WO2022109758A1

WO2022109758A1 - Application of proteolytic enzyme of pit viper in treatment of alzheimer's disease

Info

Publication number: WO2022109758A1
Application number: PCT/CN2020/000289
Authority: WO
Inventors: 沈喆景
Original assignee: 沈喆景
Priority date: 2020-11-26
Filing date: 2020-11-26
Publication date: 2022-06-02

Abstract

In the Alzheimer's disease, hyperphosphorylated tau proteins form a highly dense ordered filament structure, tau protein filaments aggregate into an inclusion body, and cells are difficult to clear, so that a cell function of a central nervous system is impaired, and therefore, these diseases are further called tau protein diseases. According to the latest study on the Alzheimer's disease, impaired blood flow in the brain is related to tau protein tangle formation, and a tau protein tangle is a sign of cognitive decline, so that dysfunction of blood vessel has a certain correlation with the Alzheimer's disease. The venom of a crotalinae pit viper contains proteolytic enzymes which can dissolve fibrin in a blood vessel, so that blood circulation is improved, and pathologic tau protein "tangles" may also be cleaned up; and the proteolytic enzymes can shorten an average escape latency of a rat group suffering from the Alzheimer's disease in a Morris water maze test and improve a learning and memory capacity of the rat group suffering from the Alzheimer's disease, and thus, this discovery makes it possible to use the proteolytic enzymes of the crotalinae pit viper in the treatment of the Alzheimer's disease.

Description

The application of pit viper proteolytic enzyme in the treatment of senile dementia

technical field

The present invention relates to a group of protease (protease, proteinase) of Pitviparidae capable of improving the learning and memory ability of senile dementia rats, and a pharmaceutical composition and method for treating senile dementia, belonging to the field of biopharmaceuticals.

Background technique

Alzheimer's disease (AD), also known as Alzheimer's disease (AD), is an senile disease characterized by progressive memory impairment, impairment of judgment and reasoning ability, and movement disorders. Dementia is a syndrome of acquired and persistent intellectual disability due to brain dysfunction, and the incidence and prevalence of dementia increase with age. As the population ages, Alzheimer's disease has become the fourth leading cause of death in humans.

In 1974, researchers first isolated neurofibrillary tangles (NFTs) and tau protein, a highly soluble microtubule-associated protein in neurons of the central nervous system, from the brains of AD patients with Alzheimer's disease. It is very abundant. Microtubules are an important component of the neural cytoskeleton. Tau protein mainly acts on the distal end of axons to maintain the stability and flexibility of microtubules. Tau protein controls the stability of microtubules through isomerization and phosphorylation. When tau is hyperphosphorylated, the protein dissociates from axonal microtubules, and the tau protein then misfolds and the protein begins to aggregate, eventually forming neurofibrillary tangles (FNTs) in Alzheimer's disease patients; at the same time, Microtubules are also destabilized when tau dissociates, and the combination of neurofibrillary tangles and destabilized microtubules ultimately leads to disruption of processes such as axonal transport and nerve conduction.

In recent years, scientists have found that brain imaging of pathological tau protein "tangles" can reliably predict the location of brain atrophy in Alzheimer's patients a year or more in advance. There is growing recognition that tau is more directly responsible for brain degeneration in Alzheimer's disease than amyloid, and further evidence that tau is a major driver of the disease [1]. Other scientists have also found that in Alzheimer's disease and various neurodegenerative diseases, mutated tau protein forms a highly dense and ordered fibril structure, and tau protein fibrils aggregate into inclusion bodies, which are difficult for cells to remove. The function of cells in the central nervous system is impaired, so these diseases are also referred to as tau diseases [2, 3]. Therefore, how to remove the pathological tau protein "tangles" has become a direction for researchers to develop Alzheimer's treatment drugs.

In addition to the aggregation of tau protein fibers, scientists also found that the bilateral frontal lobe, hippocampus, temporal lobe cortex and basal ganglia cerebral blood flow (CBF), cerebral blood The volume (CBV) was significantly lower than that of the control group, and the maximum peak time (TTP) and the mean transit time (MTT) of the contrast agent were significantly longer than those of the control group, and the differences were statistically significant [4]; a new Alzheimer's Disease research has also found that impaired blood flow in the brain is associated with the formation of tau tangles, a hallmark of cognitive decline, so scientists are now beginning to fully understand that vascular dysfunction plays a role in Alzheimer's disease. role in the disease [5].

Earlier, researchers tried to use a variety of methods including monoclonal antibodies to clear the pathological tau protein "tangles" or vaccines to make the body produce antibodies to prevent the formation of pathological tau protein "tangles", but the results were not very effective. Ideal, so finding a better drug and method that can both improve damaged blood flow in the brain while clearing pathological tau "tangles" may be the direction of researchers' efforts.

Protease (proteinase) is a general term for enzymes that can catalyze the hydrolysis of polypeptides or proteins. Proteolytic enzymes hydrolyze the peptide bonds in the middle part of proteins or the amino or carboxyl termini of proteins, and gradually degrade amino acid residues. Small amino acid fragments or single amino acids.

Pit viper venom also contains proteolytic enzymes, which are called serine proteases. They have a common trypsin-like tertiary structure and 6 pairs of disulfide bonds, which belong to the "trypsin-like serine proteolytic enzyme" family. The common tertiary structure and some specific shared amino acid residue fragments make these proteolytic enzymes medically useful for dissolving fibrin in blood vessels, improving blood circulation, and they have the potential to clean up pathological diseases at the same time. Tau protein "tangles", ie aggregations of tau protein fibers [2, 3], so this makes it possible to use pit viper proteolytic enzymes to treat Alzheimer's disease.

SUMMARY OF THE INVENTION

The present invention discovers for the first time that the subfamily pit viper, such as the white-browed pit viper, the Jiangsu and Zhejiang pit viper, and the rattlesnake, their proteolytic enzymes can shorten the average escape latency of the senile dementia rat group in the Morris water maze test, and improve the learning and memory of the senile dementia rat. ability, this discovery makes it possible to use the proteolytic enzymes of the pit viper to treat Alzheimer's disease.

The mature peptide amino acid sequence of the protease hydrolase of the white-browed pit viper, the Jiangsu and Zhejiang pit viper and the rattlesnake found in the present invention is as follows:

Amino acid sequence of mature peptide of Gloydius ussuriensis proteolytic enzyme (SEQ ID No.1)

Amino acid sequence of mature peptide of Gloydius ussuriensis proteolytic enzyme (SEQ ID No.2)

Amino acid sequence of mature peptide of Gloydius ussuriensis proteolytic enzyme (SEQ ID No.3)

Amino acid sequence of mature peptide of Gloydius halys proteolytic enzyme (SEQ ID No.4)

Amino acid sequence of mature peptide of Gloydius halys proteolytic enzyme (SEQ ID No.5)

Amino acid sequence of the mature peptide of the Crotalus adamanteus proteolytic enzyme (SEQ ID No.6)

The present invention will be further described below in conjunction with the specific embodiments, but the following methods are not intended to limit the present invention, but only use one of the implementation methods of the present invention to illustrate the specific process of implementation, and other implementation methods may also achieve the same effect; The equivalent replacements in the art made by the disclosure of the present invention all belong to the protection scope of the present invention.

Pattern description:

FIG. 1 is a line graph of the experimental data of Table 1. FIG.

Implementation case

Case A: Obtaining the Proteolytic Enzyme of Pitviparidae

1: White-browed pit viper [Gloydius ussuriensis] proteolytic enzyme (SEQ ID No. 1) is obtained by recombination, as follows:

1. Cloning of the recombinant expression vector

Design and use primer Sequence (5'→3') according to the gene-synthesized proteolytic enzyme DNA sequence of the mature peptide of Pit viper proteolytic enzyme provided on Genbank

Forward primer ACATGTGTGGGTGACTCTGG

Reverse primer TGGTCTCCCCAAGATGCAAT

Amplify the target DNA sequence by PCR, introduce a sequence encoding an enterokinase recognition site and an Nde I restriction site at the 5' end of the upstream primer, and introduce a stop codon and a BamHI restriction site at the 5' end of the downstream primer . PCR was used to amplify the gene of the mature peptide of Viper proteolytic enzyme and clone it into pBS-T vector. The gene of the constructed recombinant pBS-T-mature peptide of Viper proteolytic enzyme was analyzed and identified.

2. Protein expression in E. coli

The recombinant plasmid was transformed into the E. coli expression vector pET15b, and the recombinant expression plasmid pET15b-the mature peptide gene of P. viper proteolytic enzyme was constructed, and the correct recombinant was transformed into E. coli BL21(DE3) LysS. The monoclone was inoculated into 5mL LB medium, cultured at 37°C overnight, inoculated into 50mL LB medium at a ratio of 1:100 the next day, and shaken at 37°C to OD600nm=0.4-0.6.

3. Collection and analysis of expression products

Incubate with 1 mmol/L IPTG for 3 hours to induce transformed E. coli BL21(DE3). The expressed bacteria were sonicated and then centrifuged, and the inclusion bodies were dissolved in buffer. After centrifugation, the supernatant and the precipitate were respectively detected by SDS-PAGE electrophoresis, and the target protein existed in the form of inclusion bodies.

4. Affinity and purification of the expressed product

The inclusion bodies after sonication were dissolved in buffer (6mol/L guanidine hydrochloride, 20mmol/L Tris-HCL pH8.0, 0.5mol/L NaCl, 5mmol/L imidazole); passed through nickel-NTA column affinity chromatography Purification, specifically, is equilibrated with the above buffer before loading the column, washed to the baseline with the above buffer containing 20 mmol/L imidazole after sample loading, and finally eluted with the above buffer containing 300 mol/L imidazole. Enterokinase cleavage yielded the mature peptide protein of the Pit Viper proteolytic enzyme.

5. Refolding of the expression product

Dialyze the above eluted protein with 6mol/l guanidine hydrochloride, 0.1mol/L Tris-HCL pH8.0, 0.01mol/LEDTA, 0.1mmol/L PMSF, 10mmol/L DTT buffer, the DTT and guanidine hydrochloride concentrations in the buffer Decrease, and then dialyze with 10 times the volume of 0.1mol/L Tris-HCL pH8.0, 5μmol/L CuSo4, 20% glycerol buffer. The renaturation results were detected by RP-HPLC, the renatured components were determined by comparing with the retention time of the standard sample, and the renatured products were stored under refrigeration.

6. Amino acid sequence determination

The amino acid sequence of the obtained Pit Viper proteolytic enzyme is analyzed by the peptide segment coverage method, the measured sequence is compared with the amino acid sequence of the Pit Viper proteolytic enzyme in the protein library, and it is confirmed that the sequence is completely consistent and used for the next step. Experimental use in the treatment of senile dementia rats.

II: Obtainment of proteolytic enzymes (SEQ ID No. 2-SEQ ID No. 6)

According to the gene of the above proteolytic enzyme mature peptide provided on Genbank, we recombine other target products (SEQ ID No. 2-SEQ ID No. 6) in the above-mentioned way I, we can obtain a series of proteolytic enzymes of the present invention The recombinant product, which is refrigerated, is used for the test of the senile dementia rat animal model.

B: animal model selection

The present invention adopts the natural aging cognitive impairment (senile dementia) animal model, and obtains the senile dementia animal model through the natural aging of the animal itself, including aging rats, mice, monkeys, etc. System changes occur naturally and are closer to the real pathophysiological changes of AD, so the present invention selects a natural aging senile cognitive impairment (senile dementia) rat animal model.

C: Experimental animals and groups

1. 120-month-old rats aged 21-22 were adaptively reared for 10 days, the animals were free to take water, the room temperature was controlled at 22-25 degrees, the humidity was 50%-70%, the light was 12 hours, and the dark was 12 hours.

2. To screen cognitively impaired rats (senile dementia rats) through the Morris water maze positioning and navigation training. Morris water maze experiment is an experiment in which animals are forced to swim and find an underwater platform. It is mainly used to evaluate the spatial learning and memory ability of animals. The experimental indicators provided are sensitive, reliable and easy to operate. It is a classic experiment to test and evaluate the indicators of senile dementia in rats. .

3. The water depth of the water maze is 50cm, the water temperature is controlled at 22-25 degrees, and a platform is set in the center of the pool. Put milk powder into the pool and mix thoroughly until the water is milky white, so that the rats cannot visually identify the position of the platform. On the training day before the formal test, put the rat into the water facing the pool wall, and train it to find and escape the platform. If the rat finds and stands on the platform for 3 seconds and does not fall off, the training can be terminated, and the time it takes to reach the platform and the time spent on it are recorded. Swim the distance and let it stay on the platform for 10 seconds, so that the rats can learn and memorize. Those who can't be found will be led to the platform and placed for 30 seconds after continuous training for 120s to train their learning and memory. Train 4 times a day, with an interval of 15 to 30 seconds for the next training, and enter the water from 4 different directions for 4 consecutive days. On the 5th day of the formal test, the real-time image system automatically records the activity of the rat, and calculates the average time for the rat to cross the platform (central area) for the first time to evaluate the learning and memory of the animal. Aged rats whose escape latency was greater than the upper limit of 60 seconds were designated as cognitively impaired rats. Each rat was labeled so that the mean escape latency before dosing could be calculated for each group of rats after completion of the final trial.

4. Rats with cognitive impairment were screened out and randomly divided into 7 groups: Alzheimer's rats control group (no drug administration, gavage with the same volume of normal saline), and 6 different proteolytic enzyme groups, (according to 50μg /Kg is formulated into a liquid, and administered by continuous gastric cleansing, 2 times a day, for 8 consecutive weeks). During the experiment, 10 rats per group were maintained. excess out of the group.

D: Behavioral (learning and memory ability) test

After 8 weeks of administration, the animals were trained again for 5 consecutive days, and the average time for each group to find a platform in the water was recorded every day, and the Morris water maze test was directly performed on the 6th day. The time for each group of animals to find a platform in the water was measured. Dosing continued during training.

E: Experimental results

The following are the average escape latency of 6 kinds of proteolytic enzymes and the senile dementia rat control group to compare, to illustrate the curative effect of the proteolytic enzyme of the present invention on improving the cognitive ability of senile dementia rats, and the results are shown in Table 1:

Table 1

The above experimental data show that, before administration, there is no significant difference between the Alzheimer's rat control group and the six proteolytic enzyme groups. After 8 weeks of administration, the Morris water maze positioning experiment training was performed again. From the third day to the fifth day, significant differences began to appear between the Alzheimer's rat control group and the six proteolytic enzyme groups. Compared with the 6 kinds of proteolytic enzymes group, there were all significant differences in dementia rat control group, * means P<0.05, ** means P<0.01, *** means P<0.001.

The above data show that the proteolytic enzyme treatment group can shorten the average escape latency of the senile dementia rat group and improve the learning and memory ability of the senile dementia rat group.

We found from the above experimental results that the mature peptides of proteolytic enzymes starting with vigg or iigg as the N-terminus of amino acid residues of Viper, Viper and Rattlesnake, as long as their homology is more than 75%, they are There is a common feature of shortening the average escape latency of the Alzheimer's rat group and improving the learning and memory ability of the Alzheimer's rats, which should be related to their common tertiary structure and some specific common amino acid residue fragments. Because they share a common trypsin-like tertiary structure, 6 pairs of disulfide bonds, they all belong to the "trypsin-like serine proteolytic enzyme" family.

The above examples are only to illustrate the implementation ideas and technical characteristics of the present invention, and the purpose is to enable those who are familiar with the technology to understand the content of the present invention and implement accordingly, and cannot limit the implementation method and protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included within the implementation method and protection scope of the present invention.

Ref:

1. Renaud La Joie et al. Prospective longitudinal atrophy in Alzheimer’s disease correlates with the intensity and topography of baseline tau-PET. Science Translational Medicine, 2020, doi: 10.1126/scitranslmed.aau5732.

2. Goedert M. Tau filaments in different neurodegenerative disease. FEBS letters 592: 2383-2391 (2018).

3. Anthony W et al. Cryo-EM structures of tau filaments from Alzheimer’s disease. Nature, Published online 05 July 2017, doi: 10.1038/nature23002

4. Huang Xiaoquan, Wang Hua, The diagnostic value of CT perfusion in Alzheimer's disease, "China Chronic Disease Prevention and Control", 2016-10

5. Daniel Albrecht et al, Associations between vascular function and tau PET are associated with global cognition and amyloid. Journal of Neuroscience 12 October 2020, JN-RM-1230-20; DOI: 10.1523/JNEUROSCI.1230-20.2020

Claims

A pharmaceutical composition and method for treating senile dementia patients, by using the therapeutically effective amount of the proteolytic enzyme of the subfamily Pitviparidae and a pharmaceutically acceptable carrier contained in the composition to reverse, reduce or treat the symptoms of senile dementia .
The proteolytic enzyme of Pitviparidae according to claim (1), characterized in that their mature peptide amino acid sequence is the proteolytic enzyme shown in SEQ ID No.1 to SEQ ID No.6; or A protein/polypeptide having 75% or more homology with any one of the proteolytic enzyme mature peptides of SEQ ID No. 1 to SEQ ID No. 6, respectively, and starting with amino acid residues vigg or iigg as the mature peptide, the The function of the protein/polypeptide is the same as or similar to that of the proteolytic enzymes of the amino acid sequences of the mature peptides shown in SEQ ID No. 1 to SEQ ID No. 6.
Claims (1-2) The proteolytic enzymes of Pitviparidae described above, characterized in that they can be derived from separation and extraction from natural snake venom, or chemical polypeptide synthesis, or from prokaryotic or eukaryotic using recombinant technology produced in hosts (eg, bacterial, yeast, higher plant, insect and mammalian cells).
According to the proteolytic enzyme of the Pitviparidae Viper of the above-described recombination production of claim (3), according to the host used in the recombinant production scheme, the proteolytic enzyme protein/polypeptide of the Pitviparidae Viper of the present invention can be a glycosyl or may be non-glycosylated; may or may not contain disulfide bonds. The proteolytic enzyme protein/polypeptide of Viperidae described in the present invention may also include or not include an initial methionine residue.
Claims (1-4) The Pitviparidae proteolytic enzyme protein/polypeptide described above, characterized in that the Pitviparidae Pitviper proteolytic enzyme protein/polypeptide described in the present invention may include the above-mentioned various Pitviparidae Fragments of hydrolyzed or enzymatically hydrolyzed proteolytic enzymes, derivatives and analogs treated by physical and chemical methods, they are basically the same as the proteolytic enzyme proteins/polypeptides of the above-mentioned Viper subfamily. The biological function or activity of the protein/polypeptide. The fragments, derivatives or analogs described in the present invention may be polypeptides or proteins with one or more amino acid residues substituted, or polypeptides or proteins with substitution groups in one or more amino acid residues, or with A polypeptide or protein formed by fusion of another compound (such as a compound that prolongs the half-life of a polypeptide, such as polyethylene glycol, aliphatic chain), or a polypeptide or protein formed by fusion of an additional amino acid sequence to this polypeptide or protein sequence. These fragments, derivatives and analogs are well known to those skilled in the art from the description herein.
The method of claim (1) comprising intravenous, intramuscular, subcutaneous, oral, sublingual, nasal, rectal, intradermal, intraperitoneal or intrathecal or transdermal administration.
The method of claim (1), the dose of Pitviparidae proteolytic enzyme comprises from 1 μg/Kg to 500 μg/kg each time, and the dosing frequency is from once a day to multiple times a day; or multiple times a year.