WO2022093919A1 - Inhibitors of exo1 in combination with other cancer drugs to inhibit cancer cells - Google Patents

Inhibitors of exo1 in combination with other cancer drugs to inhibit cancer cells Download PDF

Info

Publication number
WO2022093919A1
WO2022093919A1 PCT/US2021/056795 US2021056795W WO2022093919A1 WO 2022093919 A1 WO2022093919 A1 WO 2022093919A1 US 2021056795 W US2021056795 W US 2021056795W WO 2022093919 A1 WO2022093919 A1 WO 2022093919A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
combination
cancer
subject
pharmaceutically acceptable
Prior art date
Application number
PCT/US2021/056795
Other languages
French (fr)
Inventor
Nikhil C. Munshi
Masood A. SHAMMAS
Original Assignee
Dana-Farber Cancer Institute, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dana-Farber Cancer Institute, Inc. filed Critical Dana-Farber Cancer Institute, Inc.
Publication of WO2022093919A1 publication Critical patent/WO2022093919A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50—Pyridazines; Hydrogenated pyridazines
    • A61K31/5025—Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/05—Dipeptides

Definitions

  • Genomic instability enables cells to acquire new genomic characteristics for progression and resist therapy.
  • the number of mutations correlates with overall and event free survival in multiple myeloma (MM), suggesting a role of genomic instability in poor clinical outcome.
  • Dysregulated homologous recombination (HR) is a key mediator of genomic instability and drug resistance in MM, as well as contributes to telomere maintenance and tumor growth in cancer cells.
  • Exonuclease (EXO1), through its 5'— >3' double-stranded DNA exonuclease activity, brings about DNA end resection. This is a critical step in the initiation of HR. EXO1 also contributes to DNA mismatch repair, repair of 5'-overhanging flap structures, somatic hypermutation and class switch recombination of immunoglobulin genes.
  • the present invention is based, at least in part, on a discovery that Exonuclease (EXO1), contributes to increased DNA damage, HR activity and genomic instability in cancer cells at multiple levels.
  • EXO1 Exonuclease
  • Data presented in the working examples show that inhibition of EXO 1 activity in cancer cells reduces DNA breaks, inhibits HR and genomic instability, and induces cell cycle arrest.
  • the working examples also show that inhibition of EXO 1 activity increases sensitivity of MM cells to cancer drugs such as melphalan and bortezomib. Although inhibition of EXO1 activity increases cytotoxicity, it reduces genomic instability and heterogeneity caused by melphalan, a known chemotherapeutic agent.
  • a first aspect of the present invention is directed to a method of treating cancer or a pre-cancerous condition wherein cells of the cancer or pre-cancer express exonuclease 1 (EXO1) (and/or the cancer or pre-cancerous condition has EXO1 activity), comprising administering a therapeutically effective amount of compound 1, 2, 3, 4, 5, 6, 7 or 8: pharmaceutically acceptable salt thereof, to a subject in need thereof.
  • EXO1 exonuclease 1
  • a related aspect is directed to a method of treating cancer or a precancerous condition wherein cells of the cancer or pre-cancer express EXO1 (and/or the cancer or pre-cancerous condition has EXO1 activity), which comprises administering in combination to a subject in need thereof a therapeutically effective amount of any one or more of compounds 1, 2, 3, 4, 5, 6, 7 and 8: pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an additional anti-cancer (e.g., chemotherapeutic) agent, wherein the additional anti-cancer (e.g., chemotherapeutic) agent exhibits greater cytotoxicity to cancer cells of the subject than when administered alone without any of compounds 1-8.
  • an additional anti-cancer e.g., chemotherapeutic
  • the inventive methods may increase cytotoxicity of existing cancer drugs, and/or reduce genetic damage/instability caused by anticancer (chemotherapeutic) agents in cancer and pre-cancerous cells.
  • FIG. 1A-FIG. ID are a series of chemical structures and graphs showing the characteristics of three EXO1 inhibitors.
  • FIG. 1 A shows the chemical structures of compounds 1, 2, and 3.
  • FIG. 1B-FIG. ID is a series of graphs that demonstrate a dose-dependent inhibition of EXO1 activity by compounds 1, 2, and 3, respectively.
  • FIG. 2 is a bar graph depicting compound 1 activity in MM (RPMI) cell lysate.
  • FIG. 3 is a series of bar graphs showing that EXO1 activity is inhibited in MM (H929 and MM1S) cells cultured in the presence of compounds 1 (left) and 3 (right).
  • FIG. 4A-FIG. 4B is a series of bar graphs showing the impact of three-day treatment with compound 1 on indicated MM cells and normal cell viability.
  • FIG. 5A-FIG. 5B is a series of bar graphs showing the impact of five-day treatment with compound 1 on indicated MM cells and normal cell viability.
  • FIG. 6 is a series of graphs showing that compound 2 inhibited the growth of MM (MM1S and U266) cell lines with minimal impact on three different normal cell types.
  • FIG. 7A is a series of bar graphs showing the impact of three-day treatment with compound 3 on indicated MM cells and normal cell viability.
  • FIG. 7B is a series of bar graphs showing the impact of five-day treatment with compound 3 on indicated MM cells and normal cell viability.
  • FIG. 8A is a graph showing the ICso values compound 1 in three normal cell types and three MM (AM01, H929, and KK1) cell lines.
  • FIG. 8B is a graph showing the cytotoxic effect (expressed in ICso values) of compound 3 in three normal cell types and three MM cell lines.
  • FIG. 9A is a series of bar graphs showing the impact of 24-hour treatment of compound 1, alone and in combination with bortezomib, on viability of MM (ARP1, LR5, and
  • FIG. 9B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib in MM (ARP1, LR5, and MM1R) cells.
  • FIG. 10A is a series of bar graphs showing the impact of 24-hour treatment of compound 3, alone and in combination with bortezomib, on viability of MM (H929, JJN3, KMS11, and MM1S) cells.
  • FIG. 10B is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of bortezomib in MM (H929, JJN3, KMS11, and
  • FIG. 11A is a series of bar graphs showing the impact of 48-hour treatment of compound 1, alone and in combination with melphalan, on viability of MM (ARP1, MM1R, and MM1S) cells.
  • FIG. 1 IB is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of melphalan in MM (ARP1, MM1R, and MM1S) cells.
  • FIG. 12A is a series of bar graphs showing the impact of 72-hour treatment of compound 1, alone and in combination with dexamethasone, on viability of MM (MM1R) cells.
  • FIG. 12B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of dexamethasone in MM (MM1R) cells.
  • FIG. 13 is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of dexamethasone in MM (MM1S, MM1R, LR5, KMS11, JJN3, and H929) cells following 72-hour treatment.
  • FIG. 14A is a series of bar graphs showing the impact of 72-hour treatment of compound 1, alone and in combination with lenalidomide, on viability of MM (H929) cells.
  • FIG. 14B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of lenalidomide in MM (H929) cells.
  • FIG. 15 is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of lenalidomide in MM (MM1S, MM1R, LR5, KMS11, JJN3, and H929) cells following 72-hour treatment.
  • FIG. 16A is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of cyclophosphamide in MM (U266, KMS20, and AM01) cells following 72-hour treatment.
  • FIG. 16B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bendamustine in MM (U266, KMS20, and AM01) cells following 72-hour treatment.
  • FIG. 17A is a series of bar graphs showing the impact of 48-hour treatment of compound 1, alone and in combination with doxorubicin, on viability of MM (MM1S and MM1R) cells.
  • FIG. 17B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of doxorubicin in MM (MM1S and MM1R) cells.
  • FIG. 18A is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib, dexamethasone, and lenalidomide in MM (H929) cells.
  • FIG. 18B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib, dexamethasone, and lenalidomide in MM (MM1S) cells.
  • FIG. 19A is a series of flow cytometry images showing the impact of compounds 1 and 3, alone (top panels) and in combination with dexamethasone (bottom panels), on apoptosis in MM (MM1S) cells.
  • FIG. 19B is a bar graph showing the fraction of cells in early and late apoptosis in single and combination treatment in MM (MM1S) cells.
  • FIG. 20A is a series of flow cytometry images showing the impact of compounds 1 and 3, alone (top panels) and in combination with dexamethasone (bottom panels), on apoptosis in MM (H929) cells.
  • FIG. 20B is a bar graph showing the fraction of cells in early and late apoptosis in single and combination treatment in MM (H929) cells.
  • FIG. 21 A is a Western blot showing that compound 1 inhibits DNA end resection and DNA breaks in MM (H929) cells.
  • FIG. 21B is a bar graph showing that compound 1 inhibits DNA end resection and DNA breaks in MM (H929) cells.
  • FIG. 22A is a Western blot showing that compound 3 inhibits DNA end resection and DNA breaks in MM (H929) cells.
  • FIG. 22B is a Western blot showing that compound 3 inhibits DNA end resection and DNA breaks in MM (MM1S) cells.
  • FIG. 23 A is a series of flow cytometry images of micronuclei for MM (MM1R) cells that were treated with DMSO (upper left), compound 1 (upper right), and compound 3 (lower left).
  • FIG. 23B is a bar graph showing the percentage of micronuclei in MM (MM1R) cells.
  • FIG. 24A is a series of flow cytometry images of micronuclei for MM (MM1S) cells that were treated with DMSO (upper left), compound 1 (upper right), and compound 3 (lower left).
  • FIG. 24B is a bar graph showing the percentage of micronuclei in MM (MM1S) cells.
  • FIG. 25A is a series of flow cytometry images of micronuclei for MM (MM1S) cells that were treated with compound 1 and melphalan, alone and in combination.
  • FIG. 25B is a bar graph showing the percentage of micronuclei in MM (MM1S) cells.
  • FIG. 26A is a series of bar graphs showing the impact of a 3-day treatment of compound 8 on cell viability (panel I) and ICso values (panel II) in the indicated cell lines.
  • FIG. 26B is a series of bar graphs showing the impact of 5-day treatment of compound 8 on cell viability (panel I) and IC 50 values (panel II).
  • Normal fibroblasts (HDF) t(4:14) MM cell lines (H929, KMS11, OPM1, OPM2) and non t(4:14) MM cell lines (MM1S, AM01 and JJN3) are shown.
  • FIG. 27A is a series of bar graphs showing the impact of bortezomib (velcade®) on compound 8-induced cell viability.
  • FIG. 27B is a combination index plot showing synergistic impact of bortezomib on cytotoxicity of compound 8 in MM (H929 and MM1S) cells. DETAILED DESCRIPTION
  • transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements, or method steps.
  • the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim.
  • the transitional phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
  • the compounds may be in the form of a free acid or free base, or a pharmaceutically acceptable salt.
  • pharmaceutically acceptable in the context of a salt refers to a salt of the compound that does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the compound in salt form may be administered to a subject without causing undesirable biological effects (such as dizziness or gastric upset) or interacting in a deleterious manner with any of the other components of the composition in which it is contained.
  • pharmaceutically acceptable salt refers to a product obtained by reaction of the compound of the present invention with a suitable acid or a base.
  • Examples of pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic bases such as Li, Na, K, Ca, Mg, Fe, Cu, Al, Zn and Mn salts.
  • suitable inorganic bases such as Li, Na, K, Ca, Mg, Fe, Cu, Al, Zn and Mn salts.
  • Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulf
  • compositions for purposes of treating patients.
  • practice of the inventive methods may entail formulating compounds 1-8 or a pharmaceutically acceptable salt thereof, with a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to a pharmaceutically acceptable material, composition or vehicle, suitable for administering compounds of the present invention to mammals.
  • Suitable carriers may include, for example, liquids (both aqueous and non-aqueous alike, and combinations thereof), solids, encapsulating materials, gases, and combinations thereof (e.g, semi-solids), and gases, that function to carry or transport the compound from one organ, or portion of the body, to another organ, or portion of the body.
  • a carrier is “acceptable” in the sense of being physiologically inert to and compatible with the other ingredients of the formulation and not injurious to the subject or patient.
  • the composition may further include one or more pharmaceutically acceptable excipients.
  • compounds 1-8 and their pharmaceutically acceptable salts may be formulated into a given type of composition in accordance with conventional pharmaceutical practice such as conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping and compression processes (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
  • the type of formulation depends on the mode of administration which may include enteral (e.g., oral, buccal, sublingual and rectal), parenteral (e.g., subcutaneous (s.cf, intravenous (i.vf, intramuscular (i.mf, and intrastemal injection, or infusion techniques, intra-ocular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, interdermal, intravaginal, intraperitoneal, mucosal, nasal, intratracheal instillation, bronchial instillation, and inhalation) and topical (e.g, transdermal).
  • enteral e.g., oral, buccal, sublingual and rectal
  • parenteral e.g., subcutaneous (s.cf, intravenous (i.vf, intramuscular (i.mf, and intrastemal injection, or infusion techniques, intra-ocular, intra-arterial, intramedullary, intrathecal, intraventricular, transderma
  • parenteral (e.g, intravenous) administration may also be advantageous in that the compound may be administered relatively quickly such as in the case of a single-dose treatment and/or an acute condition.
  • the compounds are formulated for oral or intravenous administration (e.g., systemic intravenous injection).
  • compounds 1-8 may be formulated into solid compositions (e.g., powders, tablets, dispersible granules, capsules, cachets, and suppositories), liquid compositions (e.g, solutions in which the compound is dissolved, suspensions in which solid particles of the compound are dispersed, emulsions, and solutions containing liposomes, micelles, or nanoparticles, syrups and elixirs); semi-solid compositions (e.g, gels, suspensions and creams); and gases (e.g, propellants for aerosol compositions).
  • the compounds may also be formulated for rapid, intermediate or extended release.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
  • the active compound is mixed with a carrier such as sodium citrate or dicalcium phosphate and an additional carrier or excipient such as a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, methylcellulose, microcrystalline cellulose, hydroxypropylmethylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as crosslinked polymers (e.g, crosslinked polyvinylpyrrolidone (crospovidone), crosslinked sodium carboxymethyl cellulose (croscarmellose sodium), sodium starch glycolate, agar-agar, calcium carbonate, potato or tapio
  • a carrier such as
  • the dosage form may also include buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings. They may further contain an opacifying agent.
  • compounds 1-8 may be formulated in a hard or soft gelatin capsule.
  • Representative excipients that may be used include pregelatinized starch, magnesium stearate, mannitol, sodium stearyl fumarate, lactose anhydrous, microcrystalline cellulose and croscarmellose sodium.
  • Gelatin shells may include gelatin, titanium dioxide, iron oxides and colorants.
  • Liquid dosage forms for oral administration include solutions, suspensions, emulsions, micro-emulsions, syrups and elixirs.
  • the liquid dosage forms may contain an aqueous or non-aqueous carrier (depending upon the solubility of the compounds) commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, com, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • Oral compositions may also include an excipients such as
  • Injectable preparations may include sterile aqueous solutions or oleaginous suspensions. They may be formulated according to standard techniques using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • the effect of the compound may be prolonged by slowing its absorption, which may be accomplished by the use of a liquid suspension or crystalline or amorphous material with poor water solubility.
  • Prolonged absorption of the compound from a parenterally administered formulation may also be accomplished by suspending the compound in an oily vehicle.
  • compounds 1-8 may be administered in a local rather than systemic manner, for example, via injection of the conjugate directly into an organ, often in a depot preparation or sustained release formulation.
  • long acting formulations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • injectable depot forms are made by forming microencapsule matrices of the compound in a biodegradable polymer, e.g, polylactidepolyglycolides, poly(orthoesters) and poly(anhydrides). The rate of release of the compound may be controlled by varying the ratio of compound to polymer and the nature of the particular polymer employed.
  • Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.
  • the compound is delivered in a targeted drug delivery system, for example, in a liposome coated with organ-specific antibody.
  • the liposomes are targeted to and taken up selectively by the organ.
  • Compounds 1-8 may be formulated for buccal or sublingual administration, examples of which include tablets, lozenges and gels.
  • Compounds 1-8 may be formulated for administration by inhalation.
  • Various forms suitable for administration by inhalation include aerosols, mists or powders.
  • Pharmaceutical compositions may be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas).
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit of a pressurized aerosol may be determined by providing a valve to deliver a metered amount.
  • capsules and cartridges including gelatin for example, for use in an inhaler or insufflator, may be formulated containing a powder mix of the compound and
  • Compounds 1-8 may be formulated for topical administration which as used herein, refers to administration intradermally by application of the formulation to the epidermis. These types of compositions are typically in the form of ointments, pastes, creams, lotions, gels, solutions and sprays.
  • compositions for topical application include solvents (e.g, alcohols, poly alcohols, water), creams, lotions, ointments, oils, plasters, liposomes, powders, emulsions, microemulsions, and buffered solutions (e.g, hypotonic or buffered saline).
  • Creams for example, may be formulated using saturated or unsaturated fatty acids such as stearic acid, palmitic acid, oleic acid, palmito-oleic acid, cetyl, or oleyl alcohols. Creams may also contain a non-ionic surfactant such as polyoxy-40-stearate.
  • the topical formulations may also include an excipient, an example of which is a penetration enhancing agent.
  • a penetration enhancing agent capable of transporting a pharmacologically active compound through the stratum comeum and into the epidermis or dermis, preferably, with little or no systemic absorption.
  • a wide variety of compounds have been evaluated as to their effectiveness in enhancing the rate of penetration of drugs through the skin. See, for example, Percutaneous Penetration Enhancers, Maibach H. I. and Smith H. E. (eds.), CRC Press, Inc., Boca Raton, Fla. (1995), which surveys the use and testing of various skin penetration enhancers, and Buyuktimkin et al.
  • penetration enhancing agents include triglycerides (e.g, soybean oil), aloe compositions (e.g, aloe-vera gel), ethyl alcohol, isopropyl alcohol, octolyphenylpolyethylene glycol, oleic acid, polyethylene glycol 400, propylene glycol, N- decylmethylsulfoxide, fatty acid esters (e.g., isopropyl myristate, methyl laurate, glycerol monooleate, and propylene glycol monooleate), and N-methylpyrrolidone.
  • triglycerides e.g, soybean oil
  • aloe compositions e.g, aloe-vera gel
  • ethyl alcohol isopropyl alcohol
  • octolyphenylpolyethylene glycol oleic acid
  • polyethylene glycol 400 propylene glycol
  • N- decylmethylsulfoxide e.g., iso
  • compositions that may be included in topical as well as in other types of formulations (to the extent they are compatible), include preservatives, antioxidants, moisturizers, emollients, buffering agents, solubilizing agents, skin protectants, and surfactants.
  • Suitable preservatives include alcohols, quaternary amines, organic acids, parabens, and phenols.
  • Suitable antioxidants include ascorbic acid and its esters, sodium bisulfite, butylated hydroxy toluene, butylated hydroxyanisole, tocopherols, and chelating agents like EDTA and citric acid.
  • Suitable moisturizers include glycerin, sorbitol, polyethylene glycols, urea, and propylene glycol.
  • Suitable buffering agents include citric, hydrochloric, and lactic acid buffers.
  • Suitable solubilizing agents include quaternary ammonium chlorides, cyclodextrins, benzyl benzoate, lecithin, and polysorbates.
  • Suitable skin protectants include vitamin E oil, allatoin, dimethicone, glycerin, petrolatum, and zinc oxide.
  • Transdermal formulations typically employ transdermal delivery devices and transdermal delivery patches wherein the compound is formulated in lipophilic emulsions or buffered, aqueous solutions, dissolved and/or dispersed in a polymer or an adhesive. Patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. Transdermal delivery of the compounds may be accomplished by means of an iontophoretic patch. Transdermal patches may provide controlled delivery of the compounds wherein the rate of absorption is slowed by using rate-controlling membranes or by trapping the compound within a polymer matrix or gel.
  • Absorption enhancers may be used to increase absorption, examples of which include absorbable pharmaceutically acceptable solvents that assist passage through the skin.
  • Ophthalmic formulations include eye drops.
  • Formulations for rectal administration include enemas, rectal gels, rectal foams, rectal aerosols, and retention enemas, which may contain conventional suppository bases such as cocoa butter or other glycerides, as well as synthetic polymers such as polyvinylpyrrolidone, PEG, and the like.
  • compositions for rectal or vaginal administration may also be formulated as suppositories which can be prepared by mixing the compound with suitable non-irritating carriers and excipients such as cocoa butter, mixtures of fatty acid glycerides, polyethylene glycol, suppository waxes, and combinations thereof, all of which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the compound.
  • suitable non-irritating carriers and excipients such as cocoa butter, mixtures of fatty acid glycerides, polyethylene glycol, suppository waxes, and combinations thereof, all of which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the compound.
  • terapéuticaally effective amount refers to an amount of compound 1, 2, 3, 4, 5, 6, 7, or 8, or a pharmaceutically acceptable salt thereof, effective in producing the desired therapeutic response in a particular patient suffering from cancer or a precancerous condition.
  • terapéuticaally effective amount includes the amount of the compound or a pharmaceutically acceptable salt thereof, when administered, may induce a positive modification in the cancer or precancerous condition to be treated (e.g, to inhibit or reduce EXO1 activity), or is sufficient to prevent progression of the cancer or precancer, or alleviate to some extent, one or more of the symptoms of the cancer or precancer being treated in a subject, or which simply kills or inhibits the growth of diseased cells, or reduces the amount of EXO1 or other relevant markers in diseased cells.
  • the amount of compound 1, 2, 3, 4, 5, 6, 7, or 8 may inhibit, reduce or delay genomic evolution, increase cytotoxicity of the additional anti-cancer agent, or reduce genetic damage/instability caused by the anti-cancer (e.g., chemotherapeutic) agents in cancer or precancerous cells.
  • the anti-cancer e.g., chemotherapeutic
  • a “prophylactically effective amount” of a compound described herein is an amount sufficient to prevent a condition, or one or more symptoms associated with the condition or prevent its recurrence.
  • a prophylactically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with other agents, which provides a prophylactic benefit in the prevention of the condition.
  • the term “prophylactically effective amount” can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.
  • the total daily dosage of the compounds and usage thereof may be decided in accordance with standard medical practice, e.g, by the attending physician using sound medical judgment.
  • the specific therapeutically effective dose for any particular subject may depend upon a variety of factors including the disease or disorder being treated and the severity thereof (e.g. , its present status); the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts (see, for example, Goodman and Gilman's, The Pharmacological Basis of Therapeutics , 10th Edition, A. Gilman, J. Hardman and L. Limbird, eds., McGraw-Hill Press, 155-173, 2001).
  • the amount of compound 1, 2, 3, 4, 5, 6, 7, or 8 that is used for a therapeutic application varies with standard considerations, such as the nature of the condition being treated and the age and condition of the subject and may be ultimately determined by the attending physician.
  • Compounds 1-8 may be effective over a wide dosage range.
  • the total daily dosage (e.g., for adult humans) may range from about 0.0001 to about 3000 mg, from about 0.0001 to about 2000 mg, from about 0.0001 to about 1000 mg, from about 0.001 to about 1000 mg, from about 0.01 to about 1000 mg, from about 0.1 to about 1000 mg, from about 1 to about 1000 mg, from about 1 to about 100 mg, from about 10 to about 1000 mg, from about 100 to about 1000 mg, and in yet other embodiments from about 0.001 to about 100 mg/kg or from about 1.0 to about 100 pg/kg.
  • Individual dosages may be formulated to contain the desired dosage amount depending upon the number of times the compound is administered per day.
  • capsules may be formulated with from about 5 to about 25 mg of compound (e.g., 1, 2, 2.5, 3, 4, 5, 10, 15, 20, 25, 50, 100, 150, and 200 mg).
  • aspects of the present invention are directed to treating cancer or a precancerous condition.
  • the cancer or precancerous condition may be characterized by expression of EXO 1.
  • the cancer or precancerous condition may be characterized by EXO1 activity.
  • the cancer or precancerous condition may be characterized by expression of EXO 1 and EXO1 activity.
  • subject includes all members of the animal kingdom prone to or suffering from the indicated disease or disorder.
  • the subject is a mammal, e.g., a human or a non-human mammal.
  • the methods are also applicable to companion animals such as dogs and cats as well as livestock such as cows, horses, sheep, goats, pigs, and other domesticated and wild animals.
  • a subject “in need of’ the treatment may be suffering from or suspected of suffering from a specific disease or disorder may have been positively diagnosed or otherwise presents with a sufficient number of risk factors or a sufficient number or combination of signs or symptoms such that a medical professional could diagnose or suspect that the subject was suffering from the disease or disorder.
  • subjects suffering from a specific disease or disorder versus subjects suspected of suffering from a specific disease or disorder are not necessarily two distinct groups.
  • Compounds 1-8 and their pharmaceutically acceptable salts may be used to treat cancer or a precancerous condition by way of monotherapy.
  • the method entails administering a therapeutically effective amount of compound 1, 2, 3, 4, 5, 6, 7 or 8: pharmaceutically acceptable salt thereof, to a subject in need thereof.
  • compound 1, 2, 3, 4, 5, 6, 7, or 8 may be administered to a patient as monotherapy as a front/first-line therapy who has not undergone any prior anti-cancer treatment or as follow-on, e.g., “second line” therapy e.g., for a patient who is unresponsive to front line therapy, who has had previous treatments which have been partially successful but are intolerant to the particular treatment, or as an adjuvant treatment, i.e., to prevent reoccurrence of cancer in a patient with no currently detectable disease or after surgical removal of a tumor.
  • second line therapy e.g., for a patient who is unresponsive to front line therapy, who has had previous treatments which have been partially successful but are intolerant to the particular treatment, or as an adjuvant treatment, i.e., to prevent reoccurrence of cancer in a patient with no currently detectable disease or after surgical removal of a tumor.
  • Compounds 1-8 and their pharmaceutically acceptable salts may also be used to treat cancer or a precancerous condition by way of combination therapy.
  • the method comprises administering in combination to a subject in need thereof a therapeutically effective amount of any one or more of compounds 1, 2, 3, 4, 5, 6, 7 and 8: pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an additional anti-cancer agent, wherein the additional anti-cancer agent exhibits greater cytotoxicity to cancer cells of the subject than when administered alone without any of compounds 1-8.
  • the term “administered in combination” means that the two active agents are co-administered.
  • Co-administration includes substantially contemporaneous administration, by way of the same or separate dosage forms, and by the same or different modes of administration, or sequentially (either one before the other), e.g., as part of the same treatment regimen, or by way of successive treatment regimens. Therefore, the method is not limited to the administration of the active agents at exactly the same time. If administered sequentially, administration of the second agent is timed such that it is capable of augmenting the anti-cancer effect of the first and previously administered agent.
  • the co-administration of compound 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 and the additional anti-cancer agent achieves a synergistic anti-cancer effect.
  • the additional anti-cancer (e.g, chemotherapeutic) agent exhibits greater cytotoxicity to cancer cells of the subject when administered in combination with compound 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 than when administered alone as a single active agent, without any of compounds 1-8.
  • the synergistic anti-cancer effect may be the result of reducing genomic instability and heterogeneity caused by known chemotherapeutic agents such as melphalan.
  • the dosage of the additional anticancer therapeutic may be the same or even lower than known or recommended doses. See, Hardman et al., eds., Goodman & Gilman's The Pharmacological Basis Of Basis Of Therapeutics , 10th ed., McGraw-Hill, New York, 2001; Physician's Desk Reference. 60th ed., 2006.
  • the methods of the present invention may entail administration of compounds 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 and/or the additional anti-cancer agent, or pharmaceutical compositions thereof to the patient in a single dose or in multiple doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, or more doses).
  • the frequency of administration may range from once a day up to about once every eight weeks. In some embodiments, the frequency of administration ranges from about once a day for 1, 2, 3, 4, 5, or 6 weeks, and in other embodiments entails a 28-day cycle which includes daily administration for 3 weeks (21 days).
  • the compound may be dosed twice a day (BID) over the course of two and a half days (for a total of 5 doses) or once a day (QD) over the course of two days (for a total of 2 doses). In other embodiments, the compound may be dosed once a day (QD) over the course of five days.
  • the length of the treatment period depends on a variety of factors, such as severity of the disease, age of the subject, the concentration and the activity of the compound, or a combination thereof. It will also be appreciated that the effective dosage of the compound used for the treatment may increase or decrease over the course of a particular treatment regime.
  • additional anti-cancer agents that may be effective in the inventive methods include chemotherapeutic agents such as melphalan, vincristine, cyclophosphamide, dexamethasone, etoposide, doxorubicin, bendamustine, bevacizumab, irinotecan hydrochloride, capecitabine, cetuximab, ramucirumab, oxaliplatin, cetuximab, fluorouracil, ipilimumab, pembrolizumab, nivolumab, panitumumab, regorafenib, abemaciclib, paclitaxel, everolimus, anastrozole, atezolizumab, docetaxel, epirubicin hydrochloride, exemestane, toremifene, fulvestrant, letrozole, gemcitabine hydrochloride, eribulin mesylate, trastuzum
  • the other anti-cancer agent is a proteasome inhibitor, examples of which include bortezomib, carfilzomib, and ixazomib.
  • the other anti-cancer agent is an immunomodulating agent, examples of which include thalidomide, lenalidomide, pomalidomide and CC-885.
  • the other anti-cancer agent is cyclophosphamide.
  • the other anti-cancer agent is melphalan.
  • the other anti-cancer agent is lenalidomide.
  • the other anti-cancer agent is bortezomib.
  • the other anti-cancer agent is dexamethasone.
  • the other anti-cancer agent is doxorubicin.
  • the other anti-cancer agent is bendamustine.
  • compound 1 is used in combination with cyclophosphamide.
  • compound 1 is used in combination with melphalan.
  • compound 1 is used in combination with lenalidomide.
  • compound 1 is used in combination with bortezomib.
  • compound 1 is used in combination with dexamethasone.
  • compound 1 is used in combination with doxorubicin.
  • compound 1 is used in combination with bendamustine.
  • compound 2 is used in combination with cyclophosphamide.
  • compound 2 is used in combination with melphalan.
  • compound 2 is used in combination with lenalidomide.
  • compound 2 is used in combination with bortezomib.
  • compound 2 is used in combination with dexamethasone.
  • compound 2 is used in combination with doxorubicin.
  • compound 2 is used in combination with bendamustine.
  • compound 3 is used in combination with cyclophosphamide.
  • compound 3 is used in combination with melphalan.
  • compound 3 is used in combination with lenalidomide.
  • compound 3 is used in combination with bortezomib.
  • compound 3 is used in combination with dexamethasone.
  • compound 3 is used in combination with doxorubicin.
  • compound 3 is used in combination with bendamustine.
  • compound 4 is used in combination with cyclophosphamide.
  • compound 4 is used in combination with melphalan.
  • compound 4 is used in combination with lenalidomide.
  • compound 4 is used in combination with bortezomib.
  • compound 4 is used in combination with dexamethasone.
  • compound 4 is used in combination with doxorubicin.
  • compound 4 is used in combination with bendamustine.
  • compound 5 is used in combination with cyclophosphamide.
  • compound 5 is used in combination with melphalan.
  • compound 5 is used in combination with lenalidomide.
  • compound 5 is used in combination with bortezomib. [00113] In some embodiments, compound 5 is used in combination with dexamethasone. [00114] In some embodiments, compound 5 is used in combination with doxorubicin. [00115] In some embodiments, compound 5 is used in combination with bendamustine. [00116] In some embodiments, compound 6 is used in combination with cyclophosphamide. [00117] In some embodiments, compound 6 is used in combination with melphalan.
  • compound 6 is used in combination with lenalidomide.
  • compound 6 is used in combination with bortezomib.
  • compound 6 is used in combination with dexamethasone.
  • compound 6 is used in combination with doxorubicin.
  • compound 6 is used in combination with bendamustine.
  • compound 7 is used in combination with cyclophosphamide.
  • compound 7 is used in combination with melphalan.
  • compound 7 is used in combination with lenalidomide.
  • compound 7 is used in combination with bortezomib.
  • compound 7 is used in combination with dexamethasone.
  • compound 7 is used in combination with doxorubicin.
  • compound 7 is used in combination with bendamustine.
  • compound 8 is used in combination with cyclophosphamide.
  • compound 8 is used in combination with melphalan.
  • compound 8 is used in combination with lenalidomide.
  • compound 8 is used in combination with bortezomib.
  • compound 8 is used in combination with dexamethasone.
  • compound 8 is used in combination with doxorubicin.
  • compound 8 is used in combination with bendamustine.
  • Cancers which may be amenable to combination therapy according to the present invention include carcinomas (solid tumors including both primary and metastatic tumors), sarcomas, melanomas, and hematological cancers (cancers affecting blood including lymphocytes, bone marrow and/or lymph nodes) such as leukemia, lymphoma and multiple myeloma.
  • carcinomas solid tumors including both primary and metastatic tumors
  • sarcomas sarcomas
  • melanomas hematological cancers (cancers affecting blood including lymphocytes, bone marrow and/or lymph nodes) such as leukemia, lymphoma and multiple myeloma.
  • hematological cancers cancers affecting blood including lymphocytes, bone marrow and/or lymph nodes
  • leukemia lymphoma
  • lymphoma multiple myeloma
  • the cancers may be vascularized, or not yet substantially vascularized, or non-vascularized tumors.
  • Sarcomas that may be treatable with the methods of the present invention include both soft tissue and bone cancers alike, representative examples of which include osteosarcoma or osteogenic sarcoma (bone) (e.g, Ewing’s sarcoma), chondrosarcoma (cartilage), leiomyosarcoma (smooth muscle), rhabdomyosarcoma (skeletal muscle), mesothelial sarcoma or mesothelioma (membranous lining of body cavities), fibrosarcoma (fibrous tissue), and angiosarcoma or hemangioendothelioma (blood vessels).
  • bone e.g, Ewing’s sarcoma
  • chondrosarcoma cartilage
  • leiomyosarcoma smooth muscle
  • rhabdomyosarcoma skeletal muscle
  • mesothelial sarcoma or mesothelioma membranous lining of
  • methods of the present invention entail treatment of subjects having a cancer of the thyroid, skin, cervix, esophagus, stomach, or hematological system.
  • the cancer may be a hematological or an esophageal cancer.
  • Representative examples of hematological cancers that may be amenable to treatment with the methods of the present invention include lymphoma, leukemia, myeloid neoplasms, mast cell neoplasms, myelodysplasia, benign monoclonal gammopathy, lymphomatoid papulosis, polycythemia vera, chronic myelocytic leukemia, agnogenic myeloid metaplasia, and essential thrombocythemia.
  • hematologic cancers may thus include multiple myeloma, lymphoma (including T-cell lymphoma, Hodgkin’s lymphoma, non-Hodgkin’s lymphoma (diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL) and ALK+ anaplastic large cell lymphoma (e.g., B-cell non-Hodgkin’s lymphoma selected from diffuse large B-cell lymphoma (e.g., germinal center B-cell-like diffuse large B-cell lymphoma or activated B-cell-like diffuse large B-cell lymphoma), Burkitt’s lymphoma/leukemia, mantle cell lymphoma, mediastinal (thymic) large B-cell lymphoma, follicular lymphoma, marginal zone lymphoma, lymphoplasmacytic lymphoma/Waldenstrom macro
  • esophageal cancers that may be amenable to treatment with the methods of the present invention include all forms of cell proliferative disorders affecting esophageal cells such as esophageal cancer (e.g., esophageal adenocarcinoma, esophageal squamous cell carcinoma, esophageal leiomyosarcoma, esophageal rhabdomyosarcoma, esophageal melanoma, and esophageal lymphoma), a precancer or precancerous condition of the esophagus, hyperplasia of the esophagus, dysplasia of the esophagus, benign growths or lesions of the esophagus, and malignant growths or lesions of the esophagus, and metastatic lesions in tissue and organs in the body other than the esophagus.
  • esophageal cancer e
  • the methods may be useful in the treatment of esophageal adenocarcinoma.
  • Inventive methods that treat pre-cancerous conditions may deter or delay onset of cancer.
  • the methods may be useful in the treatment of monoclonal gammopathy of undetermined significance (MGUS) and/or to prevent or delay its progression.
  • MGUS monoclonal gammopathy of undetermined significance
  • the methods may be useful in the treatment of Barrett’s esophagus and/or to prevent or delay its progression.
  • compound 1 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 1 is used in combination with melphalan to treat multiple myeloma.
  • compound 1 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 1 is used in combination with bortezomib to treat multiple myeloma.
  • compound 1 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 1 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 1 is used in combination with bendamustine to treat multiple myeloma.
  • compound 2 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 2 is used in combination with melphalan to treat multiple myeloma.
  • compound 2 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 2 is used in combination with bortezomib to treat multiple myeloma.
  • compound 2 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 2 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 2 is used in combination with bendamustine to treat multiple myeloma.
  • compound 3 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 3 is used in combination with melphalan to treat multiple myeloma.
  • compound 3 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 3 is used in combination with bortezomib to treat multiple myeloma.
  • compound 3 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 3 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 3 is used in combination with bendamustine to treat multiple myeloma.
  • compound 4 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 4 is used in combination with melphalan to treat multiple myeloma.
  • compound 4 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 4 is used in combination with bortezomib to treat multiple myeloma.
  • compound 4 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 4 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 4 is used in combination with bendamustine to treat multiple myeloma.
  • compound 5 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 5 is used in combination with melphalan to treat multiple myeloma.
  • compound 5 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 5 is used in combination with bortezomib to treat multiple myeloma.
  • compound 5 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 5 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 5 is used in combination with bendamustine to treat multiple myeloma.
  • compound 6 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 6 is used in combination with melphalan to treat multiple myeloma.
  • compound 6 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 6 is used in combination with bortezomib to treat multiple myeloma.
  • compound 6 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 6 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 6 is used in combination with bendamustine to treat multiple myeloma.
  • compound 7 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 7 is used in combination with melphalan to treat multiple myeloma.
  • compound 7 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 7 is used in combination with bortezomib to treat multiple myeloma.
  • compound 7 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 7 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 7 is used in combination with bendamustine to treat multiple myeloma.
  • compound 8 is used in combination with cyclophosphamide to treat multiple myeloma.
  • compound 8 is used in combination with melphalan to treat multiple myeloma.
  • compound 8 is used in combination with lenalidomide to treat multiple myeloma.
  • compound 8 is used in combination with bortezomib to treat multiple myeloma.
  • compound 8 is used in combination with dexamethasone to treat multiple myeloma.
  • compound 8 is used in combination with doxorubicin to treat multiple myeloma.
  • compound 8 is used in combination with bendamustine to treat multiple myeloma.
  • kits or pharmaceutical systems may be assembled into kits or pharmaceutical systems.
  • Kits or pharmaceutical systems according to this aspect of the invention include a carrier or package such as a box, carton, tube or the like, having in close confinement therein one or more containers, such as vials, tubes, ampoules, or bottles, which contains compound 1, 2, 3, 4, 5, 6, 7, or 8, or a pharmaceutical composition thereof.
  • the kits or pharmaceutical systems of the invention may also include printed instructions for using the compounds and compositions.
  • Example 1 Materials and Methods
  • a custom library of 100,000 small molecules was used to identify novel inhibitors of EXO1 activity in myeloma cells. These inhibitors were evaluated for impact on genome stability and growth, alone as well as in the presence of existing MM drugs, in MM cell lines.
  • DNA breaks were estimated by evaluating MM cells for levels of y-H2A.X. Expression of '/-H2AX was measured by Western blotting using anti-H2A.X (Serl39, antibody # 2577; Cell Signaling Technology®) as previously reported (Pal, et al., J. Gastroenterol. Hepatol. Res. 6(1)'. 2286-2295 (2017)).
  • DNA double strand break end resection requires phosphorylation of RPA32 on S4/8. Levels of phosphorylated RPA32 were detected using anti-phospho-RPA32 (S4/8) or RPA32 antibodies (Bethyl Laboratories).
  • the cells were cultured in the presence or absence of an EXO1 inhibitor, melphalan or combination of both.
  • the cells were evaluated for micronuclei, a marker of unstable genome (Balmus et al., Nat. Protoc. 10(1):205-215 (2015); Terradas et al., Arch. Toxicol. 90(11).2657 -2667 (2016)), using Micronucleus Assay MicroFlow® kit (Litron Laboratories, New York, USA).
  • Cells were treated as indicated for 72 hours and viability assessed using CellTiter- Glo® Luminescent Cell Viability Assay (Promega®) or Cell Counting Kit-8 (CCK-8) assay (Sigma Aldrich®) according to the manufacturer’s protocol.
  • Myeloma (RMPI) cell lysate was incubated with various concentrations of inhibitor. The EXO1 activity was evaluated. Cells were lysed in IP lysis buffer at 10,000 cells/pL and diluted 10-fold in the EXO1 assay buffer (20 mM Trish-HCl pH 7.0, 0.76 mM HEPES, 120 mM KC1, 1.5 mM ATP, ImM glutathione, 5mM MgCh, 0.25 mg/mL BSA, 600 pM DTT and 1% glycerol) to a final concentration of 1000 cells/pL. Diluted lysate (40 pL) was added per cell in 96 well plate.
  • DMSO or 20 pL inhibitor prepared in the assay buffer at 3X the respective final doses
  • EXO1 substrate oligo GGATCCCCGC[T(FAM)]AGCGGGTACCGAGCTCGAATTCACTGG (SEQ ID NO: 1)- RTQ1
  • 60 pL of substrate in assay buffer was added to the lysates.
  • Samples were transferred into 384 well plates (30 pL/well *3) and fluorescence was measured at different time points at Em 560 nm, Ex 594 nm. Reading from the no lysate well was used as background (FIG. 2).
  • Myeloma (H929 and MM1S) cells were treated overnight or for 36 hours with compounds 1 and 3 at different concentrations. The cells were then lysed, and the lysates (at 5 pg/pL protein) were mixed with EXO1 assay substrate and incubated at 37°C for 30 minutes. The fluorescence intensity was measured using a plate reader (Emission wavelength 521 nm and excitation wavelength 490 nm) (FIG. 3).
  • HDF human normal diploid fibroblast
  • MM cell lines (20 in Panel A and 10 in Panel B) were treated for 3 days with compound 1 at different concentrations and cell viability was assessed by CellTiter-Glo® (FIG. 4).
  • Normal/non-cancerous cell types including HDF (human normal diploid fibroblasts), HEEC (primary human esophageal epithelial cells, and HS5 (bone marrow stromal cell line; right panel) and MM cell lines (MM1 S, U266) were treated for various durations with compound 2 at 16 pM and cell viability assessed by CellTiter-Glo®.
  • Compound 2 inhibits growth of myeloma cell lines with minimal impact on three different normal cell types (FIG. 6).
  • PBMC Normal cell types
  • PBMC activated PBMC
  • MM cells lines AM01, H929, KK1
  • Growth curves (I) and IC50 values (II) are shown in FIG. 8.
  • MM (MM1R and MM1S) cells were treated with compounds 1 and 3. Live cell fraction purified and the impact on micronuclei (a marker of genomic instability) was assessed with flow cytometry (FIG. 23 and FIG. 24).
  • Elevated expression and/or activity of Exonuclease 1 contribute to increased HR activity, DNA breaks (both endogenous as well as DNA damaging agent-induced) and cell cycle progression, and thus drive genomic evolution in MM cells.
  • EXO1 is a critical target and its inhibitors, compounds 1-8, have ability to: (1) inhibit growth of cancer cells; (2) increase cytotoxicity (or efficacy) of existing cancer drugs; (3) inhibit or reduce genomic evolution in multiple myeloma and esophageal cancer and other cancers, preventing or delaying the progression of cancer to advanced stages including development of drug resistance; and (4) prevent or reduce the DNA damage and genomic instability caused by chemotherapeutic agents.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed are compounds and their pharmaceutically acceptable salts that possess inhibitory activity against EXO1, and methods of using the compounds and salts to treat cancer and precancerous conditions.

Description

INHIBITORS OF EXO1 IN COMBINATION WITH OTHER CANCER DRUGS TO INHIBIT CANCER CELLS
RELATED APPLICATIONS
[0001] This application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No: 63/106,636, filed October 28, 2020, which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on October 27, 2021, is named “52095-606001WO_ST25” and is 0.68 KB in size.
BACKGROUND OF THE INVENTION
[0003] The majority of cancers display a complex spectrum of diverse genetic alterations at diagnosis, and acquire additional changes with progression of disease, indicating a genomic instability, which seems to arise early at the premalignant stage. Genomic instability enables cells to acquire new genomic characteristics for progression and resist therapy. The number of mutations correlates with overall and event free survival in multiple myeloma (MM), suggesting a role of genomic instability in poor clinical outcome. Dysregulated homologous recombination (HR) is a key mediator of genomic instability and drug resistance in MM, as well as contributes to telomere maintenance and tumor growth in cancer cells. Exonuclease (EXO1), through its 5'— >3' double-stranded DNA exonuclease activity, brings about DNA end resection. This is a critical step in the initiation of HR. EXO1 also contributes to DNA mismatch repair, repair of 5'-overhanging flap structures, somatic hypermutation and class switch recombination of immunoglobulin genes.
SUMMARY OF THE INVENTION
[0004] The present invention is based, at least in part, on a discovery that Exonuclease (EXO1), contributes to increased DNA damage, HR activity and genomic instability in cancer cells at multiple levels. Data presented in the working examples show that inhibition of EXO 1 activity in cancer cells reduces DNA breaks, inhibits HR and genomic instability, and induces cell cycle arrest. The working examples also show that inhibition of EXO 1 activity increases sensitivity of MM cells to cancer drugs such as melphalan and bortezomib. Although inhibition of EXO1 activity increases cytotoxicity, it reduces genomic instability and heterogeneity caused by melphalan, a known chemotherapeutic agent. The present invention includes methods for using EXO1 inhibitors in combination with chemotherapeutics, such as melphalan, to treat cancer and pre-cancerous conditions. Embodiments of the invention achieve a synergistic effect in terms of cytotoxicity and/or reduced genomic instability in treated subjects. [0005] A first aspect of the present invention is directed to a method of treating cancer or a pre-cancerous condition wherein cells of the cancer or pre-cancer express exonuclease 1 (EXO1) (and/or the cancer or pre-cancerous condition has EXO1 activity), comprising administering a therapeutically effective amount of compound 1, 2, 3, 4, 5, 6, 7 or 8:
Figure imgf000003_0001
pharmaceutically acceptable salt thereof, to a subject in need thereof. [0006 ] A related aspect is directed to a method of treating cancer or a precancerous condition wherein cells of the cancer or pre-cancer express EXO1 (and/or the cancer or pre-cancerous condition has EXO1 activity), which comprises administering in combination to a subject in need thereof a therapeutically effective amount of any one or more of compounds 1, 2, 3, 4, 5, 6, 7 and 8:
Figure imgf000004_0001
pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an additional anti-cancer (e.g., chemotherapeutic) agent, wherein the additional anti-cancer (e.g., chemotherapeutic) agent exhibits greater cytotoxicity to cancer cells of the subject than when administered alone without any of compounds 1-8.
[0007] Without intending to be bound by theory, the inventive methods, may increase cytotoxicity of existing cancer drugs, and/or reduce genetic damage/instability caused by anticancer (chemotherapeutic) agents in cancer and pre-cancerous cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1A-FIG. ID are a series of chemical structures and graphs showing the characteristics of three EXO1 inhibitors. FIG. 1 A shows the chemical structures of compounds 1, 2, and 3. FIG. 1B-FIG. ID is a series of graphs that demonstrate a dose-dependent inhibition of EXO1 activity by compounds 1, 2, and 3, respectively.
[0009] FIG. 2 is a bar graph depicting compound 1 activity in MM (RPMI) cell lysate.
[0010] FIG. 3 is a series of bar graphs showing that EXO1 activity is inhibited in MM (H929 and MM1S) cells cultured in the presence of compounds 1 (left) and 3 (right).
[0011 ] FIG. 4A-FIG. 4B is a series of bar graphs showing the impact of three-day treatment with compound 1 on indicated MM cells and normal cell viability.
|0012] FIG. 5A-FIG. 5B is a series of bar graphs showing the impact of five-day treatment with compound 1 on indicated MM cells and normal cell viability.
[0013] FIG. 6 is a series of graphs showing that compound 2 inhibited the growth of MM (MM1S and U266) cell lines with minimal impact on three different normal cell types.
[0014] FIG. 7A is a series of bar graphs showing the impact of three-day treatment with compound 3 on indicated MM cells and normal cell viability. FIG. 7B is a series of bar graphs showing the impact of five-day treatment with compound 3 on indicated MM cells and normal cell viability.
[0015] FIG. 8A is a graph showing the ICso values compound 1 in three normal cell types and three MM (AM01, H929, and KK1) cell lines. FIG. 8B is a graph showing the cytotoxic effect (expressed in ICso values) of compound 3 in three normal cell types and three MM cell lines.
[0016] FIG. 9A is a series of bar graphs showing the impact of 24-hour treatment of compound 1, alone and in combination with bortezomib, on viability of MM (ARP1, LR5, and
MMIR) cells. FIG. 9B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib in MM (ARP1, LR5, and MM1R) cells.
[0017] FIG. 10A is a series of bar graphs showing the impact of 24-hour treatment of compound 3, alone and in combination with bortezomib, on viability of MM (H929, JJN3, KMS11, and MM1S) cells. FIG. 10B is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of bortezomib in MM (H929, JJN3, KMS11, and
MMIS) cells. [0018] FIG. 11A is a series of bar graphs showing the impact of 48-hour treatment of compound 1, alone and in combination with melphalan, on viability of MM (ARP1, MM1R, and MM1S) cells. FIG. 1 IB is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of melphalan in MM (ARP1, MM1R, and MM1S) cells. [0019] FIG. 12A is a series of bar graphs showing the impact of 72-hour treatment of compound 1, alone and in combination with dexamethasone, on viability of MM (MM1R) cells. FIG. 12B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of dexamethasone in MM (MM1R) cells.
[0020 ] FIG. 13 is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of dexamethasone in MM (MM1S, MM1R, LR5, KMS11, JJN3, and H929) cells following 72-hour treatment.
[0021] FIG. 14A is a series of bar graphs showing the impact of 72-hour treatment of compound 1, alone and in combination with lenalidomide, on viability of MM (H929) cells. FIG. 14B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of lenalidomide in MM (H929) cells.
[0022 ] FIG. 15 is a combination index plot showing that compound 3 has a synergistic impact on the cytotoxicity of lenalidomide in MM (MM1S, MM1R, LR5, KMS11, JJN3, and H929) cells following 72-hour treatment.
[0023] FIG. 16A is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of cyclophosphamide in MM (U266, KMS20, and AM01) cells following 72-hour treatment. FIG. 16B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bendamustine in MM (U266, KMS20, and AM01) cells following 72-hour treatment.
[0024] FIG. 17A is a series of bar graphs showing the impact of 48-hour treatment of compound 1, alone and in combination with doxorubicin, on viability of MM (MM1S and MM1R) cells. FIG. 17B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of doxorubicin in MM (MM1S and MM1R) cells.
[0025] FIG. 18A is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib, dexamethasone, and lenalidomide in MM (H929) cells. FIG. 18B is a combination index plot showing that compound 1 has a synergistic impact on the cytotoxicity of bortezomib, dexamethasone, and lenalidomide in MM (MM1S) cells.
[0026] FIG. 19A is a series of flow cytometry images showing the impact of compounds 1 and 3, alone (top panels) and in combination with dexamethasone (bottom panels), on apoptosis in MM (MM1S) cells. FIG. 19B is a bar graph showing the fraction of cells in early and late apoptosis in single and combination treatment in MM (MM1S) cells.
[0027] FIG. 20A is a series of flow cytometry images showing the impact of compounds 1 and 3, alone (top panels) and in combination with dexamethasone (bottom panels), on apoptosis in MM (H929) cells. FIG. 20B is a bar graph showing the fraction of cells in early and late apoptosis in single and combination treatment in MM (H929) cells.
[0028] FIG. 21 A is a Western blot showing that compound 1 inhibits DNA end resection and DNA breaks in MM (H929) cells. FIG. 21B is a bar graph showing that compound 1 inhibits DNA end resection and DNA breaks in MM (H929) cells.
[0029] FIG. 22A is a Western blot showing that compound 3 inhibits DNA end resection and DNA breaks in MM (H929) cells. FIG. 22B is a Western blot showing that compound 3 inhibits DNA end resection and DNA breaks in MM (MM1S) cells.
[0030] FIG. 23 A is a series of flow cytometry images of micronuclei for MM (MM1R) cells that were treated with DMSO (upper left), compound 1 (upper right), and compound 3 (lower left). FIG. 23B is a bar graph showing the percentage of micronuclei in MM (MM1R) cells.
[0031 ] FIG. 24A is a series of flow cytometry images of micronuclei for MM (MM1S) cells that were treated with DMSO (upper left), compound 1 (upper right), and compound 3 (lower left). FIG. 24B is a bar graph showing the percentage of micronuclei in MM (MM1S) cells.
|0032] FIG. 25A is a series of flow cytometry images of micronuclei for MM (MM1S) cells that were treated with compound 1 and melphalan, alone and in combination. FIG. 25B is a bar graph showing the percentage of micronuclei in MM (MM1S) cells.
[0033] FIG. 26A is a series of bar graphs showing the impact of a 3-day treatment of compound 8 on cell viability (panel I) and ICso values (panel II) in the indicated cell lines. FIG. 26B is a series of bar graphs showing the impact of 5-day treatment of compound 8 on cell viability (panel I) and IC50 values (panel II). Normal fibroblasts (HDF), t(4:14) MM cell lines (H929, KMS11, OPM1, OPM2) and non t(4:14) MM cell lines (MM1S, AM01 and JJN3) are shown.
[0034] FIG. 27A is a series of bar graphs showing the impact of bortezomib (velcade®) on compound 8-induced cell viability. FIG. 27B is a combination index plot showing synergistic impact of bortezomib on cytotoxicity of compound 8 in MM (H929 and MM1S) cells. DETAILED DESCRIPTION
[0035 ] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the subject matter herein belongs. As used in the specification and the appended claims, unless specified to the contrary, the following terms have the meaning indicated in order to facilitate the understanding of the present invention.
[0036] As used in the description and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a composition” includes mixtures of two or more such compositions, reference to “an inhibitor” includes mixtures of two or more such inhibitors, and the like.
[0037] Unless stated otherwise, the term “about” means within 10% (e.g, within 5%, 2% or 1%) of the particular value modified by the term “about.”
[0038} The transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements, or method steps. By contrast, the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
[0039] Methods of the present invention utilize the following compounds, as follows:
Figure imgf000008_0001
5-((3-(dimethylamino)propyl)amino)-9,10-dimethyl-8Ef- thieno[2',3':4,5]pyrimido[2,l-a]phthalazin-8-one ( 1, “0952”)
Figure imgf000008_0002
6-chloro-3-(m-tolyl)-[l,2,4]triazolo[4,3-b ]pyridazine(2, “2012”)
Figure imgf000009_0001
2'-(4-aminophenyl)-l/7,l'/7-[2,5'-bibenzo[</]imidazol]-5-amine (3 , “0054”)
Figure imgf000009_0002
5-((2-(dimethylamino)ethyl)amino)- N-methyl-8-oxo-9,12-dihydro-8H - pyrido[4",3" :4",5"]thieno[2',3':4,5]pyrimido[2, 1 -α]phthalazine- 11(10H)- carboxamide (4, "0156”),
Figure imgf000009_0003
5-((2-(dimethylamino)ethyl)amino)- N-methyl-8-oxo-9, 10,11,12-tetrahydro-8H - benzo[4',5']thieno[2',3':4,5]pyrimido[2,l-α]phthalazine-ll-carboxamide (5, " 0177”),
Figure imgf000009_0004
5-((2-(dimethylamino)ethyl)amino)-8-oxo-9, 10, 11 ,12-tetrahydro-8/7- benzo[4',5']thieno[2',3':4,5]pyrimido[2,1-α]phthalazine-11-carboxamide (6, " 0176”),
Figure imgf000010_0001
5-((2-(dimethylamino)ethyl)amino)-A,/V-dimethyl-8-oxo-9,10,ll,12- tetrahydro-8H -benzo[4',5']thieno[2',3':4,5]pyrimido[2,l-r?]phthalazine-ll- carboxamide
(7, “0178”),
Figure imgf000010_0002
9,10-dimethyl-5-((3-(4-methylpiperazin-l-yl)propyl)amino)-8H - thieno[2',3':4,5]pyrimido[2,l-c?]phthalazin-8-one “0051”), or a pharmaceutically acceptable salt thereof. The compounds may be synthesized in accordance with known procedures and/or are commercially available.
[0040 ] The compounds may be in the form of a free acid or free base, or a pharmaceutically acceptable salt. As used herein, the term "pharmaceutically acceptable" in the context of a salt refers to a salt of the compound that does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the compound in salt form may be administered to a subject without causing undesirable biological effects (such as dizziness or gastric upset) or interacting in a deleterious manner with any of the other components of the composition in which it is contained. The term "pharmaceutically acceptable salt" refers to a product obtained by reaction of the compound of the present invention with a suitable acid or a base. Examples of pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic bases such as Li, Na, K, Ca, Mg, Fe, Cu, Al, Zn and Mn salts. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, 4-methylbenzenesulfonate or p-toluenesulfonate salts and the like. Certain compounds of the invention can form pharmaceutically acceptable salts with various organic bases such as lysine, arginine, guanidine, diethanolamine or metformin.
Pharmaceutical Compositions
[0041] Compounds 1-8 and their pharmaceutically acceptable salts may be formulated into a variety of compositions for purposes of treating patients. Thus, practice of the inventive methods may entail formulating compounds 1-8 or a pharmaceutically acceptable salt thereof, with a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier,” as known in the art, refers to a pharmaceutically acceptable material, composition or vehicle, suitable for administering compounds of the present invention to mammals. Suitable carriers may include, for example, liquids (both aqueous and non-aqueous alike, and combinations thereof), solids, encapsulating materials, gases, and combinations thereof (e.g, semi-solids), and gases, that function to carry or transport the compound from one organ, or portion of the body, to another organ, or portion of the body. A carrier is “acceptable” in the sense of being physiologically inert to and compatible with the other ingredients of the formulation and not injurious to the subject or patient. Depending on the type of formulation, the composition may further include one or more pharmaceutically acceptable excipients.
[0042] Broadly, compounds 1-8 and their pharmaceutically acceptable salts may be formulated into a given type of composition in accordance with conventional pharmaceutical practice such as conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping and compression processes (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York). The type of formulation depends on the mode of administration which may include enteral (e.g., oral, buccal, sublingual and rectal), parenteral (e.g., subcutaneous (s.cf, intravenous (i.vf, intramuscular (i.mf, and intrastemal injection, or infusion techniques, intra-ocular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, interdermal, intravaginal, intraperitoneal, mucosal, nasal, intratracheal instillation, bronchial instillation, and inhalation) and topical (e.g, transdermal). In general, the most appropriate route of administration will depend upon a variety of factors including, for example, the nature of the agent (e.g, its stability in the environment of the gastrointestinal tract), and/or the condition of the subject (e.g, whether the subject is able to tolerate oral administration). For example, parenteral (e.g, intravenous) administration may also be advantageous in that the compound may be administered relatively quickly such as in the case of a single-dose treatment and/or an acute condition.
[0043] In some embodiments, the compounds are formulated for oral or intravenous administration (e.g., systemic intravenous injection).
|0O44] Accordingly, compounds 1-8 may be formulated into solid compositions (e.g., powders, tablets, dispersible granules, capsules, cachets, and suppositories), liquid compositions (e.g, solutions in which the compound is dissolved, suspensions in which solid particles of the compound are dispersed, emulsions, and solutions containing liposomes, micelles, or nanoparticles, syrups and elixirs); semi-solid compositions (e.g, gels, suspensions and creams); and gases (e.g, propellants for aerosol compositions). The compounds may also be formulated for rapid, intermediate or extended release.
|0045] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with a carrier such as sodium citrate or dicalcium phosphate and an additional carrier or excipient such as a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, methylcellulose, microcrystalline cellulose, hydroxypropylmethylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as crosslinked polymers (e.g, crosslinked polyvinylpyrrolidone (crospovidone), crosslinked sodium carboxymethyl cellulose (croscarmellose sodium), sodium starch glycolate, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also include buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings. They may further contain an opacifying agent.
[0046] In some embodiments, compounds 1-8 may be formulated in a hard or soft gelatin capsule. Representative excipients that may be used include pregelatinized starch, magnesium stearate, mannitol, sodium stearyl fumarate, lactose anhydrous, microcrystalline cellulose and croscarmellose sodium. Gelatin shells may include gelatin, titanium dioxide, iron oxides and colorants.
[0047] Liquid dosage forms for oral administration include solutions, suspensions, emulsions, micro-emulsions, syrups and elixirs. In addition to the compound, the liquid dosage forms may contain an aqueous or non-aqueous carrier (depending upon the solubility of the compounds) commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, com, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Oral compositions may also include an excipients such as wetting agents, suspending agents, coloring, sweetening, flavoring, and perfuming agents.
[0048] Injectable preparations may include sterile aqueous solutions or oleaginous suspensions. They may be formulated according to standard techniques using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. The effect of the compound may be prolonged by slowing its absorption, which may be accomplished by the use of a liquid suspension or crystalline or amorphous material with poor water solubility. Prolonged absorption of the compound from a parenterally administered formulation may also be accomplished by suspending the compound in an oily vehicle.
[0049] In certain embodiments, compounds 1-8 may be administered in a local rather than systemic manner, for example, via injection of the conjugate directly into an organ, often in a depot preparation or sustained release formulation. In specific embodiments, long acting formulations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Injectable depot forms are made by forming microencapsule matrices of the compound in a biodegradable polymer, e.g, polylactidepolyglycolides, poly(orthoesters) and poly(anhydrides). The rate of release of the compound may be controlled by varying the ratio of compound to polymer and the nature of the particular polymer employed. Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues. Furthermore, in other embodiments, the compound is delivered in a targeted drug delivery system, for example, in a liposome coated with organ-specific antibody. In such embodiments, the liposomes are targeted to and taken up selectively by the organ.
[0050] Compounds 1-8 may be formulated for buccal or sublingual administration, examples of which include tablets, lozenges and gels.
[0051] Compounds 1-8 may be formulated for administration by inhalation. Various forms suitable for administration by inhalation include aerosols, mists or powders. Pharmaceutical compositions may be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas). In some embodiments, the dosage unit of a pressurized aerosol may be determined by providing a valve to deliver a metered amount. In some embodiments, capsules and cartridges including gelatin, for example, for use in an inhaler or insufflator, may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0052] Compounds 1-8 may be formulated for topical administration which as used herein, refers to administration intradermally by application of the formulation to the epidermis. These types of compositions are typically in the form of ointments, pastes, creams, lotions, gels, solutions and sprays.
[0053] Representative examples of carriers useful in formulating compositions for topical application include solvents (e.g, alcohols, poly alcohols, water), creams, lotions, ointments, oils, plasters, liposomes, powders, emulsions, microemulsions, and buffered solutions (e.g, hypotonic or buffered saline). Creams, for example, may be formulated using saturated or unsaturated fatty acids such as stearic acid, palmitic acid, oleic acid, palmito-oleic acid, cetyl, or oleyl alcohols. Creams may also contain a non-ionic surfactant such as polyoxy-40-stearate. [0054] In some embodiments, the topical formulations may also include an excipient, an example of which is a penetration enhancing agent. These agents are capable of transporting a pharmacologically active compound through the stratum comeum and into the epidermis or dermis, preferably, with little or no systemic absorption. A wide variety of compounds have been evaluated as to their effectiveness in enhancing the rate of penetration of drugs through the skin. See, for example, Percutaneous Penetration Enhancers, Maibach H. I. and Smith H. E. (eds.), CRC Press, Inc., Boca Raton, Fla. (1995), which surveys the use and testing of various skin penetration enhancers, and Buyuktimkin et al. , Chemical Means of Transdermal Drug Permeation Enhancement in Transdermal and Topical Drug Delivery Systems, Gosh T. K., Pfister W. R., Yum S. I. (Eds.), Interpharm Press Inc., Buffalo Grove, Ill. (1997). Representative examples of penetration enhancing agents include triglycerides (e.g, soybean oil), aloe compositions (e.g, aloe-vera gel), ethyl alcohol, isopropyl alcohol, octolyphenylpolyethylene glycol, oleic acid, polyethylene glycol 400, propylene glycol, N- decylmethylsulfoxide, fatty acid esters (e.g., isopropyl myristate, methyl laurate, glycerol monooleate, and propylene glycol monooleate), and N-methylpyrrolidone.
[0055] Representative examples of yet other excipients that may be included in topical as well as in other types of formulations (to the extent they are compatible), include preservatives, antioxidants, moisturizers, emollients, buffering agents, solubilizing agents, skin protectants, and surfactants. Suitable preservatives include alcohols, quaternary amines, organic acids, parabens, and phenols. Suitable antioxidants include ascorbic acid and its esters, sodium bisulfite, butylated hydroxy toluene, butylated hydroxyanisole, tocopherols, and chelating agents like EDTA and citric acid. Suitable moisturizers include glycerin, sorbitol, polyethylene glycols, urea, and propylene glycol. Suitable buffering agents include citric, hydrochloric, and lactic acid buffers. Suitable solubilizing agents include quaternary ammonium chlorides, cyclodextrins, benzyl benzoate, lecithin, and polysorbates. Suitable skin protectants include vitamin E oil, allatoin, dimethicone, glycerin, petrolatum, and zinc oxide.
[0056] Transdermal formulations typically employ transdermal delivery devices and transdermal delivery patches wherein the compound is formulated in lipophilic emulsions or buffered, aqueous solutions, dissolved and/or dispersed in a polymer or an adhesive. Patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. Transdermal delivery of the compounds may be accomplished by means of an iontophoretic patch. Transdermal patches may provide controlled delivery of the compounds wherein the rate of absorption is slowed by using rate-controlling membranes or by trapping the compound within a polymer matrix or gel. Absorption enhancers may be used to increase absorption, examples of which include absorbable pharmaceutically acceptable solvents that assist passage through the skin.
[0057] Ophthalmic formulations include eye drops.
[0058] Formulations for rectal administration include enemas, rectal gels, rectal foams, rectal aerosols, and retention enemas, which may contain conventional suppository bases such as cocoa butter or other glycerides, as well as synthetic polymers such as polyvinylpyrrolidone, PEG, and the like. Compositions for rectal or vaginal administration may also be formulated as suppositories which can be prepared by mixing the compound with suitable non-irritating carriers and excipients such as cocoa butter, mixtures of fatty acid glycerides, polyethylene glycol, suppository waxes, and combinations thereof, all of which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the compound.
Dosage Amounts
[0059] As used herein, the term, "therapeutically effective amount" refers to an amount of compound 1, 2, 3, 4, 5, 6, 7, or 8, or a pharmaceutically acceptable salt thereof, effective in producing the desired therapeutic response in a particular patient suffering from cancer or a precancerous condition. The term "therapeutically effective amount" includes the amount of the compound or a pharmaceutically acceptable salt thereof, when administered, may induce a positive modification in the cancer or precancerous condition to be treated (e.g, to inhibit or reduce EXO1 activity), or is sufficient to prevent progression of the cancer or precancer, or alleviate to some extent, one or more of the symptoms of the cancer or precancer being treated in a subject, or which simply kills or inhibits the growth of diseased cells, or reduces the amount of EXO1 or other relevant markers in diseased cells. In the context of co-therapy, the amount of compound 1, 2, 3, 4, 5, 6, 7, or 8 may inhibit, reduce or delay genomic evolution, increase cytotoxicity of the additional anti-cancer agent, or reduce genetic damage/instability caused by the anti-cancer (e.g., chemotherapeutic) agents in cancer or precancerous cells.
[0060] A “prophylactically effective amount” of a compound described herein is an amount sufficient to prevent a condition, or one or more symptoms associated with the condition or prevent its recurrence. A prophylactically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with other agents, which provides a prophylactic benefit in the prevention of the condition. The term “prophylactically effective amount” can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent. [0061 ] The total daily dosage of the compounds and usage thereof may be decided in accordance with standard medical practice, e.g, by the attending physician using sound medical judgment. The specific therapeutically effective dose for any particular subject may depend upon a variety of factors including the disease or disorder being treated and the severity thereof (e.g. , its present status); the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts (see, for example, Goodman and Gilman's, The Pharmacological Basis of Therapeutics , 10th Edition, A. Gilman, J. Hardman and L. Limbird, eds., McGraw-Hill Press, 155-173, 2001).
[0062] The amount of compound 1, 2, 3, 4, 5, 6, 7, or 8 that is used for a therapeutic application varies with standard considerations, such as the nature of the condition being treated and the age and condition of the subject and may be ultimately determined by the attending physician.
[0063] Compounds 1-8 may be effective over a wide dosage range. In some embodiments, the total daily dosage (e.g., for adult humans) may range from about 0.0001 to about 3000 mg, from about 0.0001 to about 2000 mg, from about 0.0001 to about 1000 mg, from about 0.001 to about 1000 mg, from about 0.01 to about 1000 mg, from about 0.1 to about 1000 mg, from about 1 to about 1000 mg, from about 1 to about 100 mg, from about 10 to about 1000 mg, from about 100 to about 1000 mg, and in yet other embodiments from about 0.001 to about 100 mg/kg or from about 1.0 to about 100 pg/kg. Individual dosages may be formulated to contain the desired dosage amount depending upon the number of times the compound is administered per day. By way of example, capsules may be formulated with from about 5 to about 25 mg of compound (e.g., 1, 2, 2.5, 3, 4, 5, 10, 15, 20, 25, 50, 100, 150, and 200 mg).
Methods of Use
[0064] Aspects of the present invention are directed to treating cancer or a precancerous condition. In some embodiments, the cancer or precancerous condition may be characterized by expression of EXO 1. In some embodiments, the cancer or precancerous condition may be characterized by EXO1 activity. In some embodiments, the cancer or precancerous condition may be characterized by expression of EXO 1 and EXO1 activity.
[0065] The term “subject” (or “patient”) as used herein includes all members of the animal kingdom prone to or suffering from the indicated disease or disorder. In some embodiments, the subject is a mammal, e.g., a human or a non-human mammal. The methods are also applicable to companion animals such as dogs and cats as well as livestock such as cows, horses, sheep, goats, pigs, and other domesticated and wild animals. A subject “in need of’ the treatment may be suffering from or suspected of suffering from a specific disease or disorder may have been positively diagnosed or otherwise presents with a sufficient number of risk factors or a sufficient number or combination of signs or symptoms such that a medical professional could diagnose or suspect that the subject was suffering from the disease or disorder. Thus, subjects suffering from a specific disease or disorder versus subjects suspected of suffering from a specific disease or disorder are not necessarily two distinct groups.
[0066] Compounds 1-8 and their pharmaceutically acceptable salts may be used to treat cancer or a precancerous condition by way of monotherapy. The method entails administering a therapeutically effective amount of compound 1, 2, 3, 4, 5, 6, 7 or 8:
Figure imgf000018_0001
pharmaceutically acceptable salt thereof, to a subject in need thereof. Thus, in some embodiments, compound 1, 2, 3, 4, 5, 6, 7, or 8 may be administered to a patient as monotherapy as a front/first-line therapy who has not undergone any prior anti-cancer treatment or as follow-on, e.g., “second line” therapy e.g., for a patient who is unresponsive to front line therapy, who has had previous treatments which have been partially successful but are intolerant to the particular treatment, or as an adjuvant treatment, i.e., to prevent reoccurrence of cancer in a patient with no currently detectable disease or after surgical removal of a tumor.
[0067] Compounds 1-8 and their pharmaceutically acceptable salts may also be used to treat cancer or a precancerous condition by way of combination therapy. The method comprises administering in combination to a subject in need thereof a therapeutically effective amount of any one or more of compounds 1, 2, 3, 4, 5, 6, 7 and 8:
Figure imgf000019_0001
pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an additional anti-cancer agent, wherein the additional anti-cancer agent exhibits greater cytotoxicity to cancer cells of the subject than when administered alone without any of compounds 1-8.
[0068] As used herein, the term “administered in combination” means that the two active agents are co-administered. Co-administration includes substantially contemporaneous administration, by way of the same or separate dosage forms, and by the same or different modes of administration, or sequentially (either one before the other), e.g., as part of the same treatment regimen, or by way of successive treatment regimens. Therefore, the method is not limited to the administration of the active agents at exactly the same time. If administered sequentially, administration of the second agent is timed such that it is capable of augmenting the anti-cancer effect of the first and previously administered agent. In some embodiments, the co-administration of compound 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 and the additional anti-cancer agent achieves a synergistic anti-cancer effect. For example, in some embodiments, the additional anti-cancer (e.g, chemotherapeutic) agent exhibits greater cytotoxicity to cancer cells of the subject when administered in combination with compound 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 than when administered alone as a single active agent, without any of compounds 1-8. In some embodiments, the synergistic anti-cancer effect may be the result of reducing genomic instability and heterogeneity caused by known chemotherapeutic agents such as melphalan.
[0069] In view of these effects, in some embodiments, the dosage of the additional anticancer therapeutic may be the same or even lower than known or recommended doses. See, Hardman et al., eds., Goodman & Gilman's The Pharmacological Basis Of Basis Of Therapeutics , 10th ed., McGraw-Hill, New York, 2001; Physician's Desk Reference. 60th ed., 2006.
[0070] The methods of the present invention may entail administration of compounds 1 and/or 2 and/or 3 and/or 4 and/or 5 and/or 6 and/or 7 and/or 8 and/or the additional anti-cancer agent, or pharmaceutical compositions thereof to the patient in a single dose or in multiple doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, or more doses). For example, the frequency of administration may range from once a day up to about once every eight weeks. In some embodiments, the frequency of administration ranges from about once a day for 1, 2, 3, 4, 5, or 6 weeks, and in other embodiments entails a 28-day cycle which includes daily administration for 3 weeks (21 days). In other embodiments, the compound may be dosed twice a day (BID) over the course of two and a half days (for a total of 5 doses) or once a day (QD) over the course of two days (for a total of 2 doses). In other embodiments, the compound may be dosed once a day (QD) over the course of five days. The length of the treatment period depends on a variety of factors, such as severity of the disease, age of the subject, the concentration and the activity of the compound, or a combination thereof. It will also be appreciated that the effective dosage of the compound used for the treatment may increase or decrease over the course of a particular treatment regime.
[0071] Representative examples of additional anti-cancer agents that may be effective in the inventive methods include chemotherapeutic agents such as melphalan, vincristine, cyclophosphamide, dexamethasone, etoposide, doxorubicin, bendamustine, bevacizumab, irinotecan hydrochloride, capecitabine, cetuximab, ramucirumab, oxaliplatin, cetuximab, fluorouracil, ipilimumab, pembrolizumab, nivolumab, panitumumab, regorafenib, abemaciclib, paclitaxel, everolimus, anastrozole, atezolizumab, docetaxel, epirubicin hydrochloride, exemestane, toremifene, fulvestrant, letrozole, gemcitabine hydrochloride, eribulin mesylate, trastuzumab, palbociclib, ixabepilone, ribociclib, olaparib, methotrexate, pertuzumab, thiotepa, alectinib, brigatinib, dabrafenib, dacomitinib, durvalumab, gefitinib, lorlatinib, sunitinib malate, mitomycin C, osimertinib mesylate, dactinomycin, ifosfamide, vinblastine sulfate, bleomycin sulfate, topotecan hydrochloride, hydroxyurea, megestrol acetate, glasdegib, venetoclax, paxopanib, temsirolimus, abiraterone acetate, apalutamide, bicalutamide, cabazitaxel, degarelix, leuprolide acetate, enzalutamide, flutamide, goserelin acetate, nilutamide, sipuleucel-T, radium 223 dichloride, aldesleukin, auelumab, axitinib, cabozantinib-S-malate, lenvatinib mesylate, sorafenib tosylate, bortezomib, carfilzomib, ixazomib, thalidomide, lenalidomide, pomalidomide, iberdomide, CC-885 and cellular and antibody-drug conjugates, antibody-based therapies such as daratumumab, elotuzumab, bispecific antibodies and cellular therapies.
[0072] In some embodiments, the other anti-cancer agent is a proteasome inhibitor, examples of which include bortezomib, carfilzomib, and ixazomib.
|0073] In other embodiments, the other anti-cancer agent is an immunomodulating agent, examples of which include thalidomide, lenalidomide, pomalidomide and CC-885.
[0074] In certain embodiments, the other anti-cancer agent is cyclophosphamide.
[0075] In certain embodiments, the other anti-cancer agent is melphalan.
[0076] In certain embodiments, the other anti-cancer agent is lenalidomide.
[0077] In certain embodiments, the other anti-cancer agent is bortezomib.
[0078] In certain embodiments, the other anti-cancer agent is dexamethasone.
[0079] In certain embodiments, the other anti-cancer agent is doxorubicin. [0080] In certain embodiments, the other anti-cancer agent is bendamustine.
[0081 ] In some embodiments, compound 1 is used in combination with cyclophosphamide.
[0082] In some embodiments, compound 1 is used in combination with melphalan.
[0083] In some embodiments, compound 1 is used in combination with lenalidomide.
|0084] In some embodiments, compound 1 is used in combination with bortezomib.
[0085] In some embodiments, compound 1 is used in combination with dexamethasone.
[0086] In some embodiments, compound 1 is used in combination with doxorubicin.
[0087] In some embodiments, compound 1 is used in combination with bendamustine.
[0088] In some embodiments, compound 2 is used in combination with cyclophosphamide.
[0089] In some embodiments, compound 2 is used in combination with melphalan.
|0090] In some embodiments, compound 2 is used in combination with lenalidomide.
|0091] In some embodiments, compound 2 is used in combination with bortezomib.
[0092] In some embodiments, compound 2 is used in combination with dexamethasone.
[0093] In some embodiments, compound 2 is used in combination with doxorubicin.
[0094] In some embodiments, compound 2 is used in combination with bendamustine.
[0095] In some embodiments, compound 3 is used in combination with cyclophosphamide.
[0096] In some embodiments, compound 3 is used in combination with melphalan.
[0097] In some embodiments, compound 3 is used in combination with lenalidomide.
|0098] In some embodiments, compound 3 is used in combination with bortezomib.
[0099] In some embodiments, compound 3 is used in combination with dexamethasone.
[00190] In some embodiments, compound 3 is used in combination with doxorubicin.
[00101] In some embodiments, compound 3 is used in combination with bendamustine.
[00162] In some embodiments, compound 4 is used in combination with cyclophosphamide.
[00103] In some embodiments, compound 4 is used in combination with melphalan.
[00104] In some embodiments, compound 4 is used in combination with lenalidomide.
[00105] In some embodiments, compound 4 is used in combination with bortezomib.
[00196] In some embodiments, compound 4 is used in combination with dexamethasone.
[00197] In some embodiments, compound 4 is used in combination with doxorubicin.
[00108] In some embodiments, compound 4 is used in combination with bendamustine.
[00109] In some embodiments, compound 5 is used in combination with cyclophosphamide.
[00110] In some embodiments, compound 5 is used in combination with melphalan.
[00111] In some embodiments, compound 5 is used in combination with lenalidomide.
[00112] In some embodiments, compound 5 is used in combination with bortezomib. [00113] In some embodiments, compound 5 is used in combination with dexamethasone. [00114] In some embodiments, compound 5 is used in combination with doxorubicin. [00115] In some embodiments, compound 5 is used in combination with bendamustine. [00116] In some embodiments, compound 6 is used in combination with cyclophosphamide. [00117] In some embodiments, compound 6 is used in combination with melphalan.
[00118] In some embodiments, compound 6 is used in combination with lenalidomide.
[00119] In some embodiments, compound 6 is used in combination with bortezomib.
[00120] In some embodiments, compound 6 is used in combination with dexamethasone.
[00121 ] In some embodiments, compound 6 is used in combination with doxorubicin. [00122] In some embodiments, compound 6 is used in combination with bendamustine. [O0123] In some embodiments, compound 7 is used in combination with cyclophosphamide. [00124] In some embodiments, compound 7 is used in combination with melphalan.
[00125] In some embodiments, compound 7 is used in combination with lenalidomide.
[00126] In some embodiments, compound 7 is used in combination with bortezomib.
[00127] In some embodiments, compound 7 is used in combination with dexamethasone.
[00128] In some embodiments, compound 7 is used in combination with doxorubicin.
[00129] In some embodiments, compound 7 is used in combination with bendamustine.
[00130] In some embodiments, compound 8 is used in combination with cyclophosphamide.
[00131] In some embodiments, compound 8 is used in combination with melphalan.
[00132] In some embodiments, compound 8 is used in combination with lenalidomide.
[00133] In some embodiments, compound 8 is used in combination with bortezomib.
[00134] In some embodiments, compound 8 is used in combination with dexamethasone.
[00135] In some embodiments, compound 8 is used in combination with doxorubicin.
[00136] In some embodiments, compound 8 is used in combination with bendamustine.
[00137] Cancers which may be amenable to combination therapy according to the present invention include carcinomas (solid tumors including both primary and metastatic tumors), sarcomas, melanomas, and hematological cancers (cancers affecting blood including lymphocytes, bone marrow and/or lymph nodes) such as leukemia, lymphoma and multiple myeloma. Adult tumors/cancers and pediatric tumors/cancers are included. The cancers may be vascularized, or not yet substantially vascularized, or non-vascularized tumors.
[00138] Sarcomas that may be treatable with the methods of the present invention include both soft tissue and bone cancers alike, representative examples of which include osteosarcoma or osteogenic sarcoma (bone) (e.g, Ewing’s sarcoma), chondrosarcoma (cartilage), leiomyosarcoma (smooth muscle), rhabdomyosarcoma (skeletal muscle), mesothelial sarcoma or mesothelioma (membranous lining of body cavities), fibrosarcoma (fibrous tissue), and angiosarcoma or hemangioendothelioma (blood vessels).
[00139] In some embodiments, methods of the present invention entail treatment of subjects having a cancer of the thyroid, skin, cervix, esophagus, stomach, or hematological system. [00140] In certain embodiments, the cancer may be a hematological or an esophageal cancer. [00141] Representative examples of hematological cancers that may be amenable to treatment with the methods of the present invention include lymphoma, leukemia, myeloid neoplasms, mast cell neoplasms, myelodysplasia, benign monoclonal gammopathy, lymphomatoid papulosis, polycythemia vera, chronic myelocytic leukemia, agnogenic myeloid metaplasia, and essential thrombocythemia. Representative examples of hematologic cancers may thus include multiple myeloma, lymphoma (including T-cell lymphoma, Hodgkin’s lymphoma, non-Hodgkin’s lymphoma (diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL) and ALK+ anaplastic large cell lymphoma (e.g., B-cell non-Hodgkin’s lymphoma selected from diffuse large B-cell lymphoma (e.g., germinal center B-cell-like diffuse large B-cell lymphoma or activated B-cell-like diffuse large B-cell lymphoma), Burkitt’s lymphoma/leukemia, mantle cell lymphoma, mediastinal (thymic) large B-cell lymphoma, follicular lymphoma, marginal zone lymphoma, lymphoplasmacytic lymphoma/Waldenstrom macroglobulinemia, metastatic pancreatic adenocarcinoma, refractory B-cell non-Hodgkin’s lymphoma, and relapsed B-cell non-Hodgkin’s lymphoma, childhood lymphomas, and lymphomas of lymphocytic and cutaneous origin, e.g., small lymphocytic lymphoma, leukemia, including childhood leukemia, hairy-cell leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloid leukemia (e.g., acute monocytic leukemia), chronic lymphocytic leukemia, small lymphocytic leukemia, chronic myelocytic leukemia, chronic myelogenous leukemia, and mast cell leukemia, myeloid neoplasms, mast cell neoplasms and virus-induced cancers (e.g., Epstein-Barr virus (EBV)- induced cancers, hepatitis B virus (HBV)-induced cancers, and human immunodeficiency virus (HlV)-induced cancers).
[00142] Representative examples of esophageal cancers that may be amenable to treatment with the methods of the present invention include all forms of cell proliferative disorders affecting esophageal cells such as esophageal cancer (e.g., esophageal adenocarcinoma, esophageal squamous cell carcinoma, esophageal leiomyosarcoma, esophageal rhabdomyosarcoma, esophageal melanoma, and esophageal lymphoma), a precancer or precancerous condition of the esophagus, hyperplasia of the esophagus, dysplasia of the esophagus, benign growths or lesions of the esophagus, and malignant growths or lesions of the esophagus, and metastatic lesions in tissue and organs in the body other than the esophagus. [00143] In certain embodiments, the methods may be useful in the treatment of multiple myeloma.
[00144] In certain embodiments, the methods may be useful in the treatment of esophageal adenocarcinoma.
[00145] Inventive methods that treat pre-cancerous conditions may deter or delay onset of cancer.
[00146] In certain embodiments, the methods may be useful in the treatment of monoclonal gammopathy of undetermined significance (MGUS) and/or to prevent or delay its progression. [00147] In certain embodiments, the methods may be useful in the treatment of Barrett’s esophagus and/or to prevent or delay its progression.
[00148] In some embodiments, compound 1 is used in combination with cyclophosphamide to treat multiple myeloma.
[00149] In some embodiments, compound 1 is used in combination with melphalan to treat multiple myeloma.
[00150] In some embodiments, compound 1 is used in combination with lenalidomide to treat multiple myeloma.
[00151] In some embodiments, compound 1 is used in combination with bortezomib to treat multiple myeloma.
[00152] In some embodiments, compound 1 is used in combination with dexamethasone to treat multiple myeloma.
[00153] In some embodiments, compound 1 is used in combination with doxorubicin to treat multiple myeloma.
|00154] In some embodiments, compound 1 is used in combination with bendamustine to treat multiple myeloma.
[00155] In some embodiments, compound 2 is used in combination with cyclophosphamide to treat multiple myeloma.
[00156] In some embodiments, compound 2 is used in combination with melphalan to treat multiple myeloma.
[00157] In some embodiments, compound 2 is used in combination with lenalidomide to treat multiple myeloma. [00158] In some embodiments, compound 2 is used in combination with bortezomib to treat multiple myeloma.
100159] In some embodiments, compound 2 is used in combination with dexamethasone to treat multiple myeloma.
[00160] In some embodiments, compound 2 is used in combination with doxorubicin to treat multiple myeloma.
[00161] In some embodiments, compound 2 is used in combination with bendamustine to treat multiple myeloma.
[00162] In some embodiments, compound 3 is used in combination with cyclophosphamide to treat multiple myeloma.
[00163] In some embodiments, compound 3 is used in combination with melphalan to treat multiple myeloma.
[00164] In some embodiments, compound 3 is used in combination with lenalidomide to treat multiple myeloma.
[00165] In some embodiments, compound 3 is used in combination with bortezomib to treat multiple myeloma.
[00166] In some embodiments, compound 3 is used in combination with dexamethasone to treat multiple myeloma.
[00167] In some embodiments, compound 3 is used in combination with doxorubicin to treat multiple myeloma.
[00168] In some embodiments, compound 3 is used in combination with bendamustine to treat multiple myeloma.
[00169] In some embodiments, compound 4 is used in combination with cyclophosphamide to treat multiple myeloma.
[00170] In some embodiments, compound 4 is used in combination with melphalan to treat multiple myeloma.
[00171] In some embodiments, compound 4 is used in combination with lenalidomide to treat multiple myeloma.
[00172] In some embodiments, compound 4 is used in combination with bortezomib to treat multiple myeloma.
[00173] In some embodiments, compound 4 is used in combination with dexamethasone to treat multiple myeloma. [00174] In some embodiments, compound 4 is used in combination with doxorubicin to treat multiple myeloma.
[00175] In some embodiments, compound 4 is used in combination with bendamustine to treat multiple myeloma.
[00176] In some embodiments, compound 5 is used in combination with cyclophosphamide to treat multiple myeloma.
[00177] In some embodiments, compound 5 is used in combination with melphalan to treat multiple myeloma.
[00178 ] In some embodiments, compound 5 is used in combination with lenalidomide to treat multiple myeloma.
|00179] In some embodiments, compound 5 is used in combination with bortezomib to treat multiple myeloma.
[00180] In some embodiments, compound 5 is used in combination with dexamethasone to treat multiple myeloma.
[00181 ] In some embodiments, compound 5 is used in combination with doxorubicin to treat multiple myeloma.
[00182] In some embodiments, compound 5 is used in combination with bendamustine to treat multiple myeloma.
[00183] In some embodiments, compound 6 is used in combination with cyclophosphamide to treat multiple myeloma.
[00184] In some embodiments, compound 6 is used in combination with melphalan to treat multiple myeloma.
[00185] In some embodiments, compound 6 is used in combination with lenalidomide to treat multiple myeloma.
[00186] In some embodiments, compound 6 is used in combination with bortezomib to treat multiple myeloma.
[00187] In some embodiments, compound 6 is used in combination with dexamethasone to treat multiple myeloma.
[00188] In some embodiments, compound 6 is used in combination with doxorubicin to treat multiple myeloma.
[00189] In some embodiments, compound 6 is used in combination with bendamustine to treat multiple myeloma. [00190] In some embodiments, compound 7 is used in combination with cyclophosphamide to treat multiple myeloma.
[00191 ] In some embodiments, compound 7 is used in combination with melphalan to treat multiple myeloma.
[00192] In some embodiments, compound 7 is used in combination with lenalidomide to treat multiple myeloma.
[00193] In some embodiments, compound 7 is used in combination with bortezomib to treat multiple myeloma.
[00194] In some embodiments, compound 7 is used in combination with dexamethasone to treat multiple myeloma.
|00195] In some embodiments, compound 7 is used in combination with doxorubicin to treat multiple myeloma.
[00196] In some embodiments, compound 7 is used in combination with bendamustine to treat multiple myeloma.
[00197] In some embodiments, compound 8 is used in combination with cyclophosphamide to treat multiple myeloma.
[00198] In some embodiments, compound 8 is used in combination with melphalan to treat multiple myeloma.
[00199] In some embodiments, compound 8 is used in combination with lenalidomide to treat multiple myeloma.
[00200] In some embodiments, compound 8 is used in combination with bortezomib to treat multiple myeloma.
[00201 ] In some embodiments, compound 8 is used in combination with dexamethasone to treat multiple myeloma.
[00202] In some embodiments, compound 8 is used in combination with doxorubicin to treat multiple myeloma.
[00203] In some embodiments, compound 8 is used in combination with bendamustine to treat multiple myeloma.
Pharmaceutical Kits
[00204] The compounds and/or compositions containing them may be assembled into kits or pharmaceutical systems. Kits or pharmaceutical systems according to this aspect of the invention include a carrier or package such as a box, carton, tube or the like, having in close confinement therein one or more containers, such as vials, tubes, ampoules, or bottles, which contains compound 1, 2, 3, 4, 5, 6, 7, or 8, or a pharmaceutical composition thereof. The kits or pharmaceutical systems of the invention may also include printed instructions for using the compounds and compositions.
[00205] These and other aspects of the present invention will be further appreciated upon consideration of the following Examples, which are intended to illustrate certain particular embodiments of the invention but are not intended to limit its scope, as defined by the claims.
EXAMPLES
[00206] These and other aspects of the present invention will be further appreciated upon consideration of the following Examples, which are intended to illustrate certain particular embodiments of the invention but are not intended to limit its scope, as defined by the claims.
[00297] Example 1 : Materials and Methods
Identification of novel EXO1 inhibitors
[00208] A custom library of 100,000 small molecules was used to identify novel inhibitors of EXO1 activity in myeloma cells. These inhibitors were evaluated for impact on genome stability and growth, alone as well as in the presence of existing MM drugs, in MM cell lines.
Detection of DNA breaks
[00209] DNA breaks were estimated by evaluating MM cells for levels of y-H2A.X. Expression of '/-H2AX was measured by Western blotting using anti-H2A.X (Serl39, antibody # 2577; Cell Signaling Technology®) as previously reported (Pal, et al., J. Gastroenterol. Hepatol. Res. 6(1)'. 2286-2295 (2017)). DNA double strand break end resection, a decisive and initiating step in HR, requires phosphorylation of RPA32 on S4/8. Levels of phosphorylated RPA32 were detected using anti-phospho-RPA32 (S4/8) or RPA32 antibodies (Bethyl Laboratories).
Evaluating impact on micronuclei, a marker of genomic instability
[00210] To evaluate impact on genomic instability, the cells were cultured in the presence or absence of an EXO1 inhibitor, melphalan or combination of both. The cells were evaluated for micronuclei, a marker of unstable genome (Balmus et al., Nat. Protoc. 10(1):205-215 (2015); Terradas et al., Arch. Toxicol. 90(11).2657 -2667 (2016)), using Micronucleus Assay MicroFlow® kit (Litron Laboratories, New York, USA). Cell Viability Assays
[00211 ] Cells were treated as indicated for 72 hours and viability assessed using CellTiter- Glo® Luminescent Cell Viability Assay (Promega®) or Cell Counting Kit-8 (CCK-8) assay (Sigma Aldrich®) according to the manufacturer’s protocol.
RPMI Cell Lysate
[00212] Myeloma (RMPI) cell lysate was incubated with various concentrations of inhibitor. The EXO1 activity was evaluated. Cells were lysed in IP lysis buffer at 10,000 cells/pL and diluted 10-fold in the EXO1 assay buffer (20 mM Trish-HCl pH 7.0, 0.76 mM HEPES, 120 mM KC1, 1.5 mM ATP, ImM glutathione, 5mM MgCh, 0.25 mg/mL BSA, 600 pM DTT and 1% glycerol) to a final concentration of 1000 cells/pL. Diluted lysate (40 pL) was added per cell in 96 well plate. DMSO or 20 pL inhibitor (prepared in the assay buffer at 3X the respective final doses) was added to the lysates and incubated for 1 hour at 37°C. EXO1 substrate oligo (GGATCCCCGC[T(FAM)]AGCGGGTACCGAGCTCGAATTCACTGG (SEQ ID NO: 1)- RTQ1) was diluted to 0.1 pM concentration in the assay buffer. 60 pL of substrate in assay buffer was added to the lysates. Samples were transferred into 384 well plates (30 pL/well *3) and fluorescence was measured at different time points at Em 560 nm, Ex 594 nm. Reading from the no lysate well was used as background (FIG. 2).
Impact of compounds 1 and 3 on EXO1 activity in MM cells
[00213] Myeloma (H929 and MM1S) cells were treated overnight or for 36 hours with compounds 1 and 3 at different concentrations. The cells were then lysed, and the lysates (at 5 pg/pL protein) were mixed with EXO1 assay substrate and incubated at 37°C for 30 minutes. The fluorescence intensity was measured using a plate reader (Emission wavelength 521 nm and excitation wavelength 490 nm) (FIG. 3).
Impact of three-day treatment with compound 1 on MM and normal cell viability
[00214] Normal cell types (HDF, human normal diploid fibroblast; 4 samples of PBMC and 4 samples of activated PBMC) and MM cell lines (20 in Panel A and 10 in Panel B) were treated for 3 days with compound 1 at different concentrations and cell viability was assessed by CellTiter-Glo® (FIG. 4).
Impact of five-day treatment with compound 1 on MM and normal cell viability
[00215] Normal cell types (HDF, human normal diploid fibroblast; 4 samples of PBMC and 4 samples of activated PBMC) and MM cell lines (20 in Panel A and 10 in Panel B) were treated for 5 days with compound 1 at different concentrations and cell viability was assessed by CellTiter-Glo® (FIG. 5). Impact of treatment with compound 2 on MM and normal cell viability
[00216] Normal/non-cancerous cell types including HDF (human normal diploid fibroblasts), HEEC (primary human esophageal epithelial cells, and HS5 (bone marrow stromal cell line; right panel) and MM cell lines (MM1 S, U266) were treated for various durations with compound 2 at 16 pM and cell viability assessed by CellTiter-Glo®. Compound 2 inhibits growth of myeloma cell lines with minimal impact on three different normal cell types (FIG. 6).
Impact of compound 3 on MM and normal cell viability
[00217] Normal cell types (HDF, human normal diploid fibroblast; IMR90, human normal diploid fibroblast; 4 samples of PBMC and 4 samples of activated PBMC) and 20 MM cell lines were treated for 3 days (Panel A) or 5 days (Panel B) with compound 3 at different concentrations and cell viability was assessed by CellTiter-Glo® (FIG. 7).
3-Day impact of compounds 1 and 3 on MM and normal cells
[00218] Normal cell types (PBMC, activated PBMC, fibroblasts) and MM cells lines (AM01, H929, KK1) were treated for 3 days with compound 1 (A) or compound 3 (B) at different concentrations and cell viability assessed by CellTiter-Glo®. Growth curves (I) and IC50 values (II) are shown in FIG. 8.
Compounds 1 and 3 inhibit DNA end resection and DNA breaks in MM (H929) cells
|00219] Western blot shows the impact of compound 1 (at various concentrations) on expression of EXO1, phosphorylated RPA32 (a marker of DNA end resection which is a distinct step in the initiation of HR and outcome of EXO 1 -mediated 5’ to 3’ exonuclease activity) and γH2AX (a marker of DNA breaks). Expression on pRPA32 and yH2AX following normalization with GAPDH (a housekeeping gene) (FIG. 21 and FIG. 22).
Compounds 1 and 3 inhibit genomic instability in MM cells
[00220] MM (MM1R and MM1S) cells were treated with compounds 1 and 3. Live cell fraction purified and the impact on micronuclei (a marker of genomic instability) was assessed with flow cytometry (FIG. 23 and FIG. 24).
Impact of three- and five-day treatment with compound 8 on MM and normal cell viability
[00221 ] Normal cell types (HDF, human normal diploid fibroblast) and MM cell lines H929, KMS11, OPM1, OPM2, MM1S, AM01 and JJN3) were treated with compound 8 at different concentrations and cell viability was assessed by CellTiter-Glo® (FIG. 26).
Synergistic Impact of Bortezomib and Compound 8 MM (H929 and MM1S) cells treated with bortezomib (velcade®) and compound 8 showed a synergistic impact on cytotoxicity (FIG. 27).
Significance of Results
[00222] The majority of cancers display a complex spectrum of diverse genetic alterations at diagnosis and acquire additional changes with progression of disease. Genomic instability, which seems to arise early at the premalignant stage, enables cells to acquire new characteristics for progression and resist therapy. There are a number of mutations that correlate with overall and event free survival in MM, suggesting a role of genomic instability in poor clinical outcome. The data presented herein show that elevated homologous recombination (HR) is a key mediator of genomic instability and drug resistance in cancer and contributes to telomere maintenance and tumor growth. Elevated expression and/or activity of Exonuclease 1 (EXO1) contribute to increased HR activity, DNA breaks (both endogenous as well as DNA damaging agent-induced) and cell cycle progression, and thus drive genomic evolution in MM cells. Inhibition of EXO 1 expression, through transgenic as well as chemical manipulations, reduces DNA breaks and genomic instability in MM cells.
[00223 ] These data also demonstrate that EXO1 overexpression or its increased activity can drive genomic evolution leading to tumorigenesis, and its inhibitors have potential not only to inhibit growth but also inhibit or reduce genomic damage and evolution, both endogenous or that induced by chemotherapy, in MM cells (FIG. 3-FIG. 27). EXO1 is a critical target and its inhibitors, compounds 1-8, have ability to: (1) inhibit growth of cancer cells; (2) increase cytotoxicity (or efficacy) of existing cancer drugs; (3) inhibit or reduce genomic evolution in multiple myeloma and esophageal cancer and other cancers, preventing or delaying the progression of cancer to advanced stages including development of drug resistance; and (4) prevent or reduce the DNA damage and genomic instability caused by chemotherapeutic agents.
[00224] All patent publications and non-patent publications are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are herein incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference.
[00225] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims.

Claims

What is claimed is:
1. A method of treating cancer or a pre-cancerous condition with exonuclease 1 (EXO1) expression and/or activity, comprising administering to a subject in need thereof a therapeutically effective amount of compound 1, 2, 3, 4, 5, 6, 7 or 8:
Figure imgf000034_0001
pharmaceutically acceptable salt thereof, to a subject in need thereof.
2. A method of treating cancer or a precancerous condition with EXO1 expression and/or activity, which comprises administering in combination to a subject in need thereof a therapeutically effective amount of any one or more of compounds 1, 2, 3, 4, 5, 6, 7 and 8:
Figure imgf000035_0001
pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an additional anti-cancer agent, wherein the additional anti-cancer agent exhibits greater cytotoxicity to cancer cells of the subject than when administered alone without any of compounds 1-8.
3. The method of claim 2, wherein the additional anti-cancer agent is selected from the group consisting of melphalan, vincristine, cyclophosphamide, dexamethasone, etoposide, doxorubicin, bendamustine, bevacizumab, irinotecan hydrochloride, capecitabine, cetuximab, ramucirumab, oxaliplatin, cetuximab, fluorouracil, ipilimumab, pembrolizumab, nivolumab, panitumumab, regorafenib, abemaciclib, paclitaxel, everolimus, anastrozole, atezolizumab, docetaxel, epirubicin hydrochloride, exemestane, toremifene, fulvestrant, letrozole, gemcitabine hydrochloride, eribulin mesylate, trastuzumab, palbociclib, ixabepilone,
34 ribociclib, olaparib, methotrexate, pertuzumab, thiotepa, alectinib, brigatinib, dabrafenib, dacomitinib, durvalumab, gefitinib, lorlatinib, sunitinib malate, mitomycin C, osimertinib mesylate, dactinomycin, ifosfamide, vinblastine sulfate, bleomycin sulfate, topotecan hydrochloride, hydroxyurea, megestrol acetate, glasdegib, venetoclax, paxopanib, temsirolimus, abiraterone acetate, apalutamide, bicalutamide, cabazitaxel, degarelix, leuprolide acetate, enzalutamide, flutamide, goserelin acetate, nilutamide, sipuleucel-T, radium 223 dichloride, aldesleukin, auelumab, axitinib, cabozantinib-S-malate, lenvatinib mesylate, sorafenib tosylate, bortezomib, carfilzomib, ixazomib, thalidomide, lenalidomide, pomalidomide, iberdomide, CC-885, and cellular and antibody-drug conjugates, antibodybased therapies such as daratumumab, elotuzumab, bispecific antibodies and cellular therapies.
4. The method of claim 3, wherein the additional anti-cancer agent is melphalan.
5. The method of claim 3, wherein the additional anti-cancer agent is cyclophosphamide.
6. The method of claim 2, wherein the additional anti-cancer agent is a proteasome inhibitor.
7. The method of claim 6, wherein the proteasome inhibitor is bortezomib, carfilzomib, or ixazomib.
8. The method of claim 7, wherein the proteasome inhibitor is bortezomib.
9. The method of claim 2, wherein the additional anti-cancer agent is an immunomodulating agent.
10. The method of claim 9, where the immunomodulating agent is thalidomide, lenalidomide, pomalidomide, or CC-885.
11. The method of claim 10, where the immunomodulating agent is lenalidomide.
12. The method of claim 10, where the immunomodulating agent is dexamethasone.
13. The method of claim 1 or 2, wherein the cancer is lung, cervical, colon, breast, esophageal, stomach, or hematological cancer.
14. The method of claim 13, wherein the hematological cancer is multiple myeloma.
15. The method of claim 13, wherein the esophageal cancer is esophageal adenocarcinoma.
16. The method of claim 1 or 2, wherein the precancerous condition is monoclonal gammopathy of undetermined significance (MGUS).
17. The method of claim 1 or 2, wherein the precancerous condition is Barrett’s esophagus.
18. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 1 or a pharmaceutically acceptable salt thereof is administered to the subject.
19. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 2 or a pharmaceutically acceptable salt thereof is administered to the subject.
20. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 3 or a pharmaceutically acceptable salt thereof is administered to the subject.
21. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 4 or a pharmaceutically acceptable salt thereof is administered to the subject.
22. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 5 or a pharmaceutically acceptable salt thereof is administered to the subject.
23. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 6 or a pharmaceutically acceptable salt thereof is administered to the subject.
24. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 7 or a pharmaceutically acceptable salt thereof is administered to the subject.
25. The method of any one of claims 1-17, wherein a therapeutically effective amount of compound 8 or a pharmaceutically acceptable salt thereof is administered to the subject.
26. The method of any one of claims 1-25, wherein the subject is human.
PCT/US2021/056795 2020-10-28 2021-10-27 Inhibitors of exo1 in combination with other cancer drugs to inhibit cancer cells WO2022093919A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063106636P 2020-10-28 2020-10-28
US63/106,636 2020-10-28

Publications (1)

Publication Number Publication Date
WO2022093919A1 true WO2022093919A1 (en) 2022-05-05

Family

ID=81384410

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/056795 WO2022093919A1 (en) 2020-10-28 2021-10-27 Inhibitors of exo1 in combination with other cancer drugs to inhibit cancer cells

Country Status (1)

Country Link
WO (1) WO2022093919A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140155432A1 (en) * 2007-06-20 2014-06-05 The Johns Hopkins University Activators and therapeutic applications thereof
US20180050037A1 (en) * 2016-08-17 2018-02-22 Macau University Of Science And Technology Alk kinase inhibitor and its use

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140155432A1 (en) * 2007-06-20 2014-06-05 The Johns Hopkins University Activators and therapeutic applications thereof
US20180050037A1 (en) * 2016-08-17 2018-02-22 Macau University Of Science And Technology Alk kinase inhibitor and its use

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BURGESS JOSHUA T, CROFT LAURA V, WALLACE NATHAN C, STEPHENSON SALLY-ANNE, ADAMS MARK N, ASHTON NICHOLAS W, SOLOMON BENJAMIN, O’BYR: "DNA repair pathways and their therapeutic potential in lung cancer", LUNG CANCER MANAGEMENT, FUTURE MEDICINE LTD., UK, vol. 3, no. 2, 1 April 2014 (2014-04-01), UK , pages 159 - 173, XP055939302, ISSN: 1758-1966, DOI: 10.2217/lmt.14.12 *
TING XIONG, HENG WEI, XIAOQIONG CHEN AND HUI XIAO: "PJ34, a poly(ADP-ribose) polymerase (PARP) inhibitor, reverses melphalan-resistance and inhibits repair of DNA double-strand breaks by targeting the GAMMAA/DRCA pathway in multidrug resistant multiple myeloma cell line KPMI8226/R", INTERNATIONAL JOURNAL OF ONCOLOGY, vol. 46, 1 January 2015 (2015-01-01), pages 223 - 232, XP055939315, DOI: 10.3892/ijo.2014.2726 *
TUN JORTAN O., SALVADOR-REYES LILIBETH A., VELARDE MICHAEL C., SAITO NAOKI, SUWANBORIRUX KHANIT, CONCEPCION GISELA P.: "Synergistic Cytotoxicity of Renieramycin M and Doxorubicin in MCF-7 Breast Cancer Cells", MARINE DRUGS, vol. 17, no. 9, 16 September 2019 (2019-09-16), pages 536, XP055939318, DOI: 10.3390/md17090536 *

Similar Documents

Publication Publication Date Title
US20210100813A1 (en) Combination therapy for cancer using bromodomain and extra-terminal (bet) protein inhibitors
RU2757373C2 (en) Combination therapy with antitumor alkaloid
US11591298B2 (en) Bisaminoquinoline compounds, pharmaceutical compositions prepared therefrom and their use
US6552059B2 (en) Pharmaceutical composition for and method of treating leukemia
US20120128667A1 (en) Pentamidine combinations for treating cancer
JP5551589B2 (en) 7- (2,5-Dihydro-4-imidazo [1,2-a] pyridin-3-yl-2,5-dioxo-1H-pyrrol-3-yl) -9-fluoro-1,2,3 Synergy of cancer chemotherapy with 4-tetrahydro-2- (1-piperidinyl-carbonyl) pyrrolo [3,2,1-jk] [1,4] benzodiazepine
US20210177871A1 (en) Methods for cancer therapy
CN111481551B (en) Tumor selective combination therapy
US20070027175A1 (en) Antineoplastic activities of ellipticine and its derivatives
JP2009536956A (en) Anticancer therapy
US20190231793A1 (en) Use of harringtonines in the treatment of breast cancer, in particular triple-negative breast cancer
CZ299686B6 (en) Medicament containing distamycin derivatives and intended for treating tumors
WO2022093919A1 (en) Inhibitors of exo1 in combination with other cancer drugs to inhibit cancer cells
US9492469B2 (en) Combination therapy for the treatment of proliferative diseases
US20220289686A1 (en) Compositions of nrf2 inhibiting agents and methods of use thereof
WO2022093789A1 (en) Small molecule inhibitors of apex, alone and in combination with other cancer drugs to inhibit growth of cancer cells
CN114469949A (en) Quinoline derivatives for the treatment of diffuse large B-cell lymphoma
JP2014111666A (en) Combination therapy with organic arsenical
US20240335438A1 (en) Targeting dot1l and smarca4/2 for the treatment of mllr leukemia
WO2012155061A1 (en) Use of arsenic for cancer therapy protection
WO2021114089A1 (en) Methods of using crocetin in treating solid tumors
CN113747898A (en) Quinoline derivatives for the combined treatment of soft tissue sarcomas
CN112294814A (en) Quinoline derivatives for the treatment of glioblastoma
WO2006124884A2 (en) Dosing regimen
KR20100131457A (en) Anti-tumor agent comprising cytidine derivative and carboplatin

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21887412

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21887412

Country of ref document: EP

Kind code of ref document: A1