDR3, respectively.
- the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1 , HC CDR2, and HC CDR3, respectively.
- the LC CDR1 comprises the sequence of SEQ ID NO. 124, 127, or 130.
- the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 124, 127, or 130.
- the LC CDR2 comprises the sequence of SEQ ID NO. 125, 128, or 131 .
- the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 125, 128, or 131 .
- the LC CDR3 comprises the sequence of SEQ ID NO. 126, 129, or 132.
- the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 126, 129, or 132.
- the HC CDR1 comprises the sequence of SEQ ID NO. 133, 136, 139, or
- the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 133, 136, 139, or
- the HC CDR2 comprises the sequence of SEQ ID NO. 134, 137, 140, or
- the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 134, 137, 140, or
- the HC CDR3 comprises the sequence of SEQ ID NO. 135, 138, 141 , or
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202180092683.6A CN116940367A (zh) | 2020-12-03 | 2021-12-02 | 工程化改造免疫细胞用于增强的效力和持久性的方法以及工程化细胞在免疫疗法中的用途 |
| JP2023533999A JP2023552998A (ja) | 2020-12-03 | 2021-12-02 | 効力および持続性の増強のために免疫細胞を操作する方法、ならびに免疫療法における操作された細胞の使用 |
| EP21901656.5A EP4255453A4 (en) | 2020-12-03 | 2021-12-02 | Methods for manipulating immune cells for increased potency and persistence, as well as uses of engineered cells in immunotherapy |
| US18/255,222 US20240335536A1 (en) | 2020-12-03 | 2021-12-02 | Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy |
| CA3200367A CA3200367A1 (en) | 2020-12-03 | 2021-12-02 | Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy |
| AU2021392809A AU2021392809A1 (en) | 2020-12-03 | 2021-12-02 | Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy |
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063121206P | 2020-12-03 | 2020-12-03 | |
| US63/121,206 | 2020-12-03 | ||
| US202163201159P | 2021-04-15 | 2021-04-15 | |
| US63/201,159 | 2021-04-15 | ||
| US202163236167P | 2021-08-23 | 2021-08-23 | |
| US63/236,167 | 2021-08-23 | ||
| US202163264223P | 2021-11-17 | 2021-11-17 | |
| US202163264234P | 2021-11-17 | 2021-11-17 | |
| US63/264,223 | 2021-11-17 | ||
| US63/264,234 | 2021-11-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2022120370A2 true WO2022120370A2 (en) | 2022-06-09 |
| WO2022120370A3 WO2022120370A3 (en) | 2022-07-14 |
Family
ID=81854915
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/072715 Ceased WO2022120370A2 (en) | 2020-12-03 | 2021-12-02 | Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20240335536A1 (https=) |
| EP (1) | EP4255453A4 (https=) |
| JP (1) | JP2023552998A (https=) |
| AU (1) | AU2021392809A1 (https=) |
| CA (1) | CA3200367A1 (https=) |
| WO (1) | WO2022120370A2 (https=) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117384852A (zh) * | 2022-07-11 | 2024-01-12 | 士泽生物医药(苏州)有限公司 | 一种表达lgals9的通用型细胞及其制备方法 |
| CN117384853A (zh) * | 2022-07-11 | 2024-01-12 | 士泽生物医药(苏州)有限公司 | 一种表达pvr的通用型细胞及其制备方法 |
| WO2024030970A3 (en) * | 2022-08-03 | 2024-04-11 | Nkarta, Inc. | Genetic editing of target genes to enhance natural killer cell function |
| WO2024099265A1 (zh) * | 2022-11-07 | 2024-05-16 | 上海先博生物科技有限公司 | 工程化嵌合抗原受体免疫细胞及其应用 |
| WO2024113714A1 (zh) * | 2022-11-28 | 2024-06-06 | 上海恩凯细胞技术有限公司 | 敲低nkg2a基因的car-免疫细胞及其用途 |
| WO2024107891A3 (en) * | 2022-11-16 | 2024-06-20 | Nkarta, Inc. | Dosing regimens for combination therapies |
| WO2024211554A1 (en) * | 2023-04-07 | 2024-10-10 | Nkarta, Inc. | Methods for treatment of autoimmune diseases |
| EP4165171A4 (en) * | 2020-06-12 | 2025-03-26 | Nkarta, Inc. | GENETICALLY MODIFIED NATURAL KILLER CELLS FOR CD70-DIRECTED CANCER IMMUNOTHERAPY |
| WO2025073908A1 (en) * | 2023-10-05 | 2025-04-10 | Onk Therapeutics Limited | Optimised il-15 constructs |
| WO2025146467A1 (en) | 2024-01-04 | 2025-07-10 | Onk Therapeutics Limited | Targeted il-15 construct delivery |
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
| WO2026041793A1 (en) * | 2024-08-23 | 2026-02-26 | BioNTech SE | Chimeric proteins comprising non-human protein domains for enhancing antigenicity |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102660336B1 (ko) | 2017-03-27 | 2024-04-26 | 내셔널 유니버시티 오브 싱가포르 | 절단된 nkg2d 키메라 수용체 및 자연 살해 세포 면역요법에서의 그의 용도 |
| CN112055717B (zh) | 2018-04-02 | 2024-04-26 | 新加坡国立大学 | 用在免疫细胞中表达的膜结合抗细胞因子非信号传导粘合剂中和人细胞因子 |
| EP3844186A4 (en) | 2018-08-29 | 2022-08-17 | National University of Singapore | METHOD OF SPECIFIC STIMULATION OF SURVIVAL AND EXPANSION OF GENETICALLY MODIFIED IMMUNE CELLS |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX373460B (es) * | 2014-03-11 | 2020-04-07 | Cellectis | Metodo para generar celulas t compatibles para el trasplante alogenico. |
| US10648020B2 (en) * | 2015-06-18 | 2020-05-12 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| EP4043556B1 (en) * | 2015-06-30 | 2024-02-07 | Cellectis | Methods for improving functionality in nk cell by gene inactivation using specific endonuclease |
| KR102438360B1 (ko) * | 2016-03-04 | 2022-08-31 | 에디타스 메디신, 인코포레이티드 | 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분 |
| JP2020503043A (ja) * | 2016-12-30 | 2020-01-30 | セルラリティ インコーポレイテッド | 遺伝子改変されたナチュラルキラー細胞 |
| WO2018195339A1 (en) * | 2017-04-19 | 2018-10-25 | Board Of Regents, The University Of Texas System | Immune cells expressing engineered antigen receptors |
| JP2021502077A (ja) * | 2017-11-06 | 2021-01-28 | エディタス・メディシン,インコーポレイテッド | 免疫療法のためのt細胞におけるcblbのcrispr−cas9編集のための方法、組成物および構成要素 |
| EP3765608A4 (en) * | 2018-03-15 | 2022-01-12 | KSQ Therapeutics, Inc. | GENE REGULATORY COMPOSITIONS AND METHODS FOR IMPROVED IMMUNOTHERAPY |
| MX2020011697A (es) * | 2018-05-03 | 2020-12-10 | Univ Texas | Células exterminadoras naturales diseñadas para expresar receptores de antígeno quimérico con bloqueo de punto de control inmunitario. |
| WO2020113029A2 (en) * | 2018-11-28 | 2020-06-04 | Board Of Regents, The University Of Texas System | Multiplex genome editing of immune cells to enhance functionality and resistance to suppressive environment |
| US20220133790A1 (en) * | 2019-01-16 | 2022-05-05 | Beam Therapeutics Inc. | Modified immune cells having enhanced anti-neoplasia activity and immunosuppression resistance |
| EP3924467A1 (en) * | 2019-02-15 | 2021-12-22 | Editas Medicine, Inc. | Modified natural killer (nk) cells for immunotherapy |
| JP7629414B2 (ja) * | 2019-06-04 | 2025-02-13 | ンカルタ・インコーポレイテッド | 免疫療法のための操作されたナチュラルキラー細胞と操作されたt細胞の組み合わせ |
| WO2021252804A1 (en) * | 2020-06-12 | 2021-12-16 | Nkarta, Inc. | Genetically modified natural killer cells for cd70-directed cancer immunotherapy |
-
2021
- 2021-12-02 JP JP2023533999A patent/JP2023552998A/ja active Pending
- 2021-12-02 US US18/255,222 patent/US20240335536A1/en active Pending
- 2021-12-02 EP EP21901656.5A patent/EP4255453A4/en active Pending
- 2021-12-02 AU AU2021392809A patent/AU2021392809A1/en active Pending
- 2021-12-02 CA CA3200367A patent/CA3200367A1/en active Pending
- 2021-12-02 WO PCT/US2021/072715 patent/WO2022120370A2/en not_active Ceased
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
| EP4165171A4 (en) * | 2020-06-12 | 2025-03-26 | Nkarta, Inc. | GENETICALLY MODIFIED NATURAL KILLER CELLS FOR CD70-DIRECTED CANCER IMMUNOTHERAPY |
| CN117384853A (zh) * | 2022-07-11 | 2024-01-12 | 士泽生物医药(苏州)有限公司 | 一种表达pvr的通用型细胞及其制备方法 |
| CN117384852A (zh) * | 2022-07-11 | 2024-01-12 | 士泽生物医药(苏州)有限公司 | 一种表达lgals9的通用型细胞及其制备方法 |
| CN117384852B (zh) * | 2022-07-11 | 2026-01-16 | 士泽生物医药(苏州)有限公司 | 一种表达lgals9的通用型细胞及其制备方法 |
| CN117384853B (zh) * | 2022-07-11 | 2025-12-19 | 士泽生物医药(苏州)有限公司 | 一种表达pvr的通用型细胞及其制备方法 |
| WO2024030970A3 (en) * | 2022-08-03 | 2024-04-11 | Nkarta, Inc. | Genetic editing of target genes to enhance natural killer cell function |
| WO2024099265A1 (zh) * | 2022-11-07 | 2024-05-16 | 上海先博生物科技有限公司 | 工程化嵌合抗原受体免疫细胞及其应用 |
| WO2024107891A3 (en) * | 2022-11-16 | 2024-06-20 | Nkarta, Inc. | Dosing regimens for combination therapies |
| WO2024113714A1 (zh) * | 2022-11-28 | 2024-06-06 | 上海恩凯细胞技术有限公司 | 敲低nkg2a基因的car-免疫细胞及其用途 |
| WO2024211554A1 (en) * | 2023-04-07 | 2024-10-10 | Nkarta, Inc. | Methods for treatment of autoimmune diseases |
| WO2025073908A1 (en) * | 2023-10-05 | 2025-04-10 | Onk Therapeutics Limited | Optimised il-15 constructs |
| WO2025146467A1 (en) | 2024-01-04 | 2025-07-10 | Onk Therapeutics Limited | Targeted il-15 construct delivery |
| WO2026041793A1 (en) * | 2024-08-23 | 2026-02-26 | BioNTech SE | Chimeric proteins comprising non-human protein domains for enhancing antigenicity |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4255453A4 (en) | 2025-03-26 |
| CA3200367A1 (en) | 2022-06-09 |
| US20240335536A1 (en) | 2024-10-10 |
| WO2022120370A3 (en) | 2022-07-14 |
| EP4255453A2 (en) | 2023-10-11 |
| JP2023552998A (ja) | 2023-12-20 |
| AU2021392809A1 (en) | 2023-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240335536A1 (en) | Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy | |
| JP7629414B2 (ja) | 免疫療法のための操作されたナチュラルキラー細胞と操作されたt細胞の組み合わせ | |
| US12012458B2 (en) | Genetically modified natural killer cells for CD70-directed cancer immunotherapy | |
| US20230390392A1 (en) | Multiplex gene edited cells for cd70-directed cancer immunotherapy | |
| US20250319185A1 (en) | Bcma-directed cellular immunotherapy compositions and methods | |
| US20260000761A1 (en) | Engineered immune cells with enhanced potency and uses of same in immunotherapy | |
| EP4194472A1 (en) | Chimeric antigen receptor comprising novel co-stimulatory domain and use thereof | |
| US20250018036A1 (en) | Immunotherapy targeting sox2 antigens | |
| WO2024030970A2 (en) | Genetic editing of target genes to enhance natural killer cell function | |
| WO2022066973A1 (en) | Immunotherapy targeting pbk or oip5 antigens | |
| CN116940367A (zh) | 工程化改造免疫细胞用于增强的效力和持久性的方法以及工程化细胞在免疫疗法中的用途 | |
| EP4649139A1 (en) | Methods for expanding immune cells and related compositions and uses thereof | |
| EP4712987A2 (en) | Methods for treatment using cd19-directed immunotherapies | |
| HK40097595A (zh) | 靶向sox2抗原的免疫治疗 | |
| HK40086008A (en) | Chimeric antigen receptor comprising novel co-stimulatory domain and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 3200367 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023533999 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021901656 Country of ref document: EP Effective date: 20230703 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21901656 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2021392809 Country of ref document: AU Date of ref document: 20211202 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202180092683.6 Country of ref document: CN |