WO2022093159A1 - Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field - Google Patents

Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field Download PDF

Info

Publication number
WO2022093159A1
WO2022093159A1 PCT/TR2021/051078 TR2021051078W WO2022093159A1 WO 2022093159 A1 WO2022093159 A1 WO 2022093159A1 TR 2021051078 W TR2021051078 W TR 2021051078W WO 2022093159 A1 WO2022093159 A1 WO 2022093159A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
target
primers
del
transv
Prior art date
Application number
PCT/TR2021/051078
Other languages
French (fr)
Inventor
Cagcil YETIM
Original Assignee
Yetim Cagcil
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from TR2020/20743A external-priority patent/TR202020743A2/en
Application filed by Yetim Cagcil filed Critical Yetim Cagcil
Priority to US18/034,388 priority Critical patent/US20240318238A1/en
Publication of WO2022093159A1 publication Critical patent/WO2022093159A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to the usage of real-time PCR device in a new and different diagnosis and moreover a diagnosis kit developed for use in real-time PCR device for this new diagnosis field.
  • Infectious disease is a public health problem which affects all civilization. Infectious diseases affect societies socially, economically and culturally in periods where infectious diseases occur in a dense manner.
  • ssRNA single-stranded RNA
  • PAMPs pathogen-associated molecular patterns
  • TLR7 Toll-like receptor 7
  • TLR7 activates various signal pathways and transcription factors and leads to synthesis of monocyte chemo-attractant protein-1 (MCP-1 ) of primary cytokines like IL-1 and IL-6 related to inflammation, macrophage inflammatory protein 1 alpha (MIP-1A), tumor necrosis factor (TNF-) and antiviral Type 1 interferon (IFN1 ).
  • MIP-1 monocyte chemo-attractant protein-1
  • MIP-1A macrophage inflammatory protein 1 alpha
  • TNF- tumor necrosis factor
  • IFN1 antiviral Type 1 interferon
  • Rare variants of X chromosomal TLR7 gene are associated with deteriorated type I and II IFN responses, and they lead to insufficiency of the immune system in the first defense response against the viral infection. Therefore, detection of rare variants of TLR7 gene in a rapid manner is important. In the present system, the rare variants, which affect TLR 7 gene, can be detected by means of Sanger arraying method, however, featured genetic laboratories are needed for this method, and this method gives result in longer duration for realizing diagnosis.
  • the present invention relates to the usage of real-time PCR device in the detection of normal TLR7 gene and TLR7 gene mutations, and moreover a diagnosis kit developed for use in real-time PCR device for the detection of normal TLR7 gene and also TLR7 gene mutations (variants which are rare and which affect sufficient functioning of the TLR7 gene), for eliminating the abovementioned disadvantages and for bringing new advantages to the related technical field.
  • the main object of the present invention is to provide usage of real-time PCR device and a new diagnosis kit, which is to be used in real-time PCR device, in detection of normal TLR7 gene and also variants of TLR7 gene, which are rare and which affect sufficient functioning of the TLR7 gene.
  • the present invention relates to a diagnosis kit developed for use in real-time PCR device for detection of normal TLR7 gene and variants of TLR7 gene (mutations), wherein the subject matter diagnosis kit comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target (wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9) delPm (SEQ ID No:10) transvP (SEQ ID No:11) transvPm (SEQ ID No:12) probes.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ
  • the present invention relates to a diagnosis kit developed for use in real-time PCR device for detection of normal TLR7 gene and variants of TLR7 gene (mutations), wherein the subject matter diagnosis kit comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • Transv-target(wt) SEQ ID No
  • the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers.
  • the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • Transv-target(wt)
  • the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and delp (SEQ ID No:9), delPm(SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes.
  • the reaction mixture comprises a mixture of delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes.
  • the reaction mixture comprises delF (SEQ ID No:1) and deIR (SEQ ID No:2) primers.
  • the reaction mixture comprises delF (SEQ ID No:1), deIR (SEQ ID No:2) Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
  • the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
  • the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
  • the reaction mixture comprises Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
  • the reaction mixture comprises Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
  • the reaction mixture comprises delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
  • the subject matter diagnosis kit can comprise the mixture of at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt)(SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers and additionally, reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt)(SEQ ID No:5) Del-target(m) (SEQ
  • delF which exists in the specification describes the primer which has 5'- TTAGAGGAATTAGACATCTCT-3' sequence array, and this sequence array is named briefly as SEQ ID No:1 in the specification.
  • deIR which exists in the specification describes the primer which has 5'- TGA AAG ATT TGA GCC CA -3' sequence array, and this sequence array is named briefly as SEQ ID No:2 in the specification.
  • TransvF which exists in the specification describes the primer which has 5'- TCA AAT CAG GAG TCT GAC GA -3' sequence array, and this sequence array is named briefly as SEQ ID No:3 in the specification.
  • TransvR which exists in the specification describes the primer which has 5'- AGG TGC ACA GAA ACC GAT TA -3' sequence array, and this sequence array is named briefly as SEQ ID No:4 in the specification.
  • Del-target which exists in the specification describes the primer which has TTAGAGGAATTAGACATCTCTAAAAATTCCCTAAGTTTCTTGCCTTCTGGAGTTTT TGATGGTATGCCTCCAAATCTAAAGAATCTCTCTTTGGCCAAAAATGGGCTCAAA TCTTTCA sequence array, and this sequence array is named briefly as SEQ ID No:5 in the specification.
  • Del-target (m) which exists in the specification describes the primer which has TTAGAGGAATTAGACATCTCTAAAAATTCCCTAAGTTTCTTTCTGGAGTTTTTGAT GGTATGCCTCCAAATCTAAAGAATCTCTCTTTGGCCAAAAATGGGCTCAAATCTT TCA sequence array, and this sequence array is named briefly as SEQ ID No:6 in the specification.
  • Transv-target (wt) which exists in the specification describes the primer which has
  • Transv-target (m) which exists in the specification describes the primer which has
  • delp which exists in the specification describes the probe which has FAM- TAAGTTTCTTGCCTTCTGGAGTT sequence array, and this sequence array is named briefly as SEQ ID No:9 in the specification.
  • delPm which exists in the specification describes the probe which has HEX- ATTCCCTAAGTTTCTTTCTGGAGTTTTTG sequence array, and this sequence array is named briefly as SEQ ID No:10 in the specification.
  • transvP which exists in the specification describes the probe which has Cy5- TGCCTTCCAGTTGCGATATCTGGA-BHQ2 sequence array, and this sequence array is named briefly as SEQ ID No:11 in the specification.
  • transvPm which exists in the specification describes the probe which has Cy5,5- TGCCTTCCAGTTTCGATATCTGGA-BHQ2 sequence array, and this sequence array is named briefly as SEQ ID No:12 in the specification.
  • the subject matter test kit has a reaction mixture comprising the mixture of at least one, some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • Transv-target(wt) SEQ ID No:7
  • Transv-target(m) SEQ ID No:8 primers.
  • the subject matter test kit has a reaction mixture comprising the mixture of at least one, some or all of the (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes.
  • the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv- target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers which exist in the reaction mixture are specific primers which detect of normal TLR7 gene and variants of TLR7 gene (mutations). They realize detection of the mutant variants.
  • the primers which exist in the reaction mixture reach a suitable temperature in the cycle after enzyme activation and incubation in the device, the primers bind to the specific complementary regions and provide operation of DNA polymerase enzyme and DNA amplification in this region. Even if DNA amount, which increases exponentially during cycles, is low, specific variants can be displayed such that signal can be received.
  • the primers, designed for the subject matter serve this purpose, and they provide detection of the variants, of which the presence is searched, by means of fluorescent signals.
  • DNA oligo-nucleotide array is provided which is called 2 sets of primers.
  • Wild type TLR7 detection is also realized by means of melting curve analysis and thus, inhibition control is also made.
  • the control of operation of the test kit is realized by means of positive-negative controls.
  • another version of the present invention functions as follows: As in the general operation of real-time PCR technology, when the primers which exist in the reaction mix arrive at suitable temperature in the cycle after enzyme activation and incubation in the device, they bind to the specific complementary regions and provide operation of the DNA polymerase enzyme and DNA amplification in this region. Even if the DNA amount which increases exponentially during cycles is at low proportion, it provides displaying of specific variants so as to be able to receive signal.
  • the primers designed particularly in the invention, serve this purpose and provide detection of the variants, the presence of which is searched, by means of fluorescent signals.
  • there are 3 sets of DNA oligo-nucleotide arrays which are called primerprobe.
  • TLR7 comprises specific primer mixture which detects mutant variants. It makes detection of mutant variants.
  • treatment management or protective health service shall be realized in a more effective manner by means of detection of this variant, in accordance with the information which indicates that the progress of the ssRNA virus disease in some individuals is much heavier when compared with the other individuals, particularly in COVID-19.
  • the advantage and benefit provided by the present invention are that real-time per method is used and by this way, more rapid diagnosis is realized by means of easily accessible and easy method in most laboratories where real-time per device exists.
  • Another advantage of the present invention is that the present invention provides rapid and exact variant detection in the in vitro medium. This advantage is provided by specific and rapid response characteristic of the real-time PCR method, and the test can be realized by means of material like venous blood which can be easily obtained and in a manner which can be additional to routine blood tests.
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del- target(wt)(SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP(SEQ ID No:11), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP(SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) Del-target(wt)SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • the present invention relates to the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
  • Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in detection of TLR7 gene mutation.
  • Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID
  • Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of TLR7 gene mutations.
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4 primers and/or delp (SEQ ID No:9)
  • delPm SEQ ID No:10
  • transvP SEQ ID No:11
  • transvPm SEQ ID No:12
  • Another application of the present invention is the usage of one or some or all of the delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes in a method to be used in detection of TLR7 gene mutations.
  • Another application of the present invention is the usage of one or some or all of the Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of normal TLR7 gene and TLR7 gene mutations.
  • Another application of the present invention is the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) primers in a method to be used in detection of TLR7 gene mutations.
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Transv-target(wt) SEQ ID No:7
  • Transv-target(m) SEQ ID No:8 primers in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
  • Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
  • delF SEQ ID No:1
  • deIR SEQ ID No:2
  • TransvF SEQ ID No:3
  • TransvR SEQ ID No:4
  • Del-target(wt) SEQ ID No:5
  • Del-target(m) SEQ ID No:6
  • Transv-target(wt) SEQ ID No:7
  • Transv-target(m) SEQ ID No:8 primers in
  • Another application of the present invention relates to a method for the detection of normal TLR7 gene and TLR7 gene mutations, comprises the steps of: i. Realizing nucleic acid extraction from in vitro patient samples, ii. Mixing the nucleic acids, obtained in step 1 , with the reaction mixture comprising at least one or some or all of the delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, or mixing
  • nucleic acids obtained in step 1 , with the reaction mixture comprising one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers or any primer and probe mixture or mixtures with a completely different array from the primer and prob arrays of which the sequence list is given above, primers and probe mixture or mixtures, primer and probe mixture or mixtures, primer and probes mixture or mixtures, or primers and probes mixture or mixtures or single primer or primers mixture or single probe or probes mixture with a completely different array from the primer and probe arrays of which the sequence list is given above and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/
  • the primers have been designed with Primer3 bio-informatics tool such that Melting Curve Analysis will be made by means of SYBR Green.
  • the primer arrays and the target regions are given in Table 1 .
  • the reaction mixture has one-step characteristic, and as the template sample, RNA or DNA can be used.
  • RNA or DNA can be used for deletion detection and transversion detection in each patient sample.
  • separate enzyme mixture which comprises deletion specific primers, is used for deletion detection
  • separate enzyme mixture which comprises transversion specific primers, is used for transversion detection.
  • Total reaction volume is 25 ⁇ l.
  • Total reaction volume is 25 ⁇ l.
  • Protocol for RNA sample
  • Probes Taqqman probes have been designed for use in real-time PCR. Probe arrays have been given in Table 2.
  • the reaction mixture has one-step characteristic, and as the template sample, RNA or DNA can be used.
  • RNA or DNA can be used for deletion detection and transversion detection in each patient sample.
  • separate enzyme mixture which comprises deletion specific primers and probes, is used for deletion detection
  • separate enzyme mixture which comprises transversion specific primers and probes, is used for transversion detection.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the usage of real-time PCR device for the detection of normal and rare variants of TLR7 gene and moreover a diagnosis kit developed for use in real-time PCR device for this new diagnosis field and developed for detection of normal and rare variants of TLR7 gene.

Description

METHOD OF USING REAL-TIME PCR DEVICE IN A NEW DIAGNOSTIC FIELD AND DIAGNOSTIC KIT DEVELOPED TO USE IN REAL-TIME PCR DEVICE FOR THIS NEW DIAGNOSTIC FIELD
TECHNICAL FIELD
The present invention relates to the usage of real-time PCR device in a new and different diagnosis and moreover a diagnosis kit developed for use in real-time PCR device for this new diagnosis field.
PRIOR ART
Infectious disease is a public health problem which affects all humanity. Infectious diseases affect societies socially, economically and culturally in periods where infectious diseases occur in a dense manner.
In viral infections, natural immunity response is triggered firstly by lung epithelial cells, alveolar macrophages and neutrophils. In the next phase, T and B lymphocytes become active as a result of activation of the gained immunity response. The viral particles which comprise single-stranded RNA (ssRNA) behave like pathogen- associated molecular patterns (PAMPs) and are recognized by Toll-like receptor 7 (TLR7) provided on the surface of macrophages and dendritic cells and provide beginning of natural immunity response. TLR7 activates various signal pathways and transcription factors and leads to synthesis of monocyte chemo-attractant protein-1 (MCP-1 ) of primary cytokines like IL-1 and IL-6 related to inflammation, macrophage inflammatory protein 1 alpha (MIP-1A), tumor necrosis factor (TNF-) and antiviral Type 1 interferon (IFN1 ).
Rare variants of X chromosomal TLR7 gene are associated with deteriorated type I and II IFN responses, and they lead to insufficiency of the immune system in the first defense response against the viral infection. Therefore, detection of rare variants of TLR7 gene in a rapid manner is important. In the present system, the rare variants, which affect TLR 7 gene, can be detected by means of Sanger arraying method, however, featured genetic laboratories are needed for this method, and this method gives result in longer duration for realizing diagnosis.
As a result, because of the abovementioned problems, an improvement is required in the related technical field.
BRIEF DESCRIPTION OF THE INVENTION
The present invention relates to the usage of real-time PCR device in the detection of normal TLR7 gene and TLR7 gene mutations, and moreover a diagnosis kit developed for use in real-time PCR device for the detection of normal TLR7 gene and also TLR7 gene mutations (variants which are rare and which affect sufficient functioning of the TLR7 gene), for eliminating the abovementioned disadvantages and for bringing new advantages to the related technical field.
The main object of the present invention is to provide usage of real-time PCR device and a new diagnosis kit, which is to be used in real-time PCR device, in detection of normal TLR7 gene and also variants of TLR7 gene, which are rare and which affect sufficient functioning of the TLR7 gene.
DETAILED DESCRIPTION OF THE INVENTION
In this detailed description, the subject matter test kit and detection method is explained with references to examples without forming any restrictive effect only in order to make the subject more understandable.
The present invention relates to a diagnosis kit developed for use in real-time PCR device for detection of normal TLR7 gene and variants of TLR7 gene (mutations), wherein the subject matter diagnosis kit comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target (wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9) delPm (SEQ ID No:10) transvP (SEQ ID No:11) transvPm (SEQ ID No:12) probes.
The present invention relates to a diagnosis kit developed for use in real-time PCR device for detection of normal TLR7 gene and variants of TLR7 gene (mutations), wherein the subject matter diagnosis kit comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
In a preferred application of the present invention, the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers.
In a preferred application of the present invention, the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes.
In a preferred application of the present invention, the reaction mixture which exists in the subject matter diagnosis kit comprises a mixture of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and delp (SEQ ID No:9), delPm(SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes.
In a preferred application of the present invention, the reaction mixture comprises a mixture of delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes. In a preferred application of the present invention, the reaction mixture comprises delF (SEQ ID No:1) and deIR (SEQ ID No:2) primers.
In a preferred application of the present invention, the reaction mixture comprises delF (SEQ ID No:1), deIR (SEQ ID No:2) Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
In a preferred application of the present invention, the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
In a preferred application of the present invention, the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
In a preferred application of the present invention, the reaction mixture comprises Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
In a preferred application of the present invention, the reaction mixture comprises Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
In a preferred application of the present invention, the reaction mixture comprises delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
In a preferred application of the present invention, the subject matter diagnosis kit can comprise the mixture of at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt)(SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers and additionally, reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures. The nucleic acid arrays of the delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers which are mentioned in the application have been given in Table 1 provided in the examples section and in the sequence list enclosed to this specification.
The nucleic acid arrays of the delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12), Del-target(wt) probes which are mentioned in the application have been given in Table 2 provided in the examples section and in the sequence list enclosed to this specification.
The term delF which exists in the specification describes the primer which has 5'- TTAGAGGAATTAGACATCTCT-3' sequence array, and this sequence array is named briefly as SEQ ID No:1 in the specification.
The term deIR which exists in the specification describes the primer which has 5'- TGA AAG ATT TGA GCC CA -3' sequence array, and this sequence array is named briefly as SEQ ID No:2 in the specification.
The term TransvF which exists in the specification describes the primer which has 5'- TCA AAT CAG GAG TCT GAC GA -3' sequence array, and this sequence array is named briefly as SEQ ID No:3 in the specification.
The term TransvR which exists in the specification describes the primer which has 5'- AGG TGC ACA GAA ACC GAT TA -3' sequence array, and this sequence array is named briefly as SEQ ID No:4 in the specification.
The term Del-target (wt) which exists in the specification describes the primer which has TTAGAGGAATTAGACATCTCTAAAAATTCCCTAAGTTTCTTGCCTTCTGGAGTTTT TGATGGTATGCCTCCAAATCTAAAGAATCTCTCTTTGGCCAAAAATGGGCTCAAA TCTTTCA sequence array, and this sequence array is named briefly as SEQ ID No:5 in the specification. The term Del-target (m) which exists in the specification describes the primer which has TTAGAGGAATTAGACATCTCTAAAAATTCCCTAAGTTTCTTTCTGGAGTTTTTGAT GGTATGCCTCCAAATCTAAAGAATCTCTCTTTGGCCAAAAATGGGCTCAAATCTT TCA sequence array, and this sequence array is named briefly as SEQ ID No:6 in the specification.
The term Transv-target (wt) which exists in the specification describes the primer which has
TCAAATCAGGAGTCTGACGAAGTATTTTCTACAAGATGCCTTCCAGTTGCGATAT CTGGATCTCAGCTCAAATAAAATCCAGATGATCCAAAAGACCAGCTTCCCAAAAA TGTCCTCAACAATCTGAAGATGTTGCTTTTGCATCATAATCGGTTTCTGTGCACC T sequence array, and this sequence array is named briefly as SEQ ID No:7 in the specification.
The term Transv-target (m) which exists in the specification describes the primer which has
TCAAATCAGGAGTCTGACGAAGTATTTTCTACAAGATGCCTTCCAGTTTCGATAT CTGGATCTCAGCTCAAATAAAATCCAGATGATCCAAAAGACCAGCTTCCCAGAA AATGTCCTCAACAATCTGAAGATGTTGCTTTTGCATCATAATCGGTTTCTGTGCA CCT sequence array, and this sequence array is named briefly as SEQ ID No:8 in the specification.
The term delp which exists in the specification describes the probe which has FAM- TAAGTTTCTTGCCTTCTGGAGTT sequence array, and this sequence array is named briefly as SEQ ID No:9 in the specification.
The term delPm which exists in the specification describes the probe which has HEX- ATTCCCTAAGTTTCTTTCTGGAGTTTTTG sequence array, and this sequence array is named briefly as SEQ ID No:10 in the specification.
The term transvP which exists in the specification describes the probe which has Cy5- TGCCTTCCAGTTGCGATATCTGGA-BHQ2 sequence array, and this sequence array is named briefly as SEQ ID No:11 in the specification. The term transvPm which exists in the specification describes the probe which has Cy5,5- TGCCTTCCAGTTTCGATATCTGGA-BHQ2 sequence array, and this sequence array is named briefly as SEQ ID No:12 in the specification.
The subject matter test kit has a reaction mixture comprising the mixture of at least one, some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
The subject matter test kit has a reaction mixture comprising the mixture of at least one, some or all of the (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes.
The delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv- target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers which exist in the reaction mixture are specific primers which detect of normal TLR7 gene and variants of TLR7 gene (mutations). They realize detection of the mutant variants. As in the general operation of real-time PCR technology, when the primers which exist in the reaction mixture reach a suitable temperature in the cycle after enzyme activation and incubation in the device, the primers bind to the specific complementary regions and provide operation of DNA polymerase enzyme and DNA amplification in this region. Even if DNA amount, which increases exponentially during cycles, is low, specific variants can be displayed such that signal can be received. The primers, designed for the subject matter, serve this purpose, and they provide detection of the variants, of which the presence is searched, by means of fluorescent signals. In the invention, DNA oligo-nucleotide array is provided which is called 2 sets of primers. These are designed so as to be complementary for the related arrays for detecting the variants, which may lead to RNA transcription of TLR7 without function, and the wild type version thereof. These sets are independent from each other, however, they have been designed as two each primers according to one each target augmentation. One of the sets has been prepared for deletion variant detection and one of the sets has been prepared for transversion variant detection.
Wild type TLR7 detection is also realized by means of melting curve analysis and thus, inhibition control is also made. The control of operation of the test kit is realized by means of positive-negative controls.
Moreover, another version of the present invention functions as follows: As in the general operation of real-time PCR technology, when the primers which exist in the reaction mix arrive at suitable temperature in the cycle after enzyme activation and incubation in the device, they bind to the specific complementary regions and provide operation of the DNA polymerase enzyme and DNA amplification in this region. Even if the DNA amount which increases exponentially during cycles is at low proportion, it provides displaying of specific variants so as to be able to receive signal. The primers, designed particularly in the invention, serve this purpose and provide detection of the variants, the presence of which is searched, by means of fluorescent signals. In the invention, there are 3 sets of DNA oligo-nucleotide arrays which are called primerprobe. These have been designed so as to be complementary for the related arrays in order to detect variants, which may lead to RNA transcription of TLR7 without function, and the wild type version thereof. These sets are independent from each other, however, they have been designed in accordance with one each target augmentations as 2 each primers and 1 each probes. One of the sets has been prepared for the deletion detection, one of the sets has been prepared for transversion detection and the other one has been prepared for wild type variant detection.
Reaction mix: TLR7 comprises specific primer mixture which detects mutant variants. It makes detection of mutant variants.
Internal control: It realizes normal TLR7 detection, it makes inhibition control. Positive-negative controls: It makes the control of whether the kit operates in a regular manner or not. Primers and Probes:
Primers and Taqqman probes have been designed for use in real-time PCR.
By means of the present invention, treatment management or protective health service shall be realized in a more effective manner by means of detection of this variant, in accordance with the information which indicates that the progress of the ssRNA virus disease in some individuals is much heavier when compared with the other individuals, particularly in COVID-19. The advantage and benefit provided by the present invention are that real-time per method is used and by this way, more rapid diagnosis is realized by means of easily accessible and easy method in most laboratories where real-time per device exists.
Another advantage of the present invention is that the present invention provides rapid and exact variant detection in the in vitro medium. This advantage is provided by specific and rapid response characteristic of the real-time PCR method, and the test can be realized by means of material like venous blood which can be easily obtained and in a manner which can be additional to routine blood tests.
By the specific detection of individuals for clinical progress of the ss RNA virus sourced diseases and the specific determination about the degree of immune response of the body for each individual, before a disease factor is encountered with the screening and detection of people who are likely to show a severe clinical progress, it will be possible for such people to benefit from preventive health services and also by this screening method in case of disease situation it can be possible for them to obtain treatment protocols early and effectively.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del- target(wt)(SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP(SEQ ID No:11), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP(SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
In one perspective, the present invention relates to the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) Del-target(wt)SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection. In one perspective, the present invention relates to the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers in a method to be used in prevention of severe clinical progress of Covid-19 infection.
Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in detection of TLR7 gene mutation.
Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2 ), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of TLR7 gene mutations.
Another application of the present invention is the usage of one or some or all of the delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes in a method to be used in detection of TLR7 gene mutations.
Another application of the present invention is the usage of one or some or all of the Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes in a method to be used in detection of normal TLR7 gene and TLR7 gene mutations. Another application of the present invention is the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) primers in a method to be used in detection of TLR7 gene mutations.
Another application of the present invention is the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers in a method to be used in detection of TLR7 gene mutations.
Another application of the present invention is the usage of delF (SEQ ID No:1 ), deIR (SEQ ID No:2) Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
Another application of the present invention is the usage of TransvF (SEQ ID No:3), TransvR (SEQ ID No:4 ') Transv-target(wt) (SEQ ID No:7) Transv-target(m) (SEQ ID No:8) primers in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
Another application of the present invention is the usage of one or some or all of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers in a method to be used in detection of normal TLR7 gene and variants of TLR7 gene (mutations).
Another application of the present invention relates to a method for the detection of normal TLR7 gene and TLR7 gene mutations, comprises the steps of: i. Realizing nucleic acid extraction from in vitro patient samples, ii. Mixing the nucleic acids, obtained in step 1 , with the reaction mixture comprising at least one or some or all of the delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, or mixing the nucleic acids, obtained in step 1 , with the reaction mixture comprising at least one of the delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, iii. Mixing the nucleic acids, obtained in step 1 , with the reaction mixture comprising one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv- target(m) (SEQ ID No:8) primers or any primer and probe mixture or mixtures with a completely different array from the primer and prob arrays of which the sequence list is given above, primers and probe mixture or mixtures, primer and probe mixture or mixtures, primer and probes mixture or mixtures, or primers and probes mixture or mixtures or single primer or primers mixture or single probe or probes mixture with a completely different array from the primer and probe arrays of which the sequence list is given above and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, iv. Realizing DNA/RNA amplification, v. Examining the sample by means of fluorescent spectroscopy, vi. Determining whether the samples, where fluorescent signal is observed, have TLR7 gene mutation or not. EXAMPLES:
MATERIAL AND METHOD Peripheral blood samples have been taken and examined in terms of TLR7 gene mutations. Nucleic acid extractions have been realized from peripheral blood samples according to Qiagen DNA isolation kit usage manual (Catalogue no: 69506). After the extracted nucleic acids are dissolved in 100 pl TE, the nucleic acid concentrations have been measured in Nanodrop spectrophotometer (Thermo Fisher Scientific).
Primers
The primers have been designed with Primer3 bio-informatics tool such that Melting Curve Analysis will be made by means of SYBR Green. The primer arrays and the target regions are given in Table 1 .
Table 1. Primer Arrays
Figure imgf000015_0001
Figure imgf000016_0001
DETECTION
Detection study has been realized by means of the reaction mixture comprising the various reagents given below and specific primers with the mentioned concentrations
The reaction mixture has one-step characteristic, and as the template sample, RNA or DNA can be used. For deletion detection and transversion detection in each patient sample, separate enzyme mixture, which comprises deletion specific primers, is used for deletion detection, and separate enzyme mixture, which comprises transversion specific primers, is used for transversion detection.
Deletion detection
Figure imgf000016_0002
Figure imgf000017_0002
Total reaction volume is 25 μl.
Figure imgf000017_0001
Total reaction volume is 25 μl.
Protocol for DNA sample:
Melt curve, 0.5 increase from 65 SC to 95 SC
Protocol for RNA sample:
45 SC 20 min
95 SC 15 min
95 SC 15 s
55 SC 30 s 40 cycles
72 SC 15 s Melt curve, 0.5 increase from 65 SC to 95 SC
Probes: Taqqman probes have been designed for use in real-time PCR. Probe arrays have been given in Table 2.
Table 2. Probe sequences
Figure imgf000018_0001
DETECTION APPLICATION VERSION
The detection study has been realized by means of the reaction mixture comprising the various reagents given below and specific primers and probes with the mentioned concentrations.
The reaction mixture has one-step characteristic, and as the template sample, RNA or DNA can be used. For deletion detection and transversion detection in each patient sample, separate enzyme mixture, which comprises deletion specific primers and probes, is used for deletion detection, and separate enzyme mixture, which comprises transversion specific primers and probes, is used for transversion detection.
Deletion and transversion detection
Figure imgf000019_0001
DNA or RNA 2
Reaction Volume 20.00 positive, (wild type) plasmid
Controls T7 DNA
T7m positive, mutant plasmid DNA
MBG water negative, no template control
Protocol for DNA or RNA sample:
Figure imgf000020_0001
Alternative protocol for DNA or RNA sample:
45°C 20 min Hold
95°C 10 min Hold
95°C 30 s
60°C 30 s 45 cycles
72°C 30 s
In the known state of the art, for DNA and RNA samples, cycles are realized with temperatures and durations which can be determined by means of routine experiments by the specialized person, and DNA amplification procedure is completed.
Measurement is made in fluorescent spectrophotometer for the obtained samples, and it is decided that the samples, of which the fluorescent peak is given, have TLR7 mutation.
The protection scope of the present invention is set forth in the annexed claims and cannot be restricted to the illustrative disclosures given above, under the detailed description. It is because a person skilled in the relevant art can obviously produce similar embodiments under the light of the foregoing disclosures, without departing from the main principles of the present invention.

Claims

1 . A diagnosis kit for usage in real-time PCR device for detection of normal TLR7 gene and also variants of TLR7 gene (TLR7 gene mutations) which are rare and which affect sufficient functioning of the TLR7 gene., wherein the subject matter diagnosis kit comprises a reaction mixture comprising at least one or some or all of the delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:1 1 ), transvPm (SEQ ID No:12) probes.
2. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
3. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a reaction mixture comprising at least one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:1 1 ), transvPm (SEQ ID No:12) probes.
4. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a reaction mixture comprising at least one or some or all of delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes.
5. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a reaction mixture comprising at least one or some or all of Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and/or delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes.
6. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises delF (SEQ ID No:1), deIR (SEQ ID No:2) primers.
7. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
8. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a mixture of delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
9. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises a mixture of delF (SEQ ID No:1), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4) primers.
10. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
11. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers.
12. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises delF (SEQ ID No:1 ), deIR (SEQ ID No:2), Del-target (wtSEQ ID No:5), Del-target(m) (SEQ ID No:6) primers.
13. The diagnosis kit according to claim 1 , wherein the reaction mixture comprises TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No: 8) primers.
14. The diagnosis kit according to claims 1 -13, wherein the subject matter diagnosis kit further comprises reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCh.
5. The diagnosis kit according to claims 1 -13, wherein the subject matter diagnosis kit further comprises reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCh and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures. 6. The diagnosis kit according to claims 1 -15 for usage in detection of normal TLR7 gene and also variants of TLR7 gene (TLR7 gene mutations) which are rare and which affect sufficient functioning of the TLR7 gene. 7.delF (SEQ ID No:1) and/or deIR (SEQ ID No:2) and/or TransvF (SEQ ID No:3) and/or TransvR (SEQ ID No:4) and/or Del-target(wt) (SEQ ID No:5) and/or Del-target(m) (SEQ ID No:6) and/or Transv-target(wt) (SEQ ID No:7) and/or Transv-target(m) (SEQ ID No:8) primers for usage in detection of TLR7 gene mutations. 8.delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes for usage in detection of TLR7 gene mutations. 9. A method for detection of normal TLR7 gene and also variants of TLR7 gene (TLR7 gene mutations) which are rare and which affect sufficient functioning of the TLR7 gene, said method comprises the steps of: i. Realizing nucleic acid extraction from in vitro patient samples ii. Mixing the nucleic acids, obtained in step i, with the reaction mixture comprising at least one or some or all of the delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del- target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6), Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and/or (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11 ), transvPm (SEQ ID No:12) probes and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, iii. Mixing the nucleic acids, obtained in step i, with the reaction mixture comprising one or some or all of delF (SEQ ID No:1 ), deIR (SEQ ID No:2), TransvF (SEQ ID No:3), TransvR (SEQ ID No:4), Del-target(wt) (SEQ ID No:5), Del-target(m) (SEQ ID No:6) Transv-target(wt) (SEQ ID No:7), Transv-target(m) (SEQ ID No:8) primers and/or one or some or all of the delp (SEQ ID No:9), delPm (SEQ ID No:10), transvP (SEQ ID No:11), transvPm (SEQ ID No:12) probes or any primer and probe mixture or mixtures with a completely different array from the primer and probe arrays of which the sequence list is given above, primers and probe mixture or mixtures, primer and probe mixture or mixtures, or primers and probes mixture or mixtures or single primer or primers mixture or single probe or probes mixture with a completely different array from the primer and probe arrays of which the sequence list is given above and optionally reaction buffer and/or sterile water and/or any DNA polymerase enzyme and/or Mg+2 ion, for instance, MgCI2 and/or more different enzyme or enzymes and/or more different reaction buffer and/or additional substance mixtures, iv. Realizing DNA/RNA amplification, v. Examining the sample by means of fluorescent spectroscopy, vi. Determining whether the samples, where fluorescent signal is observed, have TLR7 gene mutation or not.
PCT/TR2021/051078 2020-10-28 2021-10-21 Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field WO2022093159A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/034,388 US20240318238A1 (en) 2020-10-28 2021-10-21 Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
TR202017266 2020-10-28
TR2020/17266 2020-10-28
TR2020/20743 2020-12-17
TR2020/20743A TR202020743A2 (en) 2020-10-28 2020-12-17 THE USE OF THE GENE ENCODING THE TLR7 RECEPTOR OF THE REAL-TIME PCR DEVICE FOR THE DETERMINATION OF NORMAL AND RARE VARIANTS AND THE METHOD OF USE, THE TLR7 GENE'S NORMAL AND RARE-VISIBLE VARIANTS USE A REAL-TIME VARIANT USER
TR202116366 2021-10-20
TR2021/016366 2021-10-20

Publications (1)

Publication Number Publication Date
WO2022093159A1 true WO2022093159A1 (en) 2022-05-05

Family

ID=81384229

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/TR2021/051078 WO2022093159A1 (en) 2020-10-28 2021-10-21 Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field

Country Status (1)

Country Link
WO (1) WO2022093159A1 (en)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide NCBI; 28 March 2020 (2020-03-28), ANONYMOUS : "PREDICTED: Trachypithecus francoisi toll like receptor 7 (TLR7), mRNA", XP055937972, Database accession no. XM_033201287 *
DATABASE Nucleotide NCBI; 30 March 2019 (2019-03-30), ANONYMOUS : "PREDICTED: Gorilla gorilla gorilla toll like receptor 7 (TLR7), mRNA", XP055937977, Database accession no. XM_004063793 *
WANG CHIOU-HUEY, ENG HOCK-LIEW, LIN KUEI-HSIANG, CHANG CHENG-HSIEN, HSIEH CHI-AN, LIN YEN-LI, LIN TSUN-MEI: "TLR7 and TLR8 Gene Variations and Susceptibility to Hepatitis C Virus Infection", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, US, vol. 6, no. 10, 1 October 2011 (2011-10-01), US , pages e26235, XP055937962, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0026235 *

Similar Documents

Publication Publication Date Title
US20050010030A1 (en) T cell receptor CDR3 sequence and methods for detecting and treating rheumatoid arthritis
JP2024103481A (en) Novel genetic classification and its use in autoimmune diseases
JP4753943B2 (en) Compositions and methods for detection of hepatitis A virus nucleic acid
Hofner et al. Polymorphism in the IL-8 gene, but not in the TLR4 gene, increases the severity of acute pancreatitis
WO2020198229A1 (en) Novel gene classifiers and uses thereof in skin cancers
JP2019520802A (en) Detection of MET exon 14 deletion and associated therapy
WO2005068655A2 (en) Methods of assessing a tissue inflammatory response using expression profiles of endothelial cells
AU5027400A (en) Methods of detecting colorectal disease
CN107419008B (en) Method and kit for accurately diagnosing Parkinson's disease in early stage
Mrazek et al. Expression of the chemokine PARC mRNA in bronchoalveolar cells of patients with sarcoidosis
WO2022093159A1 (en) Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field
WO2015140793A1 (en) Markers for diagnosing multiple sclerosis and predicting responsiveness to interferon treatment
CN113355417B (en) Application of MAP3K10 gene fragment and primer in preparation of intracranial aneurysm detection kit
US20240318238A1 (en) Method of using real-time pcr device in a new diagnostic field and diagnostic kit developed to use in real-time pcr device for this new diagnostic field
CN110551821B (en) Primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR
US9150920B2 (en) Methods of characterizing host responsiveness to interferon by ex vivo induction of interferon-responsive markers
RU2627179C1 (en) Test system for determination of interferon, il23 interleukine and mxa anti-virus protein rna
CN111690736A (en) Warfarin medication gene detection kit and use method thereof
CN110904233A (en) Oligonucleotide and method for detecting relative expression quantity of ABCG2 gene in sample
TR202020743A2 (en) THE USE OF THE GENE ENCODING THE TLR7 RECEPTOR OF THE REAL-TIME PCR DEVICE FOR THE DETERMINATION OF NORMAL AND RARE VARIANTS AND THE METHOD OF USE, THE TLR7 GENE'S NORMAL AND RARE-VISIBLE VARIANTS USE A REAL-TIME VARIANT USER
KR101768955B1 (en) Primer set for diagnosing Ebola virus and uses thereof
EP3021118B1 (en) Method for identifying species using molecular weights of nucleic acid cleavage fragments
CN115976274B (en) Composition, kit, method and application for detecting lichen planus pathogenesis inducement
WO2024009946A1 (en) Method for testing effectiveness of parp inhibitor against ovarian cancer
EP2118324B1 (en) Method for evaluating the response of an individual to a treatment with a type i interferon (ifn)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21887073

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 18034388

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 09/08/2023)

122 Ep: pct application non-entry in european phase

Ref document number: 21887073

Country of ref document: EP

Kind code of ref document: A1