WO2022088342A1

WO2022088342A1 - Sirna targeting foxp3 gene and modification method therefor

Info

Publication number: WO2022088342A1
Application number: PCT/CN2020/131889
Authority: WO
Inventors: 胡荣宽; 张佩琢; 张紫楠; 李琴
Original assignee: 苏州吉玛基因股份有限公司
Priority date: 2020-10-28
Filing date: 2020-11-26
Publication date: 2022-05-05

Abstract

A double-stranded siRNA molecule is provided, the double-stranded siRNA molecule being A or B below: A, a double-stranded siRNA molecule formed via the complementing of an RNA single strand as shown by SEQ ID No. 6 (FOXP3-Homo-487: CACAUUUCAUGCACCAGCUTT) and an RNA single strand as shown by SEQ ID No. 7 (FOXP3-Homo-487: AGCUGGUGCAUGAAAUGUGTT); B, a double-stranded siRNA molecule formed via the complementing of the RNA single strand as shown by SEQ ID No. 7 and an RNA single strand having 60% or higher homology with the RNA single strand as shown by SEQ ID No. 6; or, a double-stranded siRNA molecule formed via the complementing of the RNA single strand as shown by SEQ ID No. 6 and an RNA single strand having 60% or higher homology with the RNA single strand as shown by SEQ ID No. 7; or, a double-stranded siRNA molecule formed via the complementing of an RNA single strand having 70% or higher homology with the RNA single strand as shown by SEQ ID No. 6 and an RNA single strand having 70% or higher homology with the RNA single strand as shown by SEQ ID No. 7.

Description

A kind of siRNA targeting FOXP3 gene and its modification method

technical field

The invention relates to the field of drug research, in particular to a siRNA targeting FOXP3 and a modification method thereof.

Background technique

Transcription factor FOXP3, as a broad gene expression regulatory protein, whose main role is to participate in the gene regulation of immune regulatory T cells (ie CD4+ regulatory T cells, T-reg), has received extensive attention and is also the focus of immune research. Many genes in Treg cells are mainly regulated and expressed by FOXP3, and Treg cells are characterized by their ability to inhibit the activation of other immune cells, and this regulatory ability is the key to maintaining immune homeostasis.

In general, FOXP3-positive Treg cells function to suppress the immune system through a number of well-established mechanisms. For example, such cells are capable of secreting anti-inflammatory cytokines, expressing co-inhibitory molecules such as cytotoxic T-lymphocyte antigen 4 (CTLA4) and lymphocyte activation gene 3 protein (LAG3), and can modulate antigen-presenting cell (APC) active. Treg cells can also deplete key growth factors from the microenvironment, thereby blocking the effector T cell microenvironment and potentially leading to the latter's conversion to non-effector T cells or induction of apoptosis.

In addition, Treg cells can also absorb and consume certain amino acids, and by expressing CD39 and CD73, drive the accumulation of adenosine nucleosides, thereby disrupting the metabolism of effector T cells and causing the latter to inactivate. Treg cells are also reported to have cytotoxic potential, and they can suppress immune activity by simply killing effector T cells.

These functions of suppressing immune cell activity require appropriate regulation of genes within Treg cells, and FOXP3 is essential for the establishment and maintenance of Treg cell gene expression networks. Studies have reported that FOXP3 is mutated in mice or humans, clearly demonstrating the importance of this transcription factor in immune homeostasis. Treg cells in FOXP3 mutant mice lack the function of suppressing the immune response and are unable to suppress the production of hyperactivated T cells and their proinflammatory cytokines. In humans, mutations in the FOXP3 gene cause the classic immune dysregulated endocrine enteropathy (IPEX) syndrome, a genetic disorder that develops a variety of immunopathologies in the first few months of life, including Dermatitis, enteropathy, diabetes, thyroid disease (due to endocrine gland dysfunction) and anemia, etc.

FOXP3 is able to bind to more than 2800 genomic loci, which correspond to approximately 700–1400 genes in developed and mature Treg cells. By modulating these target loci, FOXP3 appears functionally synergistic with the epigenetically generated gene expression patterns triggered by T cell receptor (TCR) stimulation during Treg cell development. Although FOXP3 is very important for Treg cell-mediated immunosuppression, there are currently no drugs targeting FOXP3 on the market.

SUMMARY OF THE INVENTION

A double-stranded siRNA molecule of the present invention, the double-stranded siRNA molecule is the following A or B:

A. Double-stranded siRNA composed of complementary RNA single strand shown in SEQ ID No. 6 (FOXP3-Homo-487: CACAUUUCAUGCACCAGCUTT) and RNA single strand shown in SEQ ID No. 7 (FOXP3-Homo-487: AGCUGGUGCAUGAAAUGUGTT) molecular;

B. The double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.7 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.6;

Or, the double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.6 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.7;

Or, the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.6 is complementary to the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.7 double-stranded siRNA molecules.

A chemically modified double-stranded siRNA molecule, the double-stranded siRNA molecule is a double-stranded siRNA molecule that is complementary after chemical modification at least one chain of the double-stranded siRNA molecule described in the following A or B;

A, a double-stranded siRNA molecule formed by the complementarity of the RNA single strand shown in SEQ ID No.6 and the RNA single strand shown in SEQ ID No.7;

A chemically-modified double-stranded siRNA molecule, wherein the double-stranded siRNA molecule is formed by complementing at least one chain of at least one double-stranded siRNA molecule in the following A and B through any chemical modification shown in the following 1)-22). the double-stranded siRNA molecule;

Or, the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.6 is complementary to the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.7 double-stranded siRNA molecules;

1) phosphorothioate modification of the phosphate backbone;

2) 2'-methoxy modification of ribose or deoxyribose;

3) 2'-fluoro modification of ribose or deoxyribose;

4) 2'-hydroxyl modification of ribose or deoxyribose;

5) 2'-O-allyl modification of ribose or deoxyribose;

6) methoxyethyl modification of ribose or deoxyribose;

7) cyclohexenyl (CeNA) modification;

8) Hexitol (HNA) modification;

9) Locked nucleic acid modification;

10) open-loop nucleic acid modification;

11) Indole modification;

12) 5-methylcytosine modification of the base;

13) 5-ethynyluracil modification of base;

14) single-chain 5'-terminal cholesterol modification;

15) single-chain 3' terminal galactose modification;

16) single-chain 5' end polypeptide modification;

17) Phosphorylation modification at the 5' end of the single chain;

18) Fluorescent labeling modification at the 5' end of the single chain.

19) 2'-C-allyl modification of ribose or deoxyribose;

20) 2'-O-methoxyethyl-5-methyluridine modification of ribose or deoxyribose;

21) 2'-O-methoxyethyladenosine modification of ribose or deoxyribose;

22) 2'-O-methoxyethyl-5-methylcytidine modification of ribose or deoxyribose.

A chemically modified double-stranded siRNA molecule, the double-stranded siRNA is any one of the following:

1) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7, the complementary double-stranded siRNA molecules;

Nucleic acid molecule 1 is: the 7th and 9th positions of the RNA single strand shown in SEQ ID No.6 are both 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both thiols Phosphodiester bond, the 1st, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides are all 2 '-OMe modified nucleotides;

Nucleic acid molecule 2 is: nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 18 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-fluorine modified nucleosides Acid, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds, 1, 3, 7, Nucleotides at positions 9, 11, 13, 15, 17, 19, 20, and 21 are all 2'-OMe modified nucleotides;

2) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7, the complementary double-stranded siRNA molecules;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 ,5,7,9-11,13,15,17,19,21 are all 2'-fluorine modified nucleotides, and two consecutive phosphodiester bonds at the 5' end are phosphorothioate key;

Nucleic acid molecule 2: nucleotides 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleosides Acid, the 2, 4, 6, 8, 10, 14, 16, 18, 20, 22 positions are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are all thiols Phosphodiester bond, two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

3) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 ,5, 7, 9-11, 13, 15, 17, 19, and 21 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds ;

Nucleic acid molecule 2: RNA single-strand 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified cores 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2′-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond, the two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

4) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The nucleotides at positions 2, 4, 6, 8, 12, 14-21 of the single-stranded RNA shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3, 5, 7, 9-11 and 13 are 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

Nucleic acid molecule 2: RNA single-strand 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 are all 2'-OMe modified cores shown in SEQ ID No.7 2, 4, 8, 10, 14, 16, and 20 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds. The two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

5) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'-fluorine modified nucleotides, the two phosphodiester linkages at the 5' end are both phosphorothioate linkages;

Nucleic acid molecule 2: the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, and 23 positions of the single-stranded RNA shown in SEQ ID No. 7 are all modified by 2'-OMe Nucleotides, positions 2, 4, 8, 10, 14, 16, and 20 are all 2′-fluorine-modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds , the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

6) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

The 1-6, 8, 10-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are all 2'-fluorine modified nucleotides , the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds, and the RNA single strands 1, 3, 7, 9, 11, 13, 15, 17, 19- The 23rd positions are all 2'-OMe modified nucleotides, the 2, 4-6, 8, 10, 12, 14, 16, and 18 positions are all 2'-fluoro modified nucleotides, and the 5' end is continuous The two phosphodiester bonds are both phosphorothioate bonds, and the two continuous phosphodiester bonds at the 3' end are both phosphorothioate bonds;

7) Nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 , 5, 7, 9, 10, 13, 15, 17, 19, and 21 are all 2'-fluorine modified nucleotides, and the 11th position is LNA-modified nucleotides, and two consecutive 5'-end nucleotides The phosphodiester bonds are all phosphorothioate bonds;

8) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

9) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: RNA single-stranded RNA shown in SEQ ID No.6 at positions 2, 4, 6, 8, 12, 14-21 are all 2'-OMe modified nucleotides, at positions 1, 3, 5, and 7 , 9, 10, and 13 are all 2′-fluorine modified nucleotides, the 11th position are LNA modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds ;

10) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10, 12-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are 2'-fluoro modified nucleotides, the 11th position is LNA-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

11) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10, 12-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'- Fluorine-modified nucleotides, the 11th position is LNA-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds;

Nucleic acid molecule 2: the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleotides, the second , 4-6, 8, 10, 12, 14, 16, and 18 are all 2'-fluorine modified nucleotides, two phosphodiester bonds at the 5' end, two phosphodiester bonds at the 3' end The ester bond is a phosphorothioate diester bond;

12) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10-22 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'-fluoro modified nucleotides, the 11th position is deoxyribonucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

Nucleic acid molecule 2: the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleotides, the second , 4-6, 8, 10, 12, 14, 16, and 18 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, 3 'The two phosphodiester bonds that are consecutive at the end are both phosphorothioate bonds.

The above-mentioned 2'-fluoro modified nucleotides are 2' fluoro ribonucleotides; 2'-OMe modified nucleotides are 2'-O-methyl ribonucleotides; LNA modified nucleotides are locks nucleic acid;

A siRNA modification method, the siRNA comprises a sense strand and an antisense strand, the sense strand contains 21 nucleotides, and the antisense strand contains 23 nucleotides, wherein,

Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9-11 , 13, 15, 17, 19, and 21 are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; Positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 are all 2'-OMe modified nucleotides, positions 2, 4, 6, 8, 10, 14, The 16, 18, 20, and 22 positions are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two phosphodiester bonds at the 3' end are continuous The bonds are all phosphorothioate bonds;

Alternatively, positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, and 9 -11, 13, 15, 17, 19, and 21 are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the siRNA is antisense The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 23 positions of the chain are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, 10 ,14, 16, 18, and 20 are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are phosphodiester bonds. The ester bond is a phosphorothioate diester bond;

Alternatively, positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, positions 1, 3, 5, 7, 9-11, 13 Both nucleotides are 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; the 1, 3, 5-7, 9 of the siRNA antisense strand , 11-13, 15, 17-19, 21, 22 23 positions are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 positions are all 2'-fluorine modified nucleotides, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, positions 7 and 9 are all 2'-fluorine modified nucleotides, and 5 'The two consecutive phosphodiester bonds at the end are phosphorothioate bonds; the first, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 , 23 positions are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, and 20 positions are all 2'-fluorine modified nucleotides, and two consecutive phosphates at the 5' end Both the diester bonds are phosphorothioate bonds, and the two continuous phosphodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, the 1-6, 8, 10-21 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, the 7th and 9th positions are both 2'-fluoro modified nucleotides, and the first , 2 and 3 positions are connected by phosphorothioate bonds; the first, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the siRNA antisense strand are all 2'- OMe-modified nucleotides, the 2, 4-6, 8, 10, 12, 14, 16, and 18 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are is a phosphorothioate bond, and the two continuous phosphorodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, and 9 , 10, 13, 15, 17, 19, 21 are all 2′-fluorine modified nucleotides, 11 is LNA modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are sulfur Substitute phosphodiester bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides, The 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate Ester bond, two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

Alternatively, positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, and 9 , 10, 13, 15, 17, 19, and 21 are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond connection; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides, Positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds , the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, positions 1, 3, 5, 7, 9, 10, 13 Both positions are 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds; the siRNA antisense strand The 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 positions are all 2'-OMe modified nucleotides, the 2, 4, 8, 10, 14, The 16 and 20 positions are both 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two phosphodiester bonds at the 3' end are both sulfur Substitute phosphodiester bond;

Alternatively, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides , the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluoro modified nucleotides, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides , the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the 1, 3, 7, 9, 11, The 13, 15, 17, 19-23 positions are all 2'-OMe modified nucleotides, and the 2, 4-6, 8, 10, 12, 14, 16, and 18 positions are all 2'-fluorine modified cores For phosphonic acid, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

Alternatively, the 1-6, 8, 10-22 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, the 7 and 9 positions are both 2'-fluoro modified nucleotides, and the first The 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds; the 1st, 3rd, 7th, 9th, 11th, 13th, 15th, 17th , 19-23 positions are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 positions are all 2'-fluoro modified nucleotides, 5' The two consecutive phosphodiester bonds at the end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds.

A kind of siRNA, described siRNA is obtained through above-mentioned modification method; Described siRNA comprises a sense strand (sequence is

CACAUUUCAUGCACCAGCUCU) and an antisense strand (sequence AGAGCUGGUGCAUGAAAUGUGGC), so

The sense strand contains 21 nucleotides and the antisense strand contains 23 nucleotides.

A kit comprising at least one double-stranded siRNA molecule in the double-stranded siRNA molecule described in the kit or the chemically modified double-stranded siRNA molecule.

Application of the double-stranded siRNA molecule, the chemically modified double-stranded siRNA molecule or the double-stranded siRNA molecule obtained by the siRNA modification method or the described kit in the preparation of medicine; the function of the medicine is as follows (a) or (b) or (c) or (d) or (e):

(a) prevention and/or treatment of immune dysregulated endocrine enteropathy (IPEX) syndrome;

(b) prevention and/or treatment of bowel disease;

(c) prevention and/or treatment of diabetes;

(d) prevention and/or treatment of endocrine gland dysfunction thyroid disease;

(e) preventing and/or treating anemia.

The present invention provides siRNA targeting FoxP3 and a composition comprising the siRNA targeting FoxP3, further discloses the use of the siRNA targeting FoxP3 and the composition provided by the present invention for inhibiting FoxP3 expression, and discloses treatment and FoxP3 expression Related diseases such as pancreatic cancer, breast cancer, prostate cancer, bile duct cancer, melanoma, lung cancer, colorectal cancer, cervical cancer, head and neck cancer, thyroid cancer, urothelial cancer and other tumors. The method can include administering to the subject an effective amount, eg, a prophylactically effective amount or a therapeutically effective amount, of the RNAi agent.

The present invention provides siRNA for inhibiting FoxP3 gene expression, which contains one sense strand and one antisense strand. The sense or antisense strand of the siRNA can have a length in the range of 19-30 nucleotides. For example, the length of the sense or antisense strand can be between 19-21 nucleotides in length, 19-23 nucleotides in length, 19-25 nucleotides in length, 21-23 nucleotides in length, 21- 25 nucleotides in length, 23-25 nucleotides in length, 21-30 nucleotides in length, 23-30 nucleotides in length, 25-30 nucleotides in length. The sense strand and the antisense strand can form a double-stranded RNA, ie, siRNA. The double-stranded complementary region formed by the siRNA can be 15-30 nucleotides in length. According to the embodiments disclosed in the present invention, the double-stranded complementary regions of the siRNA provided by the present invention may have lengths of 15, 16, 17, 18, 19, 20, 21, 22 and 23 nucleotides.

In some embodiments of the invention, the siRNA may contain one or more overhang regions and/or capping groups at the 3' end, 5' end, or both ends of one or both strands. Overhangs can be 1-6 nucleotides in length, such as 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. These overhangs can be the result of one strand being longer than the other, or the staggering of two strands of the same length. The overhang can form a mismatch with FoxP3 mRNA, or it can be complementary to the targeted gene sequence or can be another sequence. The sense and antisense strands can also be linked, eg, by additional bases to form a hairpin or by other non-base linkers.

In one embodiment of the present invention, after complementary pairing of the sense strand and antisense strand of the siRNA, an overhang with a length of 2 nucleotides is formed at the 3' ends of the two strands, and the double-stranded region of the siRNA has 19 nucleosides acid length. In one embodiment of the present invention, after complementary pairing of the sense and antisense strands of the siRNA, an overhang with a length of 3 nucleotides is formed at the 3' ends of the two strands. In one embodiment of the present invention, after complementary pairing of the sense strand and antisense strand of the siRNA, an overhang with a length of 4 nucleotides is formed at the 3' ends of the two strands. In one embodiment of the present invention, after complementary pairing of the sense and antisense strands of the siRNA, an overhang with a length of 5 nucleotides is formed at the 3' ends of the two strands.

In one embodiment of the present invention, the indicated siRNA may contain only a single overhang, which can enhance the interfering activity of the siRNA without affecting its overall stability. For example, the single-stranded overhang can be located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand. The siRNA may also have blunt ends at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa. Generally, the antisense strand of the siRNA has a nucleotide overhang at the 3' end and the 5' end is blunt.

In some embodiments provided by the present invention, the nucleotides at the 5' or 3' overhangs of the sense strand, antisense strand or both strands of the siRNA can be independently chemically modified, including but not limited to being 2' - sugar modified (modification of the pentose sugar at the 2' position of a nucleotide), such as 2'-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5- Methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.

In some embodiments provided by the present invention, the 5' or 3' overhang at the sense strand, antisense strand or both strands of the siRNA may be phosphorylated, for example, the overhang region(s) contains two A nucleotide with a phosphorothioate between the two nucleotides, which may be the same or different. In one embodiment of the invention, the overhang is present at the 3' end of the sense strand, the antisense strand, or both strands.

In some embodiments provided by the present invention, at least one nucleotide of the sense strand, at least one nucleotide of the reactive strand, or at least one nucleotide of both strands of the siRNA is a modified nucleotide. In some embodiments of the invention, the majority of nucleotides on the sense strand are modified nucleotides, the majority of nucleotides on the antisense strand are modified nucleotides, or the majority of nucleotides on both strands are modified nucleotides nucleotides. In some embodiments of the present invention, all nucleotides on the sense strand are modified nucleotides, all nucleotides on the antisense strand are modified nucleotides, or all nucleotides on both strands are modified nucleotides acid.

In some embodiments provided by the present invention, one or more nucleotides in the sense strand or antisense strand of the siRNA can be independently chemically modified, including but not limited to 2'-O-methyl (2'-O-methyl) -OMe), 2'-fluoro(2'-fluoro)thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl Adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof. In some embodiments, one or more nucleotides of the sense or antisense strand can be linked by phosphorothioate linkages.

In some embodiments provided by the present invention, the 7th position and the 9th position of the sense strand of the siRNA are both 2'-fluorine modified nucleotides, and phosphorothioate diester is passed between the 1st, 2nd and 3rd positions. Bonding, the 1st, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides are all 2'- OMe-modified nucleotides; the 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 positions of the antisense strand of the siRNA are all 2'-fluorine-modified nucleotides, and the first , the 2, 3 positions are connected by a phosphorothioate bond, the 19, 20, and 21 positions are connected by a phosphorothioate bond, the 1, 3, 7, 9, 11, 13, 15, 17 , 19, 20, and 21 nucleotides are all 2'-OMe modified nucleotides.

Each nucleotide of the sense and antisense strands can be independently modified by LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O -Allyl, 2'-C-allyl, 2'-hydroxy, or 2'-fluoro.

In some embodiments provided by the present invention, one or more nucleotides of the sense strand or antisense strand of the siRNA can also be independently modified by the following: LNA (Locked Nucleic Acid, locked nucleic acid), HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxy, or 2'-fluoro.

In some embodiments provided by the present invention, the 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and the first, 3, 5, 7, 9-11, 13, 15, 17, 19, 21 are 2'-fluorine modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond; the The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8 ,10, 14, 16, 18, 20, and 22 are all 2′-fluorine-modified nucleotides. The 1, 2, and 3 positions are connected by a phosphorothioate bond. The 21, 22, and 23 positions connected by phosphorothioate bonds.

In some embodiments provided by the present invention, the 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and the first, Positions 3, 5, 7, 9-11, 13, 15, 17, 19, and 21 are all 2'-fluorine-modified nucleotides, and the positions 1, 2, and 3 are connected by phosphorothioate bonds; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2′-fluorine-modified nucleotides. The 1, 2, and 3 positions are connected by phosphorothioate bonds. The 21, 22, and 23 The positions are linked by phosphorothioate bonds.

In some embodiments provided by the present invention, positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, Positions 7, 9-11, and 13 are all 2'-fluorine-modified nucleotides, and the positions 1, 2, and 3 are connected by phosphorothioate bonds; the first, third, and third positions of the siRNA antisense strand are 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are It is a 2'-fluorine modified nucleotide, the 1st, 2nd and 3rd positions are connected by a phosphorothioate bond, and the 21st, 22nd and 23rd positions are connected by a phosphorothioate bond.

In some embodiments provided by the present invention, positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2'-fluoro Modified nucleotides, linked by phosphorothioate bonds between positions 1, 2, and 3; the 1, 3, 5-7, 9, 11-13, 15, 17- 19, 21, 22, 23 are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluorine modified nucleotides, the first , The 2,3 positions are connected by a phosphorothioate bond, and the 21st, 22, and 23 positions are connected by a phosphorothioate bond.

In some embodiments provided by the present invention, positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2'-fluoro Modified nucleotides, connected by phosphorothioate bonds between positions 1, 2, and 3; the first, 3, 7, 9, 11, 13, 15, 17, 19- 23 positions are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2'-fluoro modified nucleotides, 1, 2, The 3-position is connected by a phosphorothioate bond, and the 21st, 22, and 23 positions are connected by a phosphorothioate bond.

In some embodiments provided by the present invention, the 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and the first, 3, 5, 7, 9, 10, 13, 15, 17, 19, and 21 are all 2′-fluoro-modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1st, 2nd, and 3rd positions They are connected by phosphorothioate bonds; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 positions of the siRNA antisense strand are all modified by 2'-OMe The nucleotides of the The phosphodiester bond is connected, and the 21st, 22nd, and 23rd positions are connected by a thiophosphodiester bond.

In some embodiments provided by the present invention, the 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and the first, 3, 5, 7, 9, 10, 13, 15, 17, 19, and 21 are all 2′-fluoro-modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1st, 2nd, and 3rd positions They are connected by phosphorothioate bonds; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22, and 23 positions of the siRNA antisense strand are all 2'- OMe-modified nucleotides, positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2′-fluorine-modified nucleotides, with thiols between positions 1, 2, and 3 The phosphodiester bond is connected, and the 21st, 22nd, and 23rd positions are connected by a thiophosphodiester bond.

In some embodiments provided by the present invention, positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, The 7, 9, 10, and 13 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond; The 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides, and the 2, 4, 8 , 10, 14, 16, and 20 are all 2′-fluorine-modified nucleotides, the 1, 2, and 3 positions are connected by a phosphorothioate bond, and the 21, 22, and 23 positions are connected by sulfur Substitution of phosphodiester linkages.

In some embodiments provided by the present invention, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2' -Fluorine-modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, and 5 of the siRNA antisense strand -7, 9, 11-13, 15, 17-19, 21, 22, 23 are all 2'-OMe modified nucleotides, and 2, 4, 8, 10, 14, 16, 20 are all nucleotides 2'-Fluorine-modified nucleotides are linked by phosphorothiodiester bonds between positions 1, 2, and 3, and linked by phosphorothioate bonds between positions 21, 22, and 23.

In some embodiments provided by the present invention, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2' -Fluorine-modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1, 2, and 3 positions are linked by phosphorothioate bonds; the 1, 3, and 7 of the siRNA antisense strand , 9, 11, 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2' -Fluorine-modified nucleotides, the 1st, 2nd, and 3rd positions are linked by phosphorothioate bonds, and the 21st, 22nd, and 23rd positions are linked by phosphorothioate bonds.

In some embodiments provided by the present invention, positions 1-6, 8, 10-22 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2'-fluoro Modified nucleotides, the 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1st, 3rd, 7th, 9th, Positions 11, 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, and positions 2, 4-6, 8, 10, 12, 14, 16, and 18 are all 2'-fluorine modified The nucleotides of 1, 2, and 3 are connected by phosphorothioate bonds, and the 21, 22, and 23 positions are connected by phosphorothioate bonds.

In some embodiments provided by the present invention, a pharmaceutical composition is provided, and the pharmaceutical composition contains the siRNA as described above and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier can be a carrier commonly used in the field of siRNA administration, such as but not limited to magnetic nanoparticles (magnetic nanoparticles, such as Fe3O4, Fe2O3), carbon nanotubes (carbon nanotubes), mesoporous silicon (mesoporous silicon). ), calcium phosphate nanoparticles (calcium phosphate nanoparticles), polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine), PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (1,2-dioleoyl-3-trimethylammonium-propane, DOTAP), poly D-type or L-type lactic acid/glycolic acid copolymer poly(D&L-lactic/glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA) and poly(methacrylate-N,N-dimethacrylate) One or more of poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives.

The pharmaceutical composition may also contain other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally used in the art. For example, the pharmaceutically acceptable other excipients may include at least one of pH buffers, protective agents and osmotic pressure regulators. The pH buffer can be tris buffer at pH 7.5-8.5 and/or phosphate buffer at pH 5.5-8.5, preferably phosphate buffer at pH 5.5-8.5 liquid. The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

The pharmaceutical composition can be a liquid preparation, such as an injection; it can also be a lyophilized powder for injection, which is mixed with liquid auxiliary materials during administration to prepare a liquid preparation. The liquid preparation can be used for but not limited to subcutaneous, intramuscular or intravenous administration, and can also be administered to the lungs by spraying, or to other organ tissues (eg liver) by spraying through the lungs.

The technical scheme of the present invention has the following advantages:

The present invention provides non-modified nucleic acid molecules and modified nucleic acid molecules targeting FOXP3 gene. It is proved by experiments that the nucleic acid molecules of the present invention are immune to tumors, especially prostate cancer and lung cancer, esophageal cancer, cervical cancer, colorectal cancer, melanoma Cancer, breast cancer and other malignant tumors have good therapeutic effect, and can be used as an immune adjuvant, which lays a foundation for clinical treatment of cancer and has great application and promotion value.

Detailed ways

Example 1

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

The following non-limiting examples may enable those skilled in the art to better understand the present invention.

Any person skilled in the art, within the scope of the disclosure of the present invention, makes substitutions or changes according to the technical solutions and ideas of the present invention, which belong to the protection scope of the present invention.

Obviously, the following examples are only examples for clear illustration, rather than limiting the implementation manner. For those of ordinary skill in the art, changes or modifications in other different forms can also be made on the basis of the following description. There is no need and cannot be exhaustive of all implementations here. And the obvious changes or changes derived from this are still within the protection scope of the present invention.

FoxP3 in the present invention refers to transcription factor transcription factor Forkhead box P3 gene or protein. FoxP3 in the present invention refers to the gene whose mRNA sequence is shown in Genbank accession number NM_014009.3.

The present disclosure will be further illustrated by examples below, but the present disclosure is not limited thereby.

Unless otherwise specified, the reagents, culture medium and other test materials used in the present disclosure are all commercially available products.

The 293T cell line PC-3 cell line and the MDA-MB-231 cell line used in the following examples were purchased from the Collection Cell Bank of the Chinese Academy of Sciences.

The materials and suppliers used in the embodiments of the present invention are shown in Table 1:

Table 1

试剂名称Reagent name	厂家factory	批号batch number
FBSFBS	VazymeVazyme	7E401A07E401A0
DMEM培养基DMEM medium	HyCloneHyClone	AE29431648AE29431648
PBSPBS	HyCloneHyClone	AF29449009AF29449009
双荧光素酶检测试剂盒Dual Luciferase Assay Kit	Promega E1960Promega E1960	00004009260000400926
Lipofectamine2000转染试剂Lipofectamine2000 Transfection Reagent	ThermoThermo	21253612125361
2×One Step U+Mix2×One Step U+Mix	vazymevazyme	7E411B07E411B0
One Step U+Enzyme MixOne Step U+Enzyme Mix	vazymevazyme	7E411B07E411B0
50×ROX Reference Dye 150×ROX Reference Dye 1	vazymevazyme	7E411B07E411B0
RNase-free ddH2ORNase-free ddH2O	vazymevazyme	7E411B07E411B0

The complete medium was DMEM medium containing 10% fetal bovine serum.

Example 1 Construction of dual-luciferase reporter gene plasmid

The dual-luciferase reporter gene plasmid used in this example is the GP-miRGLO vector (the sequence of the empty vector is shown in its specification), which was purchased from Promega (Cat. No. E1330). The specific construction method is to insert the FOXP3 gene fragment (NCBI Reference Sequence: NM_014009.3) sequence into the GP-miRGLO vector, and the length of the inserted sequence is generally between 300-400 bp. The specific insertion information is shown in Table 1.

Table 1

Example 2 siRNA preparation

Using the FOXP3 gene (NCBI Reference Sequence: NM_014009.3) as a template to select a nucleotide sequence of 21 bp, a series of small interfering nucleic acids (siRNA) spanning the FOXP3 mRNA sequence were designed and synthesized. The siRNA designed in this example is synthesized by Suzhou Gema Gene Co., Ltd., and the siRNA sequence of the above synthesis is shown in Table 2; the sequences are all 5'-3' ends.

Table 2

Example 3

This example is used to detect the dual-luciferase reporter plasmid obtained in Example 1 and the siRNA obtained in Example 2, and to detect the inhibitory effect of siRNA on the expression level of FOXP3 gene in the dual-luciferase reporter plasmid in 293T cells. The following are the specific experimental methods:

1. When the 293T cells were cultured in a cell dish with a diameter of 10 cm to 80-90% confluence, the culture medium was discarded, and the cells were washed twice with 3 ml of PBS buffer (pH 7.4).

2. Add 1 ml of Trypsin-EDTA solution (ThermoFisher, Cat 25200056) and mix well, carefully remove the trypsin solution, and place at 37°C for 2-3 minutes.

3. Add 2 ml of complete medium to the cell dish, and pipet to make the cells form a single cell suspension.

4. Count the single cell suspension in step 3 on a hemocytometer, inoculate the cell volume of about 1×10 ⁵ per well in a 24-well plate, and culture at 37°C for 24 hours;

5. The siRNA to be tested was dissolved in DEPC-H ₂ O to obtain a siRNA solution with a concentration of 20 μM.

6. Use GP-transfect-mate transfection method (three replicate wells in each group) for transfection: add 150 μl DMEM basal medium (50 μl/well, three wells in total) to a 1.5 ml EP tube, and then add The plasmid of Example 1 was 60ng (20ng/well, three wells in total), and the corresponding oligo siRNA solution shown in Table 3 (the final concentration of siRNA in the transfection mixture was 20nM), mixed well; in another 1.5ml Add 144 μl of DMEM basal medium (50 μl/well, three wells in total) and 6ul of transfection reagent lipo2000 (Invitrogen) to the EP tube, mix well, and after standing for 5 minutes, mix the liquid in the two EP tubes to obtain Transfection mixture, a total of 300ul, was allowed to stand at room temperature for 20min.

The corresponding relationship between siRNA and dual-luciferase reporter plasmid is shown in Table 3.

table 3

编号Numbering	对应质粒Corresponding plasmid
FOXP3-Homo-mus-234FOXP3-Homo-mus-234	FOXP3-530FOXP3-530
FOXP3-Homo-487FOXP3-Homo-487	FOXP3-530FOXP3-530
FOXP3-Homo-631FOXP3-Homo-631	FOXP3-940FOXP3-940
FOXP3-Homo-689FOXP3-Homo-689	FOXP3-940FOXP3-940
FOXP3-Homo-799FOXP3-Homo-799	FOXP3-940FOXP3-940
FOXP3-Homo-895FOXP3-Homo-895	FOXP3-940FOXP3-940
FOXP3-Homo-1161FOXP3-Homo-1161	FOXP3-1480FOXP3-1480
FOXP3-Homo-mus-1166FOXP3-Homo-mus-1166	FOXP3-1480FOXP3-1480
FOXP3-Homo-1261FOXP3-Homo-1261	FOXP3-1480FOXP3-1480
FOXP3-Homo-1304FOXP3-Homo-1304	FOXP3-1480FOXP3-1480
FOXP3-Homo-1357FOXP3-Homo-1357	FOXP3-1480FOXP3-1480
FOXP3-Homo-1447FOXP3-Homo-1447	FOXP3-1480FOXP3-1480

7. Remove the medium from the 24-well plate, and add 400 μl/well of pre-warmed complete medium; in step 6, add the transfection mixture to three wells of the above 24-well plate, 100 μl/well, and shake the well plate. , placed in a 37°C incubator.

8. After culturing for 24h, harvest the cells for dual luciferase detection.

According to the situation of the dual luciferase carrier used, the Renilla value/Firefly value of the same complex plate was used to obtain the ratio results, and the average values were taken for data analysis. The experimental results are shown in Table 4. It can be seen from the table that FOXP3-Homo-487, FOXP3-Homo-799 and FOXP3-Homo-1357 have better inhibitory effect on FOXP3.

Table 4

Example 4

This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of FOXP3 mRNA in MDA-MB-231 cells. 1. When MDA-MB-231 cells were cultured in a cell dish with a diameter of 10 cm to 80-90% confluence, the culture medium was poured out, and the cells were washed twice with 3 ml of PBS.

2. Add 1ml of Trypsin-EDTAs solution (ThermoFisher, Cat 25200056) and mix well, carefully remove the trypsin solution, and place at 37°C for 2-3 minutes.

4. Take the single cell suspension obtained in the above steps, count the cells on a hemocytometer, inoculate the cells in a 12-well plate at a cell amount of about 3×10 ⁵ per well, and culture at 37° C. for 24 hours for transfection.

5. The siRNA to be tested was dissolved in DEPC-H ₂ O at a concentration of 20 μM.

6. Use the transfection method of GP-transfect-mate for transfection: add 100 μl DMEM basal medium to a 1.5 ml EP tube, then add 60 ng of the plasmid of Example 1 and oligo (in the transfection mixture) shown in Table 3. The final concentration is 50nM), mix well; add 96μl DMEM basal medium and 4ul transfection reagent lipo2000 (Invitrogen) to another 1.5ml EP tube, mix well, and after standing for 5min, put the two EP tubes in the The liquid was mixed to obtain a transfection mixture, a total of 200ul, which was allowed to stand at room temperature for 20min.

7. Remove the medium from the 12-well plate in step 4, and add 800 μl/well of pre-warmed complete medium; after 20 minutes of resting time, add 200 μl of transfection mixture per tube to the above 12-well plate. , the final volume of each well is 1ml, shake the well plate well, and put it into the incubator for culture. The medium was changed for 6 h after transfection, and the cells were harvested for QPCR detection about 24 h after transfection.

Table 5 Primers used for QPCR

8. QPCR detection

a. Total RNA extraction

1) Add Ezol lysis solution to the MDA-MB-231 cells transfected in step 7, and add 1 ml to each well.

2) Add 0.2 ml of chloroform, shake vigorously for 10 s, and place at room temperature for 3 minutes.

3) Centrifuge at 12,000 rpm for 20 min at 4°C.

4) Transfer the supernatant water phase to another new RNase-free centrifuge tube, add an equal volume of isopropanol, mix well, and place at -80°C for 1 hour.

5) Centrifuge at 12,000 rpm for 10 min at 4°C and remove the supernatant.

6) Add 1 ml of 75% (v/v) ethanol to wash the precipitate.

7) Centrifuge at 5,000 rpm for 3 min at 4°C, remove the supernatant, and dry at room temperature.

8) Add an appropriate amount of RNA-free water to dissolve the RNA.

b. mRNA reverse transcription reaction

1) Remove genomic DNA from the extracted RNA, use the system in Table 6, react at 42°C for 5 min, and place it on ice;

2) mRNA reverse transcription reaction

According to the reaction system in Table 7, the reaction was carried out at 50 °C for 20 min; at 85 °C for 1 min; and stored at 4 °C.

Table 6 Removal of genomic DNA

Table 7 Reverse transcription reaction

c. mRNA real-time fluorescence quantitative reaction system

Table 8

d. Quantitative PCR reaction program

Pre-denaturation at 95°C, 30 seconds; 95°C, 10 seconds; 60°C, 30 seconds, 72°C, 30 seconds, 40 cycles; 4°C, 10 minutes. The test results are shown in the table below.

Table 9

As shown in the table, in MDA-MB-231 cells, FOXP3-Homo-631, FOXP3-Homo-689, and FOXP3-Homo-895 have better inhibitory effects on FOXP3 mRNA, and the expression level after inhibition is reduced by 75% compared with the negative control. above.

Example 5

This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of FOXP3 mRNA in PC-3 cells.

1. When PC-3 cells were cultured in a cell dish with a diameter of 10 cm to 80-90% confluence, the culture medium was poured out, and the cells were washed twice with 3 ml of PBS.

2. Add 1ml of Trypsin-EDTA solution, after mixing, carefully remove the trypsin solution and place at 37°C for 2-3 minutes.

3. Add 2 ml of complete medium and pipet to form a single cell suspension.

4. Take the single-cell suspension from the above steps, count the cells on a hemocytometer, inoculate the cells in a 12-well plate with a cell volume of about 3×10 ⁵ per well, and culture at 37°C for 24 hours;

5. The oligo, the siRNA to be tested, was dissolved in 125 μl DEPC-H ₂ O to obtain a siRNA solution with a concentration of about 20 μM.

6. Take the cells in step 4 for transfection, and use the transfection method of GP-transfect-mate for transfection: add 100 μl DMEM basal medium to a 1.5 ml EP tube, and then add 60 ng of the plasmid of Example 1 and Table 3. The oligo shown (final transfection concentration is 50nM), mix well; add 96μl DMEM basal medium and 4ul transfection reagent lipo2000 to another 1.5ml EP tube, mix well, and mix the two after standing for 5min. Evenly, a total volume of 200ul was left at room temperature for 20min.

7. During the period, remove the medium from the 12-well plate laid the day before, and add 800 μl/well of pre-warmed complete medium; after the 20-min standing time, add 200 μl of transfection mixture per tube to the above 12 wells In the plate, the final volume of each well is 1ml, the well plate is shaken and placed in an incubator for culture. The medium was changed after 6 h of transfection, and the cells were harvested for qPCR detection about 48 h after transfection.

The detection results are shown in Table 10. As shown in the table, FOXP3-Homo-487 and FOXP3-Homo-799 have better inhibitory effects on FOXP3 mRNA in MDA-MB-231 cells.

Table 10

Example 6 Preparation of modified siRNA sequences

In order to further enhance the stability of siRNA, this example further modifies the siRNA in Example 2, first changing the overhang (the sense strand remains 21nt, the antisense strand is changed to 23nt), and the siRNA in the following table is prepared . The base to the left of m is OME modification, the base to the left of f is 2'F modification, s is PS modification (PS: phosphorothioate modification of phosphate backbone), d is deoxyribonucleic acid, and LNA is locked nucleotide modification .

The siRNA used in Example 4 was replaced by the siRNA in Table 11, and the same experiment as in Example 4 was carried out. The results are shown in Table 12.

The siRNA in Example 5 was replaced with the siRNA in Table 11, and the same experiment as in Example 5 was carried out. The results are shown in Table 13.

Table 11

Claims

A double-stranded siRNA molecule, wherein the double-stranded siRNA molecule is the following A or B:

A. Double-stranded siRNA composed of complementary RNA single strand shown in SEQ ID No. 6 (FOXP3-Homo-487: CACAUUUCAUGCACCAGCUTT) and RNA single strand shown in SEQ ID No. 7 (FOXP3-Homo-487: AGCUGGUGCAUGAAAUGUGTT) molecular;

B. The double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.7 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.6;

Or, the double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.6 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.7;

Or, the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.6 is complementary to the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.7 double-stranded siRNA molecules.
A chemically modified double-stranded siRNA molecule, characterized in that the double-stranded siRNA molecule is a double-stranded siRNA molecule formed by chemical modification of at least one chain of the double-stranded siRNA molecule described in the following A or B;

A, a double-stranded siRNA molecule formed by the complementarity of the RNA single strand shown in SEQ ID No.6 and the RNA single strand shown in SEQ ID No.7;

B. The double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.7 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.6;

Or, the double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.6 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.7;

Or, the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.6 is complementary to the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.7 double-stranded siRNA molecules.
A chemically modified double-stranded siRNA molecule, wherein the double-stranded siRNA molecule is at least one chain of at least one double-stranded siRNA molecule in the following A and B through any chemical modification shown in the following 1)-22) Double-stranded siRNA molecules formed by post-complementation;

A, a double-stranded siRNA molecule formed by the complementarity of the RNA single strand shown in SEQ ID No.6 and the RNA single strand shown in SEQ ID No.7;

B. The double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.7 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.6;

Or, the double-stranded siRNA molecule formed by the single-stranded RNA shown in SEQ ID No.6 and the single-stranded RNA with more than 60% homology with the single-stranded RNA shown in SEQ ID No.7;

Or, the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.6 is complementary to the RNA single strand with more than 70% homology with the RNA single strand shown in SEQ ID No.7 double-stranded siRNA molecules;

1) phosphorothioate modification of the phosphate backbone;

2) 2'-methoxy modification of ribose or deoxyribose;

3) 2'-fluoro modification of ribose or deoxyribose;

4) 2'-hydroxyl modification of ribose or deoxyribose;

5) 2'-O-allyl modification of ribose or deoxyribose;

6) methoxyethyl modification of ribose or deoxyribose;

7) cyclohexenyl (CeNA) modification;

8) Hexitol (HNA) modification;

9) Locked nucleic acid modification;

10) open-loop nucleic acid modification;

11) Indole modification;

12) 5-methylcytosine modification of the base;

13) 5-ethynyluracil modification of base;

14) single-chain 5'-terminal cholesterol modification;

15) single-chain 3' terminal galactose modification;

16) single-chain 5' end polypeptide modification;

17) Phosphorylation modification at the 5' end of the single chain;

18) single-chain 5'-end fluorescent labeling modification;

19) 2'-C-allyl modification of ribose or deoxyribose;

20) 2'-O-methoxyethyl-5-methyluridine modification of ribose or deoxyribose;

21) 2'-O-methoxyethyladenosine modification of ribose or deoxyribose;

22) 2'-O-methoxyethyl-5-methylcytidine modification of ribose or deoxyribose.
A chemically modified double-stranded siRNA molecule, wherein the double-stranded siRNA is any of the following:

1) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7, the complementary double-stranded siRNA molecules;

Nucleic acid molecule 1 is: the 7th and 9th positions of the RNA single strand shown in SEQ ID No.6 are 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate Diester bond, 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides are all 2' -OMe modified nucleotides;

Nucleic acid molecule 2 is: nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 18 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-fluorine modified nucleosides Acid, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds, 1, 3, 7, Nucleotides at positions 9, 11, 13, 15, 17, 19, 20, and 21 are all 2'-OMe modified nucleotides;

2) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7, the complementary double-stranded siRNA molecules;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 ,5,7,9-11,13,15,17,19,21 are all 2'-fluorine modified nucleotides, and two consecutive phosphodiester bonds at the 5' end are phosphorothioate key;

Nucleic acid molecule 2: nucleotides 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleosides Acid, the 2, 4, 6, 8, 10, 14, 16, 18, 20, 22 positions are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are all thiols Phosphodiester bond, two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

3) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 ,5, 7, 9-11, 13, 15, 17, 19, and 21 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds ;

Nucleic acid molecule 2: RNA single-strand 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified cores 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2′-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond, the two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

4) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The nucleotides at positions 2, 4, 6, 8, 12, 14-21 of the single-stranded RNA shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the nucleotides at positions 1, 3, 5, 7, 9-11 and 13 are 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

Nucleic acid molecule 2: RNA single-strand 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 are all 2'-OMe modified cores shown in SEQ ID No.7 2, 4, 8, 10, 14, 16, and 20 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds. The two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

5) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'-fluorine modified nucleotides, the two phosphodiester linkages at the 5' end are both phosphorothioate linkages;

Nucleic acid molecule 2: the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, and 23 positions of the single-stranded RNA shown in SEQ ID No. 7 are all modified by 2'-OMe Nucleotides, positions 2, 4, 8, 10, 14, 16, and 20 are all 2′-fluorine-modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds , the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

6) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

The 1-6, 8, 10-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are all 2'-fluorine modified nucleotides , the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds, and the RNA single strands 1, 3, 7, 9, 11, 13, 15, 17, 19- The 23rd positions are all 2'-OMe modified nucleotides, the 2, 4-6, 8, 10, 12, 14, 16, and 18 positions are all 2'-fluoro modified nucleotides, and the 5' end is continuous The two phosphodiester bonds are both phosphorothioate bonds, and the two continuous phosphodiester bonds at the 3' end are both phosphorothioate bonds;

7) Nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 , 5, 7, 9, 10, 13, 15, 17, 19, and 21 are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and two consecutive phosphates at the 5′ end The diester bonds are all phosphorothioate diester bonds;

Nucleic acid molecule 2: nucleotides 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleosides Acid, the 2, 4, 6, 8, 10, 14, 16, 18, 20, 22 positions are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are all thiols Phosphodiester bond, two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

8) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 2, 4, 6, 8, 12, 14, 16, 18, and 20 positions of the RNA single-strand shown in SEQ ID No. 6 are all 2'-OMe modified nucleotides, and the 1, 3 , 5, 7, 9, 10, 13, 15, 17, 19, and 21 are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and two consecutive phosphates at the 5′ end The diester bonds are all phosphorothioate diester bonds;

Nucleic acid molecule 2: RNA single-strand 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified cores 2, 4, 6, 8, 10, 14, 16, 18, and 20 are all 2′-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond, the two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

9) Nucleic acid molecule 1 formed by chemical modification of the RNA single strand shown in SEQ ID No.6 and nucleic acid molecule 2 formed by chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: RNA single-stranded RNA shown in SEQ ID No.6 at positions 2, 4, 6, 8, 12, 14-21 are all 2'-OMe modified nucleotides, at positions 1, 3, 5, and 7 , 9, 10, and 13 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds;

Nucleic acid molecule 2: RNA single strand 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified cores 2, 4, 8, 10, 14, 16, and 20 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds. The two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

10) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10, 12-21 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are 2'-fluoro modified nucleotides, the 11th position is LNA-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

Nucleic acid molecule 2: the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, and 23 positions of the single-stranded RNA shown in SEQ ID No. 7 are all modified by 2'-OMe Nucleotides, positions 2, 4, 8, 10, 14, 16, and 20 are all 2′-fluorine-modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bonds , the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

11) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10, 12-21 positions of the RNA single-strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'- Fluorine-modified nucleotides, the 11th position is LNA-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds;

Nucleic acid molecule 2: the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleotides, the second , 4-6, 8, 10, 12, 14, 16, and 18 are all 2'-fluorine modified nucleotides, two phosphodiester bonds at the 5' end, two phosphodiester bonds at the 3' end The ester bond is a phosphorothioate diester bond;

12) The nucleic acid molecule 1 formed by the chemical modification of the RNA single strand shown in SEQ ID No.6 and the nucleic acid molecule 2 formed by the chemical modification of the RNA single strand shown in SEQ ID No.7;

Nucleic acid molecule 1: The 1-6, 8, 10-22 positions of the RNA single strand shown in SEQ ID No.6 are all 2'-OMe modified nucleotides, and the 7th and 9th positions are both 2'-fluoro modified nucleotides, the 11th position is deoxyribonucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds;

Nucleic acid molecule 2: the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the single-stranded RNA shown in SEQ ID No.7 are all 2'-OMe modified nucleotides, the second , 4-6, 8, 10, 12, 14, 16, and 18 are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, 3 'The two phosphodiester bonds that are consecutive at the end are both phosphorothioate bonds.
A siRNA modification method, characterized in that the siRNA comprises a sense strand and an antisense strand, the sense strand contains 21 nucleotides, and the antisense strand contains 23 nucleotides, and the modification method is as follows Either:

(1) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9-11, 13, 15, 17, 19, and 21 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the sense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, 10 ,14, 16, 18, 20, and 22 are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end The phosphodiester bonds are all phosphorothioate bonds;

(2) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9-11, 13, 15, 17, 19, and 21 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 positions of the sense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, The 10, 14, 16, 18, and 20 positions are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two consecutive phosphates at the 3' end The diester bonds are all phosphorothioate diester bonds;

(3) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, positions 1, 3, 5, 7, 9-11, The 13th positions are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 23 positions are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 positions are all 2'-fluoro For the modified nucleotide, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(4) Positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, The two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; 22, 23 are 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluorine modified nucleotides, two consecutive 5' ends The phosphodiester bonds are both thiophosphodiester bonds, and the two consecutive phosphodiester bonds at the 3' end are both thiophosphodiester bonds;

(5) Positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, and 5 The two consecutive phosphodiester bonds at the ends are both phosphorothioate bonds; the first, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides, the 2, 4-6, 8, 10, 12, 14, 1, 18 positions are all 2'-fluorine modified nucleotides, two consecutive phosphate dibasic nucleotides at the 5' end The ester bonds are both phosphorothioate bonds, and the two continuous phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(6) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, The 9, 10, 13, 15, 17, 19, and 21 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are Phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides , the 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 positions are all 2′-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond, the two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

(7) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9, 10, 13, 15, 17, 19, and 21 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are thiolated Phosphodiester bond connection; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 23rd positions of the siRNA antisense strand are all 2'-OMe modified nucleotides , the 2, 4, 6, 8, 10, 14, 16, 18, and 20 positions are all 2′-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bond, the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(8) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9, 10, The 13th position is a 2'-fluorine modified nucleotide, the 11th position is an LNA modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the siRNA is antisense The 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 positions of the chain are all 2'-OMe modified nucleotides, and the 2, 4, 8, 10, 14 , The 16 and 20 positions are both 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two phosphodiester bonds at the 3' end are both phosphorothioate bond;

(9) Positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2'-fluorine modified nucleosides acid, the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; the 1, 3, 5-7, 9 of the siRNA antisense strand , 11-13, 15, 17-19, 21, 22, 23 are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluoro For the modified nucleotide, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(10) Positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleosides acid, the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the 1, 3, 7, 9, 11 of the siRNA antisense strand , 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2'-fluoro modified Nucleotides, two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds, and two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(11) Positions 1-6, 8, 10-22 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, The 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2'-fluorine modified nucleotides, 5 The two consecutive phosphodiester bonds at the ' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds.
A kind of siRNA, it is characterized in that, described siRNA is obtained through following any modification method:

The siRNA includes a sense strand (sequence: CACAUUUCAUGCACCAGCUCU) and an antisense strand (sequence: AGAGCUGGUGCAUGAAAUGUGGC), the sense strand contains 21 nucleotides, and the antisense strand contains 23 nucleotides;

(1) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9-11, 13, 15, 17, 19, and 21 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the sense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, 10 ,14, 16, 18, 20, and 22 are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end The phosphodiester bonds are all phosphorothioate bonds;

(2) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9-11, 13, 15, 17, 19, and 21 positions are all 2'-fluorine-modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 and 23 positions of the sense strand are all 2'-OMe modified nucleotides, and the 2, 4, 6, 8, The 10, 14, 16, 18, and 20 positions are all 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two consecutive phosphates at the 3' end The diester bonds are all phosphorothioate diester bonds;

(3) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, positions 1, 3, 5, 7, 9-11, The 13th positions are all 2'-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 23 positions are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 positions are all 2'-fluoro For the modified nucleotide, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(4) Positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, The two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; 22, 23 are 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluorine modified nucleotides, two consecutive 5' ends The phosphodiester bonds are both thiophosphodiester bonds, and the two consecutive phosphodiester bonds at the 3' end are both thiophosphodiester bonds;

(5) Positions 1-6, 8, 10-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, and 5 The two consecutive phosphodiester bonds at the ends are both phosphorothioate bonds; the first, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides, the 2, 4-6, 8, 10, 12, 14, 1, 18 positions are all 2'-fluorine modified nucleotides, two consecutive phosphate dibasic nucleotides at the 5' end The ester bonds are both phosphorothioate bonds, and the two continuous phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(6) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, The 9, 10, 13, 15, 17, 19, and 21 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are Phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the siRNA antisense strand are all 2'-OMe modified nucleotides , the 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 positions are all 2′-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate Diester bond, the two consecutive phosphodiester bonds at the 3' end are phosphorothioate bonds;

(7) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are all 2'-OMe-modified nucleotides, and positions 1, 3, 5, 7, The 9, 10, 13, 15, 17, 19, and 21 positions are all 2′-fluorine modified nucleotides, the 11th position is LNA modified nucleotides, and two consecutive phosphodiester bonds at the 5′ end are thiolated Phosphodiester bond connection; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 23rd positions of the siRNA antisense strand are all 2'-OMe modified nucleotides , the 2, 4, 6, 8, 10, 14, 16, 18, and 20 positions are all 2′-fluorine modified nucleotides, and the two consecutive phosphodiester bonds at the 5′ end are phosphorothioate bond, the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(8) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9, 10, The 13th position is a 2'-fluorine modified nucleotide, the 11th position is an LNA modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the siRNA is antisense The 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22 and 23 positions of the chain are all 2'-OMe modified nucleotides, and the 2, 4, 8, 10, 14 , The 16 and 20 positions are both 2'-fluorine modified nucleotides, the two phosphodiester bonds at the 5' end are phosphorothioate bonds, and the two phosphodiester bonds at the 3' end are both phosphorothioate bond;

(9) Positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are both 2'-fluorine modified nucleosides acid, the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds; the 1, 3, 5-7, 9 of the siRNA antisense strand , 11-13, 15, 17-19, 21, 22, 23 are all 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are all 2'-fluoro For the modified nucleotide, the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(10) Positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleosides acid, the 11th position is an LNA-modified nucleotide, and the two consecutive phosphodiester bonds at the 5' end are both phosphorothioate bonds; the 1, 3, 7, 9, 11 of the siRNA antisense strand , 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2'-fluorine modified nucleotides Nucleotides, two consecutive phosphodiester bonds at the 5' end are phosphorothioate bonds, and two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds;

(11) Positions 1-6, 8, 10-22 of the sense strand of the siRNA are all 2'-OMe modified nucleotides, and positions 7 and 9 are all 2'-fluorine modified nucleotides, The 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are all 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are all 2'-fluorine modified nucleotides, 5 The two consecutive phosphodiester bonds at the ' end are both phosphorothioate bonds, and the two consecutive phosphodiester bonds at the 3' end are both phosphorothioate bonds.
A kind of test kit, this test kit comprises the double-stranded siRNA molecule described in claim 1 or the double-stranded siRNA molecule of chemical modification described in any one of claims 2-4,6 or the double-stranded siRNA molecule obtained by the siRNA modification method described in claim 5. stranded siRNA molecule or at least one of the double stranded siRNA molecules.
The double-stranded siRNA molecule of claim 1, the chemically modified double-stranded siRNA molecule of any one of claims 2-4, 6, or the double-stranded siRNA molecule obtained by the method of claim 5, or the double-stranded siRNA molecule of claim 7 The application of the kit in the preparation of medicine; the function of the medicine is as follows (a) or (b) or (c) or (d) or (e):

(a) prevention and/or treatment of immune dysregulated endocrine enteropathy (IPEX) syndrome;

(b) prevention and/or treatment of bowel disease;

(c) prevention and/or treatment of diabetes;

(d) prevention and/or treatment of endocrine gland dysfunction thyroid disease;

(e) preventing and/or treating anemia.