WO2022109022A1 - Rna-targeting splicing modifiers for treatment of mda5-associated conditions and diseases - Google Patents

Rna-targeting splicing modifiers for treatment of mda5-associated conditions and diseases Download PDF

Info

Publication number
WO2022109022A1
WO2022109022A1 PCT/US2021/059720 US2021059720W WO2022109022A1 WO 2022109022 A1 WO2022109022 A1 WO 2022109022A1 US 2021059720 W US2021059720 W US 2021059720W WO 2022109022 A1 WO2022109022 A1 WO 2022109022A1
Authority
WO
WIPO (PCT)
Prior art keywords
adjacent
rtsm
exon
sequence
synthetic
Prior art date
Application number
PCT/US2021/059720
Other languages
French (fr)
Inventor
Botao LIU
Tai WONG
Anahita DASTUR
Mariela JASKELIOFF
Original Assignee
Skyhawk Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Skyhawk Therapeutics, Inc. filed Critical Skyhawk Therapeutics, Inc.
Publication of WO2022109022A1 publication Critical patent/WO2022109022A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
    • C12Y306/04—Hydrolases acting on acid anhydrides (3.6) acting on acid anhydrides; involved in cellular and subcellular movement (3.6.4)
    • C12Y306/04013—RNA helicase (3.6.4.13)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3233—Morpholino-type ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • RNA-targeting splicing modifier RNA-targeting splicing modifier
  • the synthetic RTSM comprises a binding domain that binds to a target region of the IFIH1 pre-messenger ribonucleic acid (pre-mRNA)
  • the target region comprises an exon-intron junction comprising a target sequence of Formula (I):RGUV, wherein R is A or G and wherein V is A, G, or C
  • exon skipping is increased as compared to the IFIH1 pre-mRNA spliced in the absence of an RTSM as demonstrated by an in vitro assay.
  • a synthetic IFIH1 RTSM that comprises a binding domain that binds to a target region of a IFIH1 pre-mRNA; wherein: the target region comprises an exon-intron junction comprising a target sequence of Formula (I): RGUV, wherein R is A or G and wherein V is A, G, or C; and exon skipping is increased as compared to when the IFIH1 pre-mRNA is spliced in the absence of the synthetic RTSM as demonstrated in an in vitro assay.
  • Formula (I): RGUV wherein R is A or G and wherein V is A, G, or C
  • FIG.1. shows RT-PCR analysis of IFIH1 isoforms (B1 and B2) present in epithelial cells following treatment with RTSM-antisense oligonucleotides (ASOs).
  • FIG. 2A and FIG. 2B show sequences of IFIH1 isoforms present in epithelial cells following treatment with RTSM-ASOs generated from the forward primer (SEQ ID NO:174).
  • FIG. 2A shows the sequence of B1-Forward (SEQ ID NO:176) contains exons 13, 14, and 15.
  • FIG. 2B shows the sequences of B2-Forward (SEQ ID NO:177) contains exons 13 and 15, exon 14 having been skipped.
  • FIG. 3A and FIG. 3B shows sequences of IFIH1 isoforms present in epithelial cells following treatment with ASOs generated from the reverse primer (SEQ ID NO:175).
  • FIG. 3A shows the sequence of B1-Reverse (SEQ ID NO:178) contains exons 13, 14, and 15.
  • FIG. 3B shows the sequences of B2- Reverse (SEQ ID NO:179) contains exons 13 and 15, exon 14 having been skipped.
  • FIG. 1A shows the sequence of B1-Forward (SEQ ID NO:176) contains exons 13, 14, and 15.
  • FIG. 2B shows the sequences of B2-Forward (SEQ ID NO:177) contains exons 13 and 15, exon 14 having been skipped
  • FIG. 5 shows quantitation of MDA5 protein isoforms present in epithelial cells following treatment with ASOs.
  • DETAILED DESCRIPTION [0010] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which embodiments herein belongs. Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of embodiments herein. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
  • binding domain can comprise a domain or portion of an RTSM which binds to a region or a portion of an IFIH1 pre-mRNA.
  • the binding can be covalent or non-covalent. Examples of non-covalent binding include binding via hydrogen bonding, Watson-Crick base pairing, wobble-base pairing, and Van der Waals interactions.
  • ASO antisense oligomer
  • oligomer such as a polynucleotide, comprising nucleobases that hybridizes to a target nucleic acid (e.g., a IFIH1 containing pre-mRNA) sequence, for example, by Watson-Crick base pairing or wobble base pairing (G-U).
  • target nucleic acid e.g., a IFIH1 containing pre-mRNA
  • G-U wobble base pairing
  • complementary and complementarity can refer to polynucleotides (e.g., a sequence of nucleotides) related by base-pairing rules.
  • the sequence “T-G-A (5’-3’),” can be complementary to the sequence “T-C-A (5’-3’).”
  • Complementarity may be “partial,” in which only some of the nucleic acid’s bases are matched according to base pairing rules. Alternatively, there may be “complete” or “total” complementarity between the nucleic acids.
  • base pairing may be contiguous or non-contiguous. The degree of complementarity between nucleic acid strands can impact efficiency and strength of hybridization between nucleic acid strands. While perfect complementarity can be desired, some embodiments can include one or more 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mismatches with respect to a target RNA.
  • a mismatch can be a mismatch between a base on an RTSM and a base on a target RNA. Variations at any location within the oligomer are included. In certain embodiments, variations in sequence near the termini of an oligomer can be within about 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides of the 5’ and/or 3’ terminus. In some embodiments, a base pairing can be a wobble base pairing.
  • CRISPR Clustered Regularly Interspersed Short Palindromic Repeat
  • CRISPR system CRISPR nuclease system
  • CRISPR nuclease system can include a non-coding RNA molecule (e.g., guide RNA) that binds to DNA or RNA and CRISPR-Associated (Cas) proteins (e.g., Cas13) with at least some or none nuclease functionality (e.g., two nuclease domains).
  • Cas CRISPR-Associated
  • exon skipping can refer to a process by which a portion of an exon, an entire exon, or more than one exon are removed from a pre-processed mRNA so that it or they are not present in a mature RNA, such as an mRNA that is translated into a protein. Accordingly, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein, and can create a modulated form of the protein.
  • the modulated protein may be functional, less functional or non-functional.
  • the modulated protein may be truncated or subjected to nonsense mediated decay.
  • an exon being skipped is an aberrant exon from the human IFIH1 gene which may contain a mutation or other alteration in its sequence that otherwise causes mutated forms of the protein.
  • an exon being skipped is a wild-type exon.
  • an exon being skipped can be any one or more of exons 1-16 of the IFIH1 gene, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.
  • sequence identity in the context of two nucleic acid sequences or amino acid sequences of polypeptides can refer to the residues in the two sequences which can be the same when aligned for maximum correspondence over a specified comparison window.
  • a “comparison window”, as used herein, can refer to a segment of at least about: 4, 8, 50, 100, 150, to 200 or more contiguous positions can be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally.
  • polypeptides herein can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference polypeptide, or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters.
  • nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters.
  • BLASTN or CLUSTAL, or any other available alignment software
  • nucleic acid or amino acid sequences comprises a sequence that has at least 90% sequence identity or more, at least 95%, at least 98% and at least 99%, compared to a reference sequence using the programs described above, e.g., BLAST, using standard parameters.
  • the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. Percentage of sequence identity can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (e.g., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • W word length
  • E expectation
  • Percentage of sequence identity can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (e.g., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage can be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • the substantial identity exists over a region of the sequences that can be at least about 8, at least about 14 residues in length, over a region of at least about 20 residues, and in some embodiments, the sequences can be substantially identical over at least about 25 residues. In some embodiments, the sequences can be substantially identical over the entire length of the coding regions.
  • Inflammatory disorder can mean an immune-mediated inflammatory condition that affects humans and is generally characterized by dysregulated expression of one or more cytokines.
  • inflammatory disorders include skin inflammatory disorders, inflammatory disorders of the joints, inflammatory disorders of the cardiovascular system, certain autoimmune diseases, lung and airway inflammatory disorders, intestinal inflammatory disorders.
  • skin inflammatory disorders include dermatitis, for example atopic dermatitis and contact dermatitis, acne vulgaris, and psoriasis.
  • Examples of inflammatory disorders of the joints include rheumatoid arthritis.
  • Examples of inflammatory disorders of the cardiovascular system can be cardiovascular disease and atherosclerosis.
  • autoimmune diseases include Type 1 diabetes, Graves disease, Guillain-Barre disease, Lupus, Psoriatic arthritis, and Ulcerative colitis.
  • lung and airway inflammatory disorders include asthma, cystic fibrosis, COPD, emphysema, and acute respiratory distress syndrome.
  • intestinal inflammatory disorders include colitis and inflammatory bowel disease.
  • Other inflammatory disorders include cancer, hay fever, periodontitis, allergies, hypersensitivity, ischemia, depression, systemic diseases, post infection inflammation and bronchitis.
  • the peptides and compositions herein may also be employed in the non- therapeutic treatment of inflammation.
  • nucleobase can generally refer to nitrogen containing compound that is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA.
  • a nucleobase may be any unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA.
  • modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine.
  • targeting domain can comprise a region or portion of an IFIH1 pre- mRNA to which a RTSM can bind.
  • the binding can be covalent or non-covalent. Examples of non-covalent binding include binding via hydrogen bonding, Watson-Crick base pairing, wobble-base pairing, and Van der Waals interactions.
  • RNA-Targeting Splicing Modifier RTSM
  • RTSM RNA-Targeting Splicing Modifier
  • the IFIH1 gene encodes for the melanoma differentiation- associated protein 5 (MDA5 protein), which can play an important role in innate immunity.
  • MDA5 is believed to be a dsRNA sensor, that binds to viral dsRNA and turns on the type 1 Interferon (IFN-1) signaling pathway.
  • the methods described herein can be useful to increase exon skipping of an IFIH1 pre-mRNA to decrease functional MDA5 levels.
  • RTSM compounds herein can bind to one or more selected regions of a pre-processed RNA of an IFIH1 gene, increase exon skipping and differential splicing, and thereby allow cells to produce a mRNA transcript that encodes a non-functional or reduced function protein.
  • the resulting MDA5 protein can be: truncated, functional, semi-functional, or a non- functional form of MDA5.
  • these and related embodiments are useful in the prophylaxis and treatment of an inflammatory disorder that is characterized by the over expression of functional MDA5 proteins, or the expression of over-functional MDA5 proteins.
  • RTSMs Interferon induced with helicase 1 (IFIH1) and melanoma differentiation-associated protein 5 (MDA5)
  • IFIH1 Interferon induced with helicase 1
  • MDA5 melanoma differentiation-associated protein 5
  • a targeted MDA5 can be identified by homology search and sequences identified by genomic and nucleotide databases, such as ENSEMBL or GENBANK, and in some embodiments, comprises a polypeptide sequence of SEQ ID NO:4.
  • an un-modulated MDA5 protein referred herein can be a full length, functional, or wild-type protein, or any combination thereof.
  • the IFIH1 gene can encode a MDA5 protein.
  • a targeted IFIH1 gene can comprise a sequence, such as the sequence identified by RefSeq. No. NC_000002.12 (disclosed herein as SEQ ID NO: 1 and incorporated by reference).
  • RTSMs disclosed herein can target IFIH1 pre-mRNA.
  • a IFIH1 pre-mRNA can be the precursor IFIH1 RNA transcribed from the IFIH1 gene, but prior to being spliced into a mature RNA.
  • a targeted pre-mRNA comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to at least about: 4, 5, 6, 7, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more continuous nucleotides of the sequence of SEQ ID NO: 2.
  • the wild-type mRNA comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to at least about: 4, 5, 6, 7, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more continuous nucleotides of the sequence of SEQ ID NO.3.
  • RTSMs disclosed herein can target a targeted region of an IFIH1 pre-mRNA.
  • a targeted region can comprise coding for: protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof.
  • RTSMs disclosed herein can increase at least partial exon skipping during splicing of an IFIH1 pre-mRNA.
  • a targeted pre-mRNA comprises one or more exons and one or more introns.
  • IFIH1 pre- mRNA comprises 16 exons and 15 introns.
  • a targeted pre-mRNA comprises exons 1-16 and introns 1-15.
  • any one of exons 1-16 can comprise, in part or in full, coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof.
  • exon 1 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof
  • exon 2 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof
  • exon 3 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof
  • exon 4 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM- RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one
  • a pre-mRNA exon(s) referred to herein comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences in Tables 2.
  • a pre-mRNA intron(s) referred to herein comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences in Table 3.
  • a pre-mRNA exon(s), intron(s), or both may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 2 or Table 3.
  • Alternative nucleobases can be any one or more of A, C, G or U, or a deletion.
  • a targeted pre-mRNA comprises a target region wherein a target region comprises an exon-intron junction.
  • Exon-intron junctions can be at least 2 nucleic acids in length, at least 3 nucleic acids in length, at least 4 nucleic acids in length, at least 5 nucleic acids in length, at least 6 nucleic acids in length, at least 7 nucleic acids in length, at least 8 nucleic acids in length, at least 9 nucleic acids in length, at least 10 nucleic acids in length, at least 11 nucleic acids in length, at least 12 nucleic acids in length, at least 13 nucleic acids in length, at least 14 nucleic acids or more in length.
  • exon-intron junctions can be about: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleic acids in length.
  • a targeted pre-mRNA comprises a targeted region wherein the targeted region comprises one or more exon-intron junction.
  • a target region comprises an exon-intron junction.
  • a target region comprises more than one exon-intron junction.
  • an exon-intron junction can be Exon1-Intron1, Exon2-Intron2, Exon3-Intron3, Exon4-Intron4, Exon5-Intron5, Exon6-Intron6, Exon7-Intron7, Exon8-Intron8, Exon9-Intron9, Exon10- Intron10, Exon11-Intron11, Exon12-Intron12, Exon13-Intron13, Exon14-Intron14, and/or Exon15- Intron15, more than one, or any combination thereof.
  • a binding domain of an RTSM in some instances can be from about 2 to about 50 nucleobases in length and can bind with about 1 to about 25 nucleobases of an exon to about 1 to about 25 nucleotides of the intron, any number in between, and combinations thereof.
  • Target region can comprise about 1 to about 25 nucleobases of an exon, 1 to about 25 nucleobases of the intron, or any combination thereof.
  • a targeted region comprises a sequence that can be at least about 2 to about 50 nucleobases long.
  • a targeted region comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length.
  • a targeted exon can be any one of, or a portion of any one of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12, Exon 13, Exon 14, Exon 15, Exon 16.
  • a targeted exon can comprise a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence of any one of SEQ ID NOS: 5-20.
  • a targeted intron can be any one of, or a portion of, any one of Intron 1, Intron 2, Intron 3, Intron 4, Intron 5, Intron 6, Intron 7, Intron 8, Intron 9, Intron 10, Intron 11, Intron 12, Intron 13, Intron 14, or Intron 15.
  • a targeted intron can comprise a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence of any one of SEQ ID NOS: 21-35.
  • an exon-intron junction can comprise a sequence that shares at least about: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% or more sequence identity to: SEQ IDS NO: 5 and 21; SEQ IDS NO: 6 and 22; SEQ IDS NO:7 and 23; SEQ IDS NO:8 and 24; SEQ IDS NO:9 and 25; SEQ IDS NO:10 and 26; SEQ IDS NO:11 and 27; SEQ IDS NO:12 and 28; SEQ IDS NO:13 and 29; SEQ IDS NO:40 and 30; SEQ IDS NO:15 and 31; SEQ IDS NO:16 and 32; SEQ IDS NO:17 and 33; SEQ IDS NO:18 and 34; or SEQ IDS NO:19 and 35.
  • a targeted mRNA comprises a targeted sequence.
  • an RTSM targets and binds to a targeted sequence of an IFIH1 pre-mRNA.
  • an exon- intron junction comprises a targeted sequence.
  • a target sequence comprises a sequence that can be at least about 2 to about 50 nucleobases long.
  • a target sequence comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length.
  • a targeted sequence comprises a sequence as set forth in Formula (I) below: Formula (I): Exemplary Targeted Sequence 5’ ... RGUV ... 3’ wherein R is A or G; wherein V is A, G, or C; and wherein indicates from the 5’ ⁇ 3’ direction.
  • a targeted sequence comprises a splice site.
  • an RTSM specifically binds to a splice site.
  • an RTSM specifically hybridizes to a splice site.
  • a splice site comprises a sequence as set forth in Formula (II) below.
  • Formula (II): Exemplary Splice Site [0041] In some embodiments, the sequence set forth in Formula (I), Formula (II), or both wherein: R is A; R is G; V is A; V is G; or V is C; and any combination thereof.
  • Formula (I), Formula (II), or both further comprise: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 N(s) wherein each N is independently A, G, C, or U.
  • Formula (I), Formula (II), or both further comprise: N; NN; NNN; NNNN; NNNNN; NNNNNNN; NNNNNNN; NNNNNNNNN; NNNNNNNNNN; NNNNNNNNNNN; NNNNNNNNNNNN; NNNNNNNNNNNNN; NNNNNNNNNNNNNN; NNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; or NNNNNNNNNNNNNNNNNNNNN; wherein each N is independently A, G, C, or U.
  • an N of a group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous N(s) can be 5’ and adjacent to R or can be 3’ and adjacent to V, wherein each N is independently A, G, C, or U.
  • Formula (I), Formula (II), or both further comprise: N that is 5’ and adjacent to R; NN that is 5’ and adjacent to R; NNN that is 5’ and adjacent to R; NNNN that is 5’ and adjacent to R; NNNNN that is 5’ and adjacent to R; NNNNNNN that is 5’ and adjacent to R; N that is 3’ and adjacent to V; NN that is 3’ and adjacent to V; NNN that is 3’ and adjacent to V; NNNN that is 3’ and adjacent to V; NNNNN that is 3’ and adjacent to V; NNNNNN that is 3’ and adjacent to V; NNNNNNN that is 3’ and adjacent to V; NNNNNNN that is 3’ and adjacent to V; NNNNNNN that is 3’ and adjacent to V; NNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3
  • Formula (I), Formula (II), or both further comprise NNN that is 5’ and adjacent to R and NNNNNN that is 3’ and adjacent to V
  • the sequence of Formula (I), Formula (II), or both may comprise NNNRGUVNNNNNNNN; wherein R is A or G; wherein V is A, G, or C; and wherein each N is independently A, G, C, or U.
  • Formula (I), Formula (II), or both further comprise NNNNN that is 5’ and adjacent to R and NNNNNNNNNNN that is 3’ and adjacent to V
  • the sequence of Formula (I), Formula (II), or both may comprise NNNNNRGUVNNNNNNNNNNNNNNN wherein R is A or G; wherein V is A, G, or C; and wherein each N is independently A, G, C, or U.
  • the sequence set forth in Formula (I), Formula (II), or both further comprising: 1, 2, or 3 D(s) wherein each D is independently A, G, or U; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 N (s) wherein each N is independently A, G, U or C; H wherein H is A, C, or U; or any combination thereof.
  • Formula (I), Formula (II), or both further comprise: D; 1, 2, 3, 4, 5, or 6 N(s); or any combination thereof, that is 5’ and adjacent to R, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C.
  • Formula (I), Formula (II), or both further comprise: 1 or 2 D(s); 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 N(s); H; or any combination thereof, that is 3’ and adjacent to V, wherein each D is independently A, G, or U, wherein each N is independently A, G, U or C, wherein H is A, C or U.
  • Formula (I), Formula (II), or both further comprise: D that is 5' and adjacent to R; ND that is 5' and adjacent to R; NND that is 5' and adjacent to R; NNND that is 5' and adjacent to R; NNNND that is 5' and adjacent to R; NNNNND that is 5' and adjacent to R; NNNNNND that is 5' and adjacent to R; N that is 3' and adjacent to V; ND that is 3' and adjacent to V; NDN that is 3' and adjacent to V; NDNN that is 3' and adjacent to V; NDNNH that is 3' and adjacent to V; NDNNHN that is 3' and adjacent to V; NDNNHNDN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNN
  • Formula (I), Formula (II), or both further comprise: NND that is 5’ and adjacent to R; and NDNNHND that is 3’ and adjacent to V; wherein the sequence of Formula (I), Formula (II), or both, comprise NNDRGUVNDNNHND, wherein H is A, C, or U, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C.
  • Formula (I), Formula (II), or both further comprise: NNNND that is 5’ and adjacent to R; and NDNNHNDNNNNNNN that is 3’ and adjacent to V; wherein the sequence of Formula (I), Formula (II), or both, comprise NNNNNNDRGUVNDNNHNDNNNNNNN, wherein H is A, C, or U, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C.
  • Various embodiments of Formula (I) can be seen in SEQ ID NOS: 36-65.
  • a target sequence comprises a sequence that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOS: 36-65.
  • Table 4 Exemplary Target Sequences
  • a target sequence may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 4. Alterations can be made singly or in combination with other alterations at other positions.
  • Alternative nucleobases can be any one or more of A, C, G or U, or a deletion.
  • alterations can be obtained through computational predictions and alignment, for example, using SPLIGN, ESEMBL, Blast.
  • the disclosed RTSM herein increases exon skipping of a targeted exon during splicing.
  • an exon to be skipped can be any one of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12, Exon 13, Exon 14, Exon 15, Exon 16, or any combination thereof.
  • an exon can be skipped when an RTSM can be bound to a target sequence.
  • a target region can comprise a splice site.
  • an exon- intron junction can comprise a splice site.
  • a splice site can be a 5’ splice site.
  • a splice site can be a 3’ splice site.
  • an exon-intron junction comprises at least a portion of a target exon, at least a portion of a target intron, both, more than one of either, and more than one of both.
  • an exon-intron junction can be located at the 5’ splice site of a target intron, wherein the corresponding targeted exon is downstream of a target intron.
  • a targeted region can comprise the 5’ splice site of an intron.
  • a targeted region comprises the 5’ splice site of intron 1 wherein a targeted exon is exon 1.
  • a targeted region comprises the 5’ splice site of intron 2 wherein a targeted exon is exon 2. In some embodiments, a targeted region comprises the 5’ splice site of intron 3 wherein a targeted exon is exon 3. In some embodiments, a targeted region comprises the 5’ splice site of intron 4 wherein a targeted exon is exon 4. In some embodiments, a targeted region comprises the 5’ splice site of intron 5 wherein a targeted exon is exon 5. In some embodiments, a targeted region comprises the 5’ splice site of intron 6 wherein a targeted exon is exon 6.
  • a targeted region comprises the 5’ splice site of intron 7 wherein a targeted exon is exon 7. In some embodiments, a targeted region comprises the 5’ splice site of intron 8 wherein a targeted exon is exon 8. In some embodiments, a targeted region comprises the 5’ splice site of intron 9 wherein a targeted exon is exon 9. In some embodiments, a targeted region comprises the 5’ splice site of intron 10 wherein a targeted exon is exon 10. In some embodiments, a targeted region comprises the 5’ splice site of intron 11 wherein a targeted exon is exon 11.
  • a targeted region comprises the 5’ splice site of intron 12 wherein a targeted exon is exon 12. In some embodiments, a targeted region comprises the 5’ splice site of intron 13 wherein a targeted exon is exon 13. In some embodiments, a targeted region comprises the 5’ splice site of intron 14 wherein a targeted exon is exon 14. In some embodiments, a targeted region comprises the 5’ splice site of intron 15 wherein a targeted exon is exon 15. [0058] In some embodiments, an RTSM binding domain specifically binds to a splice site. In some embodiments, an RTSM binding domain specifically hybridizes to a splice site.
  • a splice site comprises a sequence as set forth in Formula (II).
  • Formula (II) can be seen, for example, in any sequence set forth in Table 5.
  • a splice site sequence comprises a sequence that can be at least about 2 to about 50 nucleobases long.
  • a splice site sequence comprises a sequence that can be about 14 to about 35 nucleobases long.
  • a splice site sequence comprises a sequence that can be about 14 to about 25 nucleobases long.
  • a splice site sequence comprises a sequence that can be about: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length.
  • a splice site sequence can be about 2 nucleobases in length.
  • a splice site sequence can be about 3 nucleobases in length.
  • a splice site sequence can be about 4 nucleobases in length.
  • a splice site sequence can be about 14 nucleobases in length. In some embodiments a splice site sequence can be about 25 nucleobases in length. [0060] In some embodiments, a splice site comprises a sequence that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS. 66-95. In some embodiments, a splice site is a 5’ splice site.
  • a 5’ splice site can be the complement of any one of the sequences of SEQ ID NOS: 66-95. In some embodiments, a 5’ splice site can be the inverse complement of any one of the sequences of SEQ ID NOS.66-95.
  • Table 5 Exemplary Splice Site Sequences [0061] SEQ ID NOS: 66-95 is reproduced in Table 6 below and in some instances, the splice site can be located where the vertical line is located at each sequence.
  • Table 6 Representative Splice Sites [0062] In some embodiments, a splice site sequence further comprises one or more alterations at one or more positions on either side of the splice site.
  • an alteration can be seen at -1, -2, -3, -4, -5, - 6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26, -27, -28, -29, - 30, -31, -32, -33, -34, -35, -36, -37, -38, -39, -40, -41, -42, -43, -44, -45, -46, -47, -48, -49, -50 or more positions from the splice site in the 3’ to the 5’ direction.
  • an alteration can be seen at +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25, +26, +27, +28, +29, +30, +31, +32, +33, +34, +35, +36, +37, +38, +39, +40, +41, +42, +43, +44, +45, +46, +47, +48, +49, +50 or more positions from the splice site in the 5’ to the 3’ direction.
  • an alteration can be seen at -25, -24, -23, -22, -21, -20, -19, -18, -17, -16, -15, -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1, +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25 positions from the splice site.
  • Alterations can be any one of A, C, G, or or U.
  • alterations can be obtained through computational predictions and alignment, for example, using SPLIGN, ESEMBL, Blast.
  • alterations in a splice site sequence can be induced by one or more IFIH1 gene mutations.
  • an IFIH1 gene comprises one or more gene mutations.
  • the one or more IFIH1 gene mutations are associated with: splicing of a pre-mRNA; expansion of a portion of a pre-mRNA; the expression level of a pre-mRNA or a protein encoded by the gene; gain-of-function of a protein encoded by the gene; or an associated disease or a condition thereof.
  • RNA-Targeted Splicing Modifiers [0064]
  • An RTSM disclosed herein can be synthetic RNA targeting splicing modifiers that can increase exon skipping during splicing of IFIH1 pre-mRNA compared to IFIH1 pre-mRNA spliced in the absence of RTSM.
  • An RTSM disclosed herein can increase the level of modulated IFIH1 mRNA transcripts as compared to mRNA transcripts processed in the absence of RTSM.
  • An RTSM disclosed herein can increase the level of modulated MDA5 protein production or expression as compared to MDA5 produced in the absence of RTSM.
  • the term “increase” means to induce or to increase.
  • any incidence of exon skipping or any indication of exon skipping activity resulting from splicing in the presence of RTSM has thereby “increased” exon skipping.
  • an evaluation of an increase in exon skipping can occur in an in vitro assay.
  • comparison of the amount of exon skipping in two otherwise substantially identical systems where one system lacks an RTSM and the other system has an RTSM can determine if exon increases in the presence of the RTSM.
  • an RTSM can be selected from the group consisting of an antibody or a fragment thereof, an aptamer, an antisense oligomer (ASO), or a CRISPR associated protein, and any combination thereof.
  • an RTSM targets and binds to IFIH1 pre-mRNA.
  • RTSM-pre-mRNA binding can prevent recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, interfere with splice site signaling, sterically block splicing of a pre-mRNA, or any combination thereof.
  • an RTSM comprises a binding domain that binds to IFIH1 pre- mRNA. In some embodiments, an RTSM comprises a binding domain that binds to a target region of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that binds to a target sequence of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that specifically binds to a splice site sequence of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that specifically hybridizes to a splice site sequence of an IFIH1 pre-mRNA.
  • a binding domain of an RTSM disclosed herein can be from about 2 to about 50 nucleobases in length and can bind with about 1 to about 25 nucleobases of an exon to about 1 to about 25 nucleotides of the intron, any number in between, and combinations thereof.
  • a binding domain of an RTSM comprises a sequence that can be at least about 2 to about 50 nucleobases long.
  • a binding domain of an RTSM comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length.
  • an RTSM need not to completely bind to all nucleobases in a target sequence and the nucleobases to which it does bind to may be contiguous or noncontiguous.
  • RTSMs may bind over one or more segments of a pre-mRNA transcript, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed).
  • an RTSM binds to noncontiguous nucleobases in a target pre-mRNA transcript.
  • a RTSM may bind to nucleobases in a pre-mRNA transcript that are separated by one or more nucleobase(s) to which an RTSM does not bind.
  • an RTSM can bind to about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 continuous nucleobases of a target pre-mRNA.
  • an RTSM binding domain comprises a binding sequence.
  • a binding sequence binds to the sequence as set forth in Formula II.
  • a binding sequence hybridizes to the sequence as set forth in Formula II.
  • a binding sequence comprises a sequence as set forth in Formula (III) below: Formula (III): Exemplary Binding Sequence [0071]
  • Formula (III) further comprises: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 N(s) wherein each N is independently A, G, C, T or U.
  • Formula (I), Formula (II), or both further comprise: N; NN; NNN; NNNN; NNNNNNN; NNNNNNN; NNNNNNNNN; NNNNNNNNNN; NNNNNNNNNNN; NNNNNNNNNNNNNN; NNNNNNNNNNNNN; NNNNNNNNNNNN; NNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; or NNNNNNNNNNNNNNNNNNN wherein each N is independently A, G, C, T or U.
  • an N of a group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous N(s) can be 5’ and adjacent to B or can be 3’ and adjacent to Y, or any combination thereof, wherein each N is independently A, G, C, T or U.
  • Formula (III) further comprises an N of a group of: 1, 2, 3, 4, 5 or 6 contiguous N(s) that can be 5’ and adjacent to B; an N group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 contiguous N(s) that can be 3’ and adjacent to Y; or any combination thereof, wherein each N is independently A, G, C, T or U.
  • Formula (III) further comprises: N that is 5’ and adjacent to B; NN that is 5’ and adjacent to B; NNN that is 5’ and adjacent to B; NNNN that is 5’ and adjacent to B; NNNNN that is 5’ and adjacent to B; NNNNNNN that is 5’ and adjacent to B; NNNNNNNN that is 5’ and adjacent to B; NNNNNNNN that is 5’ and adjacent to B; NNNNNNNN that is 5’ and adjacent to B; or NNNNNNNNNNNNN that is 5’ and adjacent to B; N that is 3’ and adjacent to Y; NN that is 3’ and adjacent to Y; NNN that is 3’ and adjacent to Y; NNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNN that is 3
  • Formula (III) further comprises NNNNNNNN that is 5’ and adjacent to B and NNN that is 3’ and adjacent to Y
  • the sequence of Formula (III) may comprise NNNNNNNNBACYNNN.
  • Formula (III) further comprises NNNNNNNNNNN that is 5’ and adjacent to B and NNNNNNN that is 3’ and adjacent to Y
  • the sequence of Formula (III) may comprise NNNNNNNNNBACYNNNNNNN, wherein each N is independently A, G, C, T or U.
  • Formula (III) further comprises: D wherein D is A, G, T or U; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 N (s) wherein each N is independently A, G, T, U or C; 1, 2, or 3 H(s) wherein each H is independently A, C, T or U; or any combination thereof.
  • Formula (III) further comprises: D; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 N(s); 1 or 2 H(s); or any combination thereof, that is 5’ and adjacent to B, wherein D is A, G, T or U, each N is independently A, G, T, U or C, and each H is independently A, C, T or U.
  • Formula (III) further comprises: 1, 2, 3, 4, 5, or 6 N(s); H; or any combination thereof, that is 3’ and adjacent to Y.
  • Formula (III) further comprises: N that is 5’ and adjacent to B; HN that is 5’ and adjacent to B; NHN that is 5’ and adjacent to B; NNHN that is 5’ and adjacent to B; DNNHN that is 5’ and adjacent to B; NDNNHN that is 5’ and adjacent to B; HNDNNHN that is 5’ and adjacent to B; NHNDNNHN that is 5’ and adjacent to B; NNHNDNNHN that is 5’ and adjacent to B; NNNHNDNNHN that is 5’ and adjacent to B; NNNNHNDNNHN that is 5’ and adjacent to B; NNNNHNDNNHN that is 5’ and adjacent to B; NNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNHNDNNHN that is 5’ and
  • Formula (III) further comprises HNDNNHN that is 5’ and adjacent to B, HNN that is 3’ and adjacent to Y, wherein the sequence of Formula (III) comprises HNDNNHNBACYHNN wherein each N is independently A, G, T, U or C, wherein D is A, G, T or U, and wherein H is A, C, T or U.
  • Formula (III) comprises NNNNNNNHNDN HN that is 5’ and adjacent to B and HNNNNNN that is 3’ and adjacent to Y, wherein the sequence of Formula (III) comprises NNNNNNNHNDNNHNBACYHNNNNNNNN wherein each N is independently A, G, T, U or C, wherein each D is independetly A, G, T or U, and wherein each H is independently A, C, T or U.
  • Various embodiments of Formula (III) can be seen in SEQ ID NOS: 96-155.
  • Various embodiments of Formula (III) can be modified as described in the methods herein.
  • an RTSM binding domain comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
  • an RTSM binding domain comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
  • an RTSM binding domain comprises a sequence about 2 to about 50 nucleobases in length that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
  • an RTSM binding domain comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
  • Table 7 Exemplary Binding Sequences [0082]
  • a binding sequence may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 7. Alterations can be made singly or in combination with other alterations at other positions.
  • a binding sequence comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
  • a binding sequence comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
  • a binding sequence disclosed herein comprises a sequence that binds to or hybridizes to 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 continuous or non-continuous nucleotides of any one of the sequences of SEQ IDS NOS: 66-95.
  • An RTSM disclosed herein can increase exon skipping during pre-mRNA splicing as compared to a pre-mRNA spliced in the absence of an RTSM.
  • exon skipping modulates exon coding in IFIH1 mRNA, MDA5 protein, or both.
  • modulated exon coding can be determined by modulated mRNA transcription, modulated MDA5 protein translation, or both.
  • modulated exon coding comprises: absence of one or more IFIH1 gene exon(s) in an IFIH1 mRNA molecule, a truncated mRNA molecule, absence of one or more IFIH1 gene exon(s) in a MDA5 protein molecule, a non-functional MDA5 protein, a semi-functional MDA5 protein, a truncated MDA5 protein molecule, or any combination thereof.
  • an increase in exon skipping induces an increase in modulated exon coding.
  • RTSM-modulated IFIH1 mRNA transcript can be encoded by a sequence that excludes a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to: SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:10; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:6; SEQ ID NO:17; SEQ ID NO:18; SEQ ID NO:19; SEQ ID NO:20 and any combination thereof.
  • RTSM-modulated IFIH1-mRNA transcript can be determined by analysis of a IFIH1 mRNA transcript expressed in the absence of RTSM, or to a wild-type IFIH1 mRNA, or both, wherein the wild-type IFIH1 mRNA can be encoded by a sequence with at least: 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3.
  • RTSM-modulated MDA5 protein expression can be determined by analysis of a MDA5 protein translated in the absence of RTSM, or a wild-type MDA5 protein, or both, wherein the wild-type MDA5 protein can be encoded by a sequence with at least: 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4.
  • Antibodies [0089]
  • an RTSM can be an antibody or a fragment thereof specific or selective for a IFIH1 pre-mRNA.
  • an RTSM can be an anti-mRNA antibody or a fragment thereof.
  • Antibodies also known as immunoglobulin (Ig), as disclosed herein can be monoclonal or polyclonal antibodies.
  • the term “monoclonal antibodies,” as used herein, can refer to antibodies that are produced by a single clone of B-cells and bind to the same epitope.
  • polyclonal antibodies can refer to a population of antibodies that are produced by different B-cells and bind to different epitopes of the same antigen.
  • the antibodies can be from any animal origin.
  • An antibody can be IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY.
  • the antibody can be whole antibodies, including single-chain whole antibodies.
  • the antibody can be a fragment of an antibody, which can include, but are not limited to, a Fab, a Fab’, a F(ab’)2, a Fd (consisting of VH and CH1), a Fv fragment (consisting of VH and VL), a single-chain variable fragment (scFv), a single-chain antibody, a disulfide-linked variable fragment (dsFv), and fragments comprising either a VL or VH domain.
  • a whole antibody typically consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two identical copies of a light (L) chain polypeptide.
  • Each of the heavy chains contains one N-terminal variable (VH) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (VL) region and one C- terminal constant (CL) region.
  • the variable regions of each pair of light and heavy chains form the antigen binding site of an antibody.
  • the VH and VL regions have a similar general structure, with each region comprising four framework regions, whose sequences are relatively conserved.
  • the framework regions are connected by three complementarity determining regions (CDRs).
  • the three CDRs form the “hypervariable region” of an antibody, which can be responsible for antigen binding, and can include overlapping or subsets of amino acid residues when compared against each other.
  • the term “CDR” can be a CDR which can be defined based on sequence comparisons.
  • CDRH1, CDRH2 and CDRH3 denote the heavy chain CDRs
  • CDRL1, CDRL2 and CDRL3 denote the light chain CDRs.
  • fragment of an antibody can mean one or more fragments or portions of an antibody that retain the ability to specifically or selectively bind to an antigen.
  • the antibody fragment desirably comprises, for example, one or more CDRs, the variable region (or portions thereof), the constant region (or portions thereof), or any combination thereof.
  • Non-limiting examples of antibody fragments include (1) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (2) a F(ab’)2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the stalk region; (3) a Fv fragment comprising the VL and VH domains of a single arm of an antibody; (4) a single chain Fv (scFv), which is a monovalent molecule comprising the two domains of the Fv fragment (e.g., VL and VH) joined by a linker which enables the two domains to be synthesized as a single polypeptide chain and (5) a diabody, which is a dimer of polypeptide chains, wherein each polypeptide chain comprises a VH connected to a VL by a peptide linker that is too short to allow pairing between the VH and VL on the same polypeptide chain, thereby driving the pairing between the complementary
  • an RTSM antibody or fragment of described herein comprises a binding region that targets a target region on a IFIH1 pre-mRNA.
  • an RTSM antibody binding region can be also known as an “antigen recognition domain,” “antigen binding domain,” or “antigen binding region” which can refer to a portion of an RTSM specifically binds to a target region.
  • a target region of a pre-mRNA comprising a target sequence can be referred to herein as an antigen.
  • a target region of a pre-mRNA can be an antigen
  • a target sequence can be an epitope
  • an RTSM antibody or fragment thereof targets to and binds to the pre-mRNA epitope.
  • an RTSM antibodies or fragments thereof can be generated by a modified nucleobase-coupling protocol.
  • the antibody can be modified, coupled or conjugated with a nucleic acid probe, such as an antisense oligonucleotide probe, wherein the nucleic acid probe binds to a targeted region of the IFH1 pre-mRNA and increases exon skipping.
  • an RTSM can be an aptamer that binds to a riboswitch on a targeted pre- mRNA
  • an RTSM aptamer can be operably linked to a ligand.
  • an RTSM can be operably linked to a ligand.
  • a ligand or molecule specific to an aptamer it can be helpful to meet some or all of the following criteria. First, it should be able to bind its ligand-binding aptamer with high affinity. Second, ligand-aptamer interaction should not require the assistance of any other factor.
  • the ligand-binding site (the aptamer) should be unstructured and only upon binding of ligand should the aptamer undergo a conformational change or rearrangement.
  • the ligand-aptamer binding must be preserved under the conditions that support pre-mRNA splicing.
  • the ligand should not affect the splicing of a substrate that does not contain its binding site.
  • the aptamer-ligand comprises a binding region that targets and binds to a target sequence of a pre-mRNA, wherein the aptamer inserts into the strand and the ligand increases exon skipping.
  • a ligand can be tobramycin, neomycin, or theophylline.
  • Antisense Oligonucleotides ASOs
  • an RTSM can be an ASO.
  • an RTSM disclosed herein comprises a binding domain that targets and binds to a target region of an IFIH1 pre-mRNA
  • a binding domain of an RTSM comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length.
  • an ASO binding domain comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
  • a binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of SEQ ID NOS: 36-65.
  • an ASO-RTSM of the present disclosure comprises a sequence that has at least about 85% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an RTSM of the present disclosure comprises a sequence that has at least about 92% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an RTSM of the present disclosure comprises a sequence that has at least about 84% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has at least about 88% sequence complementary to the sequence of SEQ ID NO: 64.
  • an ASO RTSM of the present disclosure comprises a sequence that has at least about 92% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has at least about 96% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence complementary to the sequence of SEQ ID NO: 64. [0097] An ASO and a DNA or RNA target binding partner can be complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which can be used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between an ASO and a DNA or RNA target. It can be understood that the sequence of an ASO need not be 100% complementary to that of its target sequence to be specifically hybridizable.
  • An ASO can be specifically hybridizable when there are sufficient binding interactions between an ASO and DNA or RNA target such that the ASO, at least temporarily, adheres to the specific region which its targeting. Specific binding can occur under physiological conditions, including but not limited to room temperature, in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • an ASO can have exact sequence complementary to a target sequence or near complementarity (e.g., sufficient complementarity to bind a target sequence and modulating splicing at a splice site).
  • Complementarity the degree to which one polynucleotide is complementary with another
  • the sequence of an antisense oligomer (ASO) need not be 100% complementary to that of its target nucleic acid to hybridize.
  • ASOs can comprise at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to a target region within a target nucleic acid sequence to which they are targeted.
  • an ASO in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining non-complementary nucleobases may be clustered together or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • Percent complementarity of an ASO with a region of a target nucleic acid can be determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs.
  • ASOs disclosed herein can be designed so that they bind to a target nucleic acid (e.g., a targeted region of a pre-mRNA transcript) and remain bound under physiological conditions. In some embodiments, binding as described herein can be hybridizing. In some embodiments, if an ASO binds to a site other than the intended (targeted) nucleic acid sequence, it binds to a limited number of sequences that are not a target nucleic acid (to a few sites other than a target nucleic acid).
  • ASOs can bind to a target pre-mRNA.
  • ASOs can hybridize to a pre-mRNA.
  • ASOs can "specifically hybridize” to or are “specific” to a target nucleic acid or a targeted portion of a pre-mRNA.
  • Such hybridization can occur with a T m (melting temperature) substantially greater than 37 o C, at least 50 o C, or between 60 o C to approximately 90 o C.
  • T m melting temperature
  • Such hybridization preferably corresponds to stringent hybridization conditions.
  • the T m is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide.
  • an ASO can bind to, hybridize to, or specifically hybridize to a splice site sequence in a target pre-mRNA wherein a splice site sequence comprises a sequence that shares at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 66-95.
  • an ASO RTSM comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:96-155.
  • an ASO comprises a sequence about 14 to about 30 nucleobases in length that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:96-155.
  • an ASO RTSM of the present disclosure comprises a sequence that shares at least about 85% sequence identity to the sequence of SEQ ID NO: 109.
  • an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 109.
  • an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 109. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 85% sequence identity to the sequence of SEQ ID NO: 124. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 124. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 124.
  • an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 88% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 139.
  • an ASO RTSM of the present disclosure comprises a sequence that shares at least about 96% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 139. [0104] In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 88% sequence identity to the sequence of SEQ ID NO: 154.
  • an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 96% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 154.
  • An ASO disclosed herein can comprise oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of binding to a complementary nucleobase on a target mRNA, but in some embodiments, an ASO does not comprise a sugar moiety, such as a peptide nucleic acid (PNA).
  • An ASO may comprise naturally-occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the preceding.
  • the term "modified nucleotides” includes nucleotides with modified or substituted sugar groups and/or having a modified backbone. In some embodiments, all of the nucleotides of an ASO are modified nucleotides.
  • one or more nucleobases of an ASO may be any unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA.
  • modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine.
  • an ASO described herein further comprises a backbone structure that connects the components of an oligomer.
  • backbone structure and “oligomer linkages” may be used interchangeably and can refer to the connection between monomers of the ASO.
  • the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of the oligomer.
  • the backbone structure or oligomer linkages of an ASO described herein can include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like.
  • the backbone structure of an ASO does not contain phosphorous but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups.
  • the backbone modification can be a phosphothioate linkage.
  • the backbone modification can be a phosphoramidate linkage.
  • Any of the ASOs described herein may contain a sugar moiety that comprises ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog, including a morpholine ring.
  • Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O- guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars.
  • the sugar moiety modification can be selected from 2'-O-Me, 2'F, and 2'MOE.
  • the sugar moiety modification can be an extra bridge bond, such as in a locked nucleic acid (LNA).
  • the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO).
  • the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification.
  • the sugar moiety comprises 2'4'-constrained 2'O-methyloxyethyl (cMOE) modifications.
  • the sugar moiety comprises cEt 2', 4' constrained 2'-O ethyl BNA modifications.
  • the sugar moiety comprises tricycloDNA (tcDNA) modifications.
  • the sugar moiety comprises ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety comprises MCE modifications.
  • one or more monomer, or each monomer of an ASO can be modified in the same way, for example each linkage of the backbone of an ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification. Such modifications that are present on each of the monomer components of an ASO are referred to as "uniform modifications.”
  • a combination of different modifications may be desired, for example, an ASO may comprise a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos).
  • an ASO comprises one or more backbone modifications.
  • an ASO comprises one or more sugar moiety modification.
  • an ASO comprises one or more backbone modifications and one or more sugar moiety modifications.
  • an ASO comprises a 2'MOE modification and a phosphorothioate backbone.
  • an ASO comprises a phosphorodiamidate morpholino (PMO).
  • an ASO comprises a peptide nucleic acid (PNA).
  • an ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage.
  • an ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, a 2'-Fluoro, or a 2'-O- methoxyethyl moiety.
  • an ASO comprises at least one modified sugar moiety.
  • each sugar moiety can be a modified sugar moiety.
  • any of the ASOs or any component of an ASO may be independently modified in order to achieve desired properties or activities of an ASO or reduce undesired properties or activities of the ASO.
  • an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (e.g., RNase H); improve uptake of an ASO into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; and/or modulate the half-life of the ASO.
  • an ASO can be comprised of one or more 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides.
  • ASOs comprised of such nucleotides can be especially well-suited to the methods disclosed herein; oligomers having such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery in some embodiments described herein.
  • ASOs can be synthesized by methods described herein. Alternatively or in addition, ASOs may be obtained from a commercial source. In certain embodiments, an ASO can be prepared by stepwise solid- phase synthesis.
  • an ASO e.g., to enhance pharmacokinetics or to facilitate capture or detection of the compound.
  • a moiety may be covalently attached, according to standard synthetic methods. For example, addition of a polyethylene glycol moiety or other hydrophilic polymer, e.g., one having 1-100 monomeric subunits, may be useful in enhancing solubility.
  • a reporter moiety such as fluorescein or a radiolabeled group, may be attached for purposes of detection.
  • the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin.
  • RTSMs comprising a CRISPR associated protein.
  • An RTSM can be a CRISPR-Cas system (CC RTSM system) wherein the system comprises a CRISPR associated protein.
  • the CC RTSM system can be designed to target an IFIH1 pre-mRNA, prevent recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, interfere with splice site signaling, sterically block splicing of a pre-mRNA, or any combination thereof.
  • CC systems that target RNA, including but not limited to Types III and VI. While any suitable CC system may be used for the purposes of the disclosure herein, in some embodiments, systems that target RNA and does not rely on consensus protospacer adjacent motif (PAM) for activity, such as Types III and VI, can be used herein.
  • PAM consensus protospacer adjacent motif
  • the CC systems used herein can rely on RNA protospacer flanking sequences (PFS) or PAM sequences.
  • an IFIH1 RNA further comprises a PFS sequence or a PAM sequence.
  • PFS RNA protospacer flanking sequence
  • a PAM sequence or a PAM sequence.
  • Subtypes of suitable CC systems disclosed herein include, but are not limited Type II class 2, Types III-A, III-B, VI-A, VI-A, VI-C, or VI-D.
  • Type II RNA-targeting Cas9 systems can also be used as an RTSM disclosed herein.
  • the CC RTSM system comprises a guide RNA and a Cas nuclease.
  • the guide RNA comprises a crispr RNA (crRNA) and a tracr RNA.
  • the guide RNA comprises a single guide RNA (sgRNA).
  • CC RTSM system can comprise one or more Cas nuclease.
  • suitable Cas nucleases include, but are not limited to, Csm3, Cmr4, Csm6, Csx1, Csx27, Csx28, a member of a Cas 7 superfamily, or a Cas9, Cas12, or a Cas13 effector nuclease.
  • CC Systems that target an IFIH1 pre-mRNA can be computationally identified through determination of a Cas containing signature genes that express RNAse or RNA targeting activity, and transcribed and processed into a CRISPR gRNA.
  • the gRNA of the CC RTSM system comprises a binding domain that binds to a target region of an IFIH1 pre-mRNA.
  • a gRNA or sgRNA binding domain comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. In one embodiment, a gRNA or sgRNA binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
  • a gRNA or sgRNA binding domain comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:111-125 and 141-155.
  • a gRNA or sgRNA binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:111-125 and 141-155.
  • a gRNA of the CC RTSM system targets an IFIH1 pre-mRNA of interest and directs a Cas nuclease to a pre-mRNA.
  • the Cas nuclease can be a catalytically dead variant, wherein upon gRNA binding to a target region of a pre-mRNA, the CC RTSM system increases exon skipping wherein the system prevents recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, or sterically block mRNA splicing.
  • a Cas nuclease can be selected and or synthesized to interfere with splice site signaling through RNAse activity wherein upon gRNA binding to a target region of a pre-mRNA, the Cas nuclease can disrupt splice site signaling sequences of a targeted exon-intron junction thereby inducing exon skipping.
  • Modifications [0124] Any of the RTSMs described herein may be modified in order to achieve desired properties or activities of an RTSM or reduce undesired properties or activities of the RTSM.
  • an RTSM or one or more components of any RTSM may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (e.g., RNase H); improve uptake of an RTSM into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the RTSM; and/or modulate the half-life of the RTSM.
  • vector delivery systems that are capable of expressing an RTSM sequences herein, such as vectors that express a polynucleotide sequence comprising any one or more of the sequences shown in Table 7, as described herein.
  • vector or “nucleic acid construct” can be meant to be a polynucleotide molecule, such as a DNA molecule, derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned.
  • a vector can contain one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrated with the genome of the defined host such that the cloned sequence can be reproducible.
  • the vector can be an autonomously replicating vector, e.g., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome.
  • the vector can contain any means for assuring self-replication.
  • the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • an RTSM of the present disclosure can be conjugated to a cell penetrating peptide.
  • an RTSM can be an ASO wherein an ASO can comprise an oligonucleotide moiety conjugated to a cell penetrating peptide effective to enhance transport of the compound into cells.
  • the oligonucleotide moiety can be an arginine-rich peptide transport moiety effective to enhance transport of the compound into cells.
  • the transport moiety can be attached to a terminus of the oligomer.
  • the peptides have the capability of inducing cell penetration within 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of cells of a given cell culture population, including all integers in between, and allow macromolecular translocation within multiple tissues in vivo upon systemic administration.
  • the cell-penetrating peptide may be an arginine-rich peptide transporter.
  • the cell-penetrating peptide may be Penetratin or the Tat peptide.
  • the CPP can be conjugated to an ASO herein and can utilize glycine as the linker between the CPP and the antisense oligonucleotide.
  • a preferred peptide conjugated PMO consists of R 6 -G-PMO.
  • RTSMs disclosed herein can increase exon skipping during pre-mRNA splicing as compared to a pre-mRNA spliced in the absence of an RTSM herein as determined by an in vitro assay. In some embodiments, exon skipping modulates IFIH1 mRNA transcript production.
  • exon skipping increases production of mRNA transcript excluding coding for one or more exons, a truncated mRNA molecule, or both.
  • RTSM-modulated mRNA expression can be compared to mRNA processed in the absence of RTSM as determined by an in vitro assay.
  • exon skipping modulates MDA5 protein production.
  • an increase in exon skipping induces an increase in modulated MDA5 protein expression.
  • exon skipping increases production of a non-functional MDA5 protein, a semi- functional MDA5 protein, a truncated MDA5 protein, or combinations thereof.
  • RTSM modulated MDA5 protein production can be compared to MDA5 protein production in the absence of RTSM as determined by an in vitro assay.
  • the cell, organ, or subject can be evaluated to determine if appropriate for the methods and compositions described herein. Methods of determining exon skipping, mRNA modulation, protein expression, or MDA5 modulation are described, such as in the Examples, herein. Other non-limiting assays to determine gene expression, exon skipping and MDA5 expression include quantitative PCR (qPCR), including but not limited to PCR, real-time PCR (e.g., Sybr-green), and/or hot PCR.
  • qPCR quantitative PCR
  • real-time PCR e.g., Sybr-green
  • hot PCR hot PCR.
  • expression of one or more genes can be measured by detecting the level of transcripts of the genes.
  • Exon skipping can be measured by detecting the expression of the processed m-RNA.
  • Expression of functional MDA5 protein can be measured by detecting the level or length of the protein, or by an assay that measures its biological activity.
  • expression can be measured by Northern blotting, nuclease protection assays (e.g., RNase protection assays), reverse transcription PCR, quantitative PCR (e.g., real-time PCR such as real-time quantitative reverse transcription PCR), in situ hybridization (e.g., fluorescent in situ hybridization (FISH)), dot-blot analysis, differential display, serial analysis of gene expression, subtractive hybridization, microarrays, nanostring, and/or sequencing (e.g., next-generation sequencing)
  • Expression can be measured by protein immunostaining, protein immunoprecipitation, electrophoresis (e.g., SDS-PAGE), Western blotting, bicinchoninic acid assay, spectrophotometry, mass spectrometry, enzyme assays (e.g., enzyme-linked immunosorbent assays), immunohistochemistry, flow cytometry, and/or immunocytochemistry.
  • microscopy can be optical, electron, or scanning probe microscopy.
  • Optical microscopy can comprise use of bright field, oblique illumination, cross-polarized light, dispersion staining, dark field, phase contrast, differential interference contrast, interference reflection microscopy, fluorescence (e.g., when particles, e.g., cells, are immunostained), confocal, single plane illumination microscopy, light sheet fluorescence microscopy, deconvolution, or serial time-encoded amplified microscopy.
  • Methods Disclosed herein are, among other disclosures, are methods of exon skipping, modulating IFIH1 pre-mRNA expression, modulating MDA5 protein expression, and prophylaxis/treatment of: MDA5- mediated conditions, inflammatory disorders, autoimmune diseases, IFN-1-mediated autoimmune diseases, and any combination thereof.
  • the disclosed compositions and methods result in a truncated MDA5 protein.
  • the disclosed compositions and methods result in a decrease in the wild-type MDA5 protein.
  • the disclosed compositions and methods result in modulating the splicing of IFIH1 pre-mRNA.
  • the disclosed compositions and methods result in IFIH1 mRNA lacking exon 14 or a portion thereof.
  • IFIH1 expression can be modulated compared to a control.
  • a control can be wild-type or non wild-type control. Controls can be positive or negative controls.
  • Methods of modulating IFIH1 expression [0135] Disclosed herein are methods to increase exon skipping of an IFIH1 mRNA comprising contacting a IFIH1 pre-mRNA with an RTSM as disclosed herein, and allowing modulated splicing to occur.
  • RTSMs herein can increase the level of modulated IFIH1 mRNA transcripts as compared to mRNA transcripts processed in the absence of RTSM wherein a mRNA transcript modulation comprises a decrease in full-length IFIH1 mRNA transcript, an increase in truncated IFIH1 mRNA transcript, an increase in an IFIH1 mRNA transcript lacking coding for one or more exons, or any combination thereof.
  • the increase in modulated mRNA transcript processing can be about: 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a non-contacted control.
  • the increase in modulated mRNA transcript processing can be about: 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to a non-contacted control.
  • modulated MDA5 protein expression comprises a decrease of the level of functional MDA5 protein, an increase of expression of truncated MDA5 protein, decrease of expression of functional MDA5 protein, or inhibition of expression of functional MDA5 protein, and any combination thereof compared to a non-contacted control.
  • the increase in modulated MDA5 protein production can be about: 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a non-contacted control.
  • the increase in modulated MDA5 protein expression can be by about: 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to a non-contacted control.
  • Methods of Treating Diseases and Conditions [0139] Disclosed herein are methods of prophylaxis/treatment of inflammatory disorders. In some embodiments, the disclosed herein relates to methods of prophylaxis/treatment of inflammatory disorders, MDA5-associated conditions, autoimmune diseases, or an IFN-1-mediated autoimmune disease.
  • the disclosure provides a method for inducing exon skipping to decrease the level of functional MDA5 in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM.
  • the disclosure provides a method for increasing the level of exon modulated IFIH1 mRNA in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM.
  • the disclosure provides a method for decreasing the level of functional MDA5 in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing the level of functional MDA5 to decrease IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing interferon ⁇ (IFN- ⁇ ) production to decrease in IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM.
  • IFN- ⁇ interferon ⁇
  • the disclosure provides a method for decreasing interferon ⁇ (IFN- ⁇ ) production to decrease IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM.
  • treatment with a RTSM of the disclosure increases one or more exon- modulated IFIH1 mRNA production, decreases full length IFIH1 mRNA production, decreases functional MDA5 production, decreases full-length MDA5 protein production, increases truncated MDA5 production, decreases IFN- ⁇ production, decreases IFN- ⁇ production, decreases IFN- ⁇ SURGXFWLRQ ⁇ GHFUHDVHV ⁇ ,)1-1 signaling, prevents disease development, delays disease progression, ameliorates disease symptoms, decreases auto-immunity, reduces tissue inflammation, reduces tissue damage, and any combination thereof, to be expected in the absence of treatment with a RTSM.
  • the method disclosed herein can be useful treat subject who is suffering from or is at a risk of developing an inflammatory disorder.
  • inflammatory disorder can mean an immune- mediated inflammatory condition, generally characterized by dysregulated expression of one or more cytokines.
  • inflammatory disease include skin inflammatory disorders, inflammatory disorders of the joints, and inflammatory disorders of the cardiovascular system, autoimmune diseases, lung and airway inflammatory disorders, intestinal inflammatory disorders.
  • skin inflammatory disorders include dermatitis, for example atopic dermatitis and contact dermatitis, acne vulgaris, and psoriasis.
  • inflammatory disorders of the joints include rheumatoid arthritis.
  • inflammatory disorders of the cardiovascular system are cardiovascular disease and atherosclerosis.
  • autoimmune diseases include Type 1 diabetes, Graves’ disease, Guillain-Barre disease, Lupus, Psoriatic arthritis, and Ulcerative colitis.
  • lung and airway inflammatory disorders include asthma, cystic fibrosis, COPD, emphysema, and acute respiratory distress syndrome.
  • intestinal inflammatory disorders include colitis and inflammatory bowel disease.
  • Other inflammatory disorders include cancer, hay fever, periodontitis, allergies, hypersensitivity, ischemia, depression, systemic diseases, post infection inflammation, amyotrophic lateral sclerosis and bronchitis.
  • inflammatory disorder comprises MDA5-associated conditions, autoimmune diseases, or an IFN-1 mediated autoimmune disease.
  • an MDA5 associated condition is a disorder generally characterized by dysregulated expression of MDA5 protein, wherein the MDA5 protein can over- expressed or over-functional.
  • an MDA5 associated condition may result from wild- type expression of the MDA5 protein in addition to other predispositions, such as for an inflammatory disorder or an autoimmune disease.
  • a MDA5 associated condition can be selected from the group consisting of Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D), Aicardi-Goutieres Syndrome (AGS), Singleton-Merten Syndrome, Primary SS, Inflammatory Myositis, Scleroderma, and Rheumatoid Arthritis (RA).
  • SLE Systemic Lupus Erythematosus
  • T1D Type 1 Diabetes
  • Aicardi-Goutieres Syndrome Aicardi-Goutieres Syndrome
  • Singleton-Merten Syndrome Singleton-Merten Syndrome
  • Primary SS Inflammatory Myositis
  • Scleroderma Scleroderma
  • Rheumatoid Arthritis Rheumatoid Arthritis
  • Exemplary autoimmune diseases include, but are not limited to, organ specific disorders such as Hashimoto's thyroiditis, primary myxoedema thyrotoxicosis, pernicious anemia, Addison's disease, and insulin-dependent diabetes mellitus as well as non-organ specific disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis, dermatomyositis, scleroderma and psoriasis.
  • organ specific disorders such as Hashimoto's thyroiditis, primary myxoedema thyrotoxicosis, pernicious anemia, Addison's disease, and insulin-dependent diabetes mellitus
  • non-organ specific disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis, dermatomyositis, scleroderma and psorias
  • Non-limiting examples of autoimmune disorders treatable with RTSM or pharmaceutical composition of the disclosure include Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D), Aicardi-Goutieres Syndrome (AGS), Singleton-Merten Syndrome, Primary SS, Inflammatory Myositis, Scleroderma, and Rheumatoid Arthritis (RA).
  • Non-limiting examples of inflammation treatable with an RTSM composition of the present disclosure include inflammatory interferon signaling, such as by IFN-1.
  • the method disclosed herein can be useful treat subject who is suffering from or is at a risk of developing an IFN-1 mediated autoimmune disease.
  • IFN-1 mediated autoimmune disease can be an auto-immune disease generally characterized by dysregulated expression of proinflamPDWRU ⁇ PROHFXOHV ⁇ LQWHUIHURQ ⁇ LQWHUIHURQ ⁇ ⁇ , and interferon ⁇ , and an increase in type 1 IFN signaling.
  • IFN-1 mediated autoimmune diseases include SLE, pSS, myositis, scleroderma, and RA.
  • treatment with an RTSM of the disclosure increases in truncated IFIH1 mRNA transcript production, decreases full length IFIH1 mRNA transcript production, decreases functional MDA5 production, decreases full-length MDA5 protein production, increases truncated MDA5 production, decreases IFN- ⁇ production, decreases IFN- ⁇ SURGXFWLRQ ⁇ GHFUHDVHV ⁇ IFN- ⁇ production, decreases IFN-1 signaling, prevents disease development, delays disease progression, ameliorates disease symptoms, decreases auto-immunity, reduces tissue inflammation, reduces tissue damage, any combination thereof to be expected in the absence of treatment with a RTSM as demonstrated in an in vitro assay.
  • the method increases truncated IFIH1 mRNA transcript production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases full-length IFIH1 mRNA production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases functional MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases full-length MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method increases truncated MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases MDA5 signaling by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases IFN- ⁇ SURGXFWLRQ ⁇ E ⁇ 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases IFN- ⁇ production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases IFN- ⁇ production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the method decreases IFN-1 signaling by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control.
  • the disease can be T1D.
  • the disease can be SLE.
  • biological markers may be utilized to characterize development, progression, and symptoms of a disease disclosed herein.
  • the biological markers include but are not limited to blood glucose level, insulitis, serum IFN- ⁇ , serum IFN- ⁇ and serum IFN- ⁇ .
  • the biological markers include but are not limited to antinuclear antibody, serum IFN- ⁇ , serum IFN- ⁇ and serum IFN- ⁇ .
  • the method further comprises evaluating a subject prior to RTSM administration to determine whether the subject is suitable for the treatment.
  • evaluating a subject can be determination of mutations of an IFIH1 gene, increased MDA5 protein expression compared to a wild-type control, increased MDA5 functionality compared to a wild-type control, and any combination thereof.
  • Methods of Administration may be given orally, parenterally, systemically, topically, rectally or intramuscular administration. They can be given in a form suitable for each administration route. For example, they can be administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories.
  • formulations herein may conveniently be presented in unit dosage form.
  • the amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingredient, from about 5 percent to about 70 percent, or from about 10 percent to about 30 percent.
  • the selected dosage level will depend upon a variety of factors including the activity of the particular RTSM herein the route of administration, the time of administration, the rate of excretion or metabolism of the particular RTSM being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular oligomer employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • a suitable daily dose of a compound herein will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.
  • an RTSM can be an ASO
  • doses of an ASO herein can be generally administered is from about 0.001 mg/kg to about 1000 mg/kg, wherein mg is mg of RTSM and kg is the body weight of the subject.
  • mg mg of RTSM
  • kg the body weight of the subject.
  • an ASO can be administered at doses of about: 0.001 mg/kg, 0.01 mg/kg, 0.1 mg/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 21 mg/kg, 22mg/kg, 23 mg/kg, 24mg/kg, 25 mg/kg, 26 mg/kg, 27 mg/kg, 28 mg/kg, 29 mg/kg, 30 mg/kg, 31 mg/kg, 32 mg/kg, 33 mg/kg, 34 mg/kg, 35 mg/kg, 36 mg/kg, 37 mg/kg, 38 mg/kg, 39 mg/kg, 40 mg/kg, 41 mg/kg, 42 mg/kg, 43 mg/kg, 44 mg/kg, 45 mg/kg, 46 mg/kg, 47 mg/kg, 48 mg/kg, 49 mg/kg 50 mg/kg, 51 mg/kg, 52 mg/kg, 53 mg/kg, 54 mg/kg, 55 mg/kg, 56
  • the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.
  • dosing is one administration per day.
  • dosing is one or more administration per every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, as needed, to maintain the desired expression of an IFIH1 pre-mRNA and/or MDA5 protein.
  • An RTSM may be administered in continuously or in cycles.
  • an RTSM of the present disclosure can be administered, generally at regular intervals (e.g., daily, weekly, biweekly, monthly, bimonthly).
  • An RTSM may be administered at regular intervals, e.g., daily; once every two days; once every three days; once every 3 to 7 days; once every 3 to 10 days; once every 7 to 10 days; once every week; once every two weeks; once monthly.
  • an RTSM may be administered once weekly by intravenous infusion.
  • An RTSM may be administered intermittently over a longer period of time, e.g., for several weeks, months or years.
  • an RTSM may be administered once every one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve months.
  • an RTSM may be administered once every one, two, three, four or five years.
  • Administration may be followed by, or concurrent with, co-administration with a second agent, for example with an antibiotic, steroid or other therapeutic agent.
  • the treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment.
  • an RTSM of the disclosure may be administered either simultaneously with the other treatment(s), or sequentially in any order and can be temporally spaced up to several days apart.
  • Pharmaceutical Compositions and Dosage Forms [0169] Disclosed herein, in certain embodiments, are pharmaceutical compositions comprising an RTSM described herein and a carrier thereof for administration in a subject. [0170] In certain embodiments, the pharmaceutically acceptable compositions comprise a therapeutically- effective amount of one or more of an RTSM, formulated together with one or more pharmaceutically acceptable: carriers (additives) and/or diluents.
  • an RTSM herein when administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99%, or 10 to 30% of an RTSM in combination with a pharmaceutically acceptable carrier.
  • a pharmaceutical composition of the present disclosure can be delivered, e.g., subcutaneously or intravenously with a standard needle and syringe or a pen delivery device.
  • the injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc.
  • the injectable preparations may be prepared, e.g., by dissolving, suspending or emulsifying an RTSM herein in a sterile aqueous medium or an oily medium conventionally used for injections.
  • aqueous medium for injections there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc.
  • an alcohol e.g., ethanol
  • a polyalcohol e.g., propylene glycol, polyethylene glycol
  • a nonionic surfactant e.g., polysorbate 80, HCO-50 (
  • compositions of the present disclosure can be in the form of, for example, granules, powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions.
  • the amount of the aforesaid antibody contained can be about 5 to about 500 mg per dosage form in a unit dose.
  • an RTSM can be contained in about in about 5 to about 100 mg, for example for a parental dosage form. In other embodiments, an RTSM can be contained in about 10 to about 250 mg for the other dosage forms.
  • oral, buccal, and sublingual administration, powders, suspensions, granules, tablets, pills, capsules, gelcaps, and caplets can be used as solid dosage forms. These can be prepared, for example, by mixing an RTSM, with at least one additive such as a starch or other additive.
  • Suitable additives are sucrose, lactose, cellulose sugar, mannitol, maltitol, dextran, starch, agar, alginates, chitins, chitosans, pectins, tragacanth gum, gum arabic, gelatins, collagens, casein, albumin, synthetic or semi-synthetic polymers or glycerides.
  • oral dosage forms can contain other ingredients to aid in administration, such as an inactive diluent, or lubricants such as magnesium stearate, or preservatives such as paraben or sorbic acid, or anti-oxidants such as ascorbic acid, tocopherol or cysteine, a disintegrating agent, binders, thickeners, buffers, sweeteners, flavoring agents or perfuming agents. Tablets and pills may be further treated with suitable coating materials known in the art.
  • Liquid dosage forms for oral administration may be in the form of pharmaceutically acceptable emulsions, syrups, elixirs, suspensions, and solutions, which may contain an inactive diluent, such as water.
  • pharmaceutical formulations and medicaments may be prepared as liquid suspensions or aqueous solutions, for example, using a sterile liquid, such as, but not limited to, an oil, water, an alcohol, and combinations of these.
  • pharmaceutical compositions can be prepared in a lyophilized form.
  • the lyophilized preparations can comprise a cryoprotectant known in the art.
  • cryoprotectants as used herein generally includes agents, which provide stability to the protein from freezing-induced stresses.
  • cryoprotectants include polyols such as, for example, mannitol, and include saccharides such as, for example, sucrose, as well as including surfactants such as, for example, polysorbate, poloxamer or polyethylene glycol, and the like. Cryoprotectants also contribute to the tonicity of the formulations. Pharmaceutically suitable surfactants, suspending agents, emulsifying agents, may be added for oral or par- enteral administration. [0176] As noted above, suspensions may include oils. Such oils include, but are not limited to, peanut oil, sesame oil, cottonseed oil, corn oil and olive oil.
  • Suspension preparation may also contain esters of fatty acids such as ethyl oleate, isopropyl myristate, fatty acid glycerides and acetylated fatty acid glycerides.
  • Suspension formulations may include alcohols, such as, but not limited to, ethanol, iso- propyl alcohol, hexadecyl alcohol, glycerol and propylene glycol.
  • Ethers such as but not limited to, poly(ethyleneglycol), petroleum hydrocarbons such as mineral oil and petrolatum; and water may also be used in suspension formulations.
  • the pharmaceutical formulations and medicaments may be a spray or aerosol containing an appropriate solvent(s) and optionally other compounds such as, but not limited to, stabilizers, antimicrobial agents, antioxidants, pH modifiers, surfactants, bio- availability modifiers and combinations of these.
  • a propellant for an aerosol Formulation may include compressed air, nitrogen, carbon dioxide, or a hydrocarbon based low boiling solvent.
  • Injectable dosage forms generally include aqueous suspensions or oil suspensions which may be prepared using a suitable dispersant or wetting agent and a suspending agent. Injectable forms may be in solution phase or in the form of a suspension, which can be prepared with a solvent or diluent.
  • Acceptable solvents or vehicles include sterilized water, Ringer's solution, or an isotonic aqueous saline solution.
  • sterile oils may be employed as solvents or suspending agents.
  • the oil or fatty acid can be non-volatile, including natural or synthetic oils, fatty acids, mono-, di- or tri-glycerides.
  • the pharmaceutical formulation and/ or medicament may be a powder suitable for reconstitution with an appropriate solution as described above. Examples of these include, but are not limited to, freeze dried, rotary dried or spray dried powders, amorphous powders, granules, precipitates, or particulates.
  • the formulations may optionally contain stabilizers, pH modifiers, surfactants, bioavailability modifiers and combinations of these.
  • the pharmaceutical formulations and medicaments may be in the form of a suppository, an ointment, an enema, a tablet or a cream for release of compound in the intestines, sigmoid flexure and/or rectum. Rectal suppositories are prepared by mixing one or more compounds herein with acceptable vehicles, for example, cocoa butter or polyethylene glycol, which is present in a solid phase at normal storing temperatures, and present in a liquid phase at those temperatures suitable to release a drug inside the body, such as in the rectum.
  • acceptable vehicles for example, cocoa butter or polyethylene glycol
  • Oils may also be employed in the preparation of formulations of the soft gelatin type and suppositories.
  • Water, saline, aqueous dextrose and related sugar solutions, and glycerols may be employed in the preparation of suspension formulations which may also contain suspending agents such as pectins, carbomers, methyl cellulose, hydroxypropyl cellulose or carboxymethyl cellulose, as well as buffers and preservatives.
  • the concentration of an RTSM in these compositions can vary widely, e.g., from less than about 10%, least about 25% to as much as 75% or 90% by weight and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.
  • compositions comprising an RTSM described herein can be formulated using one or more physiologically acceptable carriers including excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • Pharmaceutical compositions are optionally manufactured such as, by way of example only, by means of mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.
  • compositions may also include one or more pH adjusting agents or buffering agents, including acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
  • acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids
  • bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane
  • buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
  • Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
  • compositions may also include one or more salts in an amount required to bring osmolality of the composition into
  • Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
  • sustained-release preparations can be used. Suitable examples of sustained- release preparations include semipermeable matrices of solid hydrophobic polymers containing an antibody or antigen binding fragment of the present disclosure, in which the matrices are in the form of shaped articles, e.g., films, or microcapsule.
  • sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and y ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.
  • polyesters for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)
  • polylactides U.S. Patent No. 3,773,919
  • copolymers of L-glutamic acid and y ethyl-L-glutamate non-de
  • the aggregation mechanism is discovered to be intermolecular S--S bond formation through thiodisulfide interchange
  • stabilization can be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • the pharmaceutical composition can be delivered in a controlled release system.
  • a pump may be.
  • polymeric materials can be used.
  • a controlled release system can be placed in proximity of the composition's target, thus requiring only a fraction of the systemic dose.
  • an RTSM can be administered with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier.
  • an RTSM can be linked with a viral vector, e.g., to render an RTSM more effective or increase transport across the blood-brain barrier.
  • delivery of agents can be by administration of an adenovirus vector to motor neurons in muscle tissue. Delivery of vectors directly to the brain, include but are not limited to the striatum, the thalamus, the hippocampus, or the substantia nigra.
  • an RTSM can be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
  • an RTSM can be coupled to a substance that promotes penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor.
  • osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(- ) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabito
  • the composition can be encapsulated in glucose-coated polymeric nanocarriers.
  • Second Agent The compositions herein may be administered alone or in combination with another therapeutic. The additional therapeutic may be administered prior, concurrently or subsequently to the administration of the composition.
  • the compositions disclosed herein, comprising an RTSM, described herein can also contain more than one active agent as necessary for the particular indication being treated, and include those with complementary activities that do not adversely affect each other.
  • the composition can further comprise an anti-inflammatory, a therapeutic protein, a steroid, an analgesic, a non-steroidal anti- inflammatory, a corticosteroid, and combinations thereof.
  • compositions may be administered in combination with a steroid and/or an antibiotic.
  • the steroid may be a glucocorticoid or prednisone.
  • Glucocorticoids such as cortisol control carbohydrate, fat and protein metabolism, and are anti- inflammatory by preventing phospholipid release, decreasing eosinophil action and a number of other mechanisms.
  • Mineralocorticoids such as aldosterone control electrolyte and water levels, mainly by promoting sodium retention in the kidney.
  • Corticosteroids are a class of chemicals that includes steroid hormones naturally produced in the adrenal cortex of vertebrates and analogues of these hormones that are synthesized in laboratories.
  • Corticosteroids are involved in a wide range of physiological processes, including stress response, immune response, and regulation of inflammation, carbohydrate metabolism, protein catabolism, blood electrolyte levels, and behavior.
  • Corticosteroids include Betamethasone, Budesonide, Cortisone, Dexamethasone, Hydrocortisone, Methylprednisolone, Prednisolone, and Prednisone. [0190]
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • compositions comprising an antibody or antigen binding fragment thereof described herein can also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microparticle, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microparticle, microemulsions, nano-particles and nanocapsules
  • the pharmaceutical composition can be also delivered in a vesicle, in particular a liposome.
  • Liposomes include emulsions, foams, micelles, insoluble monolayers, phospholipid dispersions, lamellar layers and the like, and can serve as vehicles to target the M-CSF antibodies to a particular tissue as well as to increase the half life of the composition.
  • Liposomes containing an RTSM, the second active compound or both can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
  • RTSMs herein can be conjugated to liposomes via a disulfide interchange reaction.
  • the second agent can be optionally contained within the liposome.
  • the second agent may be formulated with the compositions described herein or separately co-administered.
  • Further Embodiments [0193] In some embodiments, described herein, is a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA.
  • ASO antisense oligomer
  • G-U wobble base pairing
  • the ASO may have exact sequence complementary to the target sequence or near complementarity (e.g., sufficient complementarity to bind the target sequence and modulating splicing at a splice site).
  • ASOs are designed so that they bind (hybridize) to a target nucleic acid (e.g., a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Typically, if they hybridize to a site other than the intended (targeted) nucleic acid sequence, they hybridize to a limited number of sequences that are not a target nucleic acid (to a few sites other than a target nucleic acid).
  • a target nucleic acid e.g., a targeted portion of a pre-mRNA transcript
  • ASO can take into consideration the occurrence of the nucleic acid sequence of the targeted portion of the pre-mRNA transcript or a sufficiently similar nucleic acid sequence in other locations in the genome or cellular pre- mRNA or transcriptome, such that the likelihood the ASO will bind other sites and cause "off-target” effects is limited.
  • ASOs "specifically hybridize” to or are “specific” to a target nucleic acid or a targeted portion of a pre-mRNA. Typically such hybridization occurs with a Tm substantially greater than 37oC, preferably at least 50 oC, and typically between 60 oC to approximately 90 oC. Such hybridization preferably corresponds to stringent hybridization conditions.
  • the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide.
  • Oligomers such as oligonucleotides, are "complementary" to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides.
  • a double-stranded polynucleotide can be "complementary" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second.
  • Complementarity (the degree to which one polynucleotide is complementary with another) is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules.
  • the sequence of an antisense oligomer (ASO) need not be 100% complementary to that of its target nucleic acid to hybridize.
  • ASOs can comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted.
  • an ASO in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining non-complementary nucleobases may be clustered together or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • Percent complementarity of an ASO with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul, et al., J. Mol.
  • An ASO need not hybridize to all nucleobases in a target sequence and the nucleobases to which it does hybridize may be contiguous or noncontiguous. ASOs may hybridize over one or more segments of a pre-mRNA transcript, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed). In certain embodiments, an ASO hybridizes to noncontiguous nucleobases in a target pre-mRNA transcript.
  • an ASO can hybridize to nucleobases in a pre-mRNA transcript that are separated by one or more nucleobase(s) to which the ASO does not hybridize.
  • the ASOs described herein comprise nucleobases that are complementary to nucleobases present in a targeted portion of a pre-mRNA.
  • the term ASO embodies oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of hybridizing to a complementary nucleobase on a target mRNA but does not comprise a sugar moiety, such as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the ASOs may comprise naturally-occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the preceding.
  • naturally occurring nucleotides includes deoxyribonucleotides and ribonucleotides.
  • modified nucleotides includes nucleotides with modified or substituted sugar groups and/or having a modified backbone. In some embodiments, all of the nucleotides of the ASO are modified nucleotides.
  • One or more nucleobases of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA.
  • modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine.
  • the ASOs described herein also comprise a backbone structure that connects the components of an oligomer.
  • the term "backbone structure” and “oligomer linkages” may be used interchangeably and refer to the connection between monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of the oligomer.
  • the backbone structure or oligomer linkages of the ASOs described herein may include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. See, e.g., LaPlanche, et al., Nucleic Acids Res.14:9081 (1986); Stec, et al., J. Am. Chem. Soc. 106:6077 (1984), Stein, et al., Nucleic Acids Res.
  • the backbone structure of the ASO does not contain phosphorous but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups.
  • PNA peptide nucleic acid
  • the backbone modification is a phosphothioate linkage. In some embodiments, the backbone modification is a phosphoramidate linkage.
  • Any of the ASOs described herein may contain a sugar moiety that comprises ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog, including a morpholine ring.
  • Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O- guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars.
  • the sugar moiety modification is selected from 2'-O-Me, 2'F, and 2'MOE.
  • the sugar moiety modification is an extra bridge bond, such as in a locked nucleic acid (LNA).
  • the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO).
  • the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification.
  • the sugar moiety comprises 2'4'-constrained 2'O-methyloxyethyl (cMOE) modifications.
  • the sugar moiety comprises cEt 2', 4' constrained 2'-O ethyl BNA modifications.
  • the sugar moiety comprises tricycloDNA (tcDNA) modifications.
  • the sugar moiety comprises ethylene nucleic acid (ENA) modifications.
  • the sugar moiety comprises MCE modifications. Modifications are known in the art and described in the literature, e.g., by Jarver, et al., 2014, "A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications," Nucleic Acid Therapeutics 24(1): 37-47, incorporated by reference for this purpose herein. [0204] In some embodiments, each monomer of the ASO is modified in the same way, for example each linkage of the backbone of the ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification.
  • an ASO may comprise a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos). Combinations of different modifications to an ASO are referred to as “mixed modifications” or “mixed chemistries.”
  • the ASO comprises one or more backbone modifications. In some embodiments, the ASO comprises one or more sugar moiety modification. In some embodiments, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications.
  • the ASO comprises a 2'MOE modification and a phosphorothioate backbone.
  • the ASO comprises a phosphorodiamidate morpholino (PMO).
  • the ASO comprises a peptide nucleic acid (PNA). Any of the ASOs or any component of an ASO (e.g., a nucleobase, sugar moiety, backbone) described herein may be modified in order to achieve desired properties or activities of the ASO or reduce undesired properties or activities of the ASO.
  • an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (i.e., RNase H); improve uptake of the ASO into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; and/or modulate the half-life of the ASO.
  • the ASOs are comprised of 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides.
  • ASOs comprised of such nucleotides are especially well-suited to the methods disclosed herein; oligomers having such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery in some embodiments described herein. See e.g., Geary, et al., J Pharmacol Exp Ther.2001; 296(3):890-7; Geary, et al., J Pharmacol Exp Ther.2001; 296(3):898-904. [0207] Methods of synthesizing ASOs will be known to one of skill in the art. Alternatively or in addition, ASOs may be obtained from a commercial source.
  • compositions and methods useful for treating autoimmune diseases result in a truncated MDA5 protein. In some embodiments, these compositions and methods result in a decrease in the wild-type MDA5 protein. In some embodiments, the compositions and methods result in modulating the splicing of IFIH1 RNA. In some embodiments, the compositions and methods result in an IFIH1 RNA lacking exon 14.
  • a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA.
  • the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA.
  • the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA.
  • the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA. In some embodiments, the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID NO:64. In some embodiments, the 5’ splice site comprises the sequence of SEQ ID No: 64. In some embodiments, the 5’ splice site comprises complement of the sequence of SEQ ID No: 64. In some embodiments, the 5’ splice site comprises the inverse complement of the sequence of SEQ ID No: 64. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO).
  • ASO antisense oligonucleotide
  • the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139. In some embodiments, the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139.
  • disclosed herein is a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • the autoimmune diseases is selected from the group consisting of type 1 diabetes mellitus and systemic lupus erythematosus.
  • the autoimmune disease is systemic lupus erythematosus. In some embodiments, the autoimmune disease is type 1 diabetes mellitus.
  • a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA.
  • the therapeutic agent is an antisense oligomer (ASO) and wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identity to SEQ ID NO: 139 or 172.
  • the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage.
  • the ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, a 2'-Fluoro, or a 2'-O- methoxyethyl moiety.
  • the ASO comprises at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety.
  • the ASO consists of from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases,
  • the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, complementary to the targeted portion of the IFIH1 mRNA encoding the MDA5 protein.
  • the method further comprises assessing IFIH1 mRNA or MDA5 protein expression.
  • the cells are ex vivo.
  • the therapeutic agent is administered to the subject by intravitreal injection, intrathecal injection, intraperitoneal injection, subcutaneous injection, intravenous injection, subretinal injection, intracerebroventricular injection, intramuscular injection, topical application, or implantation.
  • the therapeutic agent is administered with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier by any method known in the art.
  • the therapeutic agent is linked with a viral vector, e.g., to render the therapeutic agent more effective or increase transport across the blood-brain barrier.
  • delivery of agents by administration of an adenovirus vector to motor neurons in muscle tissue is described in U.S. Pat. No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons,” incorporated herein by reference.
  • the therapeutic agent is linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
  • the therapeutic agent is coupled to a substance, known in the art to promote penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor.
  • osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-
  • the therapeutic agent is encapsulated in glucose-coated polymeric nanocarriers, such as those described in Min et al.
  • a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA.
  • the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA.
  • the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA.
  • the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64.
  • the therapeutic agent is an antisense oligonucleotide (ASO).
  • the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139.
  • the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139.
  • disclosed herein is a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent.
  • the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA.
  • the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA.
  • the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA.
  • the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64.
  • the therapeutic agent is an antisense oligonucleotide (ASO).
  • ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139.
  • the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139.
  • the autoimmune diseases is selected from the group consisting of type 1 diabetes mellitus and systemic lupus erythematosus.
  • the autoimmune diseases is systemic lupus erythematosus.
  • disclosed herein is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA.
  • the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0239] In some embodiments, wherein the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA. [0240] In some embodiments, wherein the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA. [0241] In some embodiments, wherein the therapeutic agent binds to the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA [0242] In some embodiments, wherein the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64.
  • the therapeutic agent is an antisense oligonucleotide (ASO).
  • ASO antisense oligonucleotide
  • the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139.
  • the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139.
  • nucleobases corresponding to the abbreviations in various nucleobase sequences disclosed herein can be found in Table 9A below.
  • Table 9A Nucleobase Abbreviations [0247] In some embodiments, amino acids corresponding to the abbreviations in various polypeptide sequences disclosed herein can be found, for example, in Table 9B below. Table 9B: Amino Acid Abbreviations EXAMPLES [0248] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. ASOs described herein can be synthesized using synthetic techniques, using methods described herein or combinations of both. Alternatively, ASOs are available commercially from various sources, including Integrated DNA Technologies (IDT), Coralville, Iowa and GeneTools, LLC.
  • IDT Integrated DNA Technologies
  • Coralville Iowa
  • GeneTools, LLC GeneTools, LLC.
  • Example 1 IFIH1 splicing modulation in epithelial cells
  • HuTu80 cells ATCC ® HTB-40 TM
  • HuTu80 cells ATCC ® HTB-40 TM
  • ASOs with morpholino-modified backbones were transfected individually into each well using EndoPorter (Gene-Tools, LLC at 6ul/ml). Each ASO was at a 1mM (1000uM) stock concentration and was added to the wells to achieve final concentrations of 6uM (3ul/well), 9uM (4.5ul/well), 12uM (6ul/well) and 15uM (7.5ul/well).
  • NTC is a non-targeting control
  • CONT is an ASO that targets IFIH1 at the Exon6- Intron6 boundary
  • IFIH14 is an ASO that targets the 5’ splice site of intron 14 of an IFIH1 pre-mRNA.
  • the sequences of the ASOs used are set forth below in Table 10. Table 10.
  • ASO sequences [0251] Samples were harvested after 48hrs. RNA was prepared from each sample, using RNeasy plus mini kits (Qiagen # 74134). RNA was quantitated and cDNA was made with 1ug total RNA using SuperScriptTM III First-Strand Synthesis SuperMix (Cat.No.11752-050, Lot No.0243941, Invitrogen).
  • RT-PCR reactions were performed using Invitrogen Platinum SuperFI DNA Polymerase (Cat.No.12351050), with the following primers: Table 11.
  • Primers [0253] After the initial denaturation step (98 o C, 30s), 35 cycles were performed (98 o C 10s, 60 o C 10s, 72 o C 30s), followed by a final extension step (72 o C 5min). The PCR products were run on an agarose gel (1.5%) shown in FIG.1. Both bands (B1 and B2) from Lane 3 were cut and sent for sequencing with the forward and reverse primers identified above (SEQ ID NOs: 174 and 175). B1 corresponds to the expected product that contains exons 13, 14 and 15.
  • B2 corresponds to the expected product that contains exons 13 and 15, exon 14 having been skipped.
  • the sequences are shown in FIG. 2A-2B and FIG. 3A-3B.
  • the sequence corresponding to exon 14 is in bolded underline in both FIG.2A-2B and FIG.3A-3B.
  • Table 12 IFIH1 Isoforms
  • Example 2 MDA5 protein modulation in epithelial cells
  • HuTu80 cells ATCC® HTB-40TM were plated at a concentration of 400,000 cells/well in a 24- well plate and cultured according to ATCC recommendations for 24 hours.
  • ASOs with morpholino-modified backbones were transfected individually into each well using EndoPorter (Gene-Tools, LLC at 6ul/ml). Each ASO was at a 1mM (1000uM) stock concentration and was added to the wells to achieve final concentrations of 6uM (3ul/well), 9uM (4.5ul/well), 12uM (6ul/well) and 15uM (7.5ul/well). Samples were harvested in RIPA buffer after 48hrs. Protein was quantitated by BCA assays and 15ug of each sample was loaded on an SDS-PAGE gel.
  • a IFIH1-RTSM control according to Example 1 can be administered to the control group using the same regime. After 3 days, blood can be collected and IFIH1 mRNA and MDA5 protein, and IFN-1 expression can be evaluated. RT-PCR evaluation of the IFIH1-RTSM treated mRNA can depict that the mRNA product contains exons 1-13, and 15-16, exon 14 having been skipped. BCA assays and SDS-PAGE gel probed with anti-mda5 antibodies can demonstrate that the IFIH1-RTSMs of the present disclosure decreased the level of functional MDA5 protein compared to the control.
  • Example 4 Down-regulated expression of MDA5 protein will prevent the progression of or treat autoimmune diabetes
  • Mice predisposed to T1D can be backcrossed with MDA5 knockout (MDA5 -/- ) on a C57BL/6 background to develop MDA5 -/- that carry a full complement of NOD idd alleles and the ability to develop spontaneous diabetes.
  • MDA5 -/- mice can be bred with NOD mice and MDA5 +/- mice.
  • MDA5 +/+ progeny can also be bred. Mice can be split into two treatment groups, treatment with or without an RTSM herein.
  • mice Ten- to 12-week-old mice can be infected with sublethal doses of 400 plaque-forming units i.p. CB4 Edwards strain 2 diluted in DMEM.
  • RTSM treatment groups can be injected with exemplary murine IFIH1- RTSMs herein at 5 mg/kg, or PBS, subcutaneously, once a day for three days.
  • Infected and PBS treated MDA5 +/+ can serve as a positive control.
  • Infected and RTSM treated MDA5 -/- can serve as a negative control.
  • Diabetic incidence can be monitored by nonfasting blood glucose measurements before and after infection, before treatment as a baseline and after treatment, and can be determined by two consecutive blood glucose levels > 300 mg/dL.
  • Example 5 In vivo activity of MDA5-mediated IFN-1 signaling
  • Test groups in Example 4 can be sacrificed and organs evaluated by western blotting for protein expression, intracellular cytokine staining and analyzation by flow cytometry, and RT-PCR for RNA analysis.
  • RT-PCR evaluation of the IFIH1-RTSM treated mRNA can depict that the mRNA product contains exons 13 and 15, exon 14 having been skipped.
  • Western blotting can demonstrate that the IFIH1-RTSMs of the present disclosure can decrease the level of functional MDA5 protein compared to the positive control.
  • Flow cytometry results can demonstrate the decrease in the presence of IFN- ⁇ IFN- ⁇ , and IFN- ⁇ cytokines compared to a positive control.

Abstract

Provided herein are methods and compositions for decreasing the expression of a protein, and for treating a subject in need thereof, e.g., a subject with excess protein expression or a subject having an associate disease described herein.

Description

RNA-TARGETING SPLICING MODIFIERS FOR TREATMENT OF MDA5- ASSOCIATED CONDITIONS AND DISEASES RELATED APPLICATIONS [0001] This application claims priority to U.S. Provisional Patent Application No. 63/114,866, filed November 17, 2020 the contents of which is entirely incorporated herein by reference for all purposes. SUMMARY [0002] Disclosed herein is a method of treating a disease or condition in a human subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of a synthetic interferon induced with helicase 1 (IFIH1) RNA-targeting splicing modifier (RTSM), thereby treating the disease or condition in the human subject in need thereof; wherein: the synthetic RTSM comprises a binding domain that binds to a target region of the IFIH1 pre-messenger ribonucleic acid (pre-mRNA); the target region comprises an exon-intron junction comprising a target sequence of Formula (I):RGUV, wherein R is A or G and wherein V is A, G, or C; and exon skipping is increased as compared to the IFIH1 pre-mRNA spliced in the absence of an RTSM as demonstrated by an in vitro assay. [0003] Disclosed herein is a synthetic IFIH1 RTSM that comprises a binding domain that binds to a target region of a IFIH1 pre-mRNA; wherein: the target region comprises an exon-intron junction comprising a target sequence of Formula (I): RGUV, wherein R is A or G and wherein V is A, G, or C; and exon skipping is increased as compared to when the IFIH1 pre-mRNA is spliced in the absence of the synthetic RTSM as demonstrated in an in vitro assay. INCORPORATION BY REFERENCE [0004] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS [0005] FIG.1. shows RT-PCR analysis of IFIH1 isoforms (B1 and B2) present in epithelial cells following treatment with RTSM-antisense oligonucleotides (ASOs). [0006] FIG. 2A and FIG. 2B show sequences of IFIH1 isoforms present in epithelial cells following treatment with RTSM-ASOs generated from the forward primer (SEQ ID NO:174). FIG. 2A shows the sequence of B1-Forward (SEQ ID NO:176) contains exons 13, 14, and 15. FIG. 2B shows the sequences of B2-Forward (SEQ ID NO:177) contains exons 13 and 15, exon 14 having been skipped. [0007] FIG. 3A and FIG. 3B shows sequences of IFIH1 isoforms present in epithelial cells following treatment with ASOs generated from the reverse primer (SEQ ID NO:175). FIG. 3A shows the sequence of B1-Reverse (SEQ ID NO:178) contains exons 13, 14, and 15. FIG. 3B shows the sequences of B2- Reverse (SEQ ID NO:179) contains exons 13 and 15, exon 14 having been skipped. [0008] FIG. 4 shows results from Western Blot analysis of MDA5 protein isoforms present in epithelial cells following treatment with ASOs. [0009] FIG.5 shows quantitation of MDA5 protein isoforms present in epithelial cells following treatment with ASOs. DETAILED DESCRIPTION [0010] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which embodiments herein belongs. Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of embodiments herein. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure. Definitions [0011] The term “binding domain” as used herein can comprise a domain or portion of an RTSM which binds to a region or a portion of an IFIH1 pre-mRNA. The binding can be covalent or non-covalent. Examples of non-covalent binding include binding via hydrogen bonding, Watson-Crick base pairing, wobble-base pairing, and Van der Waals interactions. [0012] As used herein, the terms "ASO" and "antisense oligomer" are used interchangeably and can refer to an oligomer such as a polynucleotide, comprising nucleobases that hybridizes to a target nucleic acid (e.g., a IFIH1 containing pre-mRNA) sequence, for example, by Watson-Crick base pairing or wobble base pairing (G-U). [0013] The terms “complementary” and “complementarity” can refer to polynucleotides (e.g., a sequence of nucleotides) related by base-pairing rules. For example, the sequence “T-G-A (5’-3’),” can be complementary to the sequence “T-C-A (5’-3’).” Complementarity may be “partial,” in which only some of the nucleic acid’s bases are matched according to base pairing rules. Alternatively, there may be “complete” or “total” complementarity between the nucleic acids. Furthermore, base pairing may be contiguous or non-contiguous. The degree of complementarity between nucleic acid strands can impact efficiency and strength of hybridization between nucleic acid strands. While perfect complementarity can be desired, some embodiments can include one or more 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mismatches with respect to a target RNA. A mismatch can be a mismatch between a base on an RTSM and a base on a target RNA. Variations at any location within the oligomer are included. In certain embodiments, variations in sequence near the termini of an oligomer can be within about 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides of the 5’ and/or 3’ terminus. In some embodiments, a base pairing can be a wobble base pairing. [0014] A “CRISPR” (Clustered Regularly Interspersed Short Palindromic Repeat) “CRISPR system,” or “CRISPR nuclease system” and their grammatical equivalents can include a non-coding RNA molecule (e.g., guide RNA) that binds to DNA or RNA and CRISPR-Associated (Cas) proteins (e.g., Cas13) with at least some or none nuclease functionality (e.g., two nuclease domains). [0015] The term “exon skipping” can refer to a process by which a portion of an exon, an entire exon, or more than one exon are removed from a pre-processed mRNA so that it or they are not present in a mature RNA, such as an mRNA that is translated into a protein. Accordingly, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein, and can create a modulated form of the protein. In some embodiments, the modulated protein may be functional, less functional or non-functional. In some embodiments, the modulated protein may be truncated or subjected to nonsense mediated decay. In certain embodiments, an exon being skipped is an aberrant exon from the human IFIH1 gene which may contain a mutation or other alteration in its sequence that otherwise causes mutated forms of the protein. In certain embodiments, an exon being skipped is a wild-type exon. In some embodiments, an exon being skipped can be any one or more of exons 1-16 of the IFIH1 gene, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. [0016] The terms “identical” and its grammatical equivalents as used herein or “sequence identity” in the context of two nucleic acid sequences or amino acid sequences of polypeptides can refer to the residues in the two sequences which can be the same when aligned for maximum correspondence over a specified comparison window. A “comparison window”, as used herein, can refer to a segment of at least about: 4, 8, 50, 100, 150, to 200 or more contiguous positions can be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally. Methods of sequences for comparison can be conducted by the local homology algorithm or by computerized implementations of these algorithms including, but not limited to CLUSTAL, GAP, BESTFIT, BLAST, FASTA, and TFASTA. Alignment can be also often performed by inspection and manual alignment. In one class of embodiments, the polypeptides herein can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference polypeptide, or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters. Similarly, nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters. When one molecule can be said to have certain percentage of sequence identity with a larger molecule, can mean that when the two molecules are optimally aligned, said percentage of residues in the smaller molecule finds a match residue in the larger molecule in accordance with the order by which the two molecules are optimally aligned. The term “substantially identical” and its grammatical equivalents as applied to nucleic acid or amino acid sequences can mean that a nucleic acid or amino acid sequence comprises a sequence that has at least 90% sequence identity or more, at least 95%, at least 98% and at least 99%, compared to a reference sequence using the programs described above, e.g., BLAST, using standard parameters. For example, the BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. In another example, for amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. Percentage of sequence identity can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (e.g., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage can be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. In some embodiments, the substantial identity exists over a region of the sequences that can be at least about 8, at least about 14 residues in length, over a region of at least about 20 residues, and in some embodiments, the sequences can be substantially identical over at least about 25 residues. In some embodiments, the sequences can be substantially identical over the entire length of the coding regions. [0017] "Inflammatory disorder" can mean an immune-mediated inflammatory condition that affects humans and is generally characterized by dysregulated expression of one or more cytokines. Examples of inflammatory disorders include skin inflammatory disorders, inflammatory disorders of the joints, inflammatory disorders of the cardiovascular system, certain autoimmune diseases, lung and airway inflammatory disorders, intestinal inflammatory disorders. Examples of skin inflammatory disorders include dermatitis, for example atopic dermatitis and contact dermatitis, acne vulgaris, and psoriasis. Examples of inflammatory disorders of the joints include rheumatoid arthritis. Examples of inflammatory disorders of the cardiovascular system can be cardiovascular disease and atherosclerosis. Examples of autoimmune diseases include Type 1 diabetes, Graves disease, Guillain-Barre disease, Lupus, Psoriatic arthritis, and Ulcerative colitis. Examples of lung and airway inflammatory disorders include asthma, cystic fibrosis, COPD, emphysema, and acute respiratory distress syndrome. Examples of intestinal inflammatory disorders include colitis and inflammatory bowel disease. Other inflammatory disorders include cancer, hay fever, periodontitis, allergies, hypersensitivity, ischemia, depression, systemic diseases, post infection inflammation and bronchitis. The peptides and compositions herein may also be employed in the non- therapeutic treatment of inflammation. Examples of non-therapeutic treatment of inflammation can include use to relieve normal, non-pathological, inflammation, for example inflammation in the muscles and joints following exercise [0018] The term “nucleobase” can generally refer to nitrogen containing compound that is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA. For example, a nucleobase may be any unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA. Examples of modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine. [0019] As used herein, the term “targeting domain” can comprise a region or portion of an IFIH1 pre- mRNA to which a RTSM can bind. The binding can be covalent or non-covalent. Examples of non-covalent binding include binding via hydrogen bonding, Watson-Crick base pairing, wobble-base pairing, and Van der Waals interactions. Overview [0020] Some embodiments here are based, at least in part, on compelling evidence of a therapeutic effect of an RNA-Targeting Splicing Modifier (RTSM). Specifically, such embodiments arise out of the novel finding that treatment with an exon skipping RTSM disclosed herein can produce decreased levels of functional MDA5 protein. [0021] Without being bound by theory, the IFIH1 gene encodes for the melanoma differentiation- associated protein 5 (MDA5 protein), which can play an important role in innate immunity. MDA5 is believed to be a dsRNA sensor, that binds to viral dsRNA and turns on the type 1 Interferon (IFN-1) signaling pathway. While this protein can play an important role in fighting viral infections, gain of function mutations of the IFIH1 gene have been implicated in auto-immune diseases such as SLE (Systemic lupus erythematosus) and Type 1 Diabetes. Decreasing the abundance or functionality of this protein could improve the outcome of these diseases while still maintaining the immune response. Hence, in certain embodiments, the methods described herein can be useful to increase exon skipping of an IFIH1 pre-mRNA to decrease functional MDA5 levels. [0022] To remedy this condition, RTSM compounds herein can bind to one or more selected regions of a pre-processed RNA of an IFIH1 gene, increase exon skipping and differential splicing, and thereby allow cells to produce a mRNA transcript that encodes a non-functional or reduced function protein. In certain embodiments, the resulting MDA5 protein can be: truncated, functional, semi-functional, or a non- functional form of MDA5. [0023] By decreasing the level of functional MDA5 in cells, these and related embodiments are useful in the prophylaxis and treatment of an inflammatory disorder that is characterized by the over expression of functional MDA5 proteins, or the expression of over-functional MDA5 proteins. Further, these and related embodiments are useful in the prophylaxis and treatment of an IFN-1 mediated autoimmune disease that is characterized by oversignaling of the IFN-1 signaling pathway. Interferon induced with helicase 1 (IFIH1) and melanoma differentiation-associated protein 5 (MDA5) [0024] Disclosed herein are RTSMs that can modulate the level of functional MDA5 protein in, for example, a cell, organ or subject. A targeted MDA5 can be identified by homology search and sequences identified by genomic and nucleotide databases, such as ENSEMBL or GENBANK, and in some embodiments, comprises a polypeptide sequence of SEQ ID NO:4. In some embodiments, an un-modulated MDA5 protein referred herein can be a full length, functional, or wild-type protein, or any combination thereof. [0025] It was identified that the IFIH1 gene can encode a MDA5 protein. In one embodiment, a targeted IFIH1 gene can comprise a sequence, such as the sequence identified by RefSeq. No. NC_000002.12 (disclosed herein as SEQ ID NO: 1 and incorporated by reference). [0026] RTSMs disclosed herein can target IFIH1 pre-mRNA. A IFIH1 pre-mRNA can be the precursor IFIH1 RNA transcribed from the IFIH1 gene, but prior to being spliced into a mature RNA. In some embodiments, a targeted pre-mRNA comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to at least about: 4, 5, 6, 7, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more continuous nucleotides of the sequence of SEQ ID NO: 2. In some embodiments, the wild-type mRNA comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to at least about: 4, 5, 6, 7, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more continuous nucleotides of the sequence of SEQ ID NO.3. [0027] In some embodiments, RTSMs disclosed herein can target a targeted region of an IFIH1 pre-mRNA. In some embodiments, a targeted region can comprise coding for: protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof. [0028] In some embodiments, once an RTSM targets and binds to a target region, RTSMs disclosed herein can increase at least partial exon skipping during splicing of an IFIH1 pre-mRNA. Accordingly, in some embodiments a targeted pre-mRNA comprises one or more exons and one or more introns. IFIH1 pre- mRNA comprises 16 exons and 15 introns. Accordingly, in some embodiments a targeted pre-mRNA comprises exons 1-16 and introns 1-15. In some embodiments, any one of exons 1-16 can comprise, in part or in full, coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof. For example, exon 1 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 2 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 3 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 4 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM- RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 5 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 6 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 7 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 8 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM- RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 9 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 10 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 11 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 12 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM- RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 13 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 14 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; exon 15 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof; and exon 16 can comprise coding for protein length; protein stability; protein function; coding specific for RTSM-RNA binding; RTSM-RNA duplex formation; coding which limits off-target binding; coding which recruits one or more splicing complex component; or any combination thereof. [0029] In some embodiments, a pre-mRNA exon(s) referred to herein comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences in Tables 2. [0030] In some embodiments, a pre-mRNA intron(s) referred to herein comprises a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences in Table 3. In some embodiments, a pre-mRNA exon(s), intron(s), or both, may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 2 or Table 3. Alternative nucleobases can be any one or more of A, C, G or U, or a deletion. [0031] When an intron is contiguous with the 3’ end of an exon, the exon and intron can correspond for splicing purposes and create an exon-intron junction. In some embodiments, a targeted pre-mRNA comprises a target region wherein a target region comprises an exon-intron junction. Exon-intron junctions can be at least 2 nucleic acids in length, at least 3 nucleic acids in length, at least 4 nucleic acids in length, at least 5 nucleic acids in length, at least 6 nucleic acids in length, at least 7 nucleic acids in length, at least 8 nucleic acids in length, at least 9 nucleic acids in length, at least 10 nucleic acids in length, at least 11 nucleic acids in length, at least 12 nucleic acids in length, at least 13 nucleic acids in length, at least 14 nucleic acids or more in length. For example, exon-intron junctions can be about: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleic acids in length. [0032] In some embodiments, a targeted pre-mRNA comprises a targeted region wherein the targeted region comprises one or more exon-intron junction. In some embodiments, a target region comprises an exon-intron junction. In some embodiments, a target region comprises more than one exon-intron junction. In some embodiments, an exon-intron junction can be Exon1-Intron1, Exon2-Intron2, Exon3-Intron3, Exon4-Intron4, Exon5-Intron5, Exon6-Intron6, Exon7-Intron7, Exon8-Intron8, Exon9-Intron9, Exon10- Intron10, Exon11-Intron11, Exon12-Intron12, Exon13-Intron13, Exon14-Intron14, and/or Exon15- Intron15, more than one, or any combination thereof.
Figure imgf000010_0001
1 e GU l GGC G C CUCA C GGC UC C a C UU U CA AUCUAAG CUU GCGUCU UGA A G AGAUAU C U GA A AAU U CA G CA GAA C G UAC U b AGC C CU C CGGUU T C C AAUGUC A UC U A GG UC CGGA CAA GAA G GC CG GGUA U AUC C GGCAAC AC CA GC CAGGA GCUU GGA GC CA CGGAAUGGU U GGCU AA C C C GUGA GAGGUGU UCU C AU UUAG CUGGAC C UA AC AGCAG CA GU AGAUC AGACA A U CGGUGGC CUU UUAUAUUUA CUAAC C GUA C A C C CGG UC UAC AAUU A U C A CAGU C UCG UGU G G AA C C A A U GGCAC A CAGUC CAUU CAG AGC C AA GU C C AAAGUC U GAU AAGUGCG AUUCGC CAAUAUCUGUAUGA A G UUUUAUA CUC GAAUUGCUAA A C CUC C AGGGG AAC A C CAAAUG ACAUUAUU AAU AACG G A G CAUUA AG UGC A AUCG AC UU C C C G CA GCGCGG C A A A G AC C C U AA UA G GC GUA AU C C A A U G U U U A AUA UGUGU AG G C AUG AUGC C GUGCGAG A C GUAAG C A GU A CAUCA AAUA C UC GG UGUA UG GC AC C C C C UGC C A U G G UUCUAAGUG UC U G A C G GG UUU C C G C CU G e GGGU CAAUACU AAUACGUUUCGAAUGUGUAG c AU CG C U U A n GUGGUC CG A U U e G GU U A UGUGG C GU G CG U A UAACAUGUUUGGAU UGAU A U A u CUC C C CUU CGA CGUC C AC CUA A A C G UUA AA U A G A UG G G U C GAUCGAUCG q A C C C C GAA C CU UAACAUAACA AA ACGAG A CAUUU UUAAUAGG U CAAU A CGAA e S A C U C UCUA UGA G G G A U A G G A C G C A A A U A C U U A A A U G U U A C C U G O Q N E S D I 2
Figure imgf000011_0001
Figure imgf000012_0001
Figure imgf000013_0001
Figure imgf000014_0001
Figure imgf000015_0001
Figure imgf000016_0001
Figure imgf000017_0001
Figure imgf000018_0001
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000021_0001
Figure imgf000022_0001
Figure imgf000023_0001
Figure imgf000024_0001
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
CG AGC CUAGUGGAAGUUG AAUU CUGC UA U UUAAACCU CUUCACUU UUGCGUAUU GAUUUAG GAG CUA AUUCUUC CACA U AAGACAU UGCGUUUUUCU UA CC CGGA CCAAU UGG C AA C A A U UUUUCUU CAAUUA AA GAUAUU U U CAG CUC AU AUA C C AUAA ACG UAUAUUAGAUU UCG UCAA A CGGC CGACG AGUU AU C A AUAAACG AAA AGA UA C C AUAAU U CA G AUGAUA U GU U UU U CA A GC UCUGC C C CAC CU UUU GG CAGC AUCUUUGCUAC AUUAAUAAGC CCAU CGGA CCGAC U AC AAUUUUUU UGGGAACAC CAA GAAAUUGAUG AGACACUA CUUU CG UUUUA UCAA CUU GUC CAUUAUAA CUGG GC ACUCAAC CAUC CUU CA CU UC CA CUUUAAAUU CG GUUUAC CGAA CGGAAAAA CAUCAUU U C CA CAGAU G UU UAACUCUACU UAUC C UCU UUUAC CUUAAUA C C UA C CA UA G G A UGGA UGUA AUUUC CU U GC AC U AG UCAC C CUACUCCGCUAAU CC G G A A UAU UUUUCGCC C C AUAUAG CUU CAAAGA CGA G U U GAAAGAU CUGA A AU CUUU AAAUAGACGAA A GAC GAUUACAAUUA UU AA CU GAUU U U UCG GU GA UA CAU A UC A A C CGA CC C A UAUC U C C AC UCUCUAAA CCUU CUU U C UU C AUAUUUU UG U GC UA UCU U UAUU U UU UAC CACGA AU A CA AA UU CUAU C U AU CGCUAC U A UA U U C U UUA CUU GG A UU G U C C U UCAGUUU UAU C U UA C G A AA UGGUAAUU UU U A U A U UC CA CGC AUUACAGUA G U G U A G G C G A A A U U G A A U U A U C C A A U A C U U 5 5 IJ
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
[0033] In some embodiments, a targeted region comprises a targeted exon or a portion thereof, a targeted intron or a portion thereof, both, more than one of either, or more than one of both, that can be targeted by a binding domain of an RTSM herein. A binding domain of an RTSM in some instances can be from about 2 to about 50 nucleobases in length and can bind with about 1 to about 25 nucleobases of an exon to about 1 to about 25 nucleotides of the intron, any number in between, and combinations thereof. Target region can comprise about 1 to about 25 nucleobases of an exon, 1 to about 25 nucleobases of the intron, or any combination thereof. In some embodiments, a targeted region comprises a sequence that can be at least about 2 to about 50 nucleobases long. In some embodiments, a targeted region comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length. [0034] In some embodiments, a targeted exon can be any one of, or a portion of any one of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12, Exon 13, Exon 14, Exon 15, Exon 16. A targeted exon can comprise a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence of any one of SEQ ID NOS: 5-20. [0035] In some embodiments, a targeted intron can be any one of, or a portion of, any one of Intron 1, Intron 2, Intron 3, Intron 4, Intron 5, Intron 6, Intron 7, Intron 8, Intron 9, Intron 10, Intron 11, Intron 12, Intron 13, Intron 14, or Intron 15. A targeted intron can comprise a sequence that shares at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence of any one of SEQ ID NOS: 21-35. [0036] In some embodiments, an exon-intron junction can comprise a sequence that shares at least about: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% or more sequence identity to: SEQ IDS NO: 5 and 21; SEQ IDS NO: 6 and 22; SEQ IDS NO:7 and 23; SEQ IDS NO:8 and 24; SEQ IDS NO:9 and 25; SEQ IDS NO:10 and 26; SEQ IDS NO:11 and 27; SEQ IDS NO:12 and 28; SEQ IDS NO:13 and 29; SEQ IDS NO:40 and 30; SEQ IDS NO:15 and 31; SEQ IDS NO:16 and 32; SEQ IDS NO:17 and 33; SEQ IDS NO:18 and 34; or SEQ IDS NO:19 and 35. [0037] In some embodiments, a targeted mRNA comprises a targeted sequence. In some embodiments, an RTSM targets and binds to a targeted sequence of an IFIH1 pre-mRNA. In some embodiments, an exon- intron junction comprises a targeted sequence. [0038] In some embodiments, a target sequence comprises a sequence that can be at least about 2 to about 50 nucleobases long. In some embodiments, a target sequence comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length. [0039] In some embodiments, a targeted sequence comprises a sequence as set forth in Formula (I) below: Formula (I): Exemplary Targeted Sequence 5’ … RGUV … 3’ wherein R is A or G; wherein V is A, G, or C; and wherein indicates from the 5’ → 3’ direction.
Figure imgf000054_0001
[0040] In some embodiments, a targeted sequence comprises a splice site. In some embodiments, an RTSM specifically binds to a splice site. In some embodiments, an RTSM specifically hybridizes to a splice site. In some embodiments, a splice site comprises a sequence as set forth in Formula (II) below. Formula (II): Exemplary Splice Site
Figure imgf000055_0001
[0041] In some embodiments, the sequence set forth in Formula (I), Formula (II), or both wherein: R is A; R is G; V is A; V is G; or V is C; and any combination thereof. In some embodiments, the sequence set forth in Formula (I), Formula (II), or both wherein: R is A and V is G; R is G and V is A; R is A and G is A; R is G and V is C; or R is G and V is G. [0042] In some embodiments, Formula (I), Formula (II), or both, further comprise: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 N(s) wherein each N is independently A, G, C, or U. In some embodiments, Formula (I), Formula (II), or both, further comprise: N; NN; NNN; NNNN; NNNNN; NNNNNN; NNNNNNN; NNNNNNNN; NNNNNNNNN; NNNN
Figure imgf000055_0002
NNNNNN; NNNNNNNNNNN; NNNNNNNNNNNN; NNNNNNNNNNNNN; NNNNNNNNNNNNNN; NNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; or NNNNNNNNNNNNNNNNN; wherein each N is independently A, G, C, or U. [0043] In some embodiments, an N of a group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous N(s) can be 5’ and adjacent to R or can be 3’ and adjacent to V, wherein each N is independently A, G, C, or U. In some embodiments, an N of a group of: 1, 2, 3, 4, 5, or 6 contiguous N(s) that can be 5’ and adjacent to R; an N of a group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 contiguous N(s), that can be 3’ and adjacent to V; and combinations thereof, wherein each N is independently A, G, C, or U. [0044] In some embodiments, Formula (I), Formula (II), or both, further comprise: N that is 5’ and adjacent to R; NN that is 5’ and adjacent to R; NNN that is 5’ and adjacent to R; NNNN that is 5’ and adjacent to R; NNNNN that is 5’ and adjacent to R; NNNNNN that is 5’ and adjacent to R; NNNNNNN that is 5’ and adjacent to R; N that is 3’ and adjacent to V; NN that is 3’ and adjacent to V; NNN that is 3’ and adjacent to V; NNNN that is 3’ and adjacent to V; NNNNN that is 3’ and adjacent to V; NNNNNN that is 3’ and adjacent to V; NNNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3’ and adjacent to V; NNNNNNNN that is 3’ and adjacent to V; NNNNNNNNNN that is 3’ and adjacent to V; or NNNNNNNNNNN that is 3’ and adjacent to V; combination thereof, wherein each N is independently A, G, C, or U. [0045] For example, wherein Formula (I), Formula (II), or both, further comprise NNN that is 5’ and adjacent to R and NNNNNNNN that is 3’ and adjacent to V, the sequence of Formula (I), Formula (II), or both, may comprise NNNRGUVNNNNNNNN; wherein R is A or G; wherein V is A, G, or C; and wherein each N is independently A, G, C, or U. For example, wherein Formula (I), Formula (II), or both, further comprise NNNNNNN that is 5’ and adjacent to R and NNNNNNNNNNN that is 3’ and adjacent to V, the sequence of Formula (I), Formula (II), or both, may comprise NNNNNNNRGUVNNNNNNNNNNN wherein R is A or G; wherein V is A, G, or C; and wherein each N is independently A, G, C, or U. [0046] In some embodiments, the sequence set forth in Formula (I), Formula (II), or both, further comprising: 1, 2, or 3 D(s) wherein each D is independently A, G, or U; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 N (s) wherein each N is independently A, G, U or C; H wherein H is A, C, or U; or any combination thereof. [0047] In some embodiments, Formula (I), Formula (II), or both, further comprise: D; 1, 2, 3, 4, 5, or 6 N(s); or any combination thereof, that is 5’ and adjacent to R, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C. [0048] In some embodiments, Formula (I), Formula (II), or both, further comprise: 1 or 2 D(s); 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 N(s); H; or any combination thereof, that is 3’ and adjacent to V, wherein each D is independently A, G, or U, wherein each N is independently A, G, U or C, wherein H is A, C or U. [0049] In some embodiments, Formula (I), Formula (II), or both, further comprise: D that is 5' and adjacent to R; ND that is 5' and adjacent to R; NND that is 5' and adjacent to R; NNND that is 5' and adjacent to R; NNNND that is 5' and adjacent to R; NNNNND that is 5' and adjacent to R; NNNNNND that is 5' and adjacent to R; N that is 3' and adjacent to V; ND that is 3' and adjacent to V; NDN that is 3' and adjacent to V; NDNN that is 3' and adjacent to V; NDNNH that is 3' and adjacent to V; NDNNHN that is 3' and adjacent to V; NDNNHND that is 3' and adjacent to V; NDNNHNDN that is 3' and adjacent to V; NDNNHNDNN that is 3' and adjacent to V; NDNNHNDNNN that is 3' and adjacent to V; NDNNHNDNNNN that is 3' and adjacent to V; NDNNHNDNNNNN that is 3' and adjacent to V; NDNNHNDNNNNNN that is 3' and adjacent to V; NDNNHNDNNNNNNN that is 3' and adjacent to V; and any combination thereof, wherein each D is independently A, G, or U, wherein each N is independently A, G, U or C, and wherein H is A, C or U. [0050] In some embodiments, Formula (I), Formula (II), or both, further comprise: NND that is 5’ and adjacent to R; and NDNNHND that is 3’ and adjacent to V; wherein the sequence of Formula (I), Formula (II), or both, comprise NNDRGUVNDNNHND, wherein H is A, C, or U, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C. [0051] In some embodiments, Formula (I), Formula (II), or both, further comprise: NNNNNND that is 5’ and adjacent to R; and NDNNHNDNNNNNNN that is 3’ and adjacent to V; wherein the sequence of Formula (I), Formula (II), or both, comprise NNNNNNDRGUVNDNNHNDNNNNNNN, wherein H is A, C, or U, wherein each D is independently A, G, or U and wherein each N is independently A, G, U or C. [0052] Various embodiments of Formula (I) can be seen in SEQ ID NOS: 36-65. [0053] In some embodiments, a target sequence comprises a sequence that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOS: 36-65. Table 4: Exemplary Target Sequences
Figure imgf000056_0001
Figure imgf000057_0001
[0054] In some embodiments, a target sequence may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 4. Alterations can be made singly or in combination with other alterations at other positions. Alternative nucleobases can be any one or more of A, C, G or U, or a deletion. In some embodiments, alterations can be obtained through computational predictions and alignment, for example, using SPLIGN, ESEMBL, Blast. [0055] In some embodiments, the disclosed RTSM herein increases exon skipping of a targeted exon during splicing. In some embodiments, an exon to be skipped can be any one of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12, Exon 13, Exon 14, Exon 15, Exon 16, or any combination thereof. In some embodiments, an exon can be skipped when an RTSM can be bound to a target sequence. In some embodiments when an RTSM is bound to a target sequence, one or more of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12, Exon 13, Exon 14, Exon 15, Exon 16, or any combination thereof, can be skipped during splicing. [0056] In some embodiments, a target region can comprise a splice site. In some embodiments, an exon- intron junction can comprise a splice site. In certain embodiments, a splice site can be a 5’ splice site. In other embodiments, a splice site can be a 3’ splice site. [0057] In some embodiments, an exon-intron junction comprises at least a portion of a target exon, at least a portion of a target intron, both, more than one of either, and more than one of both. In some embodiments, an exon-intron junction can be located at the 5’ splice site of a target intron, wherein the corresponding targeted exon is downstream of a target intron. In some embodiments, a targeted region can comprise the 5’ splice site of an intron. In some embodiments, a targeted region comprises the 5’ splice site of intron 1 wherein a targeted exon is exon 1. In some embodiments, a targeted region comprises the 5’ splice site of intron 2 wherein a targeted exon is exon 2. In some embodiments, a targeted region comprises the 5’ splice site of intron 3 wherein a targeted exon is exon 3. In some embodiments, a targeted region comprises the 5’ splice site of intron 4 wherein a targeted exon is exon 4. In some embodiments, a targeted region comprises the 5’ splice site of intron 5 wherein a targeted exon is exon 5. In some embodiments, a targeted region comprises the 5’ splice site of intron 6 wherein a targeted exon is exon 6. In some embodiments, a targeted region comprises the 5’ splice site of intron 7 wherein a targeted exon is exon 7. In some embodiments, a targeted region comprises the 5’ splice site of intron 8 wherein a targeted exon is exon 8. In some embodiments, a targeted region comprises the 5’ splice site of intron 9 wherein a targeted exon is exon 9. In some embodiments, a targeted region comprises the 5’ splice site of intron 10 wherein a targeted exon is exon 10. In some embodiments, a targeted region comprises the 5’ splice site of intron 11 wherein a targeted exon is exon 11. In some embodiments, a targeted region comprises the 5’ splice site of intron 12 wherein a targeted exon is exon 12. In some embodiments, a targeted region comprises the 5’ splice site of intron 13 wherein a targeted exon is exon 13. In some embodiments, a targeted region comprises the 5’ splice site of intron 14 wherein a targeted exon is exon 14. In some embodiments, a targeted region comprises the 5’ splice site of intron 15 wherein a targeted exon is exon 15. [0058] In some embodiments, an RTSM binding domain specifically binds to a splice site. In some embodiments, an RTSM binding domain specifically hybridizes to a splice site. In some embodiments, a splice site comprises a sequence as set forth in Formula (II). Various embodiments of Formula (II) can be seen, for example, in any sequence set forth in Table 5. [0059] In some embodiments, a splice site sequence comprises a sequence that can be at least about 2 to about 50 nucleobases long. In some embodiments, a splice site sequence comprises a sequence that can be about 14 to about 35 nucleobases long. In some embodiments, a splice site sequence comprises a sequence that can be about 14 to about 25 nucleobases long. In some embodiments, a splice site sequence comprises a sequence that can be about: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length. In some embodiments, a splice site sequence can be about 2 nucleobases in length. In some embodiments, a splice site sequence can be about 3 nucleobases in length. In some embodiments, a splice site sequence can be about 4 nucleobases in length. In some embodiments, a splice site sequence can be about 14 nucleobases in length. In some embodiments a splice site sequence can be about 25 nucleobases in length. [0060] In some embodiments, a splice site comprises a sequence that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS. 66-95. In some embodiments, a splice site is a 5’ splice site. In some embodiments, a 5’ splice site can be the complement of any one of the sequences of SEQ ID NOS: 66-95. In some embodiments, a 5’ splice site can be the inverse complement of any one of the sequences of SEQ ID NOS.66-95. Table 5: Exemplary Splice Site Sequences
Figure imgf000058_0001
Figure imgf000059_0001
[0061] SEQ ID NOS: 66-95 is reproduced in Table 6 below and in some instances, the splice site can be located where the vertical line is located at each sequence. Table 6: Representative Splice Sites
Figure imgf000059_0002
Figure imgf000060_0001
[0062] In some embodiments, a splice site sequence further comprises one or more alterations at one or more positions on either side of the splice site. For example, an alteration can be seen at -1, -2, -3, -4, -5, - 6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26, -27, -28, -29, - 30, -31, -32, -33, -34, -35, -36, -37, -38, -39, -40, -41, -42, -43, -44, -45, -46, -47, -48, -49, -50 or more positions from the splice site in the 3’ to the 5’ direction. In a further example, an alteration can be seen at +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25, +26, +27, +28, +29, +30, +31, +32, +33, +34, +35, +36, +37, +38, +39, +40, +41, +42, +43, +44, +45, +46, +47, +48, +49, +50 or more positions from the splice site in the 5’ to the 3’ direction. In another example, an alteration can be seen at -25, -24, -23, -22, -21, -20, -19, -18, -17, -16, -15, -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1, +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25 positions from the splice site. Alterations can be any one of A, C, G, or or U. In some embodiments, alterations can be obtained through computational predictions and alignment, for example, using SPLIGN, ESEMBL, Blast. [0063] In some embodiments, alterations in a splice site sequence can be induced by one or more IFIH1 gene mutations. Accordingly, in some embodiments, an IFIH1 gene comprises one or more gene mutations. In some embodiments, the one or more IFIH1 gene mutations are associated with: splicing of a pre-mRNA; expansion of a portion of a pre-mRNA; the expression level of a pre-mRNA or a protein encoded by the gene; gain-of-function of a protein encoded by the gene; or an associated disease or a condition thereof. RNA-Targeted Splicing Modifiers (RTSM) [0064] An RTSM disclosed herein can be synthetic RNA targeting splicing modifiers that can increase exon skipping during splicing of IFIH1 pre-mRNA compared to IFIH1 pre-mRNA spliced in the absence of RTSM. An RTSM disclosed herein can increase the level of modulated IFIH1 mRNA transcripts as compared to mRNA transcripts processed in the absence of RTSM. An RTSM disclosed herein can increase the level of modulated MDA5 protein production or expression as compared to MDA5 produced in the absence of RTSM. [0065] As used herein, the term “increase” means to induce or to increase. For example, if no exon skipping occurred in the absence of RTSM, then any incidence of exon skipping or any indication of exon skipping activity resulting from splicing in the presence of RTSM has thereby “increased” exon skipping. In some instances, an evaluation of an increase in exon skipping can occur in an in vitro assay. In some instances, comparison of the amount of exon skipping in two otherwise substantially identical systems where one system lacks an RTSM and the other system has an RTSM can determine if exon increases in the presence of the RTSM. [0066] In some embodiments, an RTSM can be selected from the group consisting of an antibody or a fragment thereof, an aptamer, an antisense oligomer (ASO), or a CRISPR associated protein, and any combination thereof. [0067] In some embodiments, an RTSM targets and binds to IFIH1 pre-mRNA. Disclosed herein are RTSMs, wherein RTSM-pre-mRNA binding can prevent recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, interfere with splice site signaling, sterically block splicing of a pre-mRNA, or any combination thereof. In some embodiments, an RTSM comprises a binding domain that binds to IFIH1 pre- mRNA. In some embodiments, an RTSM comprises a binding domain that binds to a target region of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that binds to a target sequence of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that specifically binds to a splice site sequence of an IFIH1 pre-mRNA. In some embodiments, an RTSM comprises a binding domain that specifically hybridizes to a splice site sequence of an IFIH1 pre-mRNA. [0068] In some embodiments, a binding domain of an RTSM disclosed herein can be from about 2 to about 50 nucleobases in length and can bind with about 1 to about 25 nucleobases of an exon to about 1 to about 25 nucleotides of the intron, any number in between, and combinations thereof. In some embodiments, a binding domain of an RTSM comprises a sequence that can be at least about 2 to about 50 nucleobases long. In some embodiments, a binding domain of an RTSM comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length. [0069] In some embodiments, an RTSM need not to completely bind to all nucleobases in a target sequence and the nucleobases to which it does bind to may be contiguous or noncontiguous. RTSMs may bind over one or more segments of a pre-mRNA transcript, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed). In certain embodiments, an RTSM binds to noncontiguous nucleobases in a target pre-mRNA transcript. For example, a RTSM may bind to nucleobases in a pre-mRNA transcript that are separated by one or more nucleobase(s) to which an RTSM does not bind. In some embodiments, an RTSM can bind to about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 continuous nucleobases of a target pre-mRNA. [0070] In some embodiments, an RTSM binding domain comprises a binding sequence. In some embodiments, a binding sequence binds to the sequence as set forth in Formula II. In some embodiments, a binding sequence hybridizes to the sequence as set forth in Formula II. In some embodiments, a binding sequence comprises a sequence as set forth in Formula (III) below: Formula (III): Exemplary Binding Sequence
Figure imgf000062_0001
[0071] In some embodiments, the sequence set forth in Formula (III) wherein: B is T; B is U; B is C; B is G; Y is T; Y is U; or Y is C; and any combination thereof. In some embodiments, the sequence set forth in Formula (III) wherein: wherein B is C and Y is T; B is C and Y is U; B is C and Y is C; B is T and Y is C; B is U and Y is C; B is T and Y is T; B is U and Y is U; or B is G and Y is C. [0072] In some embodiments, Formula (III) further comprises: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 N(s) wherein each N is independently A, G, C, T or U. In some embodiments, Formula (I), Formula (II), or both, further comprise: N; NN; NNN; NNNN; NNNNN; NNNNNN; NNNNNNN; NNNNNNNN; NNNNNNNNN; NNNNNNNNNN; NNNNNNNNNNN; NNNNNNNNNNNN; NNNNNNNNNNNNN; NNNNNNNNNNNNNN; NNNNNNNNNNNNNNN; NNNNNNNNNNNNNNNN; or NNNNNNNNNNNNNNNNN wherein each N is independently A, G, C, T or U. [0073] In some embodiments, wherein an N of a group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous N(s) can be 5’ and adjacent to B or can be 3’ and adjacent to Y, or any combination thereof, wherein each N is independently A, G, C, T or U. In some embodiments, Formula (III) further comprises an N of a group of: 1, 2, 3, 4, 5 or 6 contiguous N(s) that can be 5’ and adjacent to B; an N group of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 contiguous N(s) that can be 3’ and adjacent to Y; or any combination thereof, wherein each N is independently A, G, C, T or U. [0074] In some embodiments, Formula (III) further comprises: N that is 5’ and adjacent to B; NN that is 5’ and adjacent to B; NNN that is 5’ and adjacent to B; NNNN that is 5’ and adjacent to B; NNNNN that is 5’ and adjacent to B; NNNNNN that is 5’ and adjacent to B; NNNNNNN that is 5’ and adjacent to B; NNNNNNNN that is 5’ and adjacent to B; NNNNNNNN that is 5’ and adjacent to B; NNNNNNNNNN that is 5’ and adjacent to B; or NNNNNNNNNNN that is 5’ and adjacent to B; N that is 3’ and adjacent to Y; NN that is 3’ and adjacent to Y; NNN that is 3’ and adjacent to Y; NNNN that is 3’ and adjacent to Y; NNNNN that is 3’ and adjacent to Y; NNNNNN that is 3’ and adjacent to Y; NNNNNNN that is 3’ and adjacent to Y; and any combination thereof, wherein each N is independently A, G, C, T or U. [0075] For example, wherein Formula (III) further comprises NNNNNNNN that is 5’ and adjacent to B and NNN that is 3’ and adjacent to Y, the sequence of Formula (III) may comprise NNNNNNNNBACYNNN. For example, wherein Formula (III) further comprises NNNNNNNNNNN that is 5’ and adjacent to B and NNNNNNN that is 3’ and adjacent to Y the sequence of Formula (III) may comprise NNNNNNNNNNNBACYNNNNNNN, wherein each N is independently A, G, C, T or U. [0076] In some embodiments, Formula (III) further comprises: D wherein D is A, G, T or U; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 N (s) wherein each N is independently A, G, T, U or C; 1, 2, or 3 H(s) wherein each H is independently A, C, T or U; or any combination thereof. [0077] In some embodiments, Formula (III) further comprises: D; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 N(s); 1 or 2 H(s); or any combination thereof, that is 5’ and adjacent to B, wherein D is A, G, T or U, each N is independently A, G, T, U or C, and each H is independently A, C, T or U. In some embodiments, Formula (III) further comprises: 1, 2, 3, 4, 5, or 6 N(s); H; or any combination thereof, that is 3’ and adjacent to Y. In some embodiments, Formula (III) further comprises: N that is 5’ and adjacent to B; HN that is 5’ and adjacent to B; NHN that is 5’ and adjacent to B; NNHN that is 5’ and adjacent to B; DNNHN that is 5’ and adjacent to B; NDNNHN that is 5’ and adjacent to B; HNDNNHN that is 5’ and adjacent to B; NHNDNNHN that is 5’ and adjacent to B; NNHNDNNHN that is 5’ and adjacent to B; NNNHNDNNHN that is 5’ and adjacent to B; NNNNHNDNNHN that is 5’ and adjacent to B; NNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNNHNDNNHN that is 5’ and adjacent to B; H that is 3’ and adjacent to Y; HN that is 3’ and adjacent to Y; HNN that is 3’ and adjacent to Y; HNNN that is 3’ and adjacent to Y; HNNNN that is 3’ and adjacent to Y; HNNNNN that is 3’ and adjacent to Y; HNNNNNN that is 3’ and adjacent to Y; or any combination thereof, wherein each N is independently A, G, T, U or C, wherein each D is independently A, G, T or U, and wherein each H is independently A, C, T or U. [0078] In some embodiments, Formula (III) further comprises HNDNNHN that is 5’ and adjacent to B, HNN that is 3’ and adjacent to Y, wherein the sequence of Formula (III) comprises HNDNNHNBACYHNN wherein each N is independently A, G, T, U or C, wherein D is A, G, T or U, and wherein H is A, C, T or U. In some embodiments, Formula (III) comprises NNNNNNNHNDN
Figure imgf000063_0001
HN that is 5’ and adjacent to B and HNNNNNN that is 3’ and adjacent to Y, wherein the sequence of Formula (III) comprises NNNNNNNHNDNNHNBACYHNNNNNN wherein each N is independently A, G, T, U or C, wherein each D is independetly A, G, T or U, and wherein each H is independently A, C, T or U. [0079] Various embodiments of Formula (III) can be seen in SEQ ID NOS: 96-155. Various embodiments of Formula (III) can be modified as described in the methods herein. [0080] In some embodiments, an RTSM binding domain comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. In some embodiments, an RTSM binding domain comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. [0081] In some embodiments, an RTSM binding domain comprises a sequence about 2 to about 50 nucleobases in length that shares at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155. In some embodiments, an RTSM binding domain comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155. Table 7: Exemplary Binding Sequences
Figure imgf000063_0002
Figure imgf000064_0001
Figure imgf000065_0001
[0082] In some embodiments, a binding sequence may comprise one or more nucleotide alterations at one or more positions in any of the sequences in Table 7. Alterations can be made singly or in combination with other alterations at other positions. Alternative nucleobases can be any one or more of A, C, G or U, or a deletion. In some embodiments, alterations can be obtained through computational predictions and alignment, for example, using SPLIGN, ESEMBL, Blast. [0083] In some embodiments, a binding sequence comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155. In some embodiments, a binding sequence comprises a sequence about 4 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155. [0084] In some embodiments, a binding sequence disclosed herein comprises a sequence that binds to or hybridizes to 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 continuous or non-continuous nucleotides of any one of the sequences of SEQ IDS NOS: 66-95. [0085] An RTSM disclosed herein can increase exon skipping during pre-mRNA splicing as compared to a pre-mRNA spliced in the absence of an RTSM. In some embodiments, exon skipping modulates exon coding in IFIH1 mRNA, MDA5 protein, or both. In some embodiments, wherein modulated exon coding can be determined by modulated mRNA transcription, modulated MDA5 protein translation, or both. In some embodiments, modulated exon coding comprises: absence of one or more IFIH1 gene exon(s) in an IFIH1 mRNA molecule, a truncated mRNA molecule, absence of one or more IFIH1 gene exon(s) in a MDA5 protein molecule, a non-functional MDA5 protein, a semi-functional MDA5 protein, a truncated MDA5 protein molecule, or any combination thereof. In certain embodiments, wherein an increase in exon skipping induces an increase in modulated exon coding. [0086] In some embodiments, RTSM-modulated IFIH1 mRNA transcript can be encoded by a sequence that excludes a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to: SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:10; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:6; SEQ ID NO:17; SEQ ID NO:18; SEQ ID NO:19; SEQ ID NO:20 and any combination thereof. [0087] In some embodiments, wherein RTSM-modulated IFIH1-mRNA transcript can be determined by analysis of a IFIH1 mRNA transcript expressed in the absence of RTSM, or to a wild-type IFIH1 mRNA, or both, wherein the wild-type IFIH1 mRNA can be encoded by a sequence with at least: 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. [0088] In some embodiments wherein RTSM-modulated MDA5 protein expression can be determined by analysis of a MDA5 protein translated in the absence of RTSM, or a wild-type MDA5 protein, or both, wherein the wild-type MDA5 protein can be encoded by a sequence with at least: 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. Antibodies [0089] In some embodiments, an RTSM can be an antibody or a fragment thereof specific or selective for a IFIH1 pre-mRNA. In some embodiments, an RTSM can be an anti-mRNA antibody or a fragment thereof. Antibodies, also known as immunoglobulin (Ig), as disclosed herein can be monoclonal or polyclonal antibodies. The term “monoclonal antibodies,” as used herein, can refer to antibodies that are produced by a single clone of B-cells and bind to the same epitope. In contrast, “polyclonal antibodies” can refer to a population of antibodies that are produced by different B-cells and bind to different epitopes of the same antigen. The antibodies can be from any animal origin. An antibody can be IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY. In some embodiments, the antibody can be whole antibodies, including single-chain whole antibodies. In some embodiments, the antibody can be a fragment of an antibody, which can include, but are not limited to, a Fab, a Fab’, a F(ab’)2, a Fd (consisting of VH and CH1), a Fv fragment (consisting of VH and VL), a single-chain variable fragment (scFv), a single-chain antibody, a disulfide-linked variable fragment (dsFv), and fragments comprising either a VL or VH domain. A whole antibody typically consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two identical copies of a light (L) chain polypeptide. Each of the heavy chains contains one N-terminal variable (VH) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (VL) region and one C- terminal constant (CL) region. The variable regions of each pair of light and heavy chains form the antigen binding site of an antibody. The VH and VL regions have a similar general structure, with each region comprising four framework regions, whose sequences are relatively conserved. The framework regions are connected by three complementarity determining regions (CDRs). The three CDRs, known as CDR1, CDR2, and CDR3, form the “hypervariable region” of an antibody, which can be responsible for antigen binding, and can include overlapping or subsets of amino acid residues when compared against each other. In one embodiment, the term “CDR” can be a CDR which can be defined based on sequence comparisons. CDRH1, CDRH2 and CDRH3 denote the heavy chain CDRs, and CDRL1, CDRL2 and CDRL3 denote the light chain CDRs. [0090] The terms “fragment of an antibody,” “antibody fragment,” “functional fragment of an antibody,” “antigen-binding portion” or its grammatical equivalents are used interchangeably herein and can mean one or more fragments or portions of an antibody that retain the ability to specifically or selectively bind to an antigen. The antibody fragment desirably comprises, for example, one or more CDRs, the variable region (or portions thereof), the constant region (or portions thereof), or any combination thereof. Non-limiting examples of antibody fragments include (1) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (2) a F(ab’)2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the stalk region; (3) a Fv fragment comprising the VL and VH domains of a single arm of an antibody; (4) a single chain Fv (scFv), which is a monovalent molecule comprising the two domains of the Fv fragment (e.g., VL and VH) joined by a linker which enables the two domains to be synthesized as a single polypeptide chain and (5) a diabody, which is a dimer of polypeptide chains, wherein each polypeptide chain comprises a VH connected to a VL by a peptide linker that is too short to allow pairing between the VH and VL on the same polypeptide chain, thereby driving the pairing between the complementary domains on different VH-VL polypeptide chains to generate a dimeric molecule having two functional antigen binding sites. [0091] In one embodiment, an RTSM antibody or fragment of described herein comprises a binding region that targets a target region on a IFIH1 pre-mRNA. In some embodiments, an RTSM antibody binding region can be also known as an “antigen recognition domain,” “antigen binding domain,” or “antigen binding region” which can refer to a portion of an RTSM specifically binds to a target region. In some embodiments, a target region of a pre-mRNA comprising a target sequence can be referred to herein as an antigen. In some embodiments, a target region of a pre-mRNA can be an antigen, a target sequence can be an epitope, wherein an RTSM antibody or fragment thereof targets to and binds to the pre-mRNA epitope. [0092] In some embodiments, an RTSM antibodies or fragments thereof can be generated by a modified nucleobase-coupling protocol. In such embodiments, the antibody can be modified, coupled or conjugated with a nucleic acid probe, such as an antisense oligonucleotide probe, wherein the nucleic acid probe binds to a targeted region of the IFH1 pre-mRNA and increases exon skipping. Aptamers [0093] In some embodiments an RTSM can be an aptamer that binds to a riboswitch on a targeted pre- mRNA In some embodiments, an RTSM aptamer can be operably linked to a ligand. In some embodiments, an RTSM can be operably linked to a ligand. For modulating mRNA splicing, a ligand or molecule specific to an aptamer it can be helpful to meet some or all of the following criteria. First, it should be able to bind its ligand-binding aptamer with high affinity. Second, ligand-aptamer interaction should not require the assistance of any other factor. Third, the ligand-binding site (the aptamer) should be unstructured and only upon binding of ligand should the aptamer undergo a conformational change or rearrangement. Fourth, the ligand-aptamer binding must be preserved under the conditions that support pre-mRNA splicing. Finally, the ligand should not affect the splicing of a substrate that does not contain its binding site. When an RTSM can be an aptamer-ligand system, the aptamer-ligand comprises a binding region that targets and binds to a target sequence of a pre-mRNA, wherein the aptamer inserts into the strand and the ligand increases exon skipping. In some embodiments, a ligand can be tobramycin, neomycin, or theophylline. Antisense Oligonucleotides (ASOs) [0094] In some embodiments, an RTSM can be an ASO. In some embodiments, an RTSM disclosed herein comprises a binding domain that targets and binds to a target region of an IFIH1 pre-mRNA In some embodiments, a binding domain of an RTSM comprises a sequence that can be about: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleobases in length. [0095] In some embodiments, an ASO binding domain comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. In some embodiments, a binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of SEQ ID NOS: 36-65. [0096] In some embodiments, an ASO-RTSM of the present disclosure comprises a sequence that has at least about 85% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an RTSM of the present disclosure comprises a sequence that has at least about 92% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence complementary to the sequence of SEQ ID NO: 49. In some embodiments, an RTSM of the present disclosure comprises a sequence that has at least about 84% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has at least about 88% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has at least about 92% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has at least about 96% sequence complementary to the sequence of SEQ ID NO: 64. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence complementary to the sequence of SEQ ID NO: 64. [0097] An ASO and a DNA or RNA target binding partner can be complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus in some embodiments, “specifically hybridizable” and “complementary” are terms which can be used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between an ASO and a DNA or RNA target. It can be understood that the sequence of an ASO need not be 100% complementary to that of its target sequence to be specifically hybridizable. An ASO can be specifically hybridizable when there are sufficient binding interactions between an ASO and DNA or RNA target such that the ASO, at least temporarily, adheres to the specific region which its targeting. Specific binding can occur under physiological conditions, including but not limited to room temperature, in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, the above method may be used to select ASOs. [0098] In some embodiments, an ASO can have exact sequence complementary to a target sequence or near complementarity (e.g., sufficient complementarity to bind a target sequence and modulating splicing at a splice site). Complementarity (the degree to which one polynucleotide is complementary with another) is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules. The sequence of an antisense oligomer (ASO) need not be 100% complementary to that of its target nucleic acid to hybridize. In certain embodiments, ASOs can comprise at least about: 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to a target region within a target nucleic acid sequence to which they are targeted. For example, an ASO in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered together or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percent complementarity of an ASO with a region of a target nucleic acid can be determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs. [0099] ASOs disclosed herein can be designed so that they bind to a target nucleic acid (e.g., a targeted region of a pre-mRNA transcript) and remain bound under physiological conditions. In some embodiments, binding as described herein can be hybridizing. In some embodiments, if an ASO binds to a site other than the intended (targeted) nucleic acid sequence, it binds to a limited number of sequences that are not a target nucleic acid (to a few sites other than a target nucleic acid). Design of an ASO can take into consideration the occurrence of the nucleic acid sequence of a targeted portion of a pre-mRNA transcript or a sufficiently similar nucleic acid sequence in other locations in the genome or cellular pre-mRNA or transcriptome, such that the likelihood the ASO will bind other sites and cause "off-target" effects is limited. [0100] In certain embodiments, ASOs can bind to a target pre-mRNA. In certain embodiments, ASOs can hybridize to a pre-mRNA. In some instances, ASOs can "specifically hybridize" to or are "specific" to a target nucleic acid or a targeted portion of a pre-mRNA. Such hybridization can occur with a Tm (melting temperature) substantially greater than 37oC, at least 50 oC, or between 60 oC to approximately 90 oC. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide. In some embodiments, an ASO can bind to, hybridize to, or specifically hybridize to a splice site sequence in a target pre-mRNA wherein a splice site sequence comprises a sequence that shares at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 66-95. [0101] In some embodiments, an ASO RTSM comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:96-155. In some embodiments, an ASO comprises a sequence about 14 to about 30 nucleobases in length that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:96-155. [0102] In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 85% sequence identity to the sequence of SEQ ID NO: 109. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 109. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 109. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 85% sequence identity to the sequence of SEQ ID NO: 124. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 124. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 124. [0103] In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 88% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 96% sequence identity to the sequence of SEQ ID NO: 139. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 139. [0104] In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 88% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 84% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 92% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that shares at least about 96% sequence identity to the sequence of SEQ ID NO: 154. In some embodiments, an ASO RTSM of the present disclosure comprises a sequence that has 100% sequence identity to the sequence of SEQ ID NO: 154. [0105] An ASO disclosed herein can comprise oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of binding to a complementary nucleobase on a target mRNA, but in some embodiments, an ASO does not comprise a sugar moiety, such as a peptide nucleic acid (PNA). An ASO may comprise naturally-occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the preceding. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and/or having a modified backbone. In some embodiments, all of the nucleotides of an ASO are modified nucleotides. [0106] In some embodiments, one or more nucleobases of an ASO may be any unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA. Examples of modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine. [0107] In some embodiments, an ASO described herein further comprises a backbone structure that connects the components of an oligomer. The term "backbone structure" and "oligomer linkages" may be used interchangeably and can refer to the connection between monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of the oligomer. The backbone structure or oligomer linkages of an ASO described herein can include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. In some embodiments, the backbone structure of an ASO does not contain phosphorous but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification can be a phosphothioate linkage. In some embodiments, the backbone modification can be a phosphoramidate linkage. [0108] Any of the ASOs described herein may contain a sugar moiety that comprises ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog, including a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O- guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the sugar moiety modification can be selected from 2'-O-Me, 2'F, and 2'MOE. In some embodiments, the sugar moiety modification can be an extra bridge bond, such as in a locked nucleic acid (LNA). In some embodiments the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification. In some embodiments, the sugar moiety comprises 2'4'-constrained 2'O-methyloxyethyl (cMOE) modifications. In some embodiments, the sugar moiety comprises cEt 2', 4' constrained 2'-O ethyl BNA modifications. In some embodiments, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some embodiments, the sugar moiety comprises ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety comprises MCE modifications. [0109] In some embodiments, one or more monomer, or each monomer of an ASO can be modified in the same way, for example each linkage of the backbone of an ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification. Such modifications that are present on each of the monomer components of an ASO are referred to as "uniform modifications." In some examples, a combination of different modifications may be desired, for example, an ASO may comprise a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos). Combinations of different modifications to an ASO are referred to as "mixed modifications" or "mixed chemistries." [0110] In some embodiments, an ASO comprises one or more backbone modifications. In some embodiments, an ASO comprises one or more sugar moiety modification. In some embodiments, an ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some embodiments, an ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some embodiments, an ASO comprises a phosphorodiamidate morpholino (PMO). In some embodiments, an ASO comprises a peptide nucleic acid (PNA). [0111] In some embodiments, an ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage. In some embodiments, an ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, a 2'-Fluoro, or a 2'-O- methoxyethyl moiety. In some embodiments, an ASO comprises at least one modified sugar moiety. In some embodiments, each sugar moiety can be a modified sugar moiety. [0112] Any of the ASOs or any component of an ASO (e.g., a nucleobase, sugar moiety, backbone) described herein may be independently modified in order to achieve desired properties or activities of an ASO or reduce undesired properties or activities of the ASO. For example, an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (e.g., RNase H); improve uptake of an ASO into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; and/or modulate the half-life of the ASO. [0113] In some embodiments, an ASO can be comprised of one or more 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides. ASOs comprised of such nucleotides can be especially well-suited to the methods disclosed herein; oligomers having such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery in some embodiments described herein. [0114] ASOs can be synthesized by methods described herein. Alternatively or in addition, ASOs may be obtained from a commercial source. In certain embodiments, an ASO can be prepared by stepwise solid- phase synthesis. In some cases, it may be desirable to add additional chemical moieties to an ASO, e.g., to enhance pharmacokinetics or to facilitate capture or detection of the compound. Such a moiety may be covalently attached, according to standard synthetic methods. For example, addition of a polyethylene glycol moiety or other hydrophilic polymer, e.g., one having 1-100 monomeric subunits, may be useful in enhancing solubility. [0115] Further a reporter moiety, such as fluorescein or a radiolabeled group, may be attached for purposes of detection. Alternatively, the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin. In selecting a moiety for attachment or modification of an antisense compound, can be generally desirable to select chemical compounds of groups that are biocompatible and likely to be tolerated by a subject without undesirable side effects. CRISPR-Cas Systems [0116] Disclosed herein are RTSMs comprising a CRISPR associated protein. An RTSM can be a CRISPR-Cas system (CC RTSM system) wherein the system comprises a CRISPR associated protein. The CC RTSM system can be designed to target an IFIH1 pre-mRNA, prevent recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, interfere with splice site signaling, sterically block splicing of a pre-mRNA, or any combination thereof. Envisioned herein are CC systems that target RNA, including but not limited to Types III and VI. While any suitable CC system may be used for the purposes of the disclosure herein, in some embodiments, systems that target RNA and does not rely on consensus protospacer adjacent motif (PAM) for activity, such as Types III and VI, can be used herein. Accordingly in some embodiments, the CC systems used herein can rely on RNA protospacer flanking sequences (PFS) or PAM sequences. Hence, in some embodiments, an IFIH1 RNA further comprises a PFS sequence or a PAM sequence. [0117] Subtypes of suitable CC systems disclosed herein include, but are not limited Type II class 2, Types III-A, III-B, VI-A, VI-A, VI-C, or VI-D. In other embodiments, Type II RNA-targeting Cas9 systems can also be used as an RTSM disclosed herein. [0118] In some embodiments, the CC RTSM system comprises a guide RNA and a Cas nuclease. In one embodiment, the guide RNA comprises a crispr RNA (crRNA) and a tracr RNA. In another embodiment, the guide RNA comprises a single guide RNA (sgRNA). In some embodiments, CC RTSM system can comprise one or more Cas nuclease. Examples of suitable Cas nucleases include, but are not limited to, Csm3, Cmr4, Csm6, Csx1, Csx27, Csx28, a member of a Cas 7 superfamily, or a Cas9, Cas12, or a Cas13 effector nuclease. [0119] CC Systems that target an IFIH1 pre-mRNA can be computationally identified through determination of a Cas containing signature genes that express RNAse or RNA targeting activity, and transcribed and processed into a CRISPR gRNA. [0120] In some embodiments, the gRNA of the CC RTSM system comprises a binding domain that binds to a target region of an IFIH1 pre-mRNA. In one embodiment, a gRNA or sgRNA binding domain comprises a sequence about 2 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. In one embodiment, a gRNA or sgRNA binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65. [0121] In some embodiments, a gRNA or sgRNA binding domain comprises a sequence about 4 to about 50 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:111-125 and 141-155. In some embodiments, a gRNA or sgRNA binding domain comprises a sequence about 14 to about 30 nucleobases in length that has at least about: 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOS:111-125 and 141-155. [0122] In some embodiments, a gRNA of the CC RTSM system targets an IFIH1 pre-mRNA of interest and directs a Cas nuclease to a pre-mRNA. According to some embodiments, the Cas nuclease can be a catalytically dead variant, wherein upon gRNA binding to a target region of a pre-mRNA, the CC RTSM system increases exon skipping wherein the system prevents recruitment of a one or more splicing complex component to a pre-mRNA, decrease the binding affinity of one or more splicing complex component to a pre-mRNA, or sterically block mRNA splicing. [0123] In other embodiments, a Cas nuclease can be selected and or synthesized to interfere with splice site signaling through RNAse activity wherein upon gRNA binding to a target region of a pre-mRNA, the Cas nuclease can disrupt splice site signaling sequences of a targeted exon-intron junction thereby inducing exon skipping. Modifications [0124] Any of the RTSMs described herein may be modified in order to achieve desired properties or activities of an RTSM or reduce undesired properties or activities of the RTSM. For example, an RTSM or one or more components of any RTSM may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (e.g., RNase H); improve uptake of an RTSM into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the RTSM; and/or modulate the half-life of the RTSM. [0125] Also included herein are vector delivery systems that are capable of expressing an RTSM sequences herein, such as vectors that express a polynucleotide sequence comprising any one or more of the sequences shown in Table 7, as described herein. By “vector” or “nucleic acid construct” can be meant to be a polynucleotide molecule, such as a DNA molecule, derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector can contain one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrated with the genome of the defined host such that the cloned sequence can be reproducible. Accordingly, the vector can be an autonomously replicating vector, e.g., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector can contain any means for assuring self-replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. [0126] For example, an RTSM of the present disclosure can be conjugated to a cell penetrating peptide. The term “cell penetrating peptide” and “CPP” are used interchangeably and can refer to cationic cell penetrating peptides, also called transport peptides, carrier peptides, or peptide transduction domains. The peptides, as shown herein, have the capability of inducing cell penetration within 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. [0127] In one embodiment, an RTSM can be an ASO wherein an ASO can comprise an oligonucleotide moiety conjugated to a cell penetrating peptide effective to enhance transport of the compound into cells. In some embodiment, the oligonucleotide moiety can be an arginine-rich peptide transport moiety effective to enhance transport of the compound into cells. The transport moiety can be attached to a terminus of the oligomer. The peptides have the capability of inducing cell penetration within 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of cells of a given cell culture population, including all integers in between, and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. In one embodiment, the cell-penetrating peptide may be an arginine-rich peptide transporter. In another embodiment, the cell-penetrating peptide may be Penetratin or the Tat peptide. In one embodiment, the CPP can be conjugated to an ASO herein and can utilize glycine as the linker between the CPP and the antisense oligonucleotide. For example, a preferred peptide conjugated PMO consists of R6-G-PMO. [0128] The transport moieties as described above can enhance cell entry of attached oligomers, relative to uptake of the oligomer in the absence of the attached transport moiety. Uptake can be enhanced at least ten fold, at least twenty fold, relative to the unconjugated compound. [0129] The use of arginine-rich peptide transporters (e.g., cell-penetrating peptides) can be used herein. For example, when conjugated to an antisense PMO, argine-rich CPPs can demonstrate an enhanced ability to alter splicing of several gene transcripts. Exemplary peptide transporters, excluding linkers, can be seen in Table 8. Table 8: Exemplary Peptide transporters
Figure imgf000073_0001
Figure imgf000074_0001
Assays [0130] RTSMs disclosed herein can increase exon skipping during pre-mRNA splicing as compared to a pre-mRNA spliced in the absence of an RTSM herein as determined by an in vitro assay. In some embodiments, exon skipping modulates IFIH1 mRNA transcript production. In some embodiments, exon skipping increases production of mRNA transcript excluding coding for one or more exons, a truncated mRNA molecule, or both. In some embodiments, RTSM-modulated mRNA expression can be compared to mRNA processed in the absence of RTSM as determined by an in vitro assay. [0131] In some embodiments, exon skipping modulates MDA5 protein production. In certain embodiments, an increase in exon skipping induces an increase in modulated MDA5 protein expression. In some embodiments, exon skipping increases production of a non-functional MDA5 protein, a semi- functional MDA5 protein, a truncated MDA5 protein, or combinations thereof. In some embodiments, RTSM modulated MDA5 protein production can be compared to MDA5 protein production in the absence of RTSM as determined by an in vitro assay. [0132] In some embodiments, the cell, organ, or subject can be evaluated to determine if appropriate for the methods and compositions described herein. Methods of determining exon skipping, mRNA modulation, protein expression, or MDA5 modulation are described, such as in the Examples, herein. Other non-limiting assays to determine gene expression, exon skipping and MDA5 expression include quantitative PCR (qPCR), including but not limited to PCR, real-time PCR (e.g., Sybr-green), and/or hot PCR. In some cases, expression of one or more genes can be measured by detecting the level of transcripts of the genes. Exon skipping can be measured by detecting the expression of the processed m-RNA. Expression of functional MDA5 protein can be measured by detecting the level or length of the protein, or by an assay that measures its biological activity. For example, expression can be measured by Northern blotting, nuclease protection assays (e.g., RNase protection assays), reverse transcription PCR, quantitative PCR (e.g., real-time PCR such as real-time quantitative reverse transcription PCR), in situ hybridization (e.g., fluorescent in situ hybridization (FISH)), dot-blot analysis, differential display, serial analysis of gene expression, subtractive hybridization, microarrays, nanostring, and/or sequencing (e.g., next-generation sequencing) Expression can be measured by protein immunostaining, protein immunoprecipitation, electrophoresis (e.g., SDS-PAGE), Western blotting, bicinchoninic acid assay, spectrophotometry, mass spectrometry, enzyme assays (e.g., enzyme-linked immunosorbent assays), immunohistochemistry, flow cytometry, and/or immunocytochemistry. Expression of one or more genes can also be measured by microscopy. The microscopy can be optical, electron, or scanning probe microscopy. Optical microscopy can comprise use of bright field, oblique illumination, cross-polarized light, dispersion staining, dark field, phase contrast, differential interference contrast, interference reflection microscopy, fluorescence (e.g., when particles, e.g., cells, are immunostained), confocal, single plane illumination microscopy, light sheet fluorescence microscopy, deconvolution, or serial time-encoded amplified microscopy. Methods [0133] Disclosed herein are, among other disclosures, are methods of exon skipping, modulating IFIH1 pre-mRNA expression, modulating MDA5 protein expression, and prophylaxis/treatment of: MDA5- mediated conditions, inflammatory disorders, autoimmune diseases, IFN-1-mediated autoimmune diseases, and any combination thereof. [0134] In some embodiments, the disclosed compositions and methods result in a truncated MDA5 protein. In some embodiments, the disclosed compositions and methods result in a decrease in the wild-type MDA5 protein. In some embodiments, the disclosed compositions and methods result in modulating the splicing of IFIH1 pre-mRNA. In some embodiments, the disclosed compositions and methods result in IFIH1 mRNA lacking exon 14 or a portion thereof. In some embodiments, IFIH1 expression can be modulated compared to a control. A control can be wild-type or non wild-type control. Controls can be positive or negative controls. Methods of modulating IFIH1 expression [0135] Disclosed herein are methods to increase exon skipping of an IFIH1 mRNA comprising contacting a IFIH1 pre-mRNA with an RTSM as disclosed herein, and allowing modulated splicing to occur. In some embodiments, RTSMs herein can increase the level of modulated IFIH1 mRNA transcripts as compared to mRNA transcripts processed in the absence of RTSM wherein a mRNA transcript modulation comprises a decrease in full-length IFIH1 mRNA transcript, an increase in truncated IFIH1 mRNA transcript, an increase in an IFIH1 mRNA transcript lacking coding for one or more exons, or any combination thereof. [0136] In some embodiments, the increase in modulated mRNA transcript processing can be about: 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a non-contacted control. In certain embodiments, the increase in modulated mRNA transcript processing can be about: 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to a non-contacted control. [0137] Disclosed herein are methods to increase MDA5 protein modulation comprising contacting an IFIH1 pre-mRNA with an RTSM as disclosed herein, allowing modulated splicing to occur generating a modulated mRNA, and allowing translation to occur, wherein MDA5 protein expression can be modulated compared to a non-contacted control. In some embodiments, modulated MDA5 protein expression comprises a decrease of the level of functional MDA5 protein, an increase of expression of truncated MDA5 protein, decrease of expression of functional MDA5 protein, or inhibition of expression of functional MDA5 protein, and any combination thereof compared to a non-contacted control. [0138] In certain embodiments, the increase in modulated MDA5 protein production can be about: 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a non-contacted control. In certain embodiments, the increase in modulated MDA5 protein expression can be by about: 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to a non-contacted control. Methods of Treating Diseases and Conditions [0139] Disclosed herein are methods of prophylaxis/treatment of inflammatory disorders. In some embodiments, the disclosed herein relates to methods of prophylaxis/treatment of inflammatory disorders, MDA5-associated conditions, autoimmune diseases, or an IFN-1-mediated autoimmune disease. Disclosed herein are methods of treatment comprising administering to a subject in need thereof an effective amount of IFIH1 RTSM, or a pharmaceutical composition comprising the same. In some embodiments, the disclosure provides a method for inducing exon skipping to decrease the level of functional MDA5 in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. [0140] In some embodiments, the disclosure provides a method for increasing the level of exon modulated IFIH1 mRNA in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing the level of functional MDA5 in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing the level of functional MDA5 to decrease IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing interferon ȕ (IFN-ȕ) production to decrease in IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. ,Q^VRPH^HPERGLPHQWV^^WKH^GLVFORVXUH^SURYLGHV^D^PHWKRG^IRU^GHFUHDVLQJ^LQWHUIHURQ^Į^^,)1-Į^^ production to decrease IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. In some embodiments, the disclosure provides a method for decreasing interferon Ȗ^(IFN-Ȗ) production to decrease IFN-1 signaling in a subject in need thereof comprising administering to the subject a dose of IFIH1 RTSM. [0141] In some embodiments, treatment with a RTSM of the disclosure increases one or more exon- modulated IFIH1 mRNA production, decreases full length IFIH1 mRNA production, decreases functional MDA5 production, decreases full-length MDA5 protein production, increases truncated MDA5 production, decreases IFN- ȕ production, decreases IFN-Ȗ production, decreases IFN-Į^SURGXFWLRQ^^GHFUHDVHV^,)1-1 signaling, prevents disease development, delays disease progression, ameliorates disease symptoms, decreases auto-immunity, reduces tissue inflammation, reduces tissue damage, and any combination thereof, to be expected in the absence of treatment with a RTSM. [0142] In one embodiment, the method disclosed herein can be useful treat subject who is suffering from or is at a risk of developing an inflammatory disorder. "Inflammatory disorder" can mean an immune- mediated inflammatory condition, generally characterized by dysregulated expression of one or more cytokines. Examples of inflammatory disease include skin inflammatory disorders, inflammatory disorders of the joints, and inflammatory disorders of the cardiovascular system, autoimmune diseases, lung and airway inflammatory disorders, intestinal inflammatory disorders. Examples of skin inflammatory disorders include dermatitis, for example atopic dermatitis and contact dermatitis, acne vulgaris, and psoriasis. Examples of inflammatory disorders of the joints include rheumatoid arthritis. Examples of inflammatory disorders of the cardiovascular system are cardiovascular disease and atherosclerosis. Examples of autoimmune diseases include Type 1 diabetes, Graves’ disease, Guillain-Barre disease, Lupus, Psoriatic arthritis, and Ulcerative colitis. Examples of lung and airway inflammatory disorders include asthma, cystic fibrosis, COPD, emphysema, and acute respiratory distress syndrome. Examples of intestinal inflammatory disorders include colitis and inflammatory bowel disease. Other inflammatory disorders include cancer, hay fever, periodontitis, allergies, hypersensitivity, ischemia, depression, systemic diseases, post infection inflammation, amyotrophic lateral sclerosis and bronchitis. [0143] In some embodiments, inflammatory disorder comprises MDA5-associated conditions, autoimmune diseases, or an IFN-1 mediated autoimmune disease. [0144] In one embodiment, the present disclosure can be useful to treat a subject who is suffering from or at the risk of developing an MDA5 associated condition. An MDA5 associated condition is a disorder generally characterized by dysregulated expression of MDA5 protein, wherein the MDA5 protein can over- expressed or over-functional. In other embodiments, an MDA5 associated condition may result from wild- type expression of the MDA5 protein in addition to other predispositions, such as for an inflammatory disorder or an autoimmune disease. [0145] In some embodiments, a MDA5 associated condition can be selected from the group consisting of Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D), Aicardi-Goutieres Syndrome (AGS), Singleton-Merten Syndrome, Primary SS, Inflammatory Myositis, Scleroderma, and Rheumatoid Arthritis (RA). [0146] Exemplary autoimmune diseases include, but are not limited to, organ specific disorders such as Hashimoto's thyroiditis, primary myxoedema thyrotoxicosis, pernicious anemia, Addison's disease, and insulin-dependent diabetes mellitus as well as non-organ specific disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis, dermatomyositis, scleroderma and psoriasis. Non-limiting examples of autoimmune disorders treatable with RTSM or pharmaceutical composition of the disclosure include Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D), Aicardi-Goutieres Syndrome (AGS), Singleton-Merten Syndrome, Primary SS, Inflammatory Myositis, Scleroderma, and Rheumatoid Arthritis (RA). Non-limiting examples of inflammation treatable with an RTSM composition of the present disclosure include inflammatory interferon signaling, such as by IFN-1. [0147] In one embodiment, the method disclosed herein can be useful treat subject who is suffering from or is at a risk of developing an IFN-1 mediated autoimmune disease. An "IFN-1 mediated autoimmune disease" can be an auto-immune disease generally characterized by dysregulated expression of proinflamPDWRU\^PROHFXOHV^^ LQWHUIHURQ^Į^^ LQWHUIHURQ^ Ȗ, and interferon ȕ, and an increase in type 1 IFN signaling. IFN-1 mediated autoimmune diseases include SLE, pSS, myositis, scleroderma, and RA. [0148] In some embodiments, treatment with an RTSM of the disclosure increases in truncated IFIH1 mRNA transcript production, decreases full length IFIH1 mRNA transcript production, decreases functional MDA5 production, decreases full-length MDA5 protein production, increases truncated MDA5 production, decreases IFN-ȕ production, decreases IFN-Į^ SURGXFWLRQ^^ GHFUHDVHV^ IFN-Ȗ production, decreases IFN-1 signaling, prevents disease development, delays disease progression, ameliorates disease symptoms, decreases auto-immunity, reduces tissue inflammation, reduces tissue damage, any combination thereof to be expected in the absence of treatment with a RTSM as demonstrated in an in vitro assay. [0149] In certain embodiments, the method increases truncated IFIH1 mRNA transcript production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0150] In certain embodiments, the method decreases full-length IFIH1 mRNA production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0151] In certain embodiments, the method decreases functional MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0152] In certain embodiments, the method decreases full-length MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0153] In certain embodiments, the method increases truncated MDA5 production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0154] In certain embodiments, the method decreases MDA5 signaling by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0155] In certain embodiments, the method decreases IFN- Į^SURGXFWLRQ^E\^0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0156] In certain embodiments, the method decreases IFN-ȕ production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0157] In certain embodiments, the method decreases IFN-Ȗ production by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0158] In certain embodiments, the method decreases IFN-1 signaling by 0.1%, 0.2% 0.3% 0.5%, 0.7%, 0.9%, 1%, 1.01%, 1.5%, 2%, 2.01%, 2.5%, 3%, 3.01%, 3.5%, 4%, 4.01%, 4.5%, 5%, 5.01%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 40%, 45%, 50%, 55%, or 60% or more relative to a untreated control. [0159] In some embodiments, the disease can be T1D. In some embodiments, the disease can be SLE. In some embodiments, biological markers may be utilized to characterize development, progression, and symptoms of a disease disclosed herein. For example, in one embodiment, wherein the disease is T1D, the biological markers include but are not limited to blood glucose level, insulitis, serum IFN-Į, serum IFN-Ȗ and serum IFN-ȕ. In other embodiments, wherein the disease is SLE the biological markers include but are not limited to antinuclear antibody, serum IFN-Į, serum IFN-Ȗ and serum IFN-ȕ. [0160] In some embodiments, the method further comprises evaluating a subject prior to RTSM administration to determine whether the subject is suitable for the treatment. In some embodiments, evaluating a subject can be determination of mutations of an IFIH1 gene, increased MDA5 protein expression compared to a wild-type control, increased MDA5 functionality compared to a wild-type control, and any combination thereof. Methods of Administration [0161] As disclosed in further detail below, the formulations or preparations herein may be given orally, parenterally, systemically, topically, rectally or intramuscular administration. They can be given in a form suitable for each administration route. For example, they can be administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. [0162] Regardless of the route of administration selected, formulations herein may conveniently be presented in unit dosage form. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingredient, from about 5 percent to about 70 percent, or from about 10 percent to about 30 percent. [0163] The selected dosage level will depend upon a variety of factors including the activity of the particular RTSM herein the route of administration, the time of administration, the rate of excretion or metabolism of the particular RTSM being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular oligomer employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. [0164] In general, a suitable daily dose of a compound herein will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. Generally, oral, intravenous, intracerebroventricular, intramuscular and subcutaneous doses of the compounds herein for a patient, when used for the indicated effects, will range from about 0.0001 to about 100 mg per kilogram of body weight per day. [0165] In some embodiments wherein an RTSM can be an ASO, doses of an ASO herein can be generally administered is from about 0.001 mg/kg to about 1000 mg/kg, wherein mg is mg of RTSM and kg is the body weight of the subject. For example, 0.001 mg/kg to about 1 mg/kg, 1-20 mg/kg, 20-40 mg/kg, 40- 60mg.kg, 60-80 mg/kg, or 80-100 mg/kg. For i.v. administration, preferred doses are from about 0.5 mg to 100 mg/kg. In some embodiments, an ASO can be administered at doses of about: 0.001 mg/kg, 0.01 mg/kg, 0.1 mg/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 21 mg/kg, 22mg/kg, 23 mg/kg, 24mg/kg, 25 mg/kg, 26 mg/kg, 27 mg/kg, 28 mg/kg, 29 mg/kg, 30 mg/kg, 31 mg/kg, 32 mg/kg, 33 mg/kg, 34 mg/kg, 35 mg/kg, 36 mg/kg, 37 mg/kg, 38 mg/kg, 39 mg/kg, 40 mg/kg, 41 mg/kg, 42 mg/kg, 43 mg/kg, 44 mg/kg, 45 mg/kg, 46 mg/kg, 47 mg/kg, 48 mg/kg, 49 mg/kg 50 mg/kg, 51 mg/kg, 52 mg/kg, 53 mg/kg, 54 mg/kg, 55 mg/kg, 56 mg/kg, 57 mg/kg, 58 mg/kg, 59 mg/kg, 60 mg/kg, 65 mg/kg, 70 mg/kg, 75 mg/kg, 80 mg/kg, 85 mg/kg, 90 mg/kg, 95 mg/kg, 100 mg/kg, including all integers in between. [0166] If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. In certain situations, dosing is one administration per day. In certain embodiments, dosing is one or more administration per every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, as needed, to maintain the desired expression of an IFIH1 pre-mRNA and/or MDA5 protein. An RTSM may be administered in continuously or in cycles. [0167] In some embodiments, an RTSM of the present disclosure can be administered, generally at regular intervals (e.g., daily, weekly, biweekly, monthly, bimonthly). An RTSM may be administered at regular intervals, e.g., daily; once every two days; once every three days; once every 3 to 7 days; once every 3 to 10 days; once every 7 to 10 days; once every week; once every two weeks; once monthly. For example, an RTSM may be administered once weekly by intravenous infusion. An RTSM may be administered intermittently over a longer period of time, e.g., for several weeks, months or years. For example, an RTSM may be administered once every one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve months. In addition, an RTSM may be administered once every one, two, three, four or five years. Administration may be followed by, or concurrent with, co-administration with a second agent, for example with an antibiotic, steroid or other therapeutic agent. The treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment. [0168] When co-administered with one or more other therapies, an RTSM of the disclosure may be administered either simultaneously with the other treatment(s), or sequentially in any order and can be temporally spaced up to several days apart. Pharmaceutical Compositions and Dosage Forms [0169] Disclosed herein, in certain embodiments, are pharmaceutical compositions comprising an RTSM described herein and a carrier thereof for administration in a subject. [0170] In certain embodiments, the pharmaceutically acceptable compositions comprise a therapeutically- effective amount of one or more of an RTSM, formulated together with one or more pharmaceutically acceptable: carriers (additives) and/or diluents. In some embodiments, when an RTSM herein are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99%, or 10 to 30% of an RTSM in combination with a pharmaceutically acceptable carrier. [0171] A pharmaceutical composition of the present disclosure can be delivered, e.g., subcutaneously or intravenously with a standard needle and syringe or a pen delivery device. [0172] The injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc. The injectable preparations may be prepared, e.g., by dissolving, suspending or emulsifying an RTSM herein in a sterile aqueous medium or an oily medium conventionally used for injections. As the aqueous medium for injections, there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc. As the oily medium, there are employed, e.g., sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. The injection thus prepared can befilled in an appropriate ampoule. [0173] Compositions of the present disclosure can be in the form of, for example, granules, powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions. The amount of the aforesaid antibody contained can be about 5 to about 500 mg per dosage form in a unit dose. In one embodiment, an RTSM can be contained in about in about 5 to about 100 mg, for example for a parental dosage form. In other embodiments, an RTSM can be contained in about 10 to about 250 mg for the other dosage forms. [0174] For example, oral, buccal, and sublingual administration, powders, suspensions, granules, tablets, pills, capsules, gelcaps, and caplets can be used as solid dosage forms. These can be prepared, for example, by mixing an RTSM, with at least one additive such as a starch or other additive. Suitable additives are sucrose, lactose, cellulose sugar, mannitol, maltitol, dextran, starch, agar, alginates, chitins, chitosans, pectins, tragacanth gum, gum arabic, gelatins, collagens, casein, albumin, synthetic or semi-synthetic polymers or glycerides. Optionally, oral dosage forms can contain other ingredients to aid in administration, such as an inactive diluent, or lubricants such as magnesium stearate, or preservatives such as paraben or sorbic acid, or anti-oxidants such as ascorbic acid, tocopherol or cysteine, a disintegrating agent, binders, thickeners, buffers, sweeteners, flavoring agents or perfuming agents. Tablets and pills may be further treated with suitable coating materials known in the art. [0175] Liquid dosage forms for oral administration may be in the form of pharmaceutically acceptable emulsions, syrups, elixirs, suspensions, and solutions, which may contain an inactive diluent, such as water. In some embodiments, pharmaceutical formulations and medicaments may be prepared as liquid suspensions or aqueous solutions, for example, using a sterile liquid, such as, but not limited to, an oil, water, an alcohol, and combinations of these. In some embodiments, pharmaceutical compositions can be prepared in a lyophilized form. The lyophilized preparations can comprise a cryoprotectant known in the art. The term “cryoprotectants” as used herein generally includes agents, which provide stability to the protein from freezing-induced stresses. Examples of cryoprotectants include polyols such as, for example, mannitol, and include saccharides such as, for example, sucrose, as well as including surfactants such as, for example, polysorbate, poloxamer or polyethylene glycol, and the like. Cryoprotectants also contribute to the tonicity of the formulations. Pharmaceutically suitable surfactants, suspending agents, emulsifying agents, may be added for oral or par- enteral administration. [0176] As noted above, suspensions may include oils. Such oils include, but are not limited to, peanut oil, sesame oil, cottonseed oil, corn oil and olive oil. Suspension preparation may also contain esters of fatty acids such as ethyl oleate, isopropyl myristate, fatty acid glycerides and acetylated fatty acid glycerides. Suspension formulations may include alcohols, such as, but not limited to, ethanol, iso- propyl alcohol, hexadecyl alcohol, glycerol and propylene glycol. Ethers, such as but not limited to, poly(ethyleneglycol), petroleum hydrocarbons such as mineral oil and petrolatum; and water may also be used in suspension formulations. [0177] For nasal administration, the pharmaceutical formulations and medicaments may be a spray or aerosol containing an appropriate solvent(s) and optionally other compounds such as, but not limited to, stabilizers, antimicrobial agents, antioxidants, pH modifiers, surfactants, bio- availability modifiers and combinations of these. A propellant for an aerosol Formulation may include compressed air, nitrogen, carbon dioxide, or a hydrocarbon based low boiling solvent. [0178] Injectable dosage forms generally include aqueous suspensions or oil suspensions which may be prepared using a suitable dispersant or wetting agent and a suspending agent. Injectable forms may be in solution phase or in the form of a suspension, which can be prepared with a solvent or diluent. Acceptable solvents or vehicles include sterilized water, Ringer's solution, or an isotonic aqueous saline solution. Alternatively, sterile oils may be employed as solvents or suspending agents. The oil or fatty acid can be non-volatile, including natural or synthetic oils, fatty acids, mono-, di- or tri-glycerides. [0179] For injection, the pharmaceutical formulation and/ or medicament may be a powder suitable for reconstitution with an appropriate solution as described above. Examples of these include, but are not limited to, freeze dried, rotary dried or spray dried powders, amorphous powders, granules, precipitates, or particulates. For injection, the formulations may optionally contain stabilizers, pH modifiers, surfactants, bioavailability modifiers and combinations of these. [0180] For rectal administration, the pharmaceutical formulations and medicaments may be in the form of a suppository, an ointment, an enema, a tablet or a cream for release of compound in the intestines, sigmoid flexure and/or rectum. Rectal suppositories are prepared by mixing one or more compounds herein with acceptable vehicles, for example, cocoa butter or polyethylene glycol, which is present in a solid phase at normal storing temperatures, and present in a liquid phase at those temperatures suitable to release a drug inside the body, such as in the rectum. Oils may also be employed in the preparation of formulations of the soft gelatin type and suppositories. Water, saline, aqueous dextrose and related sugar solutions, and glycerols may be employed in the preparation of suspension formulations which may also contain suspending agents such as pectins, carbomers, methyl cellulose, hydroxypropyl cellulose or carboxymethyl cellulose, as well as buffers and preservatives. [0181] The concentration of an RTSM in these compositions can vary widely, e.g., from less than about 10%, least about 25% to as much as 75% or 90% by weight and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected. [0182] In some embodiments, pharmaceutical compositions comprising an RTSM described herein can be formulated using one or more physiologically acceptable carriers including excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. [0183] Pharmaceutical compositions are optionally manufactured such as, by way of example only, by means of mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes. [0184] In certain embodiments, compositions may also include one or more pH adjusting agents or buffering agents, including acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range. In other embodiments, compositions may also include one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate. [0185] In some embodiments, sustained-release preparations can be used. Suitable examples of sustained- release preparations include semipermeable matrices of solid hydrophobic polymers containing an antibody or antigen binding fragment of the present disclosure, in which the matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and y ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they can denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S--S bond formation through thiodisulfide interchange, stabilization can be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions. In certain situations, the pharmaceutical composition can be delivered in a controlled release system. In one embodiment, a pump may be. In another embodiment, polymeric materials can be used. In yet another embodiment, a controlled release system can be placed in proximity of the composition's target, thus requiring only a fraction of the systemic dose. [0186] In some embodiments, an RTSM can be administered with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier. In some embodiments, an RTSM can be linked with a viral vector, e.g., to render an RTSM more effective or increase transport across the blood-brain barrier. For example, delivery of agents can be by administration of an adenovirus vector to motor neurons in muscle tissue. Delivery of vectors directly to the brain, include but are not limited to the striatum, the thalamus, the hippocampus, or the substantia nigra. [0187] In embodiments, an RTSM can be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties. In some embodiments, an RTSM can be coupled to a substance that promotes penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor. In some embodiments, osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(- ) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids, e.g., glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. In some embodiments, the composition can be encapsulated in glucose-coated polymeric nanocarriers. Second Agent [0188] The compositions herein may be administered alone or in combination with another therapeutic. The additional therapeutic may be administered prior, concurrently or subsequently to the administration of the composition. [0189] The compositions disclosed herein, comprising an RTSM, described herein, can also contain more than one active agent as necessary for the particular indication being treated, and include those with complementary activities that do not adversely affect each other. For example, the composition can further comprise an anti-inflammatory, a therapeutic protein, a steroid, an analgesic, a non-steroidal anti- inflammatory, a corticosteroid, and combinations thereof. For example, the compositions may be administered in combination with a steroid and/or an antibiotic. The steroid may be a glucocorticoid or prednisone. Glucocorticoids such as cortisol control carbohydrate, fat and protein metabolism, and are anti- inflammatory by preventing phospholipid release, decreasing eosinophil action and a number of other mechanisms. Mineralocorticoids such as aldosterone control electrolyte and water levels, mainly by promoting sodium retention in the kidney. Corticosteroids are a class of chemicals that includes steroid hormones naturally produced in the adrenal cortex of vertebrates and analogues of these hormones that are synthesized in laboratories. Corticosteroids are involved in a wide range of physiological processes, including stress response, immune response, and regulation of inflammation, carbohydrate metabolism, protein catabolism, blood electrolyte levels, and behavior. Corticosteroids include Betamethasone, Budesonide, Cortisone, Dexamethasone, Hydrocortisone, Methylprednisolone, Prednisolone, and Prednisone. [0190] Such molecules are suitably present in combination in amounts that are effective for the purpose intended. The active ingredients of the compositions comprising an antibody or antigen binding fragment thereof described herein can also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microparticle, microemulsions, nano-particles and nanocapsules) or in macroemulsions. The pharmaceutical composition can be also delivered in a vesicle, in particular a liposome. Liposomes include emulsions, foams, micelles, insoluble monolayers, phospholipid dispersions, lamellar layers and the like, and can serve as vehicles to target the M-CSF antibodies to a particular tissue as well as to increase the half life of the composition. [0191] Liposomes containing an RTSM, the second active compound or both can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. RTSMs herein can be conjugated to liposomes via a disulfide interchange reaction. The second agent can be optionally contained within the liposome. [0192] In some embodiments, the second agent may be formulated with the compositions described herein or separately co-administered. Further Embodiments [0193] In some embodiments, described herein, is a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0194] In some embodiments, described herein, is a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0195] In some embodiments, described herein, is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA. [0196] As used herein, the terms "ASO" and "antisense oligomer" are used interchangeably and refer to an oligomer such as a polynucleotide, comprising nucleobases that hybridizes to a target nucleic acid (e.g., a IFIH1 containing pre-mRNA) sequence by Watson-Crick base pairing or wobble base pairing (G-U). The ASO may have exact sequence complementary to the target sequence or near complementarity (e.g., sufficient complementarity to bind the target sequence and modulating splicing at a splice site). ASOs are designed so that they bind (hybridize) to a target nucleic acid (e.g., a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Typically, if they hybridize to a site other than the intended (targeted) nucleic acid sequence, they hybridize to a limited number of sequences that are not a target nucleic acid (to a few sites other than a target nucleic acid). Design of an ASO can take into consideration the occurrence of the nucleic acid sequence of the targeted portion of the pre-mRNA transcript or a sufficiently similar nucleic acid sequence in other locations in the genome or cellular pre- mRNA or transcriptome, such that the likelihood the ASO will bind other sites and cause "off-target" effects is limited. [0197] In some embodiments, ASOs "specifically hybridize" to or are "specific" to a target nucleic acid or a targeted portion of a pre-mRNA. Typically such hybridization occurs with a Tm substantially greater than 37oC, preferably at least 50 oC, and typically between 60 oC to approximately 90 oC. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide. [0198] Oligomers, such as oligonucleotides, are "complementary" to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A double-stranded polynucleotide can be "complementary" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree to which one polynucleotide is complementary with another) is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules. The sequence of an antisense oligomer (ASO) need not be 100% complementary to that of its target nucleic acid to hybridize. In certain embodiments, ASOs can comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted. For example, an ASO in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered together or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percent complementarity of an ASO with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul, et al., J. Mol. Biol., 1990, 215, 403- 410; Zhang and Madden, Genome Res., 1997, 7, 649-656). [0199] An ASO need not hybridize to all nucleobases in a target sequence and the nucleobases to which it does hybridize may be contiguous or noncontiguous. ASOs may hybridize over one or more segments of a pre-mRNA transcript, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed). In certain embodiments, an ASO hybridizes to noncontiguous nucleobases in a target pre-mRNA transcript. For example, an ASO can hybridize to nucleobases in a pre-mRNA transcript that are separated by one or more nucleobase(s) to which the ASO does not hybridize. [0200] The ASOs described herein comprise nucleobases that are complementary to nucleobases present in a targeted portion of a pre-mRNA. The term ASO embodies oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of hybridizing to a complementary nucleobase on a target mRNA but does not comprise a sugar moiety, such as a peptide nucleic acid (PNA). The ASOs may comprise naturally-occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the preceding. The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and/or having a modified backbone. In some embodiments, all of the nucleotides of the ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the methods and compositions described herein will be evident to one of skill in the art and can be found, for example, in U.S. Pat. No. 8,258,109, U.S. Pat. No. 5,656,612, U.S. Patent Publication No. 2012/0190728, and Dias and Stein, Mol. Cancer Ther. 2002, 347-355, herein incorporated by reference in their entirety. [0201] One or more nucleobases of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA. Examples of modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5- hydroxymethoylcytosine. [0202] The ASOs described herein also comprise a backbone structure that connects the components of an oligomer. The term "backbone structure" and "oligomer linkages" may be used interchangeably and refer to the connection between monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of the oligomer. The backbone structure or oligomer linkages of the ASOs described herein may include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. See, e.g., LaPlanche, et al., Nucleic Acids Res.14:9081 (1986); Stec, et al., J. Am. Chem. Soc. 106:6077 (1984), Stein, et al., Nucleic Acids Res. 16:3209 (1988), Zon, et al., Anti-Cancer Drug Design 6:539 (1991); Zon, et al., Oligonucleotides and Analogues: A Practical Approach, pp.87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)); Stec, et al., U.S. Pat. No. 5,151,510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990). In some embodiments, the backbone structure of the ASO does not contain phosphorous but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphothioate linkage. In some embodiments, the backbone modification is a phosphoramidate linkage. [0203] Any of the ASOs described herein may contain a sugar moiety that comprises ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog, including a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O- guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the sugar moiety modification is selected from 2'-O-Me, 2'F, and 2'MOE. In some embodiments, the sugar moiety modification is an extra bridge bond, such as in a locked nucleic acid (LNA). In some embodiments the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification. In some embodiments, the sugar moiety comprises 2'4'-constrained 2'O-methyloxyethyl (cMOE) modifications. In some embodiments, the sugar moiety comprises cEt 2', 4' constrained 2'-O ethyl BNA modifications. In some embodiments, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some embodiments, the sugar moiety comprises ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety comprises MCE modifications. Modifications are known in the art and described in the literature, e.g., by Jarver, et al., 2014, "A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications," Nucleic Acid Therapeutics 24(1): 37-47, incorporated by reference for this purpose herein. [0204] In some embodiments, each monomer of the ASO is modified in the same way, for example each linkage of the backbone of the ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification. Such modifications that are present on each of the monomer components of an ASO are referred to as "uniform modifications." In some examples, a combination of different modifications may be desired, for example, an ASO may comprise a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos). Combinations of different modifications to an ASO are referred to as "mixed modifications" or "mixed chemistries." [0205] In some embodiments, the ASO comprises one or more backbone modifications. In some embodiments, the ASO comprises one or more sugar moiety modification. In some embodiments, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some embodiments, the ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises a phosphorodiamidate morpholino (PMO). In some embodiments, the ASO comprises a peptide nucleic acid (PNA). Any of the ASOs or any component of an ASO (e.g., a nucleobase, sugar moiety, backbone) described herein may be modified in order to achieve desired properties or activities of the ASO or reduce undesired properties or activities of the ASO. For example, an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (i.e., RNase H); improve uptake of the ASO into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; and/or modulate the half-life of the ASO. [0206] In some embodiments, the ASOs are comprised of 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides. ASOs comprised of such nucleotides are especially well-suited to the methods disclosed herein; oligomers having such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery in some embodiments described herein. See e.g., Geary, et al., J Pharmacol Exp Ther.2001; 296(3):890-7; Geary, et al., J Pharmacol Exp Ther.2001; 296(3):898-904. [0207] Methods of synthesizing ASOs will be known to one of skill in the art. Alternatively or in addition, ASOs may be obtained from a commercial source. [0208] Described, herein are compositions and methods useful for treating autoimmune diseases. In some embodiments, these compositions and methods result in a truncated MDA5 protein. In some embodiments, these compositions and methods result in a decrease in the wild-type MDA5 protein. In some embodiments, the compositions and methods result in modulating the splicing of IFIH1 RNA. In some embodiments, the compositions and methods result in an IFIH1 RNA lacking exon 14. [0209] In some embodiments, disclosed herein is a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0210] In some embodiments, the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA. In some embodiments, the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA. In some embodiments, the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA. In some embodiments, the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA. In some embodiments, the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID NO:64. In some embodiments, the 5’ splice site comprises the sequence of SEQ ID No: 64. In some embodiments, the 5’ splice site comprises complement of the sequence of SEQ ID No: 64. In some embodiments, the 5’ splice site comprises the inverse complement of the sequence of SEQ ID No: 64. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139. In some embodiments, the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139. [0211] In some embodiments, disclosed herein is a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. In some embodiments, the autoimmune diseases is selected from the group consisting of type 1 diabetes mellitus and systemic lupus erythematosus. In some embodiments, the autoimmune disease is systemic lupus erythematosus. In some embodiments, the autoimmune disease is type 1 diabetes mellitus. [0212] In some embodiments, disclosed herein is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA. [0213] In some embodiments, the therapeutic agent is an antisense oligomer (ASO) and wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identity to SEQ ID NO: 139 or 172. [0214] In some embodiments, the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage. In some embodiments, the ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, a 2'-Fluoro, or a 2'-O- methoxyethyl moiety. In some embodiments, the ASO comprises at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety. In some embodiments, the ASO consists of from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases. In some embodiments, the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, complementary to the targeted portion of the IFIH1 mRNA encoding the MDA5 protein. In some embodiments, the method further comprises assessing IFIH1 mRNA or MDA5 protein expression. In some embodiments, the cells are ex vivo. [0215] In some embodiments, the therapeutic agent is administered to the subject by intravitreal injection, intrathecal injection, intraperitoneal injection, subcutaneous injection, intravenous injection, subretinal injection, intracerebroventricular injection, intramuscular injection, topical application, or implantation. [0216] In some embodiments, the therapeutic agent is administered with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier by any method known in the art. In some embodiments, the therapeutic agent is linked with a viral vector, e.g., to render the therapeutic agent more effective or increase transport across the blood-brain barrier. For example, delivery of agents by administration of an adenovirus vector to motor neurons in muscle tissue is described in U.S. Pat. No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons," incorporated herein by reference. Delivery of vectors directly to the brain, e.g., the striatum, the thalamus, the hippocampus, or the substantia nigra, is described, e.g., in U.S. Pat. No.6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain," incorporated herein by reference. [0217] In embodiments, the therapeutic agent is linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties. In some embodiments, the therapeutic agent is coupled to a substance, known in the art to promote penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor. In some embodiments, osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids, e.g., glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood brain barrier penetration are described, e.g., in U.S. Pat. No.9,193,969, "Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types," U.S. Pat. No. 4,866,042, "Method for the delivery of genetic material across the blood brain barrier," U.S. Pat. No. 6,294,520, "Material for passage through the blood-brain barrier," and U.S. Pat. No. 6,936,589, "Parenteral delivery systems," each incorporated herein by reference. [0218] In some embodiments, the therapeutic agent is encapsulated in glucose-coated polymeric nanocarriers, such as those described in Min et al. “Systemic Brain Delivery of Antisense Oligonucleotides across the Blood–Brain Barrier with a Glucose-Coated Polymeric Nanocarrier,” Angew. Chem. Int. Ed. 2020, 59, 8173-8180, incorporated herein by reference. [0219] In some embodiments, disclosed herein is a method of decreasing expression of full length MDA5 protein comprising contacting a IFIH1 RNA with a therapeutic agent that binds to a portion of the IFIH1 RNA, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0220] In some embodiments, wherein the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA. [0221] In some embodiments, wherein the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA. [0222] In some embodiments, wherein the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA. [0223] In some embodiments, wherein the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64. [0224] In some embodiments, wherein the therapeutic agent is an antisense oligonucleotide (ASO). [0225] In some embodiments, wherein the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139. [0226] In some embodiments, wherein the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139. [0227] In some embodiments, disclosed herein is a method of treating an autoimmune disease comprising administering a therapeutic agent that binds to a portion of a IFIH1 RNA to a subject, whereby the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0228] In some embodiments, wherein the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA. [0229] In some embodiments, wherein the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA. [0230] In some embodiments, wherein the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA. [0231] In some embodiments, wherein the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64. [0232] In some embodiments, wherein the therapeutic agent is an antisense oligonucleotide (ASO). [0233] In some embodiments, wherein the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139. [0234] In some embodiments, wherein the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139. [0235] In some embodiments, wherein the autoimmune diseases is selected from the group consisting of type 1 diabetes mellitus and systemic lupus erythematosus. [0236] In some embodiments, wherein the autoimmune diseases is systemic lupus erythematosus. [0237] In some embodiments, disclosed herein is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a IFIH1 RNA. [0238] In some embodiments, wherein the therapeutic agent causes skipping of an exon in the IFIH1 RNA that is spliced in the absence of the therapeutic agent. [0239] In some embodiments, wherein the therapeutic agent causes skipping of exon 14 in the IFIH1 RNA. [0240] In some embodiments, wherein the therapeutic agent binds to a 5’ splice site sequence in the IFIH1 RNA. [0241] In some embodiments, wherein the therapeutic agent binds to the 5’ splice site sequence is in Intron 14 of the IFIH1 RNA [0242] In some embodiments, wherein the 5’ splice site comprises a sequence with at least 95% sequence identity to SEQ ID No: 64. [0243] In some embodiments, wherein the therapeutic agent is an antisense oligonucleotide (ASO). [0244] In some embodiments, wherein the ASO comprises a sequence that is at least about 80% identity to SEQ ID NO: 139. [0245] In some embodiments, wherein the ASO comprises a sequence that is at least about 90% identity to SEQ ID NO: 139. [0246] In some embodiments, nucleobases corresponding to the abbreviations in various nucleobase sequences disclosed herein can be found in Table 9A below. Table 9A: Nucleobase Abbreviations
Figure imgf000090_0001
[0247] In some embodiments, amino acids corresponding to the abbreviations in various polypeptide sequences disclosed herein can be found, for example, in Table 9B below. Table 9B: Amino Acid Abbreviations
Figure imgf000090_0002
Figure imgf000091_0001
EXAMPLES [0248] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. ASOs described herein can be synthesized using synthetic techniques, using methods described herein or combinations of both. Alternatively, ASOs are available commercially from various sources, including Integrated DNA Technologies (IDT), Coralville, Iowa and GeneTools, LLC. Example 1: IFIH1 splicing modulation in epithelial cells [0249] HuTu80 cells (ATCC® HTB-40™) were plated at a concentration of 400,000 cells/well in a 24-well plate and cultured according to ATCC recommendations for 24 hours. [0250] ASOs with morpholino-modified backbones were transfected individually into each well using EndoPorter (Gene-Tools, LLC at 6ul/ml). Each ASO was at a 1mM (1000uM) stock concentration and was added to the wells to achieve final concentrations of 6uM (3ul/well), 9uM (4.5ul/well), 12uM (6ul/well) and 15uM (7.5ul/well). NTC is a non-targeting control, CONT is an ASO that targets IFIH1 at the Exon6- Intron6 boundary and IFIH14 is an ASO that targets the 5’ splice site of intron 14 of an IFIH1 pre-mRNA. The sequences of the ASOs used are set forth below in Table 10. Table 10. ASO sequences
Figure imgf000092_0001
[0251] Samples were harvested after 48hrs. RNA was prepared from each sample, using RNeasy plus mini kits (Qiagen # 74134). RNA was quantitated and cDNA was made with 1ug total RNA using SuperScriptTM III First-Strand Synthesis SuperMix (Cat.No.11752-050, Lot No.0243941, Invitrogen). [0252] RT-PCR reactions were performed using Invitrogen Platinum SuperFI DNA Polymerase (Cat.No.12351050), with the following primers: Table 11. Primers
Figure imgf000092_0002
[0253] After the initial denaturation step (98oC, 30s), 35 cycles were performed (98oC 10s, 60oC 10s, 72oC 30s), followed by a final extension step (72oC 5min). The PCR products were run on an agarose gel (1.5%) shown in FIG.1. Both bands (B1 and B2) from Lane 3 were cut and sent for sequencing with the forward and reverse primers identified above (SEQ ID NOs: 174 and 175). B1 corresponds to the expected product that contains exons 13, 14 and 15. B2 corresponds to the expected product that contains exons 13 and 15, exon 14 having been skipped. The sequences are shown in FIG. 2A-2B and FIG. 3A-3B. The sequence corresponding to exon 14 is in bolded underline in both FIG.2A-2B and FIG.3A-3B. Table 12: IFIH1 Isoforms
Figure imgf000093_0001
Example 2: MDA5 protein modulation in epithelial cells [0254] HuTu80 cells (ATCC® HTB-40™) were plated at a concentration of 400,000 cells/well in a 24- well plate and cultured according to ATCC recommendations for 24 hours. [0255] ASOs with morpholino-modified backbones (SEQ ID NOs: 90 and 138) were transfected individually into each well using EndoPorter (Gene-Tools, LLC at 6ul/ml). Each ASO was at a 1mM (1000uM) stock concentration and was added to the wells to achieve final concentrations of 6uM (3ul/well), 9uM (4.5ul/well), 12uM (6ul/well) and 15uM (7.5ul/well). Samples were harvested in RIPA buffer after 48hrs. Protein was quantitated by BCA assays and 15ug of each sample was loaded on an SDS-PAGE gel. The following antibodies were used to probe the SDS-PAGE gel: MDA5 – Rabbit mAb CST5321 (1:1000); Vinculin – Monoclonal antibody mouse #V9264-100; Sigma Aldrich (1:5000). The results are shown in FIG. 4. Quantitation of the MDA5 wild-type protein compared to the loading control protein is shown in FIG.5. Example 3: In Vivo Activity of an IFIH1-RTSM on IFIH1 pre-mRNA and MDA5 protein expression [0256] Female C57BL/6 mice of 5-6 weeks age (N=3/group) can be injected with exemplary murine IFIH1-RTSMs herein at 5 mg/kg, or PBS, subcutaneously once a day for three days. A IFIH1-RTSM control according to Example 1 can be administered to the control group using the same regime. After 3 days, blood can be collected and IFIH1 mRNA and MDA5 protein, and IFN-1 expression can be evaluated. RT-PCR evaluation of the IFIH1-RTSM treated mRNA can depict that the mRNA product contains exons 1-13, and 15-16, exon 14 having been skipped. BCA assays and SDS-PAGE gel probed with anti-mda5 antibodies can demonstrate that the IFIH1-RTSMs of the present disclosure decreased the level of functional MDA5 protein compared to the control. Example 4: Down-regulated expression of MDA5 protein will prevent the progression of or treat autoimmune diabetes [0257] Mice predisposed to T1D (NOD/Ltj mice) can be backcrossed with MDA5 knockout (MDA5-/-) on a C57BL/6 background to develop MDA5-/- that carry a full complement of NOD idd alleles and the ability to develop spontaneous diabetes. MDA5-/- mice can be bred with NOD mice and MDA5+/- mice. MDA5+/+ progeny can also be bred. Mice can be split into two treatment groups, treatment with or without an RTSM herein. Ten- to 12-week-old mice can be infected with sublethal doses of 400 plaque-forming units i.p. CB4 Edwards strain 2 diluted in DMEM. RTSM treatment groups can be injected with exemplary murine IFIH1- RTSMs herein at 5 mg/kg, or PBS, subcutaneously, once a day for three days. Infected and PBS treated MDA5+/+ can serve as a positive control. Infected and RTSM treated MDA5-/-can serve as a negative control. Diabetic incidence can be monitored by nonfasting blood glucose measurements before and after infection, before treatment as a baseline and after treatment, and can be determined by two consecutive blood glucose levels > 300 mg/dL. [0258] The data can depict that RTSM treated MDA5+/- and MDA5+/+ results in reduced incidence of blood glucose levels > 300 mg/dL, thereby demonstrating that an RTSM disclosed herein can prevent the progression of or reverse T1D. Example 5: In vivo activity of MDA5-mediated IFN-1 signaling [0259] Test groups in Example 4 can be sacrificed and organs evaluated by western blotting for protein expression, intracellular cytokine staining and analyzation by flow cytometry, and RT-PCR for RNA analysis. [0260] RT-PCR evaluation of the IFIH1-RTSM treated mRNA can depict that the mRNA product contains exons 13 and 15, exon 14 having been skipped. Western blotting can demonstrate that the IFIH1-RTSMs of the present disclosure can decrease the level of functional MDA5 protein compared to the positive control. Flow cytometry results can demonstrate the decrease in the presence of IFN-ȕ^^IFN-Ȗ, and IFN-Į^ cytokines compared to a positive control.

Claims

CLAIMS What is claimed is: 1. A method of treating a disease or condition in a human subject in need thereof, the method comprising: a) administering to the subject a therapeutically effective amount of a synthetic interferon induced with helicase 1 (IFIH1) RNA-targeting splicing modifier (RTSM), thereby treating the disease or condition in the human subject in need thereof; wherein: the synthetic RTSM comprises a binding domain that binds to a target region of the IFIH1 pre-messenger ribonucleic acid (pre-mRNA); the target region comprises an exon-intron junction comprising a target sequence of Formula (I): RGUV, wherein R is A or G and wherein V is A, G, or C; and exon skipping is increased as compared to the IFIH1 pre-mRNA spliced in the absence of an RTSM as demonstrated by an in vitro assay. 2. The method of claim 1, wherein increasing exon skipping comprises modulation of a IFIH1 mRNA transcript, MDA5 protein or both comprising: a decrease in full-length IFIH1 mRNA transcript, an increase in truncated IFIH1 mRNA transcript, an increase in an IFIH1 mRNA transcript lacking coding for one or more exons, a decrease in functional MDA5 expression, a decrease in full-length MDA5 protein expression, an increase in truncated MDA5 expression, or any combination thereof. 3. The method of claim 1, wherein the exon-intron junction comprises a sequence of Formula (I) wherein R is A and V is G; R is G and V is A; R is A and G is A; R is G and V is C; or R is G and V is G. 4. The method of claim 1, wherein Formula (I) further comprises: 1 or 2 Ds wherein each D is independently A, G or U; optionally, 1,
2,
3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 Ns wherein each N is independently A, G, U or C; and optionally an H wherein H is A, C or U; or any combination thereof.
5. The method of claim 1, wherein Formula (I) further comprises D that is 5’ and adjacent to R; ND that is 5’ and adjacent to R; NND 5’ that is 5’ and adjacent to R; NNND 5’ that is 5’ and adjacent to R; NNNND 5’ that is 5’ and adjacent to R; NNNNND 5’ that is 5’ and adjacent to R; NNNNNND that is 5’ and adjacent to R; N that is 3’ and adjacent to V; ND that is 3’ and adjacent to V; NDN that is 3’ and adjacent to V; NDNN that is 3’ and adjacent to V; NDNNH that is 3’ and adjacent to V; NDNNHN that is 3’ and adjacent to V; NDNNHND that is 3’ and adjacent to V; NDNNHNDN that is 3’ and adjacent to V; NDNNHNDNN that is 3’ and adjacent to V; NDNNHNDNNN that is 3’ and adjacent to V; NDNNHNDNNNN that is 3’ and adjacent to V; NDNNHNDNNNNN that is 3’ and adjacent to V; NDNNHNDNNNNNN that is 3’ and adjacent to V; or NDNNHNDNNNNNNN that is 3’ and adjacent to V; or any combination thereof; wherein each D is independently A, G or U, wherein each N is independently A, G, U or C, and wherein H is A, C or U.
6. The method of claim 5, wherein Formula (I) comprises the NND and NDNNHND or the NNNNNND and NDNNHNDNNNNNNN, wherein each D is independently A, G or U, each N is independently A, G, U or C, and wherein H is A, C or U.
7. The method of claim 1, wherein the target sequence comprises a sequence about 2 to about 50 nucleobases in length with at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ. ID NO:36-65. 8. The method of claim 1, wherein the synthetic RTSM binding domain comprises a sequence of Formula (III): BACY, wherein B is T, U, C or G; and wherein Y is T, U or C. 9. The method of claim 8, wherein the binding domain comprises a sequence of Formula (III) wherein B is C and Y is T; B is C and Y is U; B is C and Y is C; B is T and Y is C; B is U and Y is C; B is T and Y is T; B is U and Y is U; or B is G and Y is C. 10. The method of claim 8, wherein Formula (III) further comprises: 1 or 2 Hs wherein each H is independently A, C, T or U; optionally, 1, 2, 3, 4, 5, 6, 7,
8,
9,
10, 11, 12, 13, 14, 15, 16, or 17 Ns wherein each N is independently A, G, T, U or C; and optionally a D wherein D is A, G T, or U; or any combination thereof.
11. The method of claim 8, wherein Formula (III) further comprises N that is 5’ and adjacent to B; HN that is 5’ and adjacent to B; NHN that is 5’ and adjacent to B; NNHN that is 5’ and adjacent to DNNHN that is 5’ and adjacent to B; NDNNHN that is 5’ and adjacent to B; HNDNNHN that is 5’ and adjacent to B; NHNDNNHN that is 5’ and adjacent to B; NNHNDNNHN that is 5’ and adjacent to; NNNHNDNNHN that is 5’ and adjacent to B; NNNNHNDNNHN that is 5’ and adjacent to B; NNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNHNDNNHN that is 5’ and adjacent to B; or NNNNNNNHNDNNHN that is 5’ and adjacent to B; H that is 3’ and adjacent to Y; HN that is 3’ and adjacent to Y; HNN that is 3’ and adjacent to Y; HNNN; HNNNN that is 3’ and adjacent to Y; HNNNNN that is 3’ and adjacent to; HNNNNN that is 3’ and adjacent to Y; or HNNNNNN that is 3’ and adjacent to Y; or any combination thereof, wherein each D is independently A, G, T or U, each N is independently A, G, T, U or C, and wherein each H is independently A, C, T or U.
12. The method of claim 11, wherein Formula (III) comprises the NNHNDNNHN and the HNN or the HNNNNNN and the NNNNNNNHNDNNHN, wherein each D is independently A, G, T or U, each N is independently A, G, T, U or C, and wherein each H is independently A, C, T or U.
13. The method of claim 8, wherein the binding domain comprises a binding sequence comprising a sequence about 2 to about 50 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
14. The method of claim 8, wherein the binding domain comprises a binding sequence comprising a sequence about 2 to about 50 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
15. The method of claim 1, further comprising testing the subject prior to administration of the synthetic RTSM to determine whether the subject is suitable for the treatment.
16. The method of claim 1, wherein the disease or condition is an inflammatory disease or condition.
17. The method of claim 1, wherein the disease or condition is an autoimmune disease or condition.
18. The method of claim 17, where autoimmune disease is selected from the group consisting of systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis, dermatomyositis, scleroderma and psoriasis.
19. The method of claim 1, wherein the disease or condition is an IFN-1 mediated disease or condition.
20. The method of claim 19, wherein the IFN-1 mediated disease is selected from the group consisting of Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D), Aicardi-Goutieres Syndrome (AGS), Singleton-Merten Syndrome, Primary SS, Inflammatory Myositis, Scleroderma, and Rheumatoid Arthritis (RA).
21. The method of claim 1, wherein the disease or condition is an MDA5 associated disease.
22. The method of claim 21, wherein the MDA5 associated disease is selected from the group consisting of Systemic Lupus Erythematosus (SLE), Type 1 Diabetes (T1D) and Aicardi-Goutieres Syndrome (AGS).
23. The method of claim 1, wherein a therapeutically effective amount is about 0.001 mg/kg to about 1000 mg/kg, wherein mg is mg of the RTSM and kg is the body weight of the subject.
24. The method of claim 1, wherein the in vitro assay is a reverse transcription polymerase chain reaction (RT-PCR), Western blot analysis, bicinchoninic acid (BCA) assay or immunohistochemical detection.
25. The method of claim 1, wherein the RTSM is administered as a pharmaceutical composition which also comprises a pharmaceutically acceptable: excipient, diluent, or carrier.
26. The method of claim 25, wherein the pharmaceutical composition is in unit dose form.
27. The method of claim 1, wherein the RTSM is a polynucleotide comprising from about 4 to about 30 nucleotides.
28. The method of claim 1, wherein the RTSM is administered once every 7 to 10 days for at least about 90 days.
29. The method of claim 1, further comprising administering a second therapy wherein the second therapy is administered consecutively or concurrently to administration of the RTSM.
30. The method of claim 1, wherein the exon-intron junction is located at the 5’ splice site of the target intron and wherein the target exon is upstream of the exon-intron junction.
31. The method of claim 30, wherein the exon-intron junction is selected from the group consisting of Exon2-Intron2, Exon3-Intron3, Exon4-Intron4, Exon5-Intron5, Exon6-Intron6, Exon7-Intron7, Exon8-Intron8, Exon9-Intron9, Exon10-Intron10, Exon11-Intron11, Exon12-Intron12, Exon13- Intron13, Exon14-Intron14, or Exon15-Intron15.
32. The method of claim 31, wherein the targeted exon is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15 or exon 16, or any combination thereof.
33. The method of claim 1, wherein the binding sequence binds at a splice site sequence, wherein the splice site sequence comprises a sequence about 4 to about 25 nucleobases in length and is located at the 5’ splice site of the target intron.
34. The method of claim 33, wherein the splice site comprises a splice site sequence about 2 to about 50 nucleobases long with at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences in SEQ. ID NOS: 66-95.
35. The method of claim 1, wherein the synthetic RTSM is selected from the group consisting of an antibody or a fragment thereof, an aptamer, an antisense oligomer (ASO), or CRISPR associated proteins.
36. The method of claim 35, wherein the synthetic RTSM is a synthetic ASO comprising one or more nucleobases, one or more sugar moieties, a backbone, modifications thereof, and any combination thereof.
37. The method of claim 36, wherein the synthetic ASO comprises backbone modifications comprising a phosphorothioate linkage; a sugar moiety comprising a 2'O-methyl modification; more than one of each; and in combination thereof.
38. The method of claim 37, wherein the synthetic ASO comprises one or more 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides.
39. The method of claim 1, wherein exon 14 in an IFIH1 mRNA transcript or in a MDA5 protein is skipped in the presence of the RTSM as confirmed by an in vitro assay.
40. A synthetic IFIH1 RTSM that comprises a) a binding domain that binds to a target region of a IFIH1 pre-mRNA; wherein: the target region comprises an exon-intron junction comprising a target sequence of Formula (I): RGUV wherein R is A or G and wherein V is A, G, or C; and exon skipping is increased as compared to when the IFIH1 pre-mRNA is spliced in the absence of the synthetic RTSM as demonstrated in an in vitro assay.
41. The synthetic RTSM of claim 40, wherein the exon-intron junction comprises a sequence of Formula (I) wherein R is A and V is G; R is G and V is A; R is A and G is A; R is G and V is C; or R is G and V is G.
42. The synthetic RTSM of claim 40, wherein Formula (I) further comprises: 1 or 2 Ds wherein each D is independently A, G or U; optionally, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 Ns wherein each N is independently A, G, U or C; and optionally an H wherein H is A, C or U; or any combination thereof.
43. The synthetic RTSM of claim 40, wherein Formula (I) further comprises D that is 5’ and adjacent to R; ND that is 5’ and adjacent to R; NND that is 5’ and adjacent to R; NNND that is 5’ and adjacent to R; NNNND that is 5’ and adjacent to R; NNNNND that is 5’ and adjacent to R; NNNNNND that is 5’ and adjacent to R; N that is 3’ and adjacent to V; ND that is 3’ and adjacent to V; NDN that is 3’ and adjacent to V; NDNN that is 3’ and adjacent to V; NDNNH that is 3’ and adjacent to V; NDNNHN that is 3’ and adjacent to V; NDNNHND that is 3’ and adjacent to V; NDNNHNDN that is 3’ and adjacent to V; NDNNHNDNN that is 3’ and adjacent to V; NDNNHNDNNN that is 3’ and adjacent to V; NDNNHNDNNNN that is 3’ and adjacent to V; NDNNHNDNNNNN that is 3’ and adjacent to V; NDNNHNDNNNNNN that is 3’ and adjacent to V; or NDNNHNDNNNNNNN that is 3’ and adjacent to V; or any combination thereof, wherein each D is independently A, G or U, each N is independently A, G, U or C, and wherein H is A, C or U.
44. The synthetic RTSM of claim 43, wherein Formula (I) comprises the NND and the DNNHND or the NNNNNND and the NDNNHNDNNNNNNN, wherein each D is independently A, G or U, each N is independently A, G, U or C, and wherein H is A, C or U.
45. The synthetic RTSM of claim 40, wherein the exon-intron junction is located at the 5’ splice site of the target intron and wherein the target exon is upstream of the exon-intron junction.
46. The synthetic RTSM of claim 45, wherein the exon-intron junction is selected from the group consisting of Exon2-Intron2, Exon3-Intron3, Exon4-Intron4, Exon5-Intron5, Exon6-Intron6, Exon7- Intron7, Exon8-Intron8, Exon9-Intron9, Exon10-Intron10, Exon11-Intron11, Exon12-Intron12, Exon13-Intron13, Exon14-Intron14, or Exon15-Intron15.
47. The synthetic RTSM of claim 46, wherein the targeted exon is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15 or exon 16, or any combination thereof.
48. The synthetic RTSM of claim 45, wherein the target sequence comprises a sequence about 2 to about 50 nucleobases long with at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 36-65.
49. The synthetic RTSM of claim 40, wherein the RTSM binding domain comprises a sequence of Formula (III): BACY wherein B is T, U, C or G; and wherein Y is T, U or C.
50. The synthetic RTSM of claim 40, wherein the RTSM binding domain comprises a sequence of Formula (III) wherein B is C and Y is T; B is C and Y is U; B is C and Y is C; B is T and Y is C; B is U and Y is C; B is T and Y is T; B is U and Y is U; or B is G and Y is C.
51. The synthetic RTSM of claim 40, wherein Formula (III) further comprises: 1 or 2 Hs wherein each H is independently A, C, T or U; optionally, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 Ns wherein each N is independently A, G, T, U or C; and optionally a D wherein D is A, G T, or U; or any combination thereof.
52. The synthetic RTSM of claim 40, wherein Formula (III) further comprises: N that is 5’ and adjacent to B; HN that is 5’ and adjacent to B; NHN that is 5’ and adjacent to B; NNHN that is 5’ and adjacent to DNNHN that is 5’ and adjacent to B; NDNNHN that is 5’ and adjacent to B; HNDNNHN that is 5’ and adjacent to B; NHNDNNHN that is 5’ and adjacent to B; NNHNDNNHN that is 5’ and adjacent to; NNNHNDNNHN that is 5’ and adjacent to B; NNNNHNDNNHN that is 5’ and adjacent to B; NNNNNHNDNNHN that is 5’ and adjacent to B; NNNNNNHNDNNHN that is 5’ and adjacent to B; or NNNNNNNHNDNNHN that is 5’ and adjacent to B; H that is 3’ and adjacent to Y; HN that is 3’ and adjacent to Y; HNN that is 3’ and adjacent to Y; HNNN; HNNNN that is 3’ and adjacent to Y; HNNNNN that is 3’ and adjacent to; HNNNNN that is 3’ and adjacent to Y; or HNNNNNN that is 3’ and adjacent to Y; or any combination thereof, wherein each D is independently A, G, T or U, each N is independently A, G, T, U or C, and wherein H is A, C, T or U.
53. The synthetic RTSM of claim 52, wherein Formula (III) comprises the NNHNDNNHNB and HNN or the HNNNNNN and NNNNNNNHNDNNHN, wherein each D is independently A, G, T or U, each N is independently A, G, T, U or C, and wherein H is A, C, T or U.
54. The synthetic RTSM of claim 50 wherein the RTSM binding domain comprises a binding sequence comprising a sequence about 2 to about 50 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to any one of the sequences of SEQ ID NOS: 36-65.
55. The synthetic RTSM of claim 50 wherein the RTSM binding domain comprises a binding sequence comprising a sequence about 2 to about 50 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the sequences of SEQ ID NOS: 96-155.
56. The synthetic RTSM of claim 50 wherein the target sequence comprises a sequence that is about 14 to about 25 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOS: 49 or 64.
57. The synthetic RTSM of claim 50, wherein the binding sequence comprises a sequence that is about 14 to about 25 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity to SEQ ID NOS: 49 or 64.
58. The synthetic RTSM of claim 50, wherein the binding sequence comprises a sequence that is about 14 to about 25 nucleobases in length that has at least about: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity SEQ ID NOS:109, 124, 139, or 154.
59. The synthetic RTSM of claim 50 wherein the binding sequence binds at a splice site sequence, wherein the splice site sequence comprises a sequence about 4 to about 25 nucleobases in length and is located at the 5’ splice site of the target intron.
60. The synthetic RTSM of claim 50 wherein the RTSM is a polynucleotide comprising from about 4 to about 30 nucleotides.
61. The synthetic RTSM of claim 50 wherein the synthetic RTSM is selected from the group consisting of an antibody or a fragment thereof, an aptamer, an antisense oligomer (ASO), or CRISPR associated proteins.
62. The synthetic RTSM of claim 40, wherein the synthetic RTSM is a synthetic ASO comprising one or more nucleobases, one or more sugar moieties, a backbone, modifications thereof, and any combination thereof.
63. The synthetic RTSM of claim 62, wherein the synthetic ASO comprises backbone modifications comprising a phosphorothioate linkage; a sugar moiety comprising a 2'O-methyl modification; more than one of each; and in combination thereof.
64. The synthetic RTSM of claim 63, wherein the synthetic ASO comprises one or more 2'-O-(2- methoxyethyl) (MOE) phosphorothioate-modified nucleotides 65. The synthetic RTSM of claim 40, wherein the in vitro assay comprises RT-PCR, BCA Assay, Western blot analysis, or immunohistochemical detection, or any combination thereof. 66. The synthetic RTSM of claim 40, wherein exon 14 in an IFIH1 mRNA transcript or in an MDA5 protein is skipped in the presence of the RTSM as confirmed by an in vitro assay. 67. The synthetic RTSM of claim 40, wherein the RTSM is administered as a pharmaceutical composition which also comprises a pharmaceutically acceptable: excipient, diluent, or carrier. 68. The synthetic RTSM of claim 67, wherein the pharmaceutical composition is in unit dose form. 69. The synthetic RTSM of claim 67, wherein the composition further comprises a second active agent comprising an anti-inflammatory, a therapeutic protein, a steroid, an analgesic, a non-steroidal anti- inflammatory, a corticosteroid, and combinations thereof.
PCT/US2021/059720 2020-11-17 2021-11-17 Rna-targeting splicing modifiers for treatment of mda5-associated conditions and diseases WO2022109022A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063114866P 2020-11-17 2020-11-17
US63/114,866 2020-11-17

Publications (1)

Publication Number Publication Date
WO2022109022A1 true WO2022109022A1 (en) 2022-05-27

Family

ID=81709697

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/059720 WO2022109022A1 (en) 2020-11-17 2021-11-17 Rna-targeting splicing modifiers for treatment of mda5-associated conditions and diseases

Country Status (1)

Country Link
WO (1) WO2022109022A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023235838A3 (en) * 2022-06-02 2024-01-25 Skyhawk Therapeutics, Inc. Rna-targeting splicing modifiers for treatment of foxp3-associated conditions and diseases

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200277289A1 (en) * 2017-08-04 2020-09-03 Skyhawk Therapeutics, Inc. Methods and compositions for modulating splicing

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200277289A1 (en) * 2017-08-04 2020-09-03 Skyhawk Therapeutics, Inc. Methods and compositions for modulating splicing

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI JIN-JING, LIN XIANG, TANG CHENG, LU YING-QIAN, HU XINDE, ZUO ERWEI, LI HE, YING WENQIN, SUN YIDI, LAI LU-LU, CHEN HAI-ZHU, GUO : "Disruption of splicing-regulatory elements using CRISPR/Cas9 to rescue spinal muscular atrophy in human iPSCs and mice", NATIONAL SCIENCE REVIEW, OXFORD UNIVERSITY PRESS, vol. 7, no. 1, 1 January 2020 (2020-01-01), pages 92 - 101, XP055799482, DOI: 10.1093/nsr/nwz131 *
PAGLIARINI, V ET AL.: "Combined treatment with the histone deacetylase inhibitor LBH589 and a splice-switch antisense oligonucleotide enhances SMN2 splicing and SMN expression in Spinal Muscular Atrophy cells", JOURNAL OF NEUROCHEMISTRY, vol. 153, no. 2, 8 January 2020 (2020-01-08), pages 264 - 275, XP055898998, DOI: 10.1111/jnc.14935 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023235838A3 (en) * 2022-06-02 2024-01-25 Skyhawk Therapeutics, Inc. Rna-targeting splicing modifiers for treatment of foxp3-associated conditions and diseases

Similar Documents

Publication Publication Date Title
JP6946399B2 (en) C / EBPα small molecule activated RNA
CN107106590B (en) Combination (I)
TW201920227A (en) RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
KR102599712B1 (en) C/EBP alpha saRNA compositions and methods of use
JP2022501040A (en) RNAi agent for inhibiting the expression of 17β-HSD13 type (HSD17B13), its composition, and method of use.
CN103740713A (en) Complement antagonists and uses thereof
CN109526229B (en) Method for screening prophylactic or therapeutic agent for disease, and use for producing the agent
EP3210611B1 (en) Methods of treating vascular inflammatory disorders
US11129846B2 (en) Dosage form for treating severe asthma
CN116096888A (en) Oligonucleotide agonists targeting granulin precursors
WO2022109022A1 (en) Rna-targeting splicing modifiers for treatment of mda5-associated conditions and diseases
KR20220044551A (en) Methods of treating APOC3-related diseases and disorders
WO2022109030A1 (en) Rna-targeting splicing modifiers for treatment of pnpla3-associated conditions and diseases
JP2021505659A (en) TRPV6 Inhibitors and Combination Therapies for Cancer Treatment
JP2023548597A (en) Soluble interleukin-7 receptor (sIL7R) modulation therapy to treat cancer
WO2023235838A2 (en) Rna-targeting splicing modifiers for treatment of foxp3-associated conditions and diseases
JP7037160B1 (en) A prophylactic or therapeutic agent for at least one cancer selected from the group consisting of pancreatic cancer, lung cancer, colon cancer, bile duct cancer and liver cancer, and the prophylactic or therapeutic agent for the cancer in combination with the agent. A method for screening a therapeutic agent, a combination drug containing the agent, and a preventive or therapeutic agent for cancer.
WO2019208398A1 (en) Intractable asthma prophylactic/therapeutic agent screening method, and intractable asthma prophylactic/therapeutic agent
US20220378875A1 (en) Treating tissue fibrosis and/or injury and/or organ failure with interleukin 24 or interleukin 20 antagonist
WO2023040828A1 (en) Sirna conjugate targeting fap-positive cells, and pharmaceutical composition and use thereof
WO2024091286A1 (en) Compositions and methods for anti-sense oligonucleotide (aso) treatment of huntington's disease
CN112654706A (en) Nucleic acid aptamers targeting lymphocyte activation gene 3(LAG-3) and uses thereof
JP2023108978A (en) Agent for inhibiting hbv-derived cccdna, method for inhibiting hbv-derived cccdna, medical composition for hbv infection, and method for treating hbv infection
Gregory et al. Inflammatory diseases
WO2024084034A1 (en) Methods and pharmaceutical compositions for the treatment of osteoarthritis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21895505

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21895505

Country of ref document: EP

Kind code of ref document: A1