WO2022093770A1 - Combination therapy with pi3k-akt-mtor inhibitors and ferroptosis inducing agents to treat cancer - Google Patents

Combination therapy with pi3k-akt-mtor inhibitors and ferroptosis inducing agents to treat cancer Download PDF

Info

Publication number
WO2022093770A1
WO2022093770A1 PCT/US2021/056583 US2021056583W WO2022093770A1 WO 2022093770 A1 WO2022093770 A1 WO 2022093770A1 US 2021056583 W US2021056583 W US 2021056583W WO 2022093770 A1 WO2022093770 A1 WO 2022093770A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
cancer
pi3k
akt
ferroptosis
Prior art date
Application number
PCT/US2021/056583
Other languages
French (fr)
Inventor
Xuejun Jiang
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of WO2022093770A1 publication Critical patent/WO2022093770A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/137—Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine or methadone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/498—Pyrazines or piperazines ortho- and peri-condensed with carbocyclic ring systems, e.g. quinoxaline, phenazine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/65—Tetracyclines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • the present technology relates to methods for treating cancers using an inhibitor of PI3K-AKT-mTOR pathway and a ferroptosis inducing agent. Kits for use in practicing the methods are also provided.
  • Ferroptosis is triggered by an inability of cellular antioxidant defenses to overcome the oxidative stress of metabolic activity, leading to a wave of iron-dependent cellular lipid peroxidation and, ultimately, cell death.
  • Glutathione peroxidase-4 GPX4
  • GPX4 glutathionedependent enzyme catalyzing the clearance of lipid ROS
  • Inactivation of GPX4 renders the cell unable to detoxify lipid peroxides, by-products of cellular metabolism, which, when in excess, damage cellular membranes, and kill the cell via ferroptosis.
  • loss of GPX4 function can induce ferroptosis.
  • Pharmacological inhibition of system xc- cystine/glutamate antiporter can also trigger ferroptosis.
  • FSP1 a CoQ reductase, suppresses ferroptosis by generating reduced form of CoQ to trap phospholipid peroxides.
  • Ferroptosis induction may contribute to various cancer treatments, such as immune checkpoint blockade and radiotherapy. Some cancers are resistant to induced ferroptosis.
  • the role of individual tumorigenic mutations that confer resistance of a given cancer to ferroptosis is unknown, preventing the development of effective treatments of cancer using ferroptosis inducing agents.
  • the present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of at least one PI3K-AKT-mT0R pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
  • the cancer may be a solid malignant tumor or a hematological tumor.
  • the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
  • cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
  • the subject comprises a PTEN deletion and/or Z.PIK3CA activating mutation (e.g., E542K, E545K, or H1047R).
  • the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N- cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
  • the subject is human.
  • the subject is non-responsive to at least one prior line of cancer therapy such as radiation therapy, chemotherapy, or immunotherapy.
  • the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
  • the at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
  • the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mT0R dual inhibitor.
  • PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, vo
  • AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
  • mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like.
  • the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
  • SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like.
  • the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
  • SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like.
  • the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
  • the at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system X c “ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
  • ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like.
  • erastin erastin derivatives
  • erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)
  • the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
  • an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme
  • the subject exhibits decreased tumor growth, reduced tumor proliferation, lower tumor burden, or increased survival after administration of the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent. Additionally or alternatively, in some embodiments of the combination therapy methods disclosed herein, the time to response and/or duration of response is improved relative to that observed with PI3K-AKT-mTOR pathway inhibitor monotherapy or ferroptosis inducing agent monotherapy.
  • the present disclosure provides a method for increasing the efficacy of at least one chemotherapeutic agent or an immunotherapeutic agent in a subject suffering from cancer comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
  • chemotherapeutic agents include, but are not limited to, abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated-hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111.
  • immunotherapeutic agents include, but are not limited to, an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4- IBB antibody, an anti- CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti-CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, an anti-LAG-3 antibody, ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS- 936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA
  • the cancer may be a solid malignant tumor or a hematological tumor.
  • the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
  • cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
  • breast cancer colorectal cancer
  • lung cancer e.g., non-small cell lung carcinoma
  • adenocarcinoma e.g., prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer
  • squamous cell carcinoma of the skin mel
  • the subject comprises a PTEN deletion and/or a PIK3CA activating mutation (e.g., E542K, E545K, or H1047R).
  • the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
  • the subject is human.
  • the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
  • the at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
  • the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
  • PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, vo
  • AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib (GSK2110183), 4-amino-pyrido[2,3-d]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-b]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -dipheny
  • mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like.
  • the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
  • SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like.
  • the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
  • SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like.
  • the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
  • the at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system X c “ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
  • ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like.
  • erastin erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)
  • DPI2 erastin
  • the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
  • an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme
  • the at least one PI3K- AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously.
  • the PI3K-AKT-mTOR pathway inhibitor and/or the ferroptosis inducing agent may be administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, topically, or via an implanted reservoir.
  • kits comprising a PI3K-AKT-mTOR pathway inhibitor, a ferroptosis inducing agent, and instructions for treating therapy resistant cancer.
  • FIGs. 1A-1H demonstrate that oncogenic activation of the PI3K-AKT-mT0R signaling pathway confers resistance to ferroptosis.
  • FIG. IB Indicated protein components in the PI3K-AKT pathway were detected by western blot in indicated cell types.
  • FIG. IE Cells were seeded in 6-well plates, 4> ⁇ 10 5 cells per well and incubated overnight. MDA-MB-453 and BT474 cells were treated as indicated. CCI-779, 0.5 pM; RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM.
  • FIGs. 2A-2F demonstrate that mTORCl suppresses ferroptosis by upregulating SREBP1.
  • FIG. 2A BT474 and MDA-MB-453 cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM. Cell lysates were collected after 8 h and 24 h of treatment for BT474 cells and MDA-MB-453 cells, respectively, for western blot detection of p-T389 S6, total S6K, unprocessed SREBP1 (SREBPl(p)) and processed, mature SREBP1 (SREBPl(m)).
  • FIG. 2B Cells were treated as indicated.
  • FIG. 2D 3D spheroids derived from BT474 cells harboring control or SREBP1 sgRNA were treated as indicated.
  • FIGs. 3A-3G demonstrate that SREBP1 protects cells from ferroptosis through SCD1 activity.
  • FIG. 3A The expression of SREBP1, and its targets SCD1, FASN, and ACACA, in control and 577E5F7-sgRNA cells were detected by western blot.
  • FIG. 3D 3D spheroids derived from BT474 cells harboring control or SREBP1 sgRNA were treated as indicated. RSL3, 0.5 pM; CCI- 779, 0.5 pM; Fer-1, 1 pM.
  • FIG. 3F 3D spheroids derived from BT474 cells with control or SCD1 overexpression were treated as indicated.
  • FIGs. 4A-4F demonstrate that combination of mTORCl inhibition with ferroptosis induction leads to tumor regression in vivo.
  • FIG. 4A CRISPR/cas9-mediated, Dox-induced GPX4 knockout (GPX4-iKO) in BT474 cells, monitored by western blot.
  • FIG. 4A CRISPR/cas9-mediated, Dox-induced GPX4 knockout (GPX4-iKO) in BT474 cells, monitored by western blot.
  • FIG. 4C Representative haematoxylin and eosin (H&E) and immunostaining images of GPX4, Ki67, PTGS2 and pS235/236 S6, all counterstained with haematoxylin (blue), are shown from sections of xenografted tumors. Scale bar, 50 pm.
  • FIG. 4D Growth curves of BT474 tumors of each group. Data are plotted as mean ⁇ s.d., on the linear scale for actual tumor size (upper panel) or the log2 scale for the fold change of tumors (bottom panel); P- values (two-way ANOVA), ****P ⁇ 0.0001.
  • FIG. 4E Growth curves of PC-3 tumors of each group.
  • FIG. 4F Model depicting that oncogenic activation of PI3K-AKT-mTORCl signaling suppresses ferroptosis via SREBP1/SCD1 -mediated lipogenesis.
  • FIG. 5 shows genetic background of the analyzed cancer cell lines and their sensitivity to RSL3.
  • FIGs. 6A-6G demonstrate that PI3K-AKT-mTOR signaling regulates ferroptosis sensitivity.
  • FIG. 6B Cells were treated with indicated conditions. Torin, 1 pM; RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM.
  • FIG. 6D Cells were treated as indicated. CCI-779, 0.5 pM; Torin, 1 pM; Fer-1, 1 pM. Cell death was assessed by staining with propidium iodide (PI) (red) or Sytox Green (green) (scale bar, 100 pm).
  • FIG. 6G Western blot was performed to detect RPTOR and RICTOR knockdown efficiency.
  • FIGs. 7A-7E demonstrate that inhibition of mTORCl also accelerates ferroptosis and lipid peroxidation in cells harboring wild-type PI3K-AKT-mTOR pathway.
  • FIG. 7A HT1080 cells and MDA-MB-231 cells (both with wild-type PI3K-AKT-mTOR pathway) were treated as indicated. RSL3, 0.1 pM for HT1080 and 0.25 pM for MDA-MB-231; Torin,
  • FIG. 7B Two lines of PI3K-AKT-mTOR pathway wild-type cells (HT1080 and MDA-MB-231) and two lines of cells harboring activating mutation of the pathway (BT474 and MDA-MB-453) were treated as indicated. RSL3, 0.25 pM; Fer-1, 1 pM. Western blot was performed to detect the level of pT389 S6K.
  • FIG. 7C HT1080 cells were treated as indicated. tBHP, 50 pM; Fer-1,
  • FIG. 7D HT1080 cells were treated as in FIG. 7C. Western blot was performed to measure NRF2, pT389 S6K and total S6K.
  • FIGs. 8A-8B demonstrate that mTOR regulates ferroptosis sensitivity independently of autophagy.
  • FIG. 8A ATG5 and LC3 I/II in MEFs with indicated genotypes were detected by western blot.
  • FIG. 8B .47G5-knockout Cells and knockout cells with ATG5 reconstitution were treated with cystine deprivation with or without Torin (1 pM). Propidium iodide was added after 10 h treatment to stain for dead cells (scale bar, 100 pm).
  • FIGs. 9A-9K demonstrate NRF2 is not the main player mediating the ferroptosis- suppressing activity of mTORCl.
  • FIG. 9A BT474 cells were treated as indicated for 8 h. RSL3, 0.5 pM; Torin, 1 pM. Western blot was performed to measure p-T389 S6, total S6K and NRF2.
  • FIG. 9B NRF2 was depleted by CRISPR/CAS9 technology in HT1080 cells. NRF2 level was measured by western blot.
  • FIG. 9C Control or NRF2-depleted cells were treated as indicated. Erastin, 0.5 pM; RSL3, 25 nM.
  • FIG. 9D NRF2 was depleted by CRISPR/CAS9 technology in HepG2 cells. NRF2 level was measured by western blot.
  • FIG. 9E HepG2 cells with or without NRF2 depletion were treated with cystine starvation with or without CCI-779 (0.5 pM) as indicated. Sytox Green was added after 48 h for cell death staining (scale bar, 100 pm).
  • FIG. 9F NRF2 was depleted by CRISPR/CAS9 technology in PC-3 cells. NRF2 level was measured by western blot.
  • FIG. 9E HepG2 cells with or without NRF2 depletion were treated with cystine starvation with or without CCI-779 (0.5 pM) as indicated. Sytox Green was added after 48 h for cell death staining (scale bar, 100 pm).
  • FIG. 9F NRF2 was depleted by CRISPR/CAS9 technology in PC-3 cells. NRF2 level was measured by western blot.
  • FIG. 9G PC-3 cells with or without NRF2 depletion were treated with cystine starvation with or without CCI-779 (0.5 pM) as indicated. Sytox Green was added after 48 h for cell death staining (scale bar, 100 pm).
  • FIG. 9H NRF2 was depleted by CRISPR/CAS9 technology in MCF7 cells. NRF2 level was measured by western blot.
  • FIG. 9J Keapl was depleted by CRISPR/CAS9 technology in BT474 cells. NRF2 and Keapl levels were measured by western blot.
  • FIGs. 10A-10F demonstrate that SREBP1 protects cells from ferroptosis.
  • FIG. 10A MCF7 cells were treated as indicated. RSL3, 5 pM; CCI-779, 0.5 pM. Cell lysates were collected 24 h after treatment for Western blot detecting p-T389 S6, total S6K, SREBPl(P) and SREBPl(m).
  • FIG. 10B Cells were pretreated with 5 pM Fatostatin A overnight and treated as indicated. RSL3, 0.5 pM for BT474 cells, 1 pM for MDA-MB-453 and 5 pM for MCF7 cells; Fer-1, 1 pM. Cell death was measured.
  • FIG. 10C Efficiency of SREBF1 Knockout in BT474, MDA-MB-453, and MCF7 cells was monitored by western blot.
  • FIG. 10E Cells were treated as indicated.
  • FIG. 10F SREBPlm was overexpressed in MCF7, MDA-MB-453 and A549 cells and determined by western blot. Cells were treated as indicated.
  • FIGs. 11A-11B demonstrate that SREBP1 knockout downregulates SCD1.
  • FIG. 11B Determination of FASN, ACC and SCD1 levels in MCF7 cells with SREBF1 knockout by western blot.
  • FIGs. 12A-12H demonstrate that SCD1 protects cells against ferroptosis.
  • FIG. 12A Cells were pretreated with 5 pM CAY10566 overnight. Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 and 0.5 pM for BT474; Fer-1, 1 pM; CAY10566, 5 pM; Fer- 1, 1 pM. Lipid peroxidation was measured. Data are plotted as mean
  • FIG. 12B Western blot, measuring the SCD knockout efficiency in BT474, MDA-MB-453 and MCF7 cells.
  • FIG. 12D Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM. Lipid peroxidation was measured.
  • FIG. 12F SCD1 was overexpressed in BT474 cells. Cells were treated as indicated.
  • FIGs. 13A-13C demonstrate that ferroptosis sensitization triggered by mTORCl inhibition can be prevented by exogenous MUFAs.
  • FIG. 13A An overview of lipogenesis regulated by SREBP1 -driven transcription.
  • FIG. 13C Cells were treated as indicated.
  • FIGs. 14A-14E demonstrate that combination of mTORCl inhibition with ferroptosis induction leads to tumor regression.
  • FIG. 14A GPX4-iKO BT474 cells were treated as indicated for 30 h. CCI-779, 0.5 pM; DOX, 100 ng/ml; Trolox, 200 pM. Dead cells were stained with Sytox Green (scale bar, 100 pm).
  • FIG. 14B BT474 tumor volume was measured everyday of each mouse. The fold change of tumor volume of each individual mouse was plotted.
  • FIG. 14D Representative haematoxylin and eosin (H&E) and immunostaining images of Ki67, PTGS2 and pS235/236 S6, all counterstained with haematoxylin (blue), are shown from sections of xenografted tumors. Scale bar, 50 pm.
  • FIG. 14E PC-3 tumor volume was measured everyday of each mouse. The fold change of tumor volume of each individual mouse was plotted.
  • FIG. 15 provides a summary of the primers (SEQ ID NOs: 1-12) used in the Examples of the present disclosure.
  • FIG. 16 provides a summary of the sgRNA sequences (SEQ ID NOs: 13-18) used in the Examples of the present disclosure.
  • Ferroptosis a form of regulated necrosis driven by iron-dependent peroxidation of phospholipids, is regulated by cellular metabolism, redox homeostasis, and various signaling pathways. Some cancers are resistant to induced ferroptosis. However, the role of individual tumorigenic mutations that confer resistance of a given cancer to ferroptosis is unknown, preventing the development of effective treatments of cancer using ferroptosis inducing agents.
  • PI3K-AKT-mT0R signaling e.g., activating mutation of PI3K or loss of PTEN
  • PTEN a mutated pathway in human cancer
  • SREBP1 sterol regulatory element-binding protein 1
  • SCD1 stearoyl-CoA desaturase- 1
  • the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
  • the “administration” of an agent, or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and the administration by another.
  • a “control” is an alternative sample used in an experiment for comparison purpose.
  • a control can be “positive” or “negative.”
  • a positive control a compound or composition known to exhibit the desired therapeutic effect
  • a negative control a subject or a sample that does not receive the therapy or receives a placebo
  • the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein.
  • the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.
  • the compositions can also be administered in combination with one or more additional therapeutic compounds.
  • the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein.
  • a “therapeutically effective amount” of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.
  • expression includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
  • the term “pharmaceutically-acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration.
  • Pharmaceutically-acceptable carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20 th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, PA.).
  • a “sample” or “biological sample” refers to a body fluid or a tissue sample isolated from a subject.
  • a biological sample may consist of or comprise whole blood, platelets, red blood cells, white blood cells, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, tumor biopsies, aspirate and/or chorionic villi, cultured cells, endothelial cells, synovial fluid, lymphatic fluid, ascites fluid, interstitial or extracellular fluid and the like.
  • sample may also encompass the fluid in spaces between cells, including gingival crevicular fluid, bone marrow, cerebrospinal fluid (CSF), saliva, mucus, sputum, semen, sweat, urine, or any other bodily fluids.
  • Samples can be obtained from a subject by any means including, but not limited to, venipuncture, excretion, ejaculation, massage, biopsy, needle aspirate, lavage, scraping, surgical incision, or intervention or other means known in the art.
  • a blood sample can be whole blood or any fraction thereof, including blood cells (red blood cells, white blood cells or leukocytes, and platelets), serum and plasma.
  • the term “separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.
  • sequential therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.
  • the term “simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.
  • solid tumor refers to all neoplastic cell growth and proliferation, and all pre-cancerous and cancerous cells and tissues, except for hematologic cancers such as lymphomas, leukemias, and multiple myeloma.
  • solid tumors include, but are not limited to: soft tissue sarcoma, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing’s tumor and other bone tumors (e.g., osteosarcoma, malignant fibrous histiocytoma), leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma
  • the terms “subject,” “individual,” or “patient” are used interchangeably and refer to an individual organism, a vertebrate, a mammal, or a human. In certain embodiments, the individual, patient or subject is a human.
  • a “synergistic therapeutic effect” reflects a greater-than-additive therapeutic effect that is produced by a combination of at least two agents, and which exceeds that which would otherwise result from the individual administration of the agents. For example, lower doses of one or more agents may be used in treating a disease or disorder, resulting in increased therapeutic efficacy and decreased side-effects.
  • Treating”, “treat”, or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, z.e., arresting its development; (ii) relieving a disease or disorder, z.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder.
  • treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.
  • “inhibiting,” means reducing or slowing the growth of a tumor.
  • the inhibition of tumor growth may be, for example, by 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. In some embodiments, the inhibition may be complete.
  • the various modes of treatment of medical diseases and conditions as described herein are intended to mean “substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved.
  • the treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.
  • phospholipid peroxides can lead to ferroptotic death.
  • phospholipid peroxides are effectively neutralized by glutathione peroxidase-4 (GPX4), and blockage of GPX4 enzyme often triggers ferroptosis.
  • GPX4 requires the reducing agent glutathione to function, deprivation of cysteine, the essential building block of glutathione, via approaches such as cystine starvation or pharmacological inhibition of system xc- cystine/glutamate antiporter, can also trigger ferroptosis.
  • a ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system X c ” inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
  • system X c class 1 ferroptosis inducer
  • GPx4 glutthione peroxidase 4
  • ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like.
  • erastin erastin derivatives
  • erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)
  • the ferroptosis inducing agent is an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
  • an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme
  • the phosphatidylinositol-3 -kinase (PI3K)/Akt and the mammalian target of rapamycin (mTOR) signaling pathway is crucial to many aspects of cell growth and survival, in physiological as well as in pathological conditions such as cancer.
  • the PI3 -kinase/ Akt signaling pathway induces cell growth via activation of complex 1 of the target of rapamycin (TORC1).
  • TORC1 regulates the activity of sterol responsive element binding protein (SREBP1) and expression of SREBP target genes.
  • SREBP1 is a transcription factor that regulates, among other metabolic genes, multiple lipid synthesis-related genes including ACLY, ACACA, FASN, and SCI).
  • Somatic mutations and/or gains and losses of key genes are among a number of genetic alterations affecting this pathway in a number of different solid and hematological tumors.
  • the activation of the PI3K/Akt/mTOR pathway results in a profound disturbance of control of cell growth and survival, which ultimately leads to a competitive growth advantage, metastatic competence, angiogenesis, and therapy resistance.
  • PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, vo
  • AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
  • mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like.
  • the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
  • SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like.
  • the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
  • SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like.
  • the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
  • compositions of the present technology can be manufactured by methods well known in the art such as conventional granulating, mixing, dissolving, encapsulating, lyophilizing, or emulsifying processes, among others.
  • Compositions may be produced in various forms, including granules, precipitates, or particulates, powders, including freeze dried, rotary dried or spray dried powders, amorphous powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions.
  • Formulations may optionally contain solvents, diluents, and other liquid vehicles, dispersion or suspension aids, surface active agents, pH modifiers, isotonic agents, thickening or emulsifying agents, stabilizers and preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • the compositions disclosed herein are formulated for administration to a mammal, such as a human.
  • Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, cyclodextrins, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • inert diluents commonly used in the art such as
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • Compositions formulated for parenteral administration may be injected by bolus injection or by timed push, or may be administered by continuous infusion.
  • the rate of compound release can be controlled.
  • biodegradable polymers include poly(orthoesters) and poly (anhydrides).
  • Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
  • the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and g
  • Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner.
  • Examples of embedding compositions that can be used include polymeric substances and waxes.
  • the active compounds can also be in micro-encapsulated form with one or more excipients as noted above.
  • the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch.
  • Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose.
  • the dosage forms may also comprise buffering agents.
  • opacifying agents may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner.
  • embedding compositions include polymeric substances and waxes.
  • any method known to those in the art for contacting a cell, organ or tissue with a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent, such as those described herein, to a mammal, suitably a human. When used in vivo for therapy, the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect).
  • the dose and dosage regimen will depend upon the degree of the disease symptoms in the subject, the characteristics of the particular PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent, e.g., its therapeutic index, the subject, and the subject’s history.
  • the effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians.
  • An effective amount of a PI3K-AKT- mTOR pathway inhibitor and/or ferroptosis inducing agent useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds.
  • the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent may be administered systemically or locally.
  • compositions for administration, singly or in combination, to a subject for the treatment or prevention of a disorder described herein.
  • Such compositions typically include the active agent and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
  • compositions are typically formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).
  • the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent described herein is administered by a parenteral route or a topical route.
  • compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent described herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • a carrier which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid,
  • Glutathione and other antioxidants can be included to prevent oxidation.
  • isotonic agents are included, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
  • compositions can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • a sweetening agent such as sucrose or saccharin
  • compositions including the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology can be delivered in the form of an aerosol spray from a pressurized container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology as described herein can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • transdermal administration may be performed by iontophoresis.
  • a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology can be formulated in a carrier system.
  • the carrier can be a colloidal system.
  • the colloidal system can be a liposome, a phospholipid bilayer vehicle.
  • the therapeutic PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent is encapsulated in a liposome while maintaining structural integrity.
  • there are a variety of methods to prepare liposomes. See Lichtenberg et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem et al., Liposome Technology, CRC Press (1993)).
  • Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother ., 34(7-8):915-923 (2000)).
  • An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes.
  • Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.
  • the carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix.
  • the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent can be embedded in the polymer matrix, while maintaining protein integrity.
  • the polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly a-hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof.
  • the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA).
  • PVA poly-lactic acid
  • PGLA copoly lactic/glycolic acid
  • the polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother ., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).
  • the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent are prepared with carriers that will protect the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • Such formulations can be prepared using known techniques.
  • the materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent can also be formulated to enhance intracellular delivery.
  • liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.
  • Dosage, toxicity and therapeutic efficacy of the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent exhibit high therapeutic indices.
  • PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (/. ⁇ ., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • Such information can be used to more accurately determine useful doses in humans.
  • Levels in plasma may be measured, for example, by high performance liquid chromatography.
  • an effective amount of the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day.
  • the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day.
  • dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks.
  • a single dosage of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent ranges from 0.001-10,000 micrograms per kg body weight.
  • the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent concentrations is in a carrier range from 0.2 to 2000 micrograms per delivered milliliter.
  • An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
  • a therapeutically effective amount of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent may be defined as a concentration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent at the target tissue of 10' 12 to 10' 6 molar, e.g., approximately 10' 7 molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue. In some embodiments, the doses are administered by single daily or weekly administration, but may also include continuous administration e.g., parenteral infusion or transdermal application).
  • the dosage of the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology is provided at a “low,” “mid,” or “high” dose level.
  • the low dose is provided from about 0.0001 to about 0.5 mg/kg/h, suitably from about 0.001 to about 0.1 mg/kg/h.
  • the middose is provided from about 0.01 to about 1.0 mg/kg/h, suitably from about 0.01 to about 0.5 mg/kg/h.
  • the high dose is provided from about 0.5 to about 10 mg/kg/h, suitably from about 0.5 to about 2 mg/kg/h.
  • treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.
  • the mammal treated in accordance present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits.
  • the mammal is a human.
  • the present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
  • the cancer may be a solid malignant tumor or a hematological tumor.
  • the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
  • cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
  • the subject comprises a PTEN deletion and/or Z.PIK3CA activating mutation (e.g., E542K, E545K, or H1047R).
  • the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N- cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
  • the subject is human. Additionally or alternatively, in some embodiments, the subject is non-responsive to at least one prior line of cancer therapy such as radiation therapy, chemotherapy, or immunotherapy.
  • the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
  • the at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
  • the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
  • PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, vo
  • AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
  • mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like.
  • the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
  • SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like.
  • the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
  • SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like.
  • the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
  • the at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system X c “ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
  • ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like.
  • erastin erastin derivatives
  • erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)
  • the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
  • an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme
  • the subject exhibits decreased tumor growth, reduced tumor proliferation, lower tumor burden, or increased survival after administration of the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent. Additionally or alternatively, in some embodiments of the combination therapy methods disclosed herein, the time to response and/or duration of response is improved relative to that observed with PI3K-AKT-mTOR pathway inhibitor monotherapy or ferroptosis inducing agent monotherapy.
  • the present disclosure provides a method for increasing the efficacy of at least one chemotherapeutic agent or an immunotherapeutic agent in a subject suffering from cancer comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
  • chemotherapeutic agents include, but are not limited to, abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated-hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111.
  • immunotherapeutic agents include, but are not limited to, an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4- IBB antibody, an anti- CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti-CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, an anti-LAG-3 antibody, ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS- 936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA
  • the cancer may be a solid malignant tumor or a hematological tumor.
  • the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
  • cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
  • breast cancer colorectal cancer
  • lung cancer e.g., non-small cell lung carcinoma
  • adenocarcinoma e.g., prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer
  • squamous cell carcinoma of the skin mel
  • the subject comprises a PTEN deletion and/or a PIK3CA activating mutation (e.g., E542K, E545K, or H1047R).
  • the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
  • the subject is human.
  • the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
  • the at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
  • the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mT0R dual inhibitor.
  • PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, vo
  • AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
  • mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like.
  • the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
  • SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like.
  • the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
  • SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like.
  • the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
  • the at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system X c “ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
  • ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like.
  • erastin erastin derivatives
  • erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)
  • the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
  • an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme
  • the at least one PI3K- AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously.
  • the PI3K-AKT-mTOR pathway inhibitor and/or the ferroptosis inducing agent may be administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, topically, or via an implanted reservoir.
  • parenteral includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques.
  • Formulations including any PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent disclosed herein may be designed to be short-acting, fast-releasing, or long-acting.
  • compounds can be administered in a local rather than systemic means, such as administration (e.g., by injection) at a tumor site.
  • the at least one PI3K-AKT-mTOR pathway inhibitor can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a ferroptosis inducing agent to a subject suffering from cancer.
  • the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent are administered to a subject, for example, a mammal, such as a human, in a sequence and within a time interval such that the therapeutic agent that is administered first acts together with the therapeutic agent that is administered second to provide greater benefit than if each therapeutic agent were administered alone.
  • the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent can be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent are administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect of the combination of the two therapeutic agents.
  • the PI3K-AKT- mTOR pathway inhibitor and ferroptosis inducing agent exert their effects at times which overlap.
  • the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent each are administered as separate dosage forms, in any appropriate form and by any suitable route.
  • the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent are administered simultaneously in a single dosage form.
  • the frequency with which any of these therapeutic agents can be administered can be once or more than once over a period of about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 20 days, about 28 days, about a week, about 2 weeks, about 3 weeks, about 4 weeks, about a month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every year, about every 2 years, about every 3 years, about every 4 years, or about every 5 years.
  • a PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be administered daily, weekly, biweekly, or monthly for a particular period of time.
  • a PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be dosed daily over a 14 day time period, or twice daily over a seven day time period.
  • a PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be administered daily for 7 days.
  • a PI3K-AKT-mT0R pathway inhibitor or ferroptosis inducing agent may be administered daily, weekly, biweekly, or monthly for a particular period of time followed by a particular period of non-treatment.
  • the PI3K-AKT- mTOR pathway inhibitor or ferroptosis inducing agent can be administered daily for 14 days followed by seven days of non-treatment, and repeated for two more cycles of daily administration for 14 days followed by seven days of non-treatment.
  • the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent can be administered twice daily for seven days followed by 14 days of non-treatment, which may be repeated for one or two more cycles of twice daily administration for seven days followed by 14 days of non-treatment.
  • the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of 14 days.
  • the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of 12 days, or 11 days, or 10 days, or nine days, or eight days.
  • the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of seven days. In another embodiment, the PI3K-AKT- mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of six days, or five days, or four days, or three days.
  • individual doses of the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent are administered within a time interval such that the two therapeutic agents can work together (e.g., within 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 6 days, 1 week, or 2 weeks).
  • the treatment period during which the therapeutic agents are administered is then followed by a non-treatment period of a particular time duration, during which the therapeutic agents are not administered to the subject. This non-treatment period can then be followed by a series of subsequent treatment and non-treatment periods of the same or different frequencies for the same or different lengths of time.
  • the treatment and non-treatment periods are alternated. It will be understood that the period of treatment in cycling therapy may continue until the subject has achieved a complete response or a partial response, at which point the treatment may be stopped. Alternatively, the period of treatment in cycling therapy may continue until the subject has achieved a complete response or a partial response, at which point the period of treatment may continue for a particular number of cycles. In some embodiments, the length of the period of treatment may be a particular number of cycles, regardless of subject response. In some other embodiments, the length of the period of treatment may continue until the subject relapses.
  • the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent are cyclically administered to a subject. Cycling therapy involves the administration of a first agent (e.g., a first prophylactic or therapeutic agent) for a period of time, followed by the administration of a second agent and/or third agent (e.g., a second and/or third prophylactic or therapeutic agent) for a period of time and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improve the efficacy of the treatment.
  • a first agent e.g., a first prophylactic or therapeutic agent
  • a second agent and/or third agent e.g., a second and/or third prophylactic or therapeutic agent
  • the PI3K-AKT-mTOR pathway inhibitor is administered for a particular length of time prior to administration of the ferroptosis inducing agent.
  • the PI3K-AKT-mTOR pathway inhibitor may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the ferroptosis inducing agent may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21.
  • the ferroptosis inducing agent is administered for a particular length of time prior to administration of the PI3K-AKT-mT0R pathway inhibitor.
  • the ferroptosis inducing agent may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the PI3K-AKT-mT0R pathway inhibitor may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21.
  • the administration is on a 21-day dose schedule in which a once daily dose of PI3K-AKT-mT0R pathway inhibitor is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the ferroptosis inducing agent for seven days followed by 14 days of nontreatment (e.g., the PI3K-AKT-mT0R pathway inhibitor is administered on days 8-14 and the ferroptosis inducing agent is administered on days 1-7 of the 21-day schedule).
  • a once daily dose of PI3K-AKT-mT0R pathway inhibitor is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the ferroptosis inducing agent for seven days followed by 14 days of nontreatment (e.g., the PI3K-AKT-mT0R pathway inhibitor is administered on days 8-14 and the ferroptosis inducing agent is administered on days 1-7 of the 21-day schedule
  • the administration is on a 21-day dose schedule in which a once daily dose of ferroptosis inducing agent is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the PI3K-AKT-mT0R pathway inhibitor for seven days followed by 14 days of non- treatment (e.g., the ferroptosis inducing agent is administered on days 8-14 and the PI3K- AKT-mTOR pathway inhibitor is administered on days 1-7 of the 21-day schedule).
  • a once daily dose of ferroptosis inducing agent is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the PI3K-AKT-mT0R pathway inhibitor for seven days followed by 14 days of non- treatment (e.g., the ferroptosis inducing agent is administered on days 8-14 and the PI3K- AKT-mTOR pathway inhibitor is administered on days 1-7 of the 21-day schedule).
  • the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent each are administered at a dose and schedule typically used for that agent during monotherapy.
  • one or both of the agents can advantageously be administered at a lower dose than typically administered when the agent is used during monotherapy, such that the dose falls below the threshold that an adverse side effect is elicited.
  • the therapeutically effective amounts or suitable dosages of the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent in combination depends upon a number of factors, including the nature of the severity of the condition to be treated, the particular inhibitor, the route of administration and the age, weight, general health, and response of the individual subject.
  • the suitable dose level is one that achieves a therapeutic response as measured by tumor regression or other standard measures of disease progression, progression free survival, or overall survival. In other embodiments, the suitable dose level is one that achieves this therapeutic response and also minimizes any side effects associated with the administration of the therapeutic agent.
  • Suitable daily dosages of PI3K-AKT-mT0R pathway inhibitors can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of PI3K-AKT- mTOR pathway inhibitors are from about 20% to about 100% of the maximum tolerated dose as a single agent. In other embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 30% to about 80% of the maximum tolerated dose as a single agent.
  • the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 45% to about 60% of the maximum tolerated dose as a single agent.
  • suitable dosages of PI3K-AKT-mT0R pathway inhibitors are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent.
  • Suitable daily dosages of ferroptosis inducing agents can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of ferroptosis inducing agents are from about 20% to about 100% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 30% to about 80% of the maximum tolerated dose as a single agent.
  • the suitable dosages of ferroptosis inducing agents are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 45% to about 60% of the maximum tolerated dose as a single agent. In other embodiments, suitable dosages of ferroptosis inducing agents are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent.
  • a therapeutically effective amount of the PI3K-AKT- mTOR pathway inhibitor and ferroptosis inducing agent may partially or completely alleviate one or more symptoms of cancer and/or lead to increased survival, reduced tumor burden, reduced tumor relapse, reduction of the number of cancer cells, reduction of the tumor size, eradication of tumor, inhibition of cancer cell infiltration into peripheral organs, inhibition or stabilization of tumor growth, and stabilization or improvement of quality of life in the subject.
  • kits for treating cancer comprising a PI3K-AKT-mT0R pathway inhibitor disclosed herein, a ferroptosis inducing agent disclosed herein, and instructions for treating cancers e.g., therapy resistant cancers).
  • the kit may comprise a PI3K- AKT-mTOR pathway inhibitor and a ferroptosis inducing agent that has been formulated into a single pharmaceutical composition such as a tablet, or as separate pharmaceutical compositions.
  • the kit may comprise a PI3K-AKT-mTOR pathway inhibitor and a ferroptosis inducing agent that has been formulated as separate pharmaceutical compositions either in a single package, or in separate packages.
  • kits further comprise at least one chemotherapeutic agent and/or at least one immune checkpoint inhibitors that are useful for treating cancer.
  • chemotherapeutic agents include abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated- hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111.
  • immune checkpoint inhibitors include immuno-modulating/stimulating antibodies such as an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti -4- IBB antibody, an anti-CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti- CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, and an anti-LAG-3 antibody.
  • immuno-modulating/stimulating antibodies such as an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti -4- IBB antibody, an anti-CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-
  • Specific immune checkpoint inhibitors include ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS-936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA271, BMS-986016, lirilumab, urelumab, PF- 05082566, IPH2101, MEDI-6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP-514, AUNP 12, Indoximod, NLG-919, INCB024360, DLBCL inhibitors, and any combination thereof.
  • kits may further comprise pharmaceutically acceptable excipients, diluents, or carriers that are compatible with one or more kit components described herein.
  • the above described components of the kits of the present technology are packed in suitable containers and labeled for the treatment of cancer (e.g., a therapy resistant cancer).
  • cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
  • kits may optionally include instructions customarily included in commercial packages of therapeutic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic products.
  • any PI3K-AKT-mTOR pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • ferroptosis inducing agent e.g., ferroptosis inducing agent described herein
  • RSL3 (1219810-16-8, Cayman), Torin (10997, Cayman), Temsirolimus (CCI-779, NSC 683864, Selleck), Ferostatin-1 (17729, Caymen), MK-2206 (SI 078, Selleck Chemicals), GDC-0941 (S1065, Selleck Chemicals), CAY10566 (10012562, Cayman Chemicals), Fatostatin A (4444, Tocris), SYTOX Green (S7020, Thermo Fisher, Waltham, MA, USA), propidium iodide (556463, BD Biosciences, San Jose, CA, USA), BODIPY 581/591 Cl l (Thermo Fisher, Cat #D3861), Oleic acid (01383, Sigma-Aldrich), Stearic acid (S4751, Sigma), Palmitic acid (P0500, Sigma-Aldrich), Palmitoleic acid (P9417, Sigma), Imidazo
  • KELLY neuroblastoma cell line was obtained from Sigma-Aldrich, St. Louis, MO.
  • MEF, HT1080, MDA-MB-231, MDA-MB-453, BT474, MCF7, T47D, U87MG, HepG2, PC-3, DU145, A549, NCI-H1299, LN229 and SK-MEL-2 cells were obtained from the American Tissue Culture Collection (ATCC) and cultured in media conditions recommended by the ATCC in a humidified atmosphere containing 5% CO2 at 37°C. Media was prepared by the MSKCC Media Preparation Core Facility. All cell lines were subjected to STR authentication through ATCC or MSKCC IGO Core Facility.
  • Spheroids were generated by plating tumour cells at 10 3 /well into U-bottom Ultra Low Adherence (U A) 96-well plates (Corning, Tewksbury, MA, USA). Optimal three-dimensional structures were achieved by centrifugation at 600 g for 5 min followed by addition of 2.5% Matrigel (Coming, Tewksbury, MA, USA). Plates were incubated for 72 h at 37°C, 5% CO2, 95% humidity for formation of a single spheroid of cells. Spheroids were then treated with RSL3 in fresh medium containing Matrigel for the indicated time.
  • cell viability was determined by using the CellTiter-Glo® 3D Cell Viability Assay (Promega, Madison, WI, USA) following the manufacturer’s instructions. Viability was calculated by normalizing ATP levels of samples to that of negative controls (spheroids in normal full media without treatment).
  • Lipid peroxidation was analyzed by flow cytometry. Cells were seeded at appropriate density in a 6-well plate and grown overnight in DMEM. Cells were stained with 5 pM BODIPY Cl 1 (Thermo Fisher, Waltham, MA, Cat# D3861) for 30 min after indicated treatment. Labeled cells were trypsinized, re-suspended in PBS plus 2% FBS, and then subjected to flow cytometry analysis.
  • the membranes were incubated with goat anti-mouse HRP-conjugated antibody or donkey antirabbit HRP-conjugated antibody (Invitrogen, Carlsbad, CA) at room temperature for 1 hour and subjected to chemiluminescence using ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA).
  • ClarityTM Western ECL Substrate Bio-Rad, Hercules, CA, USA.
  • An Amersham Imager 600 GE Healthcare Life Sciences, Marlborough, MA, USA was used for the final detection.
  • mRNA was reverse transcribed into cDNA with an iScriptTM Reverse Transcription Supermix (BioRad, Hercules, CA).
  • cDNA was amplified with the iQTM SYBR Green Supermix (BioRad, Hercules, CA) in a CFX ConnectTM Real-Time PCR Detection System (BioRad, Hercules, CA).
  • the PCR program was as follows: 95°C, 30 seconds; 40 cycles (for each cycle 95°C, 15 seconds; 55°C, 40 seconds). All primers (SEQ ID NOs: 1-12) were synthesized by Invitrogen, Carlsbad, CA and are shown in FIG. 15.
  • Lentiviral-mediated shRNA interference' MISSION lentiviral shRNA clones targeting RPTOR and RICTOR were purchased from Sigma-Aldrich, St. Louis, MO. The clone IDs for the shRNA are: RPTOR #1 (TRCN0000039770), RPTOR #2 (TRCN0000039770) and RICTOR (TRCN0000074290). Lentiviruses were produced by the co-transfection of the lentiviral vector with the Delta- VPR envelope and CMV VSV-G packaging plasmids into 293T cells using PEI. Media was changed 8 hours after transfection. The supernatant was collected 48 hours after transfection and passed through a 0.45 pm filter. Cells were incubated with infectious particles in the presence of 4 pg/ml polybrene (Sigma- Aldrich, St. Louis, MO) overnight and cells were given fresh complete medium. After 48 hours, cells were placed under the appropriate antibiotic selection.
  • 4 pg/ml polybrene Sigma- Aldrich
  • Retroviral-mediated sene over expression For inducible expression of SREBP1 and SCD1, cDNAs were obtained from DNASU plasmid repository and were subcloned into a modified version of the retroviral vector pTRE-Tight (Clonetech, Mountain View, CA). Retrovirus was produced by co-transfection of the retroviral vector with gag/pol (Addgene, Watertown, MA) and VSV-G (Addgene, Watertown, MA) into 293T cells using PEI. Virus was collected and passed through a 0.45 pm filter. Infected cells were selected in medium containing hygromycin. Gene expression was induced by addition of 100 ng/ml doxycycline to culture medium.
  • Inducible CRISPR/Cas9 mediated GPX4 knockout' The lentiviral doxycycline (DOX)-inducible pCW-Cas9 vector and pLX-sgRNA (#50661 and #50662 respectively, Addgene, Watertown, MA)was used for inducible gene knockout (iKO).
  • the sgRNA sequence targeting human GPX4 is CACGCCCGATACGCTGAGTG (SEQ ID NO: 19).
  • Lentivirus was packaged in 293T cells using Lipofectamine 2000 (Life Technologies, Carlsbad, CA). Medium was changed 8 h after transfection, and the virus-containing supernatant was collected and filtered 48 h after transfection.
  • BT474 cells in 6-well tissue culture plates were infected with pCW-Cas9 viral supernatant containing 4 pg/mL polybrene. Cells were selected with 2 pg/ml puromycin after 48 h after infection. Single clones were screened for DOX-inducible Cas9 expression. Single clones with Cas9 expression were infected with the GPX4 sgRNA virus-containing supernatant with 4 pg/ml polybrene. Cells were selected with 10 pg/ml blasticidin after 48 h infection. Single clones with DOX- inducible Cas9 expression and GPX4 knockout were amplified and used.
  • Lentivirus was produced by co-transfection of the lentiviral vector with psPAX2 (Addgene, Watertown, MA) and VSV-G (Addgene, Watertown, MA) into 293T cells using PEI. Infected cells were selected in puromycin-containing medium before proceeding to experiments.
  • sgRNA sequences SEQ ID NOs: 13-18 used in the present disclosure are shown in FIG. 16.
  • mice were divided randomly into 4 groups: (1) Vehicle group (daily i.p.
  • mice were given intraperitoneal injections of 0.9% sterile saline or Dox (daily 100 mg/kg body weight, i.p.) for two days, right before CCI-779 treatment. Subsequently, mice were provided with daily Dox diet for Dox group and Dox+CCI-779 group, with or without CCI- 779 treatment, as indicated.
  • mice were sacrificed at a pre-determined endpoint. If any tumor exceeded a volume of 2000 mm 3 , 1.5 cm in diameter, or 10% of body weight, the mice would immediately be euthanized. At the end of the study, mice were euthanized with CO2 and tumors were taken for measurement of weight, followed by immunohistochemical staining. Results are presented as mean tumor volume ⁇ SD.
  • mice Male athymic nu/nu mice aged 5 to 6 weeks were injected in the right flank with 5 * 10 6 PC-3 cells. Tumors were measured with calipers daily. When tumours reached a mean volume of 200 mm 3 , mice were randomized into 4 groups: (1) Vehicle group (daily i.p. 65% D5W (5% dextrose in water), 5% Tween-80, 30% PEG-400); (2) IKE group (daily i.p. 50 mg/kg IKE dissolved in 65% D5W (5% dextrose in water), 5% Tween-80, 30% PEG-400); (3) CCI-779 group (daily i.p.
  • mice were euthanized with CO2 and tumours were taken for measurement of weight. All protocols for animal experiments were approved by the Memorial Sloan Kettering Cancer Center Institutional Animal Care and Use Committee (IACUC).
  • IACUC Memorial Sloan Kettering Cancer Center Institutional Animal Care and Use Committee
  • Immunohistochemical staining was performed on 5 pm-thick paraffin-embedded sections using rabbit anti-GPX4 (ab 125066, Abeam), mouse anti-Ki-67 (9449, Cell Signaling), rabbit anti-PTSG2 (12282, Cell Signaling) and rabbit-anti pS235/236 S6 (221 IS, Cell signaling) antibodies with a standard avidin-biotin HRP detection system according to the instructions of the manufacturer (anti-mouse/rabbit HRP -DAB Cell & Tissue Staining Kit, R&D Systems, Minneapolis, MN). Tissues were counterstained with haematoxylin, dehydrated, and mounted.
  • mTOR a major downstream player of the PI3K-AKT pathway
  • rapalog Temsirolimus CCI-779
  • mTOR catalytic inhibitor Torin also sensitized these cells to ferroptosis (FIGs. 1D-1E, FIGs. 6B-6D).
  • mTOR inhibition also synergized with RSL3 in inducing ferroptosis in these mutant cancer cells (FIG. IF, FIG. 6E).
  • inhibitors of ERK or BRAF failed to do so (FIG. 6F).
  • rapalog CCI-779 and mTOR catalytic inhibitor Torin can restore ferroptosis sensitivity, most likely the function of mTORCl instead of mT0RC2 is responsible for the resistance of cancer cells with PI3K-AKT pathway mutation. Consistent with this notion, short hairpin RNA (shRNA)-mediated silencing of RPTOR (a component of mTORCl) but not that of RICTOR (a component of mT0RC2) sensitized MDA-MB-453 and BT474 cells to RSL3 (FIGs. 1G-1H and FIG. 6G)
  • shRNA short hairpin RNA
  • PI3K-AKT-mT0R pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent.
  • the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
  • Lipid peroxide-trapping agent ferrostatin-1 can prevent RSL3 -triggered inactivation of mTORCl activity in HT1080 cells and MDA-MB-231 cells (FIG. 7B), suggesting lipid peroxidation is responsible for, and precedes, mTORCl inactivation in response to RSL3.
  • Fer-1 Lipid peroxide-trapping agent ferrostatin-1
  • mTORCl activity prevents the generation of cellular ROS, including lipid peroxides; and (2) accumulation of ROS and lipid peroxides in cells attenuates mTORCl activity.
  • mTORCl activity prevents the generation of cellular ROS, including lipid peroxides; and (2) accumulation of ROS and lipid peroxides in cells attenuates mTORCl activity.
  • lower basal mTORCl activity as that in wild-type cells, allows lipid peroxide accumulation, which in turn leads to the inhibition of mTORCl activity and accelerated lipid peroxidation; but in mutant cancer cells, the more potent and sustained mTORCl activity prevents lipid peroxide accumulation, thus resistant to ferroptosis.
  • PI3K-AKT-mTOR pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent.
  • the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
  • Example 4 mTORCl Activation Suppresses Ferroptosis by Upregulating SREBP1
  • mTORCl modulates multiple nutrient and energy pathways, including the lysosome-mediated catabolic process, autophagy.
  • autophagy was responsible for the ferroptosis sensitization triggered by mTORCl inhibition.
  • Weak ferroptosis was observed in mouse embryonic fibroblasts (MEFs) lacking the autophagy-essential gene ATG5, in comparison with d 705-null cells reconstituted with ATG5 expression (FIGs. 8A-8B).
  • mTOR inhibition could still sensitize autophagy-defective, ATG5-null cells to cystine starvation- induced ferroptosis (FIG. 8B), ruling out the possibility that autophagy mediates the sensitization of ferroptosis caused by mTORCl inhibition.
  • mTORCl inhibitor CCI-779 decreased the level of mature form of SREBP1 (SREBPlm) that can translocate into the nucleus to regulate its downstream transcriptional targets (FIG. 2A, FIG. 10A).
  • SREBPlm mature form of SREBP1
  • FIG. 10A Functionally, pharmacological inhibition of SREBP activity by Fatostatin A or genetic deletion of the SREBF1 gene by CRISPR/cas9 sensitized ferroptosis and lipid peroxidation in these cells (FIGs. 2B-2D, FIGs. 10B-10D).
  • PI3K-AKT-mTOR pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent.
  • the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
  • SREBP 1 is a transcription factor that regulates, among other metabolic genes, multiple lipid synthesis-related genes including ACLY, ACACA, FASN, andSCD (FIG. 13A).
  • SREBF1 knockout decreased the expression of SCD1 (both mRNA level and protein level) more significantly than that of other targets (FIG. 3A, FIGS. 11A-11B). This result prompted the examination of whether SCD1 is the major downstream target of SREBP 1 that mediates the resistance to ferroptosis induction.
  • SCD1 inhibitor CAY10566 sensitized the effect of RSL3 on the induction of ferroptosis (FIG. 3B) and lipid peroxidation (FIG. 12A).
  • CRISPR/Cas9-mediated SCD knockout also sensitized cells to ferroptosis induction and lipid peroxidation (FIGs. 3C-3D, FIGs. 12B-12D). Further, upon SCD knockout, inhibition of mTORCl, PI3K, or AKT could not further sensitize cancer cells to ferroptosis (FIG. 12E). Conversely, SCD1 overexpression protected cancer cells from ferroptosis induced by the combination of RSL3 with mTOR inhibition or with SREBF1 knockout (FIGs. 3E-3F and FIGs. 12F-12H).
  • SCD1 is an enzyme that converts saturated fatty acids to monounsaturated fatty acids (MUFAs) (FIG. 13A). Supplementation of MUFA palmitoleic acid (16: 1, PO) or oleate acid (18: 1, OA), but not saturated fatty acid palmitic acid (16:0, PA) or stearic acid (18:0, SA), resulted in ferroptosis resistance upon treatment of CCI-779 plus RSL3 (FIG. 3G and FIGs. 13B-13C). Collectively, these results demonstrate that SREBP1 protects cancer cells from ferroptosis mainly by upregulating SCD1.
  • MUFAs monounsaturated fatty acids
  • SCD1 is an iron-dependent enzyme that catalyzes fatty acid desaturation, which is by nature an oxidative reaction.
  • This irondependent, oxidative enzymatic reaction can mitigate ferroptosis, an iron-dependent, oxidative form of cell death.
  • PI3K-AKT-mTOR pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent.
  • the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
  • Example 6 Combination of mTORCl Inhibition with Ferroptosis Induction Leads to Tumor Regression In vivo
  • IKE imidazole ketone erastin
  • PI3K-AKT-mTOR pathway inhibitor e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor
  • a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent.
  • the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
  • a group having 1-3 cells refers to groups having 1, 2, or 3 cells.
  • a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Emergency Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present technology provides methods for treating cancers using combination therapy with a PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an ART inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent. Kits for use in practicing the methods are also provided.

Description

COMBINATION THERAPY WITH PI3K-AKT-MTOR INHIBITORS AND
FERROPTOSIS INDUCING AGENTS TO TREAT CANCER
CROSS-REFERENCE TO RELATED APPLICATIONS
[(HMD ] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63/106,067, filed October 27, 2020, the entire contents of which are incorporated herein by reference.
TECHNICAL FIELD
[0002] The present technology relates to methods for treating cancers using an inhibitor of PI3K-AKT-mTOR pathway and a ferroptosis inducing agent. Kits for use in practicing the methods are also provided.
STATEMENT OF GOVERNMENT SUPPORT
[0003] This invention was made with government support under grant number CA008748 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.
BACKGROUND
[0004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.
[0005] Ferroptosis is triggered by an inability of cellular antioxidant defenses to overcome the oxidative stress of metabolic activity, leading to a wave of iron-dependent cellular lipid peroxidation and, ultimately, cell death. Glutathione peroxidase-4 (GPX4), a glutathionedependent enzyme catalyzing the clearance of lipid ROS, plays an essential role in protecting cells from ferroptosis. Inactivation of GPX4 renders the cell unable to detoxify lipid peroxides, by-products of cellular metabolism, which, when in excess, damage cellular membranes, and kill the cell via ferroptosis. As such, loss of GPX4 function, either by its direct inhibition or by depriving cystine/cysteine, a building block for its cofactor glutathione, can induce ferroptosis. Pharmacological inhibition of system xc- cystine/glutamate antiporter, can also trigger ferroptosis. In addition, FSP1, a CoQ reductase, suppresses ferroptosis by generating reduced form of CoQ to trap phospholipid peroxides.
[0006] A prominent role for ferroptosis in cancer is also emerging. Ferroptosis induction may contribute to various cancer treatments, such as immune checkpoint blockade and radiotherapy. Some cancers are resistant to induced ferroptosis. However, the role of individual tumorigenic mutations that confer resistance of a given cancer to ferroptosis is unknown, preventing the development of effective treatments of cancer using ferroptosis inducing agents.
SUMMARY OF THE PRESENT TECHNOLOGY
[0007] In one aspect, the present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of at least one PI3K-AKT-mT0R pathway inhibitor and an effective amount of at least one ferroptosis inducing agent. The cancer may be a solid malignant tumor or a hematological tumor. In some embodiments, the cancer is resistant to radiation therapy, chemotherapy or immunotherapy. Examples of cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas. Additionally or alternatively, in some embodiments, the subject comprises a PTEN deletion and/or Z.PIK3CA activating mutation (e.g., E542K, E545K, or H1047R). In other embodiments, the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N- cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation. In certain embodiments, the subject is human. Additionally or alternatively, in some embodiments, the subject is non-responsive to at least one prior line of cancer therapy such as radiation therapy, chemotherapy, or immunotherapy. [0008] In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme. The at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor. In certain embodiments, the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mT0R dual inhibitor.
[0009] Examples of PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX- 037, ZSTK474, and the like.
[0010] Examples of AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
(GSK2110183), 4-amino-pyrido[2,3-d]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-b]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4- hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-lH-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3H- imidazo[4,5-b]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa- 1 ,3 -dien- 1 -yl)- lH-pyrazol-3 -yl]phenol, spiroindoline derivatives, triazolo[3,4-f][l,6]naphthyri din-3 (2H)-one derivative, triciribine, triciribine mono-phosphate active analogue, uprosertib, and the like. [00111 Examples of mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like. In some embodiments, the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
[0012] Examples of SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like. In some embodiments, the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
[0013] Examples of SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like. In some embodiments, the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
[0014] The at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc“ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like. In some embodiments, the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
[0015[ Additionally or alternatively, in some embodiments, the subject exhibits decreased tumor growth, reduced tumor proliferation, lower tumor burden, or increased survival after administration of the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent. Additionally or alternatively, in some embodiments of the combination therapy methods disclosed herein, the time to response and/or duration of response is improved relative to that observed with PI3K-AKT-mTOR pathway inhibitor monotherapy or ferroptosis inducing agent monotherapy.
[0016] In one aspect, the present disclosure provides a method for increasing the efficacy of at least one chemotherapeutic agent or an immunotherapeutic agent in a subject suffering from cancer comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent. Examples of chemotherapeutic agents include, but are not limited to, abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated-hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111. Examples of immunotherapeutic agents include, but are not limited to, an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4- IBB antibody, an anti- CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti-CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, an anti-LAG-3 antibody, ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS- 936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA271, BMS-986016, lirilumab, urelumab, PF-05082566, IPH2101, MEDI- 6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP-514, AUNP 12, Indoximod, NLG-919, INCB024360, and DLBCL inhibitors.
[0017] The cancer may be a solid malignant tumor or a hematological tumor. In some embodiments, the cancer is resistant to radiation therapy, chemotherapy or immunotherapy. Examples of cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas. Additionally or alternatively, in some embodiments, the subject comprises a PTEN deletion and/or a PIK3CA activating mutation (e.g., E542K, E545K, or H1047R). In other embodiments, the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation. In certain embodiments, the subject is human.
[0018] In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme. The at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor. In certain embodiments, the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
[0019] Examples of PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX- 037, ZSTK474, and the like.
[0020] Examples of AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib (GSK2110183), 4-amino-pyrido[2,3-d]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-b]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4- hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-lH-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3H- imidazo[4,5-b]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa- 1 ,3 -dien- 1 -yl)- lH-pyrazol-3 -yl]phenol, spiroindoline derivatives, triazolo[3,4-f][l,6]naphthyri din-3 (2H)-one derivative, triciribine, triciribine mono-phosphate active analogue, uprosertib, and the like.
[0021 ] Examples of mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like. In some embodiments, the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
[0022] Examples of SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like. In some embodiments, the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
[0023] Examples of SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like. In some embodiments, the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
[0024] The at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc“ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like. In some embodiments, the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
[0025] In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously. The PI3K-AKT-mTOR pathway inhibitor and/or the ferroptosis inducing agent may be administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, topically, or via an implanted reservoir.
[0026] Also disclosed herein are kits comprising a PI3K-AKT-mTOR pathway inhibitor, a ferroptosis inducing agent, and instructions for treating therapy resistant cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
| 0027 | FIGs. 1A-1H demonstrate that oncogenic activation of the PI3K-AKT-mT0R signaling pathway confers resistance to ferroptosis. FIG. 1A: Cells were seeded in 96-well plate, 2* 104 cells per well and incubated overnight. Cell death was induced by 24-h treatment of RSL3 with indicated concentrations. Cell death was measured by Sytox Green staining, as detailed in Example 1. Data are plotted as mean ± s.d.; n = 3 biological replicates. FIG. IB: Indicated protein components in the PI3K-AKT pathway were detected by western blot in indicated cell types. FIG. 1C: Cells were treated with or without PI3K inhibitor GDC-0941 (2 pM), AKT inhibitor MK-2206 (2 pM), RSL3 (1 pM), or ferroptosis inhibitor Ferrostatin-1 (Fer-1, 1 pM) as indicated for 12 h (BT474) or 24 h (MDA-MB-453). Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two tailed t-test), **** < 0.0001, ***P = 0.0003. FIG. ID: MDA-MB-453 and BT474 cells were treated with CCI-779 (0.5 pM), RSL3 (1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells), and Fer-1 (1 pM) as indicated. Cell death was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. FIG. IE: Cells were seeded in 6-well plates, 4>< 105 cells per well and incubated overnight. MDA-MB-453 and BT474 cells were treated as indicated. CCI-779, 0.5 pM; RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM. Cells were stained with 5 pM Cl 1-BODIPY followed by flow cytometry after 8 h treatment. Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two tailed t-test), ****C<0.000 l . FIG. IF: 3D spheroids were treated as indicated. CCI-779, 0.5 pM; RSL3, 0.5 pM; Fer-1, 1 pM. Top panel, dead cells were stained by SYTOX Green (scale bar, 100 pm). Bottom panel, cell viability was assayed by measuring cellular ATP levels. Data are plotted as mean ± s.d.; n = 3 biological replicates. P-values (two tailed t-test), ****/J<0.000 l . FIG. 1G: Cells expressing shRNAs targeting RPTOR or RICTOR were treated as indicated. CCI-779, 0.5 pM; RSL3, 0.5 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two-way ANOVA), ****7’<0.0001. FIG. 1H: Lipid peroxidation of samples as in FIG. 1G was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two-way ANOVA), ****7’<0.0001.
[0028] FIGs. 2A-2F demonstrate that mTORCl suppresses ferroptosis by upregulating SREBP1. FIG. 2A: BT474 and MDA-MB-453 cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM. Cell lysates were collected after 8 h and 24 h of treatment for BT474 cells and MDA-MB-453 cells, respectively, for western blot detection of p-T389 S6, total S6K, unprocessed SREBP1 (SREBPl(p)) and processed, mature SREBP1 (SREBPl(m)). FIG. 2B: Cells were treated as indicated. RSL3, 0.5 pM for BT474 cells and 1 pM for MDA-MB-453 cells; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two-way ANOVA), ****7’<0.0001. FIG. 2C: Cells were treated as in FIG. 2B. Lipid peroxidation was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two-way ANOVA), ****7’<0.0001. FIG. 2D: 3D spheroids derived from BT474 cells harboring control or SREBP1 sgRNA were treated as indicated. CCI-779, 0.5 pM; RSL3, 0.5 pM; Fer-1, 1 pM. Top, cell death stained by Sytox Green (scale bar, 100 pm). Bottom, cell viability plotted as mean ± s.d.; n = 3 biological replicates. -values (two tailed t-test), ****7’<0.0001. FIG. 2E: SREBPlm was overexpressed in BT474 cells and determined by western blot. Cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM. Cell death was measured (bottom panel). Data are plotted as mean ± s.d.; n = 3 biological replicates. -values (two tailed t-test), ****75<0.0001. FIG. 2F: 3D spheroids derived from BT474 cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM; Fer-1, 1 pM. Top, cell death stained by Sytox Green (scale bar, 100 m). Bottom, cell viability plotted as mean ± s.d.; n = 3 biological replicates. P- values (two tailed t-test), ****7’<0.0001.
[0029] FIGs. 3A-3G demonstrate that SREBP1 protects cells from ferroptosis through SCD1 activity. FIG. 3A: The expression of SREBP1, and its targets SCD1, FASN, and ACACA, in control and 577E5F7-sgRNA cells were detected by western blot. FIG. 3B: Cells were pretreated with or without 5 pM CAY10566 overnight, and then subjected to indicated treatments. RSL3, 0.5 pM for BT474 cells and 1 pM for MDA-MB-453 cells; CAY10566, 5 pM; Fer-1, 1 pM. Cell death was plotted as mean ± s.d.; n = 3 biological replicates. F-values (two tailed t-test), ****F<0.0001. FIG. 3C: Cells expressing control or SCD1 sgRNA were treated as indicated. RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer- 1, 1 pM. Cell death was plotted as mean ± s.d.; n = 3 biological replicates. F-values (two- way ANOVA), ***F=0.0003, ****F<0.0001. FIG. 3D: 3D spheroids derived from BT474 cells harboring control or SREBP1 sgRNA were treated as indicated. RSL3, 0.5 pM; CCI- 779, 0.5 pM; Fer-1, 1 pM. Left, cell death staining (scale bar, 100 pm). Right, cell viability plotted as mean ± s.d.; n = 3 biological replicates. F-values (two tailed t-test), ****F<0.0001. FIG. 3E: SCD1 were overexpressed in BT474 cells and determined by western blot. Cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM. Cell death was plotted as mean ± s.d.; n = 3 biological replicates. F-values (two tailed t-test), ****F<0.0001. FIG. 3F: 3D spheroids derived from BT474 cells with control or SCD1 overexpression were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM; Fer-1, 1 pM. Left, cell death staining (scale bar, 100 pm). Right, cell viability plotted as mean ± s.d.; n = 3 biological replicates. F-values (two tailed t-test), ****F<0.0001. FIG. 3G: Cells were treated as indicated. RSL3, 0.5 pM for BT474 and 1 pM for MDA-MB-453; CCI-779, 0.5 pM; Oleic acid (OA), 0.5 mM; stearic acid (SA), 0.5 mM. Cell death was measured. Data are plotted as mean ± s.d.; n = 3 biological replicates. F-values (two-way ANOVA), ns, F=0.3877 and 0.6665 (from left to right in the figure), ****F<0.0001.
[0030] FIGs. 4A-4F demonstrate that combination of mTORCl inhibition with ferroptosis induction leads to tumor regression in vivo. FIG. 4A: CRISPR/cas9-mediated, Dox-induced GPX4 knockout (GPX4-iKO) in BT474 cells, monitored by western blot. FIG. 4B: Images of resected tumors from mice xenografted with GPX4-iKO BT474 cells. Groups of mice were treated with CCI-779 and/or Dox as indicated (n = 6 per group). See Example 1 for detail. FIG. 4C: Representative haematoxylin and eosin (H&E) and immunostaining images of GPX4, Ki67, PTGS2 and pS235/236 S6, all counterstained with haematoxylin (blue), are shown from sections of xenografted tumors. Scale bar, 50 pm. FIG. 4D: Growth curves of BT474 tumors of each group. Data are plotted as mean ± s.d., on the linear scale for actual tumor size (upper panel) or the log2 scale for the fold change of tumors (bottom panel); P- values (two-way ANOVA), ****P<0.0001. FIG. 4E: Growth curves of PC-3 tumors of each group. Data are plotted as mean ± s.d., on the linear scale for actual tumor size (upper panel) or the log2 scale for the fold change of tumors (bottom panel); P- values (two-way ANOVA), **** <0.0001. FIG. 4F: Model depicting that oncogenic activation of PI3K-AKT-mTORCl signaling suppresses ferroptosis via SREBP1/SCD1 -mediated lipogenesis.
[0031 ] FIG. 5 shows genetic background of the analyzed cancer cell lines and their sensitivity to RSL3.
[0032] FIGs. 6A-6G demonstrate that PI3K-AKT-mTOR signaling regulates ferroptosis sensitivity. FIG. 6A: Cells were treated as indicated. GDC-0941, 2 pM; MK-2206, 2 pM; RSL3, 1 pM; Fer-1, 1 pM. Lipid peroxidation was plotted as mean ± s.d.; n=3 biological replicates; -values (two-way ANOVA), ****P<0.0001. FIG. 6B: Cells were treated with indicated conditions. Torin, 1 pM; RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM. Cell death was plotted as mean ± s.d.; n=3 biological replicates. FIG. 6C: Cells were treated with indicated conditions. RSL3, 10 pM for MCF cells and PC- 3 cells, 5 pM for T47D cells, 1 pM for HepG2 cells; Torin, 1 pM; CCI-779, 0.5 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), Torin group, ***P=0.0001, ** =0.006, ** =0.0049, **** =0.000096; CCI-779 group, ****P=0.00007, ***P=0.00017, ****P=0.00001, ****P=0.00001. FIG.
6D: Cells were treated as indicated. CCI-779, 0.5 pM; Torin, 1 pM; Fer-1, 1 pM. Cell death was assessed by staining with propidium iodide (PI) (red) or Sytox Green (green) (scale bar, 100 pm). FIG. 6E: 3D spheroids for MDA-MB-453 cells and MCF7 cells were treated as indicated. CCI-779, 0.5 pM; RSL3, 1 pM for MDA-MB-453 cells and 5 pM for MCF7 cells; Fer-1, 1 pM. Top panels, cell death staining (scale bar, 100 pm). Bottom panels, cell viability plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), ***p=0 Q002, **P=0.002. FIG. 6F: MDA-MB-453 cells were treated as indicated for 24 h. RSL3, 1 pM; CCI-779, 0.5 pM; GDC-0941, 2 pM; MK-2206, 2 pM; Dabrafenib, 2 pM; SCH772984, 2 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. P-values (two-way ANOVA), ****P<0.0001, *** =0.0002, ****P<0.0001, ns P>0.9999. FIG. 6G: Western blot was performed to detect RPTOR and RICTOR knockdown efficiency.
[0033] FIGs. 7A-7E demonstrate that inhibition of mTORCl also accelerates ferroptosis and lipid peroxidation in cells harboring wild-type PI3K-AKT-mTOR pathway. FIG. 7A: HT1080 cells and MDA-MB-231 cells (both with wild-type PI3K-AKT-mTOR pathway) were treated as indicated. RSL3, 0.1 pM for HT1080 and 0.25 pM for MDA-MB-231; Torin,
1 pM; CCI-779, 0.5 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. P-values (two-way ANOVA), ****P<0.0001. FIG. 7B: Two lines of PI3K-AKT-mTOR pathway wild-type cells (HT1080 and MDA-MB-231) and two lines of cells harboring activating mutation of the pathway (BT474 and MDA-MB-453) were treated as indicated. RSL3, 0.25 pM; Fer-1, 1 pM. Western blot was performed to detect the level of pT389 S6K. FIG. 7C: HT1080 cells were treated as indicated. tBHP, 50 pM; Fer-1,
2 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. FIG. 7D: HT1080 cells were treated as in FIG. 7C. Western blot was performed to measure NRF2, pT389 S6K and total S6K. FIG. 7E: HT1080 cells were treated as indicated. tBHP, 50 pM; Fer-1, 2 pM. Lipid peroxidation was measured 3 h after treatment. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), ****P<0.0001.
[0034] FIGs. 8A-8B demonstrate that mTOR regulates ferroptosis sensitivity independently of autophagy. FIG. 8A: ATG5 and LC3 I/II in MEFs with indicated genotypes were detected by western blot. FIG. 8B: .47G5-knockout Cells and knockout cells with ATG5 reconstitution were treated with cystine deprivation with or without Torin (1 pM). Propidium iodide was added after 10 h treatment to stain for dead cells (scale bar, 100 pm).
[0035] FIGs. 9A-9K demonstrate NRF2 is not the main player mediating the ferroptosis- suppressing activity of mTORCl. FIG. 9A: BT474 cells were treated as indicated for 8 h. RSL3, 0.5 pM; Torin, 1 pM. Western blot was performed to measure p-T389 S6, total S6K and NRF2. FIG. 9B: NRF2 was depleted by CRISPR/CAS9 technology in HT1080 cells. NRF2 level was measured by western blot. FIG. 9C: Control or NRF2-depleted cells were treated as indicated. Erastin, 0.5 pM; RSL3, 25 nM. Data are plotted as mean ± s.d.; n=3 biological replicates. /J- values (two-way ANOVA), ****P<0.0001, ns =0.2177. FIG. 9D: NRF2 was depleted by CRISPR/CAS9 technology in HepG2 cells. NRF2 level was measured by western blot. FIG. 9E: HepG2 cells with or without NRF2 depletion were treated with cystine starvation with or without CCI-779 (0.5 pM) as indicated. Sytox Green was added after 48 h for cell death staining (scale bar, 100 pm). FIG. 9F: NRF2 was depleted by CRISPR/CAS9 technology in PC-3 cells. NRF2 level was measured by western blot. FIG. 9G: PC-3 cells with or without NRF2 depletion were treated with cystine starvation with or without CCI-779 (0.5 pM) as indicated. Sytox Green was added after 48 h for cell death staining (scale bar, 100 pm). FIG. 9H: NRF2 was depleted by CRISPR/CAS9 technology in MCF7 cells. NRF2 level was measured by western blot. FIG. 91: MCF7 cells with or without NRF2 depletion were treated as indicated. RSL3, 5 pM; CCI-779, 0.5 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two-way ANOVA), ns =0.9284, =0.3885. FIG. 9J: Keapl was depleted by CRISPR/CAS9 technology in BT474 cells. NRF2 and Keapl levels were measured by western blot. FIG. 9K: BT474 cells with or without Keapl depletion were treated as indicated. RSL3, 0.5 pM; Torin, 1 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two-way ANOVA), **** <0 0001.
[0036] FIGs. 10A-10F demonstrate that SREBP1 protects cells from ferroptosis. FIG. 10A: MCF7 cells were treated as indicated. RSL3, 5 pM; CCI-779, 0.5 pM. Cell lysates were collected 24 h after treatment for Western blot detecting p-T389 S6, total S6K, SREBPl(P) and SREBPl(m). FIG. 10B: Cells were pretreated with 5 pM Fatostatin A overnight and treated as indicated. RSL3, 0.5 pM for BT474 cells, 1 pM for MDA-MB-453 and 5 pM for MCF7 cells; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), ****P<0.0001. FIG. 10C: Efficiency of SREBF1 Knockout in BT474, MDA-MB-453, and MCF7 cells was monitored by western blot. FIG. 10D: MCF7 cells were treated as indicated. RSL3, 5 pM; Fer-1, 1 pM. Cell death and lipid peroxidation were measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two-way ANOVA), ****P<0.0001. FIG. 10E: Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM; Torin, 1 pM; GDC-0941, 2 pM; MK-2206, 2 pM; CCI-779, 0.5 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. FIG. 10F: SREBPlm was overexpressed in MCF7, MDA-MB-453 and A549 cells and determined by western blot. Cells were treated as indicated. RSL3, 5 pM for MCF7 cells, 0.5 pM for MDA-MB-453 cells and 0.25 pM for A549 cells; CCI-779, 0.5 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), MCF7 *** =0.0004, MDA-MB-453 ***P=0.00088, A549 ***P=0.0009, ***P=0.0002.
[0037] FIGs. 11A-11B demonstrate that SREBP1 knockout downregulates SCD1. FIG. 11 A: Indicated lines of cells harboring SREBF1 knockout were collected. The mRNA level of SREPF1 and its targets genes (ACACA, FASN, SCD, ACLY) were measured by RT-PCR. Data are plotted as mean ± s.d.; n=3 biological replicates. FIG. 11B: Determination of FASN, ACC and SCD1 levels in MCF7 cells with SREBF1 knockout by western blot.
[0038] FIGs. 12A-12H demonstrate that SCD1 protects cells against ferroptosis. FIG. 12A: Cells were pretreated with 5 pM CAY10566 overnight. Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 and 0.5 pM for BT474; Fer-1, 1 pM; CAY10566, 5 pM; Fer- 1, 1 pM. Lipid peroxidation was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), *** =0.00037, ****P<0.0001. FIG. 12B: Western blot, measuring the SCD knockout efficiency in BT474, MDA-MB-453 and MCF7 cells. FIG. 12C: MCF cells (sgCtrl, sg5CD#l and sg5CD#2) were treated as indicated. RSL3, 5 pM; Fer-1, 1 pM. Cell death and lipid peroxidation were measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two-way ANOVA), ****P<0.0001. FIG. 12D: Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM. Lipid peroxidation was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. C- values (two-way ANOVA), *** =0.0002, ****P<0.0001. FIG. 12E: Cells were treated as indicated. RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; Fer-1, 1 pM; CCI-779, 0.5 pM; GDC-0941, 2 pM; MK-2206, 2 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. FIG. 12F: SCD1 was overexpressed in BT474 cells. Cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM. Lipid peroxidation was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. /J- values (two tailed t-test), ****P=0.00035. FIG. 12G: SCD1 was overexpressed in A549 cells and determined by western blot. Cells were treated as indicated. RSL3, 0.25 pM; CCI-779, 0.5 pM. Lipid peroxidation and cell death were measured 6 h and 24 h after treatment, respectively. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t-test), ** =0.00188, *** =0.0005. FIG. 12H: SCD1 was overexpressed in BT474 cells harboring SREBF1 knockout. SCD1 and SREBP1 levels were determined by western blot. Cells were treated as indicated. RSL3, 0.5 pM; CCI-779, 0.5 pM; Fer-1, 1 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two-way ANO V A), ****P<0.0001.
|0039| FIGs. 13A-13C demonstrate that ferroptosis sensitization triggered by mTORCl inhibition can be prevented by exogenous MUFAs. FIG. 13A: An overview of lipogenesis regulated by SREBP1 -driven transcription. FIG. 13B: A549 cells were treated as indicated. Oleic acid (18: 1, OA), 0.5 mM; stearic acid (18:0, SA), 0.5 mM; RSL3, 0.5 pM; CCI-779, 0.5 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t test), ****P<0.0001. FIG. 13C: Cells were treated as indicated. Palmitoleic acid (16: 1, PO), 0.5 mM; Palmitic acid (16:0, PA), 0.5 mM; RSL3, 1 pM for MDA-MB-453 cells and 0.5 pM for BT474 cells; CCI-779, 0.5 pM. Cell death was measured. Data are plotted as mean ± s.d.; n=3 biological replicates. -values (two tailed t test), *** =0.00098; ****P<0.0001.
|0040| FIGs. 14A-14E demonstrate that combination of mTORCl inhibition with ferroptosis induction leads to tumor regression. FIG. 14A: GPX4-iKO BT474 cells were treated as indicated for 30 h. CCI-779, 0.5 pM; DOX, 100 ng/ml; Trolox, 200 pM. Dead cells were stained with Sytox Green (scale bar, 100 pm). FIG. 14B: BT474 tumor volume was measured everyday of each mouse. The fold change of tumor volume of each individual mouse was plotted. FIG. 14C: Images of resected tumors from mice xenografted with PC-3 cells. Groups of mice were treated with CCI-779 and/or IKE as indicated (n = 6 per group). See Example 1 for details. FIG. 14D: Representative haematoxylin and eosin (H&E) and immunostaining images of Ki67, PTGS2 and pS235/236 S6, all counterstained with haematoxylin (blue), are shown from sections of xenografted tumors. Scale bar, 50 pm. FIG. 14E: PC-3 tumor volume was measured everyday of each mouse. The fold change of tumor volume of each individual mouse was plotted.
[0041 ] FIG. 15 provides a summary of the primers (SEQ ID NOs: 1-12) used in the Examples of the present disclosure.
[0042] FIG. 16 provides a summary of the sgRNA sequences (SEQ ID NOs: 13-18) used in the Examples of the present disclosure.
DETAILED DESCRIPTION
[0043] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present technology are described below in various levels of detail in order to provide a substantial understanding of the present technology.
[0044] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach,' Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual,' Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis,' U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization,' Anderson (1999) Nucleic Acid Hybridization,' Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir ’s Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).
[0045] Ferroptosis, a form of regulated necrosis driven by iron-dependent peroxidation of phospholipids, is regulated by cellular metabolism, redox homeostasis, and various signaling pathways. Some cancers are resistant to induced ferroptosis. However, the role of individual tumorigenic mutations that confer resistance of a given cancer to ferroptosis is unknown, preventing the development of effective treatments of cancer using ferroptosis inducing agents.
[0046] The present disclosure demonstrates that oncogenic alterations in PI3K-AKT-mT0R signaling (e.g., activating mutation of PI3K or loss of PTEN), one of the most mutated pathways in human cancer, render cancer cells more resistant to ferroptosis induction. Mechanistically, this resistance requires sustained activation of mTORCl and the mTORCl - dependent induction of sterol regulatory element-binding protein 1 (SREBP1), a central transcription factor regulating lipid metabolism. Consequently, stearoyl-CoA desaturase- 1 (SCD1), a transcriptional target of SREBP1, produces monounsaturated fatty acids to inhibit ferroptosis. Genetic or pharmacologic ablation of SREBP1 or SCD1 sensitized ferroptosis in cancer cells with PI3K-Akt-mTOR pathway mutation. Conversely, ectopic expression of SREPB1 or SCD1 restored ferroptosis resistance in these cells even when mTORCl was inhibited. As described in the Examples herein, the combination of mTORCl inhibition with ferroptosis induction resulted in near-complete regression of tumors in xenograft mouse models for PI3K-mutant breast cancer and PTEN-defective prostate cancer. Accordingly, the present disclosure demonstrates that patients bearing tumorigenic mutations in the PI3K- AKT-mTOR pathway might be treated effectively by combining ferroptosis induction with inhibitors of mTORCl or other components of the pathway.
Definitions
[0047] The definitions of certain terms as used in this specification are provided below. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this present technology belongs. [0048] As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. For example, reference to “a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.
[0049] As used herein, the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
[0050] As used herein, the “administration” of an agent, or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and the administration by another.
[0051 ] As used herein, a “control” is an alternative sample used in an experiment for comparison purpose. A control can be “positive” or “negative.” For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.
[0052] As used herein, the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a “therapeutically effective amount” of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.
[0053] As used herein, “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
[0054] As used herein, the term “pharmaceutically-acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. Pharmaceutically-acceptable carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, PA.).
[0055] As used herein, a “sample” or “biological sample” refers to a body fluid or a tissue sample isolated from a subject. In some cases, a biological sample may consist of or comprise whole blood, platelets, red blood cells, white blood cells, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, tumor biopsies, aspirate and/or chorionic villi, cultured cells, endothelial cells, synovial fluid, lymphatic fluid, ascites fluid, interstitial or extracellular fluid and the like. The term "sample" may also encompass the fluid in spaces between cells, including gingival crevicular fluid, bone marrow, cerebrospinal fluid (CSF), saliva, mucus, sputum, semen, sweat, urine, or any other bodily fluids. Samples can be obtained from a subject by any means including, but not limited to, venipuncture, excretion, ejaculation, massage, biopsy, needle aspirate, lavage, scraping, surgical incision, or intervention or other means known in the art. A blood sample can be whole blood or any fraction thereof, including blood cells (red blood cells, white blood cells or leukocytes, and platelets), serum and plasma. [0056] As used herein, the term “separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.
[0057] As used herein, the term “sequential” therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.
[0058] As used herein, the term “simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.
[0059] As used herein, “solid tumor” refers to all neoplastic cell growth and proliferation, and all pre-cancerous and cancerous cells and tissues, except for hematologic cancers such as lymphomas, leukemias, and multiple myeloma. Examples of solid tumors include, but are not limited to: soft tissue sarcoma, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing’s tumor and other bone tumors (e.g., osteosarcoma, malignant fibrous histiocytoma), leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms’ tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, brain/CNS tumors (e.g., astrocytoma, glioma, glioblastoma, childhood tumors, such as atypical teratoid/rhabdoid tumor, germ cell tumor, embryonal tumor, ependymoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma. [0060] As used herein, the terms “subject,” “individual,” or “patient” are used interchangeably and refer to an individual organism, a vertebrate, a mammal, or a human. In certain embodiments, the individual, patient or subject is a human.
[0061] As used herein, a “synergistic therapeutic effect” reflects a greater-than-additive therapeutic effect that is produced by a combination of at least two agents, and which exceeds that which would otherwise result from the individual administration of the agents. For example, lower doses of one or more agents may be used in treating a disease or disorder, resulting in increased therapeutic efficacy and decreased side-effects.
[0062] “Treating”, “treat”, or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, z.e., arresting its development; (ii) relieving a disease or disorder, z.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission. In some embodiments, “inhibiting,” means reducing or slowing the growth of a tumor. In some embodiments, the inhibition of tumor growth may be, for example, by 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. In some embodiments, the inhibition may be complete.
[0063] It is also to be appreciated that the various modes of treatment of medical diseases and conditions as described herein are intended to mean “substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.
Ferreptosis Inducing Agents
[0064] Accumulation of phospholipid peroxides can lead to ferroptotic death. In mammalian cells, phospholipid peroxides are effectively neutralized by glutathione peroxidase-4 (GPX4), and blockage of GPX4 enzyme often triggers ferroptosis. As GPX4 requires the reducing agent glutathione to function, deprivation of cysteine, the essential building block of glutathione, via approaches such as cystine starvation or pharmacological inhibition of system xc- cystine/glutamate antiporter, can also trigger ferroptosis.
[0065] A ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc” inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like. In some embodiments, the ferroptosis inducing agent is an inhibitory nucleic acid e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
FI3K-AK I -rnTOR Pathway Inhibitors
[0066] The phosphatidylinositol-3 -kinase (PI3K)/Akt and the mammalian target of rapamycin (mTOR) signaling pathway is crucial to many aspects of cell growth and survival, in physiological as well as in pathological conditions such as cancer. The PI3 -kinase/ Akt signaling pathway induces cell growth via activation of complex 1 of the target of rapamycin (TORC1). mTORCl regulates the activity of sterol responsive element binding protein (SREBP1) and expression of SREBP target genes. SREBP1 is a transcription factor that regulates, among other metabolic genes, multiple lipid synthesis-related genes including ACLY, ACACA, FASN, and SCI).
[0067] Somatic mutations and/or gains and losses of key genes are among a number of genetic alterations affecting this pathway in a number of different solid and hematological tumors. The activation of the PI3K/Akt/mTOR pathway results in a profound disturbance of control of cell growth and survival, which ultimately leads to a competitive growth advantage, metastatic competence, angiogenesis, and therapy resistance.
[0068] Examples of PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX- 037, ZSTK474, and the like.
[0069] Examples of AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
(GSK2110183), 4-amino-pyrido[2,3-t ]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-Z>]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4- hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l -methyl- 17/-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3JT- imidazo[4,5-Z>]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa- 1 ,3 -dien- 1 -yl)- 17/-pyrazol -3 -yl]phenol, spiroindoline derivatives, triazolo[3,4-/|[l,6]naphthyridin-3(2J7)-one derivative, triciribine, triciribine mono-phosphate active analogue, uprosertib, and the like.
[0070] Examples of mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like. In some embodiments, the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
[0071] Examples of SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like. In some embodiments, the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1. [0072] Examples of SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like. In some embodiments, the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
Formulations Including the PI3K-AKT-mTOR Pathway Inhibitors and/or the Ferroptosis Inducing Agents of the Present Technology
[0073] The pharmaceutical compositions of the present technology can be manufactured by methods well known in the art such as conventional granulating, mixing, dissolving, encapsulating, lyophilizing, or emulsifying processes, among others. Compositions may be produced in various forms, including granules, precipitates, or particulates, powders, including freeze dried, rotary dried or spray dried powders, amorphous powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions. Formulations may optionally contain solvents, diluents, and other liquid vehicles, dispersion or suspension aids, surface active agents, pH modifiers, isotonic agents, thickening or emulsifying agents, stabilizers and preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. In certain embodiments, the compositions disclosed herein are formulated for administration to a mammal, such as a human.
[0074] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, cyclodextrins, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
[0075] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. Compositions formulated for parenteral administration may be injected by bolus injection or by timed push, or may be administered by continuous infusion.
10076] In order to prolong the effect of a compound of the present disclosure, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly (anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.
[0077] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents such as phosphates or carbonates.
100781 Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.
[0079] The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.
Modes of Administration and Effective Dosages
[0080] Any method known to those in the art for contacting a cell, organ or tissue with a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent, such as those described herein, to a mammal, suitably a human. When used in vivo for therapy, the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease symptoms in the subject, the characteristics of the particular PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent, e.g., its therapeutic index, the subject, and the subject’s history.
[0081] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of a PI3K-AKT- mTOR pathway inhibitor and/or ferroptosis inducing agent useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent may be administered systemically or locally.
[0082] The PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent can be incorporated into pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of a disorder described herein. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
[0083] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).
[0084] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent described herein is administered by a parenteral route or a topical route.
[0085] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
[0086] The PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent described herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like.
Glutathione and other antioxidants can be included to prevent oxidation. In many cases, isotonic agents are included, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
[0087] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0088] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0089] For administration by inhalation, compositions including the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology can be delivered in the form of an aerosol spray from a pressurized container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798. [0090] Systemic administration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.
100911 A PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent is encapsulated in a liposome while maintaining structural integrity. As one skilled in the art would appreciate, there are a variety of methods to prepare liposomes. (See Lichtenberg et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother ., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.
[0092] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent can be embedded in the polymer matrix, while maintaining protein integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly a-hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother ., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).
[0093] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99/15154 (Tracy et al.), U.S. Pat. Nos. 5,674,534 and 5,716,644 (both to Zale et al.), PCT publication WO 96/40073 (Zale et ah)' , and PCT publication WO 00/38651 (Shah et al.). U. S. Pat. Nos. 5,674,534 and 5,716,644 and PCT publication WO 96/40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.
[0094] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent are prepared with carriers that will protect the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0095] The PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.
[0096] Dosage, toxicity and therapeutic efficacy of the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. In some embodiments, the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent exhibit high therapeutic indices. While the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
[0097] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (/.< ., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0098] Typically, an effective amount of the PI3K-AKT-mT0R pathway inhibitor and/or ferroptosis inducing agent, sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example, dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent concentrations is in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
[0099] In some embodiments, a therapeutically effective amount of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent may be defined as a concentration of a PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent at the target tissue of 10'12 to 10'6 molar, e.g., approximately 10'7 molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue. In some embodiments, the doses are administered by single daily or weekly administration, but may also include continuous administration e.g., parenteral infusion or transdermal application). In some embodiments, the dosage of the PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent of the present technology is provided at a “low,” “mid,” or “high” dose level. In one embodiment, the low dose is provided from about 0.0001 to about 0.5 mg/kg/h, suitably from about 0.001 to about 0.1 mg/kg/h. In one embodiment, the middose is provided from about 0.01 to about 1.0 mg/kg/h, suitably from about 0.01 to about 0.5 mg/kg/h. In one embodiment, the high dose is provided from about 0.5 to about 10 mg/kg/h, suitably from about 0.5 to about 2 mg/kg/h.
[0100] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.
[0101 ] The mammal treated in accordance present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.
Methods of Treatment of the Present Technology
[0102] In one aspect, the present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent. The cancer may be a solid malignant tumor or a hematological tumor. In some embodiments, the cancer is resistant to radiation therapy, chemotherapy or immunotherapy. Examples of cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas. Additionally or alternatively, in some embodiments, the subject comprises a PTEN deletion and/or Z.PIK3CA activating mutation (e.g., E542K, E545K, or H1047R). In other embodiments, the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N- cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation. In certain embodiments, the subject is human. Additionally or alternatively, in some embodiments, the subject is non-responsive to at least one prior line of cancer therapy such as radiation therapy, chemotherapy, or immunotherapy.
[0103] In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme. The at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor. In certain embodiments, the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
[0104] Examples of PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX- 037, ZSTK474, and the like.
[0105] Examples of AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
(GSK2110183), 4-amino-pyrido[2,3-d]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-b]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4- hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-lH-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3H- imidazo[4,5-b]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa- 1 ,3 -dien- 1 -yl)- lH-pyrazol-3 -yl]phenol, spiroindoline derivatives, triazolo[3,4-f][l,6]naphthyri din-3 (2H)-one derivative, triciribine, triciribine mono-phosphate active analogue, uprosertib, and the like.
[0106] Examples of mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like. In some embodiments, the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
[0107] Examples of SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like. In some embodiments, the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
]0108| Examples of SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like. In some embodiments, the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
10.109 ] The at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc“ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like. In some embodiments, the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
10110] Additionally or alternatively, in some embodiments, the subject exhibits decreased tumor growth, reduced tumor proliferation, lower tumor burden, or increased survival after administration of the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent. Additionally or alternatively, in some embodiments of the combination therapy methods disclosed herein, the time to response and/or duration of response is improved relative to that observed with PI3K-AKT-mTOR pathway inhibitor monotherapy or ferroptosis inducing agent monotherapy. [01111 In one aspect, the present disclosure provides a method for increasing the efficacy of at least one chemotherapeutic agent or an immunotherapeutic agent in a subject suffering from cancer comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent. Examples of chemotherapeutic agents include, but are not limited to, abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated-hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111. Examples of immunotherapeutic agents include, but are not limited to, an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4- IBB antibody, an anti- CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti-CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, an anti-LAG-3 antibody, ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS- 936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA271, BMS-986016, lirilumab, urelumab, PF-05082566, IPH2101, MEDI- 6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP-514, AUNP 12, Indoximod, NLG-919, INCB024360, and DLBCL inhibitors.
[0» 21 The cancer may be a solid malignant tumor or a hematological tumor. In some embodiments, the cancer is resistant to radiation therapy, chemotherapy or immunotherapy. Examples of cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas. Additionally or alternatively, in some embodiments, the subject comprises a PTEN deletion and/or a PIK3CA activating mutation (e.g., E542K, E545K, or H1047R). In other embodiments, the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation. In certain embodiments, the subject is human.
[0113] In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid, such as an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme. The at least one PI3K-AKT-mTOR pathway inhibitor may be a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor. In certain embodiments, the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mT0R dual inhibitor.
[0114] Examples of PI3K inhibitors include, but are not limited to, alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC-0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib, LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX- 037, ZSTK474, and the like.
[0115] Examples of AKT inhibitors include, but are not limited to, MK-2206, A-674563, A- 443654, acetoxy -tirucallic acid, 3a- and 3P-acetoxy-tirucallic acids, afuresertib
(GSK2110183), 4-amino-pyrido[2,3-d]pyrimidine derivative API-1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3- chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-b]carbazole-2,10- di carb oxy late, diindolylmethane, 2,3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4- hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-lH-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3H- imidazo[4,5-b]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa- 1 ,3 -dien- 1 -yl)- lH-pyrazol-3 -yl]phenol, spiroindoline derivatives, triazolo[3,4-f][l,6]naphthyri din-3 (2H)-one derivative, triciribine, triciribine mono-phosphate active analogue, uprosertib, and the like.
[0116] Examples of mTOR inhibitors include, but are not limited to, Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku- 0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, XL765, and the like. In some embodiments, the mTOR inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets RPTOR.
[0117] Examples of SREBP1 inhibitors include, but are not limited to, fatostatin A, betulin, PF -429242, Nelfinavir, 1,10-phenanthroline, and the like. In some embodiments, the SREBP1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SREBF1.
[0118] Examples of SCD1 inhibitors include, but are not limited to, CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, SW203668, and the like. In some embodiments, the SCD1 inhibitor is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets SCD.
[01191 The at least one of ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc“ inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and the like. In some embodiments, the ferroptosis inducing agent is an inhibitory nucleic acid (e.g., an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme) that targets GPX4.
[ 01201 In any and all embodiments of the methods disclosed herein, the at least one PI3K- AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously. The PI3K-AKT-mTOR pathway inhibitor and/or the ferroptosis inducing agent may be administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, topically, or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. Formulations including any PI3K-AKT-mTOR pathway inhibitor and/or ferroptosis inducing agent disclosed herein may be designed to be short-acting, fast-releasing, or long-acting. In other embodiments, compounds can be administered in a local rather than systemic means, such as administration (e.g., by injection) at a tumor site.
[0121 ] Additionally or alternatively, in some embodiments of the methods disclosed herein, the at least one PI3K-AKT-mTOR pathway inhibitor can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a ferroptosis inducing agent to a subject suffering from cancer.
[0122] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent are administered to a subject, for example, a mammal, such as a human, in a sequence and within a time interval such that the therapeutic agent that is administered first acts together with the therapeutic agent that is administered second to provide greater benefit than if each therapeutic agent were administered alone. For example, the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent can be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent are administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect of the combination of the two therapeutic agents. In one embodiment, the PI3K-AKT- mTOR pathway inhibitor and ferroptosis inducing agent exert their effects at times which overlap. In some embodiments, the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent each are administered as separate dosage forms, in any appropriate form and by any suitable route. In other embodiments, the PI3K-AKT-mTOR pathway inhibitor and ferroptosis inducing agent are administered simultaneously in a single dosage form.
[0123] It will be appreciated that the frequency with which any of these therapeutic agents can be administered can be once or more than once over a period of about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 20 days, about 28 days, about a week, about 2 weeks, about 3 weeks, about 4 weeks, about a month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every year, about every 2 years, about every 3 years, about every 4 years, or about every 5 years.
10124] For example, a PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be administered daily, weekly, biweekly, or monthly for a particular period of time. A PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be dosed daily over a 14 day time period, or twice daily over a seven day time period. A PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent may be administered daily for 7 days.
[0125] Alternatively, a PI3K-AKT-mT0R pathway inhibitor or ferroptosis inducing agent may be administered daily, weekly, biweekly, or monthly for a particular period of time followed by a particular period of non-treatment. In some embodiments, the PI3K-AKT- mTOR pathway inhibitor or ferroptosis inducing agent can be administered daily for 14 days followed by seven days of non-treatment, and repeated for two more cycles of daily administration for 14 days followed by seven days of non-treatment. In some embodiments, the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent can be administered twice daily for seven days followed by 14 days of non-treatment, which may be repeated for one or two more cycles of twice daily administration for seven days followed by 14 days of non-treatment. [0126] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of 14 days. In another embodiment, the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of 12 days, or 11 days, or 10 days, or nine days, or eight days. In another embodiment, the PI3K-AKT-mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of seven days. In another embodiment, the PI3K-AKT- mTOR pathway inhibitor or ferroptosis inducing agent is administered daily over a period of six days, or five days, or four days, or three days.
[0127] In some embodiments, individual doses of the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent are administered within a time interval such that the two therapeutic agents can work together (e.g., within 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 6 days, 1 week, or 2 weeks). In some embodiments, the treatment period during which the therapeutic agents are administered is then followed by a non-treatment period of a particular time duration, during which the therapeutic agents are not administered to the subject. This non-treatment period can then be followed by a series of subsequent treatment and non-treatment periods of the same or different frequencies for the same or different lengths of time. In some embodiments, the treatment and non-treatment periods are alternated. It will be understood that the period of treatment in cycling therapy may continue until the subject has achieved a complete response or a partial response, at which point the treatment may be stopped. Alternatively, the period of treatment in cycling therapy may continue until the subject has achieved a complete response or a partial response, at which point the period of treatment may continue for a particular number of cycles. In some embodiments, the length of the period of treatment may be a particular number of cycles, regardless of subject response. In some other embodiments, the length of the period of treatment may continue until the subject relapses.
[0128] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent are cyclically administered to a subject. Cycling therapy involves the administration of a first agent (e.g., a first prophylactic or therapeutic agent) for a period of time, followed by the administration of a second agent and/or third agent (e.g., a second and/or third prophylactic or therapeutic agent) for a period of time and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improve the efficacy of the treatment.
[0129] In some embodiments, the PI3K-AKT-mTOR pathway inhibitor is administered for a particular length of time prior to administration of the ferroptosis inducing agent. For example, in a 21-day cycle, the PI3K-AKT-mTOR pathway inhibitor may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the ferroptosis inducing agent may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21. In other embodiments, the ferroptosis inducing agent is administered for a particular length of time prior to administration of the PI3K-AKT-mT0R pathway inhibitor. For example, in a 21-day cycle, the ferroptosis inducing agent may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the PI3K-AKT-mT0R pathway inhibitor may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21.
[0130] In one embodiment, the administration is on a 21-day dose schedule in which a once daily dose of PI3K-AKT-mT0R pathway inhibitor is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the ferroptosis inducing agent for seven days followed by 14 days of nontreatment (e.g., the PI3K-AKT-mT0R pathway inhibitor is administered on days 8-14 and the ferroptosis inducing agent is administered on days 1-7 of the 21-day schedule). In another embodiment, the administration is on a 21-day dose schedule in which a once daily dose of ferroptosis inducing agent is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the PI3K-AKT-mT0R pathway inhibitor for seven days followed by 14 days of non- treatment (e.g., the ferroptosis inducing agent is administered on days 8-14 and the PI3K- AKT-mTOR pathway inhibitor is administered on days 1-7 of the 21-day schedule).
|0131[ In some embodiments, the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent each are administered at a dose and schedule typically used for that agent during monotherapy. In other embodiments, when the PI3K-AKT-mT0R pathway inhibitor and ferroptosis inducing agent are administered concomitantly, one or both of the agents can advantageously be administered at a lower dose than typically administered when the agent is used during monotherapy, such that the dose falls below the threshold that an adverse side effect is elicited.
[0132] The therapeutically effective amounts or suitable dosages of the PI3K-AKT-mTOR pathway inhibitor and the ferroptosis inducing agent in combination depends upon a number of factors, including the nature of the severity of the condition to be treated, the particular inhibitor, the route of administration and the age, weight, general health, and response of the individual subject. In certain embodiments, the suitable dose level is one that achieves a therapeutic response as measured by tumor regression or other standard measures of disease progression, progression free survival, or overall survival. In other embodiments, the suitable dose level is one that achieves this therapeutic response and also minimizes any side effects associated with the administration of the therapeutic agent.
[0133] Suitable daily dosages of PI3K-AKT-mT0R pathway inhibitors can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of PI3K-AKT- mTOR pathway inhibitors are from about 20% to about 100% of the maximum tolerated dose as a single agent. In other embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 30% to about 80% of the maximum tolerated dose as a single agent. In other embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of PI3K-AKT-mT0R pathway inhibitors are from about 45% to about 60% of the maximum tolerated dose as a single agent. In other embodiments, suitable dosages of PI3K-AKT-mT0R pathway inhibitors are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent.
[0134] Suitable daily dosages of ferroptosis inducing agents can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of ferroptosis inducing agents are from about 20% to about 100% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 30% to about 80% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ferroptosis inducing agents are from about 45% to about 60% of the maximum tolerated dose as a single agent. In other embodiments, suitable dosages of ferroptosis inducing agents are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent.
[0135] For example, when administered to the appropriate subject as determined by the methods of the present technology, a therapeutically effective amount of the PI3K-AKT- mTOR pathway inhibitor and ferroptosis inducing agent may partially or completely alleviate one or more symptoms of cancer and/or lead to increased survival, reduced tumor burden, reduced tumor relapse, reduction of the number of cancer cells, reduction of the tumor size, eradication of tumor, inhibition of cancer cell infiltration into peripheral organs, inhibition or stabilization of tumor growth, and stabilization or improvement of quality of life in the subject.
Kits of the Present Technology
(0136] The present disclosure provides kits for treating cancer (e.g., a therapy resistant cancer) comprising a PI3K-AKT-mT0R pathway inhibitor disclosed herein, a ferroptosis inducing agent disclosed herein, and instructions for treating cancers e.g., therapy resistant cancers). When simultaneous administration is contemplated, the kit may comprise a PI3K- AKT-mTOR pathway inhibitor and a ferroptosis inducing agent that has been formulated into a single pharmaceutical composition such as a tablet, or as separate pharmaceutical compositions. When the PI3K-AKT-mT0R pathway inhibitor and the ferroptosis inducing agent are not administered simultaneously, the kit may comprise a PI3K-AKT-mTOR pathway inhibitor and a ferroptosis inducing agent that has been formulated as separate pharmaceutical compositions either in a single package, or in separate packages.
[0137] Additionally or alternatively, in some embodiments, the kits further comprise at least one chemotherapeutic agent and/or at least one immune checkpoint inhibitors that are useful for treating cancer. Examples of such chemotherapeutic agents include abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated- hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111. Examples of immune checkpoint inhibitors include immuno-modulating/stimulating antibodies such as an anti-PD-1 antibody, an anti- PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti -4- IBB antibody, an anti-CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti- CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, and an anti-LAG-3 antibody. Specific immune checkpoint inhibitors include ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS-936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA271, BMS-986016, lirilumab, urelumab, PF- 05082566, IPH2101, MEDI-6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP-514, AUNP 12, Indoximod, NLG-919, INCB024360, DLBCL inhibitors, and any combination thereof.
[0138] The kits may further comprise pharmaceutically acceptable excipients, diluents, or carriers that are compatible with one or more kit components described herein. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the treatment of cancer (e.g., a therapy resistant cancer). Examples of cancers include, but are not limited to breast cancer, colorectal cancer, lung cancer (e.g., non-small cell lung carcinoma), adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer (e.g., Hepatocellular carcinoma), lymphomas, renal cancer, brain tumors (e.g. neuroblastomas, glioblastomas), head and neck cancer, adrenocortical carcinomas, and sarcomas.
[0139] The kits may optionally include instructions customarily included in commercial packages of therapeutic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic products.
EXAMPLES
101401 The following examples are provided to further illustrate the methods of the present disclosure. These examples are illustrative only and are not intended to limit the scope of the disclosure in any way. For each of the examples below, any PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) or ferroptosis inducing agent described herein could be used.
Example 1: Materials and Methods
[0141] Reagents'. RSL3 (1219810-16-8, Cayman), Torin (10997, Cayman), Temsirolimus (CCI-779, NSC 683864, Selleck), Ferostatin-1 (17729, Caymen), MK-2206 (SI 078, Selleck Chemicals), GDC-0941 (S1065, Selleck Chemicals), CAY10566 (10012562, Cayman Chemicals), Fatostatin A (4444, Tocris), SYTOX Green (S7020, Thermo Fisher, Waltham, MA, USA), propidium iodide (556463, BD Biosciences, San Jose, CA, USA), BODIPY 581/591 Cl l (Thermo Fisher, Cat #D3861), Oleic acid (01383, Sigma-Aldrich), Stearic acid (S4751, Sigma), Palmitic acid (P0500, Sigma-Aldrich), Palmitoleic acid (P9417, Sigma), Imidazole ketone erastin (IKE, HY-114481, MCE).
[0142] Cell culture'. KELLY neuroblastoma cell line was obtained from Sigma-Aldrich, St. Louis, MO. MEF, HT1080, MDA-MB-231, MDA-MB-453, BT474, MCF7, T47D, U87MG, HepG2, PC-3, DU145, A549, NCI-H1299, LN229 and SK-MEL-2 cells were obtained from the American Tissue Culture Collection (ATCC) and cultured in media conditions recommended by the ATCC in a humidified atmosphere containing 5% CO2 at 37°C. Media was prepared by the MSKCC Media Preparation Core Facility. All cell lines were subjected to STR authentication through ATCC or MSKCC IGO Core Facility. [0143] Generation o f Three-dimensional Spheroids'. Spheroids were generated by plating tumour cells at 103/well into U-bottom Ultra Low Adherence (U A) 96-well plates (Corning, Tewksbury, MA, USA). Optimal three-dimensional structures were achieved by centrifugation at 600 g for 5 min followed by addition of 2.5% Matrigel (Coming, Tewksbury, MA, USA). Plates were incubated for 72 h at 37°C, 5% CO2, 95% humidity for formation of a single spheroid of cells. Spheroids were then treated with RSL3 in fresh medium containing Matrigel for the indicated time.
(0144] Cell death quantification and Cell viability measurement'. Cells were seeded in plates at appropriate cell density and incubated overnight at 37°C containing 5% CO2, and then subjected to treatments as described in individual experiments. Cells were stained with hoechst 33342 (0.1 pg/ml) to monitor total cell number, and with Sytox Green (5 nM) to monitor cell death. Culture plates were read by Cytation™ 5 (Biotek Instruments Inc., Winooski, VT) at indicated time points. Percentage of cell death was calculated as Sytox Green-positive cell number over total cell number. For 3D spheroids, cell viability was determined by using the CellTiter-Glo® 3D Cell Viability Assay (Promega, Madison, WI, USA) following the manufacturer’s instructions. Viability was calculated by normalizing ATP levels of samples to that of negative controls (spheroids in normal full media without treatment).
[0145] Measurement of lipid peroxidation'. Lipid peroxidation was analyzed by flow cytometry. Cells were seeded at appropriate density in a 6-well plate and grown overnight in DMEM. Cells were stained with 5 pM BODIPY Cl 1 (Thermo Fisher, Waltham, MA, Cat# D3861) for 30 min after indicated treatment. Labeled cells were trypsinized, re-suspended in PBS plus 2% FBS, and then subjected to flow cytometry analysis.
(0146] Western Blot'. Cell lysates were resolved on SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were incubated in 5% skim milk for 1 hour at room temperature and then incubated with primary antibodies diluted in blocking buffer at 4°C overnight. The following primary antibodies were used: PTEN (9559L, Cell Signaling Technology (CST), Danvers, MA), Phospho- Akt Ser473 (4060, CST, Danvers, MA), Akt (2920, CST, Danvers, MA), 0 Actin (MO Al 978, Sigma- Aldrich, St. Louis, Mo), GAPDH (SC-47724, Santa Cruz Biotechnology, Dallas, TX), Raptor (2280, CST, Danvers, MA), Rictor (9476, CST, Danvers, MA), Total S6K (2708, CST, Danvers, MA), Phospho-p70 S6 Kinase Thr389 (9205, CST, Danvers, MA), ATG5 (A0731, Sigma-Aldrich, St. Louis, MO), LC3 I/II (L7543, Sigma- Aldrich, St. Louis, MO), SREBP1(SC-13551, Santa Cruz Biotechnology, Dallas, TX), SCD1 (ab39969, Abeam, Cambridge, United Kingdom), FASN (3180, CST, Danvers, MA), ACACA (3662, CST, Danvers, MA), NRF2 (16396-1-AP, Proteintech Group, Inc., Rosemont, IL), Keapl (8047S, CST, Danvers, MA), GPX4 (ab 125066, Abeam) and Cas9 (14697S, CST, Danvers, MA). After three washes, the membranes were incubated with goat anti-mouse HRP-conjugated antibody or donkey antirabbit HRP-conjugated antibody (Invitrogen, Carlsbad, CA) at room temperature for 1 hour and subjected to chemiluminescence using Clarity™ Western ECL Substrate (Bio-Rad, Hercules, CA, USA). An Amersham Imager 600 (GE Healthcare Life Sciences, Marlborough, MA, USA) was used for the final detection.
[0147] RT-PCR: Total RNA was prepared with the TRIzol reagent (Invitrogen, Carlsbad, CA). 20% chloroform was added to each sample. The samples were shaken vigorously for 15 seconds and incubated at room temperature for 15 min. Samples were then centrifuged at 12,000 g for 15 min at 4°C. The aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. Samples were incubated at room temperature for 10 min, followed by centrifugation at 12,000 g for 10 min at 4°C. mRNA pellets were washed in 75% ethanol, dried, and resuspended in nuclease-free water. mRNA was reverse transcribed into cDNA with an iScript™ Reverse Transcription Supermix (BioRad, Hercules, CA). cDNA was amplified with the iQ™ SYBR Green Supermix (BioRad, Hercules, CA) in a CFX Connect™ Real-Time PCR Detection System (BioRad, Hercules, CA). The PCR program was as follows: 95°C, 30 seconds; 40 cycles (for each cycle 95°C, 15 seconds; 55°C, 40 seconds). All primers (SEQ ID NOs: 1-12) were synthesized by Invitrogen, Carlsbad, CA and are shown in FIG. 15.
[0148| Lentiviral-mediated shRNA interference'. MISSION lentiviral shRNA clones targeting RPTOR and RICTOR were purchased from Sigma-Aldrich, St. Louis, MO. The clone IDs for the shRNA are: RPTOR #1 (TRCN0000039770), RPTOR #2 (TRCN0000039770) and RICTOR (TRCN0000074290). Lentiviruses were produced by the co-transfection of the lentiviral vector with the Delta- VPR envelope and CMV VSV-G packaging plasmids into 293T cells using PEI. Media was changed 8 hours after transfection. The supernatant was collected 48 hours after transfection and passed through a 0.45 pm filter. Cells were incubated with infectious particles in the presence of 4 pg/ml polybrene (Sigma- Aldrich, St. Louis, MO) overnight and cells were given fresh complete medium. After 48 hours, cells were placed under the appropriate antibiotic selection.
[0149] Retroviral-mediated sene over expression'. For inducible expression of SREBP1 and SCD1, cDNAs were obtained from DNASU plasmid repository and were subcloned into a modified version of the retroviral vector pTRE-Tight (Clonetech, Mountain View, CA). Retrovirus was produced by co-transfection of the retroviral vector with gag/pol (Addgene, Watertown, MA) and VSV-G (Addgene, Watertown, MA) into 293T cells using PEI. Virus was collected and passed through a 0.45 pm filter. Infected cells were selected in medium containing hygromycin. Gene expression was induced by addition of 100 ng/ml doxycycline to culture medium.
[0150] Inducible CRISPR/Cas9 mediated GPX4 knockout'. The lentiviral doxycycline (DOX)-inducible pCW-Cas9 vector and pLX-sgRNA (#50661 and #50662 respectively, Addgene, Watertown, MA)was used for inducible gene knockout (iKO). The sgRNA sequence targeting human GPX4 is CACGCCCGATACGCTGAGTG (SEQ ID NO: 19). Lentivirus was packaged in 293T cells using Lipofectamine 2000 (Life Technologies, Carlsbad, CA). Medium was changed 8 h after transfection, and the virus-containing supernatant was collected and filtered 48 h after transfection. BT474 cells in 6-well tissue culture plates were infected with pCW-Cas9 viral supernatant containing 4 pg/mL polybrene. Cells were selected with 2 pg/ml puromycin after 48 h after infection. Single clones were screened for DOX-inducible Cas9 expression. Single clones with Cas9 expression were infected with the GPX4 sgRNA virus-containing supernatant with 4 pg/ml polybrene. Cells were selected with 10 pg/ml blasticidin after 48 h infection. Single clones with DOX- inducible Cas9 expression and GPX4 knockout were amplified and used.
[0151] Generation of Constitutive CR1SPR/Cas9 mediated knockout'. Keapl, NRF2 and SREBP1 depleted cells were generated with CRISPR/Cas9-mediated knockout system, using the LentiCRISPRV2 vector (Addgene, Watertown, MA). sgRNA sequences were designed with the Benchling CRSPR tool, and cloned into LentiCRISPRV2. SCD1 depleted cells were generated with CRISPR/Cas9 mediated knockout system, using stable Cas9 expression cells and Sanger CRISPR clone from Sigma-Aldrich, St. Louis, MO (HS5000004019 and HS5000004020). Lentivirus was produced by co-transfection of the lentiviral vector with psPAX2 (Addgene, Watertown, MA) and VSV-G (Addgene, Watertown, MA) into 293T cells using PEI. Infected cells were selected in puromycin-containing medium before proceeding to experiments. sgRNA sequences (SEQ ID NOs: 13-18) used in the present disclosure are shown in FIG. 16.
[0152] In Vivo xenograft mouse model'. 17-P-estradiol 60-day release pellets (Innovative Research of America, Sarasota, Florida) were implanted subcutaneously into the left flank 7 days before tumor inoculation. GPX4 iKO BT474 cells were inoculated by injecting 5 * 106 cells in 50% Matrigel subcutaneously in the right flank of 6 to 8 weeks old female athymic nu/nu mice (Envigo, East Millstone, NJ, USA). Tumor growth was monitored regularly via external caliper measurements. When tumors reached the intended size, mice were divided randomly into 4 groups: (1) Vehicle group (daily i.p. Vehicle and normal diet), (2) CCI-779 group (daily i.p. 2 mg/kg of CCI-779 and normal diet), (3) Dox group (daily i.p. Vehicle and Dox diet), (4) Dox + CCI-779 group (daily i.p. 2 mg/kg of CCI-779 and DOX diet). Mice were given intraperitoneal injections of 0.9% sterile saline or Dox (daily 100 mg/kg body weight, i.p.) for two days, right before CCI-779 treatment. Subsequently, mice were provided with daily Dox diet for Dox group and Dox+CCI-779 group, with or without CCI- 779 treatment, as indicated. CCI-779 were dissolved in ethanol and diluted with a solution of 5% Tween 80 and 5% PEG400 in sterile water and administered by i.p. injection. The maximum width (X) and length (Y) of the tumor were measured every day and the volume (V) was calculated using the formula: V = (X2Y)/2. Tumor growth was monitored over time. For all experiments, mice were sacrificed at a pre-determined endpoint. If any tumor exceeded a volume of 2000 mm3, 1.5 cm in diameter, or 10% of body weight, the mice would immediately be euthanized. At the end of the study, mice were euthanized with CO2 and tumors were taken for measurement of weight, followed by immunohistochemical staining. Results are presented as mean tumor volume ± SD.
|0153| For PC-3 tumor models, male athymic nu/nu mice aged 5 to 6 weeks were injected in the right flank with 5 * 106 PC-3 cells. Tumors were measured with calipers daily. When tumours reached a mean volume of 200 mm3, mice were randomized into 4 groups: (1) Vehicle group (daily i.p. 65% D5W (5% dextrose in water), 5% Tween-80, 30% PEG-400); (2) IKE group (daily i.p. 50 mg/kg IKE dissolved in 65% D5W (5% dextrose in water), 5% Tween-80, 30% PEG-400); (3) CCI-779 group (daily i.p. 2 mg/kg of CCI-779 dissolved in ethanol and diluted with a solution of 5% Tween 80 and 5% PEG400 in sterile water); (4) IKE + CCI-779 group (daily i.p. 50 mg/kg IKE and 2 mg/kg of CCI-779). At the end of the study, mice were euthanized with CO2 and tumours were taken for measurement of weight. All protocols for animal experiments were approved by the Memorial Sloan Kettering Cancer Center Institutional Animal Care and Use Committee (IACUC).
101541 Immunohistochemistry : Formalin-fixed, paraffin-embedded specimens were collected, and a routine H&E slide was first evaluated. Antigen retrieval was performed with the Retrievagen A antigen retrieval system (550524, BD Biosciences, San Jose, CA) according to the manufacturer’s instructions. Immunohistochemical staining was performed on 5 pm-thick paraffin-embedded sections using rabbit anti-GPX4 (ab 125066, Abeam), mouse anti-Ki-67 (9449, Cell Signaling), rabbit anti-PTSG2 (12282, Cell Signaling) and rabbit-anti pS235/236 S6 (221 IS, Cell signaling) antibodies with a standard avidin-biotin HRP detection system according to the instructions of the manufacturer (anti-mouse/rabbit HRP -DAB Cell & Tissue Staining Kit, R&D Systems, Minneapolis, MN). Tissues were counterstained with haematoxylin, dehydrated, and mounted.
|0.155| Statistical analyses'. All data, if applicable, were expressed as mean+/-SD from at least three independent experiments. Group differences were performed using two-tailed t- test or two-way ANOVA. P < 0.05 was considered statistically significant.
Example 2: Oncogenic Activation of the PI3K-AKT-mTOR Signaling Pathway Confers Resistance to Ferroptosis
[0156] To investigate the functional interplay of ferroptosis with various signaling and metabolic pathways frequently mutated in cancer, a panel of human cancer cell lines with defined genetic mutations were analyzed. Ferroptosis was triggered by RSL3, a pharmacological inhibitor of GPX4. The sensitivity to ferroptosis induction varied among tested lines. Notably, cancer cells carrying PIK3CA activating mutation or P TEN deletion appeared to be more resistant to RSL3 (FIGs. 1A-1B and FIG. 5). These mutations led to the activation of the oncogenic PI3K-AKT signaling pathway.
[0157] To determine whether the resistance to ferroptosis is a result of PI3K-AKT signaling pathway activation, pharmacological inhibition of this pathway was carried out to see if it could sensitize cancer cells to ferroptosis induction. Indeed, both the PI3K inhibitor (PI3Ki) GDC-0941 and AKT inhibitor (AKTi) MK-2206 sensitized BT474 and MDA-MB-453 cells (both harboring activating mutation of the PI3K-AKT pathway) to ferroptosis (FIG. 1C) and lipid peroxidation (FIG. 6A). Moreover, inhibition of mTOR, a major downstream player of the PI3K-AKT pathway, by rapalog Temsirolimus (CCI-779) or mTOR catalytic inhibitor Torin also sensitized these cells to ferroptosis (FIGs. 1D-1E, FIGs. 6B-6D). Consistently, in a three-dimensional (3D) tumor spheroid system, mTOR inhibition also synergized with RSL3 in inducing ferroptosis in these mutant cancer cells (FIG. IF, FIG. 6E). In contrast, inhibitors of ERK or BRAF failed to do so (FIG. 6F).
[0158] As both rapalog CCI-779 and mTOR catalytic inhibitor Torin can restore ferroptosis sensitivity, most likely the function of mTORCl instead of mT0RC2 is responsible for the resistance of cancer cells with PI3K-AKT pathway mutation. Consistent with this notion, short hairpin RNA (shRNA)-mediated silencing of RPTOR (a component of mTORCl) but not that of RICTOR (a component of mT0RC2) sensitized MDA-MB-453 and BT474 cells to RSL3 (FIGs. 1G-1H and FIG. 6G)
[0159] These results demonstrate that combination therapy with a PI3K-AKT-mT0R pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent. Accordingly, the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
Example 3: mTORCl and Cellular Lipid Peroxidation Mutually Regulate Each Other
[0160] Next, cancer cells that express wild-type PI3K-AKT-mT0R pathway and are sensitive to ferroptosis induction were examined. Experiments in wild-type cells were conducted to determine why the basal activity of the pathway failed to block ferroptosis, and whether pharmacological inhibition of the pathway could also enhance ferroptosis in wildtype cells. Two cell lines with wild-type PI3K-AKT-mTOR pathway, HT1080 and MDA- MB-231 were used. Although even low concentrations of RSL3 alone was sufficient to induce ferroptosis in these cells, addition of mTOR inhibitors further enhanced ferroptosis (FIG. 7A). Notably, mTORCl activity in cells with wild-type PI3K-AKT-mTOR pathway, as measured by S6K phosphorylation, became inhibited by RSL3 at later time points; in contrast, cells harboring pathway mutations retained active mTORCl upon RSL3 treatment for the same time period (FIG. 7B).
[0161] Lipid peroxide-trapping agent ferrostatin-1 (Fer-1) can prevent RSL3 -triggered inactivation of mTORCl activity in HT1080 cells and MDA-MB-231 cells (FIG. 7B), suggesting lipid peroxidation is responsible for, and precedes, mTORCl inactivation in response to RSL3. However, in cancer cells harboring PI3K-AKT-mTOR pathway mutation, RSL3 -induced lipid peroxidation became clear only when the pathway was inhibited (FIGs. 1A-1H), suggesting mTOR inhibition precedes the substantial accumulation of lipid peroxides in these cells. To reconcile these seemingly contradictive epistatic relationships, a feedforward mechanism was proposed: (1) mTORCl activity prevents the generation of cellular ROS, including lipid peroxides; and (2) accumulation of ROS and lipid peroxides in cells attenuates mTORCl activity. In such a way, upon ferroptosis induction, lower basal mTORCl activity, as that in wild-type cells, allows lipid peroxide accumulation, which in turn leads to the inhibition of mTORCl activity and accelerated lipid peroxidation; but in mutant cancer cells, the more potent and sustained mTORCl activity prevents lipid peroxide accumulation, thus resistant to ferroptosis. In agreement with this model, treatment of cells with 50 pM tert-Butyl hydroperoxide (tBHP) caused inhibition of mTORCl and upregulation of the transcription factor NRF2, a master regulator of oxidative stress (FIGs. 7C-7E). Importantly, under this condition, 2 pM Fer-1 substantially restored mTORCl activity but had no effect on tBHP-induced NRF2 upregulation (FIG. 7D), suggesting that lipid peroxides had a much more potent effect on the inhibition of mTORCl compared to soluble ROS, whereas NRF2 pathway cannot distinguish these two types of ROS.
[0162] These results demonstrate that combination therapy with a PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent. Accordingly, the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
Example 4: mTORCl Activation Suppresses Ferroptosis by Upregulating SREBP1
[0163] As a regulator of cellular metabolism, mTORCl modulates multiple nutrient and energy pathways, including the lysosome-mediated catabolic process, autophagy. Experiments were conducted to determine if autophagy is responsible for the ferroptosis sensitization triggered by mTORCl inhibition. Weak ferroptosis was observed in mouse embryonic fibroblasts (MEFs) lacking the autophagy-essential gene ATG5, in comparison with d 705-null cells reconstituted with ATG5 expression (FIGs. 8A-8B). However, mTOR inhibition could still sensitize autophagy-defective, ATG5-null cells to cystine starvation- induced ferroptosis (FIG. 8B), ruling out the possibility that autophagy mediates the sensitization of ferroptosis caused by mTORCl inhibition.
[0164] High levels of cellular ROS, a feature of ferroptosis, will trigger antioxidant pathway by suppressing Keapl -mediated proteasomal degradation of the NRF2 transcription factor. It has been reported that mTORCl promotes the association of p62 with Keapl by phosphorylating p62, leading to the degradation of Keapl and hence NRF2 accumulation (Ichimura, Y., et al. , Molecular Cell 51 : 618-631 (2013)). This p62-Keapl-NRF2 axis was reported to protect hepatocellular carcinoma cells from ferroptosis (Sun, X., et al., Hepatology 63: 173-184 (2016)). Indeed, RSL3 -induced NRF2 accumulation was ablated by Torin treatment (FIG. 9A). However, NRF2-knockout in HT1080 cells only modestly enhanced ferroptosis induced by erastin (a chemical inhibitor of system xc- cystine/glutamate antiporter) and had no measurable effect on RSL3-induced ferroptosis (FIGs. 9B-9C); in multiple cell lines with PI3K pathway mutation, ferroptosis induction could still be potently sensitized by mTOR inhibitors even after NRF2 was knocked out (FIGs. 9D-9I). Further, Keapl knockout and consequent NRF2 accumulation in BT474 cells only resulted in a modest reduction of ferroptosis sensitization triggered by mTORCl inhibition (FIGs. 9J- 9K). These results indicate that ferroptosis sensitization caused by mTORCl inhibition is mainly through NRF2-independent mechanisms. [0165] Ferroptotic cell death requires phospholipid peroxidation. To investigate if mTORCl regulates ferroptosis through modulating cellular lipid metabolism, a central regulator of lipid synthesis, SREBP1, was examined. Indeed, in multiple types of RSL3 -resistant cancer cells, mTORCl inhibitor CCI-779 decreased the level of mature form of SREBP1 (SREBPlm) that can translocate into the nucleus to regulate its downstream transcriptional targets (FIG. 2A, FIG. 10A). Functionally, pharmacological inhibition of SREBP activity by Fatostatin A or genetic deletion of the SREBF1 gene by CRISPR/cas9 sensitized ferroptosis and lipid peroxidation in these cells (FIGs. 2B-2D, FIGs. 10B-10D). Moreover, in these SREBF1- knockout cells, mTOR inhibitors (Torin and CCI-779), PI3K inhibitor (GDC-0941) and AKT inhibitor (MK-2206) all failed to further enhance RSL3-induced ferroptosis (FIG. 10E). Conversely, ectopic expression of the constitutively active nuclear form of SREBP 1 (SREPBlm), as tested in both 2D cell culture and 3D tumor spheroid experiments, rendered (1) the otherwise RSL3 -sensitive A549 cells resistant, and (2) multiple RSL3 -resistant cell lines no longer responsive to the combination of CCI-779 with RSL3 (FIGs. 2E-2F, FIG. 10F). In conclusion, mTORCl promotes cancer cell resistance to ferroptosis induction through the upregulation of SREBP 1 function.
[0166] These results demonstrate that combination therapy with a PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent. Accordingly, the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
Example 5: SREBP1 Protects Cells from Ferroptosis Through SCD1 Activity
[01 7] SREBP 1 is a transcription factor that regulates, among other metabolic genes, multiple lipid synthesis-related genes including ACLY, ACACA, FASN, andSCD (FIG. 13A). In the tested cell lines bearing PI3K-AKT-mTOR pathway mutation, SREBF1 knockout decreased the expression of SCD1 (both mRNA level and protein level) more significantly than that of other targets (FIG. 3A, FIGS. 11A-11B). This result prompted the examination of whether SCD1 is the major downstream target of SREBP 1 that mediates the resistance to ferroptosis induction. Pharmacologically, SCD1 inhibitor CAY10566 sensitized the effect of RSL3 on the induction of ferroptosis (FIG. 3B) and lipid peroxidation (FIG. 12A).
Genetically, CRISPR/Cas9-mediated SCD knockout also sensitized cells to ferroptosis induction and lipid peroxidation (FIGs. 3C-3D, FIGs. 12B-12D). Further, upon SCD knockout, inhibition of mTORCl, PI3K, or AKT could not further sensitize cancer cells to ferroptosis (FIG. 12E). Conversely, SCD1 overexpression protected cancer cells from ferroptosis induced by the combination of RSL3 with mTOR inhibition or with SREBF1 knockout (FIGs. 3E-3F and FIGs. 12F-12H).
[0168] SCD1 is an enzyme that converts saturated fatty acids to monounsaturated fatty acids (MUFAs) (FIG. 13A). Supplementation of MUFA palmitoleic acid (16: 1, PO) or oleate acid (18: 1, OA), but not saturated fatty acid palmitic acid (16:0, PA) or stearic acid (18:0, SA), resulted in ferroptosis resistance upon treatment of CCI-779 plus RSL3 (FIG. 3G and FIGs. 13B-13C). Collectively, these results demonstrate that SREBP1 protects cancer cells from ferroptosis mainly by upregulating SCD1. Remarkably, SCD1 is an iron-dependent enzyme that catalyzes fatty acid desaturation, which is by nature an oxidative reaction. This irondependent, oxidative enzymatic reaction can mitigate ferroptosis, an iron-dependent, oxidative form of cell death.
[0169] These results demonstrate that combination therapy with a PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent. Accordingly, the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
Example 6: Combination of mTORCl Inhibition with Ferroptosis Induction Leads to Tumor Regression In vivo
[0170] To explore the cancer therapeutic potential of combining mTORCl inhibition with ferroptosis induction, two mouse xenograft models for human cancer were analyzed. For the first model, a CRISPR/Cas9-mediated GPX4 knockout in a doxycycline (Dox)-inducible manner was generated in PI3K-mutated BT474 breast cancer cells (FIG. 4A). In these cells, only the combination of GPX4 knockout with mTORCl inhibition, but not either alone, induced potent ferroptosis (FIG. 14A). In mice xenografted with these cells, the average volume of tumors was allowed to reach -400 mm3, and then mTORCl inhibition by CCI-779 administration (Dox administration was started two days earlier) was started. While CCI-779 administration decelerated tumor growth, strikingly, the combination of Dox treatment with CCI-779 caused a near-complete regression of tumors (FIGs. 4B and 4D, FIG. 14B). Immunohistochemical analysis of PTSG2, a marker of oxidative stress and ferroptosis, supported such synergistic effects of combining inhibition of GPX4 and mTORCl in inducing tumor ferroptosis in vivo (FIG. 4C). In the other mouse model, imidazole ketone erastin (IKE), a potent and metabolically stable analog of erastin, instead of genetic deletion of GPX4, was used to induce tumor cell ferroptosis. PTEN-defective PC-3 prostate cancer cells were used to generate xenograft tumors in mice (PTEN deficiency predicts poor prognosis in prostate cancer (Jamaspishvili, T., et a!.. Nature Reviews. Urology 15: 222-234, (2018).)). Similar to what was observed in BT474 xenograft experiment, here IKE treatment alone has no effects on tumor growth, but its combination with CCI-779 resulted in dramatic tumor regression (FIG. 4E, FIGs. 14C-14E). Collectively, these two in vivo experiments demonstrate that the combination of mTORCl inhibition with ferroptosis induction is useful for the treatment of cancer harboring activating mutations in the PI3K-AKT-mTORCl pathway. These results demonstrate that oncogenic activation of the PI3K-AKT-mTORCl pathway suppresses ferroptosis in cancer cells via downstream SREBP1/SCD1 -mediated lipogenesis (FIG. 4F).
[0171 ] These results demonstrate that combination therapy with a PI3K-AKT-mTOR pathway inhibitor (e.g., a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor) and a ferroptosis inducing agent increases susceptibility of a cancer patient to therapy with a ferroptosis inducing agent. Accordingly, the combination therapy methods disclosed herein are useful for treating cancer or inhibiting tumor growth/proliferation in a subject in need thereof.
EQUIVALENTS
[0172] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
10.1731 In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0174] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member.
Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.
10.1.751 All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

Claims

WHAT IS CLAIMED IS:
1. A method for treating cancer in a subject in need thereof, comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
2. The method of claim 1, wherein the at least one PI3K-AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid.
3. The method of claim 2, wherein the inhibitory nucleic acid is an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
4. The method of any one of claims 1-3, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
5. The method of claim 4, wherein the PI3K inhibitor is selected from the group consisting of alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC- 0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib,
LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX-037, and ZSTK474.
6. The method of claim 4, wherein the AKT inhibitor is selected from the group consisting of MK-2206, A-674563, A-443654, acetoxy-tirucallic acid, 3a- and 3P-acetoxy- tirucallic acids, afuresertib (GSK2110183), 4-amino-pyrido[2,3-t ]pyrimidine derivative API- 1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3-chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-Z>]carbazole- 2,10-dicarboxylate, diindolylmethane, 2, 3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4-hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-l/7-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3Z7- imidazo[4,5-Z>]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa-l,3-dien-l-yl)-l/7-pyrazol-3-yl]phenol, spiroindoline derivatives, triazolo[3,4-/|[l,6]naphthyridin-3(2J7)-one derivative, triciribine, triciribine mono-phosphate active analogue, and uprosertib.
7. The method of claim 4, wherein the mTOR inhibitor is selected from the group consisting of Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku-0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, and XL765.
8. The method of claim 4, wherein the SREBP1 inhibitor is selected from the group consisting of fatostatin A, betulin, PF-429242, Nelfinavir, and 1,10-phenanthroline.
9. The method of claim 4, wherein the SCD1 inhibitor is selected from the group consisting of CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, and SW203668.
10. The method of any one of claims 1-9, wherein the at least one ferroptosis inducing agent is a class 1 ferroptosis inducer (system Xc” inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
11. The method of claim 10, wherein the at least one ferroptosis inducing agent is selected from the group consisting of erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, and lapatinib in combination with siramesine.
12. The method of any one of claims 1-11, wherein the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously.
13. The method of any one of claims 1-12, wherein the cancer is a solid malignant tumor or a hematological tumor and/or wherein the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
14. The method of any one of claims 1-13, wherein the cancer is breast cancer, colorectal cancer, lung cancer, non-small cell lung carcinoma, adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer, hepatocellular carcinoma, lymphomas, renal cancer, brain tumors, neuroblastomas, glioblastomas, head and neck cancer, adrenocortical carcinomas, or sarcoma.
15. The method of any one of claims 1-14, wherein the subject is non-responsive to at least one prior line of cancer therapy.
16. The method of claim 15, wherein the at least one prior line of cancer therapy is radiation therapy, chemotherapy or immunotherapy.
17. The method of any one of claims 1-16, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, or topically.
18. The method of any one of claims 1-17, wherein the at least one ferroptosis inducing agent is administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, or topically.
19. The method of any one of claims 1-18, wherein the subject comprises a PTEN deletion and/or a PIK3CA activating mutation.
20. The method of claim 19, wherein the PIK3CA activating mutation is E542K, E545K, or H1047R.
21. The method of any one of claims 1-20, wherein the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
22. The method of any one of claims 1-21, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
23. The method of any one of claims 1-22, wherein the subject is human.
24. The method of any one of claims 1-23, wherein the subject exhibits decreased tumor growth, reduced tumor proliferation, lower tumor burden, or increased survival after administration of the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent.
25. A method for increasing the efficacy of at least one chemotherapeutic agent or an immunotherapeutic agent in a subject suffering from cancer comprising: administering to the subject an effective amount of at least one PI3K-AKT-mTOR pathway inhibitor and an effective amount of at least one ferroptosis inducing agent.
26. The method of claim 25, wherein the at least one chemotherapeutic agent is selected from the group consisting of abraxane, capecitabine, erlotinib, fluorouracil (5-FU), gefitinib, gemcitabine, irinotecan, leucovorin, nab-paclitaxel, docetaxel, oxaliplatin, tipifarnib, sunitinib, dovitinib, ruxolitinib, pegylated-hyaluronidase, pemetrexed, folinic acid, paclitaxel, GDC-0449, IPI-926, gamma secretase/RO4929097, M402, and LY293111.
27. The method of claim 25, wherein the at least one immunotherapeutic agent is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-Ll antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4- IBB antibody, an anti- CD73 antibody, an anti-GITR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-TIGIT antibody, an anti-CD80 antibody, an anti-CD86 antibody, an anti-ICOS antibody, an anti-BTLA antibody, an anti-LAG-3 antibody, ipilimumab, nivolumab, pidilizumab, lambrolizumab, pembrolizumab, atezolizumab, avelumab, durvalumab, MPDL3280A, BMS- 936559, MEDI- 4736, MSB 00107180, AMP-224, MDX-1105, arelumab, tremelimumab, IMP321, MGA271, BMS-986016, lirilumab, urelumab, PF-05082566, IPH2101, MEDI- 6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP-514, AUNP 12, Indoximod, NLG-919, INCB024360, and DLBCL inhibitors.
28. The method of any one of claims 25-27, wherein the at least one PI3K-AKT-mTOR pathway inhibitor and/or the at least one ferroptosis inducing agent is an inhibitory nucleic acid.
29. The method of claim 28, wherein the inhibitory nucleic acid is an antisense oligonucleotide, a shRNA, a sgRNA or a ribozyme.
30. The method of any one of claims 25-29, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a SREBP1 inhibitor, or a SCD1 inhibitor.
31. The method of claim 30, wherein the PI3K inhibitor is selected from the group consisting of alpelisib, AMG319, apitolisib, AZD8186, BKM120, BGT226, bimiralisib, buparlisib, CH5132799, copanlisib, CUDC-907, dactolisisb, duvelisib, GDC-0941, GDC- 0084, gedatolisib, GSK2292767, GSK2636771, idelalisib, IPI-549, leniolisib,
LY294002, LY3023414, nemiralisib, omipalisib, PF-04691502, pictilisib, pilaralisib, PX866, RV-1729, SAR260301, SAR245408, serabelisib, SF1126, sonolisib, taselisib, umbralisib, voxtalisib, VS-5584, wortmannin, WX-037, and ZSTK474.
32. The method of claim 30, wherein the AKT inhibitor is selected from the group consisting of MK-2206, A-674563, A-443654, acetoxy-tirucallic acid, 3a- and 3P-acetoxy- tirucallic acids, afuresertib (GSK2110183), 4-amino-pyrido[2,3-t ]pyrimidine derivative API- 1, 3 -aminopyrrolidine, anilinotriazole derivatives, ARQ751, ARQ 092, AT7867, AT13148, 7-azaindole, AZD5363, (-)-balanol derivatives, BAY 1125976, Boc-Phe-vinyl ketone, CCT128930, 3-chloroacetylindole, diethyl 6-methoxy-5,7-dihydroindolo [2,3-Z>]carbazole- 2,10-dicarboxylate, diindolylmethane, 2, 3 -diphenylquinoxaline derivatives, DM-PIT-1, edelfosine, erucylphosphocholine, erufosine, frenolicin B, GSK-2141795, GSK690693, H-8, H-89, 4-hydroxynonenal, ilmofosine, imidazo-l,2-pyridine derivatives, indole-3 -carbinol, ipatasertib, kalafungin, lactoquinomycin, medermycin, 3-methyl-xanthine, miltefosine, 1,6- naphthyridinone derivatives, NL-71-101, N-[(l-methyl-17/-pyrazol-4-yl)carbonyl]-N'-(3- bromophenyl)-thiourea, OSU-A9, perifosine, 3-oxo-tirucallic acid, PH-316, 3-phenyl-3JT- imidazo[4,5-Z>]pyridine derivatives, 6-phenylpurine derivatives, PHT-427, PIT-1, PIT-2, 2- pyrimidyl-5-amidothiophene derivative, pyrrolo[2,3-d]pyrimidine derivatives, quinoline-4- carboxamide, 2-[4-(cyclohexa-l,3-dien-l-yl)-U/-pyrazol-3-yl]phenol, spiroindoline derivatives, triazolo[3,4-/|[l,6]naphthyridin-3(2J7)-one derivative, triciribine, triciribine mono-phosphate active analogue, and uprosertib.
33. The method of claim 30, wherein the mTOR inhibitor is selected from the group consisting of Torin, CCI-779, AZD2014, AZD8055, CC-223, dactolisib, everolimus, GSK2126458, Ku-0063794, Ku-0068650, MLN0128, OSI027, PP242, RapaLinks, rapamycin, ridaforolimus, sapanisertib, temsirolimus, vistusertib, WAY-600, WYE-687, WYE-354, and XL765.
34. The method of claim 30, wherein the SREBP1 inhibitor is selected from the group consisting of fatostatin A, betulin, PF-429242, Nelfinavir, and 1,10-phenanthroline.
35. The method of claim 30, wherein the SCD1 inhibitor is selected from the group consisting of CAY10566, A939572, MF-438, CVT-11127, CVT-12012, T-3764518, BZ36, SSI-4, SW208108, and SW203668.
36. The method of any one of claims 25-35, wherein the at least one ferroptosis inducing agent is a class 1 ferroptosis inducer (system Xc” inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPx4) inhibitor).
37. The method of claim 36, wherein the at least one ferroptosis inducing agent is selected from the group consisting of erastin, erastin derivatives (e.g., MEII, PE, AE, imidazole ketone erastin (IKE)), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, sorafenib, artemisinin derivatives, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, and lapatinib in combination with siramesine.
38. The method of any one of claims 25-37, wherein the at least one PI3K-AKT-mTOR pathway inhibitor and the at least one ferroptosis inducing agent are administered separately, sequentially, or simultaneously.
39. The method of any one of claims 25-38, wherein the cancer is a solid malignant tumor or a hematological tumor and/or wherein the cancer is resistant to radiation therapy, chemotherapy or immunotherapy.
40. The method of any one of claims 25-39, wherein the cancer is breast cancer, colorectal cancer, lung cancer, non-small cell lung carcinoma, adenocarcinoma, prostate cancer, bladder cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma of the skin, melanoma, Merkel cell carcinoma, gastric cancer, liver cancer, hepatocellular carcinoma, lymphomas, renal cancer, brain tumors, neuroblastomas, glioblastomas, head and neck cancer, adrenocortical carcinomas, or sarcoma.
41. The method of any one of claims 25-40, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, or topically.
42. The method of any one of claims 25-41, wherein the at least one ferroptosis inducing agent is administered orally, intranasally, parenterally, intravenously, intramuscularly, intraperitoneally, intramuscularly, intraarterially, subcutaneously, intrathecally, intracapsularly, intraorbitally, intratumorally, intradermally, transtracheally, intracerebroventricularly, or topically.
43. The method of any one of claims 25-42, wherein the subject comprises a PTEN deletion and/or a PIK3CA activating mutation.
44. The method of claim 43, wherein the PIK3CA activating mutation is E542K, E545K, or H1047R.
45. The method of any one of claims 25-44, wherein the subject harbors a mutation in one or more genes selected from the group consisting of E-cadherin, N-cadherin, Merlin, Mstl, Mst2, Latsl, and Lats2, wherein the mutation is a frameshift mutation, a missense mutation, a deletion, an insertion, a nonsense mutation, an inversion, or a translocation.
46. The method of any one of claims 25-45, wherein the at least one PI3K-AKT-mTOR pathway inhibitor is a PI3K/mTOR dual inhibitor.
47. The method of any one of claims 25-46, wherein the subject is human.
48. A kit comprising a PI3K-AKT-mTOR pathway inhibitor, a ferroptosis inducing agent, and instructions for treating therapy resistant cancer.
PCT/US2021/056583 2020-10-27 2021-10-26 Combination therapy with pi3k-akt-mtor inhibitors and ferroptosis inducing agents to treat cancer WO2022093770A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063106067P 2020-10-27 2020-10-27
US63/106,067 2020-10-27

Publications (1)

Publication Number Publication Date
WO2022093770A1 true WO2022093770A1 (en) 2022-05-05

Family

ID=81383203

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/056583 WO2022093770A1 (en) 2020-10-27 2021-10-26 Combination therapy with pi3k-akt-mtor inhibitors and ferroptosis inducing agents to treat cancer

Country Status (1)

Country Link
WO (1) WO2022093770A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114886895A (en) * 2022-05-16 2022-08-12 重庆医科大学 Application of small molecule inhibitor BAY87-2243 in preparing medicine for treating hepatitis B
CN114948951A (en) * 2022-05-16 2022-08-30 上海市免疫学研究所 Use of FK506 or its pharmaceutically acceptable derivative and iron death inducer for preparing medicine for treating cancer
CN115057856A (en) * 2022-06-08 2022-09-16 澳门科技大学 3, 5-disubstituted-7 azaindole derivative and synthesis method and application thereof
WO2023242099A1 (en) 2022-06-13 2023-12-21 KHR Biotec GmbH Novel ras inhibitors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018060833A1 (en) * 2016-09-27 2018-04-05 Novartis Ag Dosage regimen for alpha-isoform selective phosphatidylinositol 3-kinase inhibitor alpelisib

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018060833A1 (en) * 2016-09-27 2018-04-05 Novartis Ag Dosage regimen for alpha-isoform selective phosphatidylinositol 3-kinase inhibitor alpelisib

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GARCÍA-CARRACEDO DARÍO, CAI YI, QIU WANGLONG, SAEKI KIYOSHI, FRIEDMAN RICHARD A., LEE ANDREW, LI YINGLU, GOLDBERG ELIZABETH M., ST: "PIK3CA and p53 Mutations Promote 4NQO-Initated Head and Neck Tumor Progression and Metastasis in Mice", MOLECULAR CANCER RESEARCH, vol. 18, no. 6, 1 June 2020 (2020-06-01), US , pages 822 - 834, XP055939371, ISSN: 1541-7786, DOI: 10.1158/1541-7786.MCR-19-0549 *
WONG CHI HANG, BUIG BRIGETTE, MA YUE, CHEONG HIO TENG, WUN CONNIE, HUI CHUN, HUI EDWIN PUN, TAK ANTHONY, CHAN CHEUNG: "Preclinical evaluation of PI3K inhibitor BYL719 as a single agent and its synergism in combination with cisplatin or MEK inhibitor in nasopharyngeal carcinoma", AM J CANCER RES, vol. 5, 1 January 2015 (2015-01-01), pages 1496 - 1506, XP055939375 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114886895A (en) * 2022-05-16 2022-08-12 重庆医科大学 Application of small molecule inhibitor BAY87-2243 in preparing medicine for treating hepatitis B
CN114948951A (en) * 2022-05-16 2022-08-30 上海市免疫学研究所 Use of FK506 or its pharmaceutically acceptable derivative and iron death inducer for preparing medicine for treating cancer
CN114886895B (en) * 2022-05-16 2023-02-03 重庆医科大学 Application of small molecule inhibitor BAY87-2243 in preparing medicine for treating hepatitis B
CN114948951B (en) * 2022-05-16 2023-07-07 上海市免疫学研究所 Use of FK506 or a pharmaceutically acceptable derivative thereof in combination with an iron death inducer or a pharmaceutically acceptable derivative thereof for the manufacture of a medicament for the treatment of cancer
WO2023221361A1 (en) * 2022-05-16 2023-11-23 重庆医科大学 Use of small-molecule inhibitor bay87-2243 in preparing drug for treating hepatitis b
CN115057856A (en) * 2022-06-08 2022-09-16 澳门科技大学 3, 5-disubstituted-7 azaindole derivative and synthesis method and application thereof
CN115057856B (en) * 2022-06-08 2024-04-02 澳门科技大学 3, 5-disubstituted-7-azaindole derivative and synthetic method and application thereof
WO2023242099A1 (en) 2022-06-13 2023-12-21 KHR Biotec GmbH Novel ras inhibitors

Similar Documents

Publication Publication Date Title
WO2022093770A1 (en) Combination therapy with pi3k-akt-mtor inhibitors and ferroptosis inducing agents to treat cancer
Linch et al. Systemic treatment of soft-tissue sarcoma—gold standard and novel therapies
CN107249638B (en) Use of apilimod for treating kidney cancer
CN106659716B (en) Apilimod compositions and methods of use thereof
KR102446839B1 (en) Combination therapy comprising a B-Raf inhibitor and a second inhibitor
IL311265A (en) Preservation of immune response during chemotherapy regimens
CN107427522B (en) Apilimod for treating melanoma
EP2885003B1 (en) Combination of pi3k inhibitor and c-met inhibitor
US20240108628A1 (en) Combination therapy with mek inhibitor and cdk4/6 inhibitor to treat pancreatic cancer
US20230414626A1 (en) Induction of ferroptosis for cancer therapy
TW202329946A (en) Methods and dosing regimens comprising a cdk2 inhibitor for the treatment of cancer
TW201315471A (en) Compositions and methods for treating cancer using PI3K β inhibitor and mapk pathway inhibitor, including MEK and RAF inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21887310

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21887310

Country of ref document: EP

Kind code of ref document: A1