WO2022084389A1

WO2022084389A1 - Modified immune cells

Info

Publication number: WO2022084389A1
Application number: PCT/EP2021/079093
Authority: WO
Inventors: Erica CECCARELLO
Original assignee: Immunoa Pte. Ltd.; Clegg, Richard
Priority date: 2020-10-20
Filing date: 2021-10-20
Publication date: 2022-04-28
Also published as: CN116615207A

Abstract

This invention provides immune cells with tuned migratory and/or effector characteristics and particularly, although not exclusively, to modified T cells for T cell therapies. Antisense oligonucleotides (ASOs) and means for delivering ASOs into cells are also provided.

Description

Modified Immune Cells

Field of the Invention

The present invention relates to immune cells with tuned migratory and/or effector characteristics and particularly, although not exclusively, to modified T cells for T cell therapies. The invention also relates to antisense oligonucleotides (ASOs) and means for delivering ASOs into cells.

Background

Adoptive T cell transfer is a versatile cell therapy modality that has the potential to address critical medical needs from infections and oncology to auto-immune diseases. Through the engineering of effector T cells with specific receptors, in the form of chimeric antigen receptors (CARs) or classical T cell receptors (TCRs), one can direct the lytic action of CD8⁺ T cells against a specific target. As examples, viral-infected host cells presenting viral antigens have been targeted by CAR/TCR-redirected T cells against HIV (Human Immunodeficiency Virus), HBV (Hepatitis B Virus), HCV (Hepatitis C Virus), CMV (Human Cytomegalovirus) or opportunistic fungal infections [1]— [8]. Moreover, cancer cells have been targeted using CAR/TCR specific for antigens expressed on the cell of origin (e.g. CD19 for B cell leukaemia and lymphoma) [9], [10] or targeting specific tumour antigens of self or viral origins [11]— [17].

Modification of specificity of T cells for the use in adoptive transfer (CAR- or TCR-redirected T cells) has revolutionized the therapy of liquid tumours and some infectious diseases. However, several obstacles are still hampering the efficacy of such potent therapy. To unleash the full clinical potential of adoptive T cell therapy beyond liquid tumours, two levels of cell engineering can be exploited - extrinsic and intrinsic. Extrinsic engineering is the provision of heterologous, e.g. synthetic receptors, in CAR/TCR-redirected T cells. In contrast, intrinsic engineering is the modification and/or modulation of T cell endogenous factors, to induce functional features of effector T cells that are most propitious for each clinical application. As an example, for antiviral therapy, the cytolytic activity and inflammatory induction of redirected T cells need to be cautiously calibrated to avert massive lysis of the infected targeted organs, and/or cytokine release syndrome [18], On the other hand, in the context of solid tumours, adoptive CAR/TCR-redirected T cells need to be equipped to bypass inhibitory factors in the tumour microenvironment or to specifically reach the target in specific organs. For this reason, efforts are ongoing to engineer TCR/CAR redirected T cells with improved trafficking, secretion of immune checkpoint inhibitors or stimulatory cytokines [19]-[23], i.e. a combination of extrinsic and intrinsic engineering. The molecular tools employed in the intrinsic engineering of T cells for adoptive transfer include gene knock-in with a lenti/retroviral vector, gene knockout using TALEN or CRISPR/Cas9 technologies, and suppression of gene expression with siRNAs or GAPmers [24]-[27],

The present invention has been devised in light of the above considerations. Summary of the Invention

The inventors consider the ability to modify immune cell function to be required in order to maximise the efficacy of cell based therapies such as Adoptive T cell transfer. They show the use of exogenous spliceswitching antisense oligonucleotides (ASOs) as a tool to transiently modify immune cell function, such as T cell function, and demonstrate the possibility of concurrently introducing ASOs and an exogenous TCR into primary human T cells, without undesirably affecting viability and function of the engineered immune cells. One particularly effective way of doing this involves modifying the chemistry of the ASO. Such chemically modified ASOs, described herein, can be delivered to cells easily and effectively (in a process referred to as “free uptake”), without any special transfection reagents, vectors or electroporation being required. The invention provides such chemically-modified ASOs and free-uptake cell delivery methods. This overcomes a bottleneck in the process of cell engineering and provides a means of engineering cells in a way that can maintain a higher level of cell viability than prior methods.

Moreover, the inventors show that ASOs targeting immune cell specific pre-mRNAs induce the skipping of the targeted exons, as well as the modification (e.g. reduction) of the protein and consequent modification of immune cell function. Good levels of cell viability can be maintained using these methods. Thus, at its broadest, the invention provides an effective way to modify immune cells by modulating the expression of target proteins, e.g. by knocking down functional isoforms of a targeted protein, and/or modulating the splice isoforms that are expressed (reducing or eliminating expression of specific domains encoded by targeted exons). This can be done by simply contacting a target cell with a solution of the chemically-modified ASOs described herein, without transfection reagents or vectors being required.

Thus, in one aspect, this invention provides a method of producing an engineered cell, the method comprising contacting an immune cell with a composition comprising a splice-switching antisense oligonucleotide (ASO) (or more ASOs) which comprises an oligonucleotide backbone having a ribose residue that is covalently bonded at the 2’ oxygen to a chemical moiety (that is not hydrogen), and wherein adjacent ribose residues are linked by a phosphorothioate group. Thus the ASO is delivered into the cell. Preferably, multiple (or all) of the ribose residues are modified in this way, at the 2’ oxygen. The composition is preferably an aqueous composition consisting essentially of the ASO dissolved in a buffer, which may be water or cell culture medium. The buffer may include some salt and/or a pH buffer. No transfection reagents such as lipofectamine or lipofectine are needed, therefore the amount of lipid or detergent in the buffer is zero, or essentially zero; present at trace amounts at most. Electroporative protocols are not required to achieve effective delivery into the target cell. Therefore, the cell may be contacted with the composition in the absence of an applied electric field. Alternatively, the cell may be contacted with the composition in the presence of an applied electric field. This alternative delivery method finds particular utility when a nucleic acid encoding a TCR or chimeric-TCR is delivered simultaneously with the ASO. The method may further comprise freezing the engineered immune cell after it has been treated with the ASO. The method may also comprise thawing the engineered immune cell after it has been frozen. Preferably, the cell is an immune cell that is capable of contributing to an immune response in a subject, e.g. a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell. The cell may be a T cell, e.g. a CAR T cell or an engineered T cell that expresses a heterologous TCR.

Another aspect of this invention is the splice-switching antisense oligonucleotide (ASO) itself. Preferably the ASO used and described herein has a ribose residue that has a 2’ oxygen that is covalently bonded to a non-charged side group of formula C_nH2n+i (alkyl) or C_xH2xOC_yH2y+i (alkyl-ether). Preferably, n is 1 to 6, 1 to 3, or 1 to 2. Preferably, x and y are independently 1 to 4, 1 to 3, or 1 to 2. For instance, the ASO may comprise a ribose residue has a 2’ oxygen that is covalently bonded to a methyl group; and/or a ribose residue that has a 2’ oxygen that is covalently bonded to a methoxyethyl (CH2OC2H5) group. (These modifications of the ribose sugar residues can be expressed as “the ribose is derivatised at the 2’ oxygen” with a non-hydrogen moiety disclosed herein.) One or more of the ribose residues may bear a thymine (T) base, and the T-bearing ribose residues may be covalently bonded at the 2’ oxygen to a methoxyethyl group.

Thus, the invention provides a splice-switching antisense oligonucleotide (ASO) capable of modulating the expression of a target gene in an immune cell, wherein the ASO comprises: one or more ribose residues that have a 2’ oxygen that is covalently bonded to an alkyl group (e.g. methyl), and/or one or more ribose residues that have a 2’ oxygen that is covalently bonded to an alkyl-ether group (e.g. methoxyethyl); wherein adjacent ribose residues are linked by a phosphorohioate group. Preferably, the ASO comprises one or more ribose residues that have a 2’ oxygen that is covalently bonded to an alkyl group and one or more ribose residues that have a 2’ oxygen that is covalently bonded to an alkyl-ether group. Most preferably, the ASO comprises one or more ribose residues that have a 2’ oxygen that is covalently bonded to a methyl group and one or more ribose residues that have a 2’ oxygen that is covalently bonded to a methoxyethyl group. The ASO of the invention can be used in the methods, cells and medical uses/treatments of the other aspects and embodiments of the invention.

The ASO of the invention can modulate expression of PD-1 , IFN-y, Granzyme B, Perforin, PD-L1 , TIM-3, LAG3, ADORA2A, TIGIT, PRDM1 , CD40LG, NDFIP1 , PDCD1 LG2, REL, BTLA, CD80, CD160, CD244, CTLA-4. In preferred embodiments, the ASO modulates the expression of PD-1 , IFN-y, Granzyme B, or Perforin. Where the ASO modulates the expression of PD-1 , it preferably does so by hybridising to exon 3 of the PD-1 transcript within the nucleotide sequence set out in SEQ ID NO:1. Where the ASO specifically modulates IFN-y expression, it preferably does so by hybridising to exon 2 of the IFN-y transcript. Where the ASO specifically modulates Granzyme B expression, it preferably does so by hybridising to exon 3 of the GZMB transcript. Where the ASO specifically modulates Perforin expression, it preferably does so by hybridising to exon 2 of the PRF1 transcript. The ASO may have a sequence as disclosed herein.

In another aspect, this invention provides an engineered cell comprising an ASO according to the invention. In a further aspect, this invention provides an engineered cell produced by the methods disclosed herein. Preferably, the cell is an immune cell, e.g. a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell. In a related aspect, this invention provides an engineered immune cell that is capable of contributing to an immune response in a subject, wherein the immune cell contains one or more exogenous splice-switching antisense oligonucleotides (ASOs) which respectively modulate the expression of one or more genes involved in immune cell suppression, cytotoxicity, cytokine production, growth factor production, autocrine and/or paracrine signalling, antigen presentation, priming and activation, trafficking, infiltration of engineered immune cells. In preferred embodiments, the immune cell contains two or more exogenous ASOs. Moreover, in preferred embodiments, the ASOs do not modulate expression of an antigen receptor or an immunoglobulin expression. Preferably, the immune cell contains two or more ASOs of the invention. The ASOs can be defined as not modulating expression of an antigen receptor or an immunoglobulin. At least one of the ASOs may modulate the expression of PD-1 , IFN-y, Granzyme B, Perforin, PD-L1 , TIM-3, LAG3, ADORA2A, TIGIT, PRDM1 , CD40LG, NDFIP1 , PDCD1 LG2 (PD-L2), REL, BTLA, CD80, CD160, CD244, or CTLA4. Where the cell contains two or more ASOs, these may modulate the expression of two or more genes. The two or more genes may comprise Perforin and Granzyme B. Alternatively, the two or more ASOs may modulate the expression of just one gene. The one gene may be either PD-1 or ADORA2A. The engineered immune cell may be a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell. Preferably, the cell is a T cell, e.g. a CAR T cell or engineered-TCR T cell. The engineered immune cell may be stored in a frozen sample. The engineered immune cell may be thawed from a frozen sample.

The engineered immune cell may contain an ASO that modulates the expression of PD-1. At least 70%, at least 75%, or at least 80% of the PD-1 expressed by the engineered immune cell may therefore lack the region encoded by exon 3 (shown in SEQ ID NO:1), preferably determined at the mRNA level. The cell may be a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell.

The engineered immune cell may contain an ASO that modulates the expression of IFN-y. At least 60%, at least 65%, or at least 70% of the IFN-y lacks the region encoded by exon 2, preferably determined at the mRNA level. The cell may be a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell.

This invention also provides a population of cells, which have been engineered using the methods described herein. As discussed herein, the ASOs of the invention can be delivered to cells very effectively and very easily, with no additional reagents or special transfection conditions being required. By taking this simple approach, typically at least 60% or at least 80% of the engineered immune cells remain viable one day after the delivery of the ASOs of the invention.

In a further aspect, the invention provides the engineered immune cell (or the population of engineered immune cells) for use in a method of treating the human or animal body by therapy. The treatment can be for an autoimmune condition, a cancer and/or an infectious disease. In some embodiments, the subject has, or has had, a Hepatitis B Virus (HBV) infection. In some embodiments, the treatment treats the HBV infection. In some embodiments, the treatment treats an HBV-associated cancer.

The invention includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided. Summary of the Figures

Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:

Figure 1. Shows the lack of upregulation of TLR 3/7/8/9-related pro-inflammatory gene expression in primary human T cells following mock-electroporation or electroporation with a scrambled splice-switching ASO (scrASO). (mock =mock-electroporated. n.s. = not significant.)

Figure 2. Shows the extent of exon skipping of exon 2 of IFNG following 0.15 femtomoles (fmole) spliceswitching ASO per cell (upper plot); 0.25 fmole splice-switching ASO per cell (middle plot); 0.5 fmole splice-switching ASO per cell (lower plot).

Figure 3. PD-L1 expression by THP-1 monocytes cultured with supernatant from redirected T cells that had received a scrambled control (scrASO) or an IFN-y-targeting splice-switching ASO (IFN-y ASO). The monocytes that received the supernatant from IFN-y ASO-treated T cells express PD-L1 at a lower level than the monocytes that received the supernatant from the scrambled control.

Figure 4. Reduction of PRF and GZMB in T cells transfected respectively with PRF and GZMB ASOs. T cell electroporated with GZMB or PRF ASO (and the scrambled control) are rested for 24 hours after transfection, and the production of GZMB or PRF was measured by flow cytometry. There is a reduction of Perforin and Granzyme B in T cells electroporated with the respective ASOs.

Figure 5. Percentage Spliced-ln (PSI) of PDCD1 exon 3 in the mature mRNA after 48h incubation with 2uM of ASOs. PSI was measured several times by Qsep and several times by Taqman PCR following treatment with each ASO (left and right hand bar respectively). The RNA of T cells, after 8 days of in vitro expansion and 2 more days of incubation with the free-uptake ASOs, was collected and retrotranscription was performed. The presence of exon 3 in the mRNA was investigated with two different techniques: qsep fragment length analysis PCR and Taqman PCR. Every dot represents a different biological replicate. 256 is a scrambled non targeting sequence of ASO used as a control.

Figure 6. Relative cell viability of T cells after 48h incubation with 2uM free uptake ASOs. Cell viability was calculated using the CellTiter-Glo assay from Promega and normalized for the untransfected T cells (UT). Every dot represents a biological replicate.

Figure 7. Cell-killing assay of PD-L1 -overexpressing HepG2.2.15 by T cells. T cells, following an 8-days in vitro expansion, were electroporated with HBV-specific TCR mRNA or water (mock EP). Right after electroporation, the T cells were incubated overnight with scrambled antisense oligonucleotide (TCR + Scr), 888.7 or 888MOE ASOs. Then, TCR expression was assessed by flow cytometry and the same number of TCR positive cells were co-cultured with the target cells in the xCELLigence impedance plate. Cell growth of the target cells were monitored with 15’ intervals after the addition of T cells. Figure 8. PD-L1 -expressing THP-1 cells reduce the killing activity of TCR T cells in a 3D device.

However, transfection of PD-1 ASO restore the killing ability. A model of HBV-derived hepatocellular carcinoma was employed for these experiments. In brief, it was a 3D microfluidic device where HBV- expressing targets were seeded. Together with the targets, THP-1 cells overexpressing PD-L1 were seeded in the device, in order to mimic an immunosuppressive microenvironment. In fact, TCR-redirected T cells showed reduced killing activity when PD-L1 expressing targets were added in the device (left). When TCR-redirected T cells that were transfected with PD-1 ASO were added in the system, there was a restoration of the lost killing activity.

Figure 9. Upper panel: Killing activity of T cells in a mouse models of HBV-HCC. When PD-1 ASO was transfected in the T cells, there was higher tumor burden control. Lower panel: Lower membrane-bound PD-1 in TILs of mice treated with TCR T cells transfected with PD-1 ASOs.

Figure 10. Exon skipping and MFI reduction on T cells transfected with ADORA2a ASO. ADORA2a has been recently discovered as an immunosuppressor forT cells. Here we show that we can modulate its expression by skipping exon 2 of its transcript with an ADORA2a ASO. Therefore, by flow cytometry we detect a lower expression of the protein.

Figure 11. Methodology for freeze-thaw experiment. Primary human T cells are prepared in three groups: mock electroporation (control), TCR transfected via electroporation and TCR transfected via electroporation followed by administration of 2 pM of ASO 888.7. Aliquots of each group are frozen for a week prior to subsequent functional assays.

Figure 12. Upper panel: Survival rates of T cells after thawing. Mock electroporation, TCR transfection and TCR transfection with ASO 888.7 cells all show similar survival rates. Lower panel: TCR expression before and after freezing. Similar rates are seen in both TCR and TCR+888.7 cells before and after thawing.

Figure 13. Exon skipping in Armored Redirected T cells (ART) cells before freezing and after thawing. A slight reduction in skipping of PD-1 exon 3 is observed after thawing, but TCR+888.7 cells still exhibit robust exon skipping after thawing.

Figure 14. TNF-a production in ART cells (upon culture with specific targets) before freezing and after thawing. A slight reduction in TNF-a production is seen in both TCR and TCR+888.7 cell groups after thawing.

Figure 15. Methodology of ASO kinetics experiments. Cells were incubated for 24 hours with ASO 888.7 or a control. RNA was collected every 24 hours to assess exon skipping. Figure 16. Exon skipping in T cells incubated with ASO 888.7. Strong exon skipping is observed up to day 3. The effect of ASO 888.7 begins to be reduced on day 4 onward.

Figure 17. Methodology for assessment of ASO toxicity. T cells are incubated with ASO 888.7 for 14 days. Cells are washed and new ASO 888.7 is added when necessary.

Figure 18. Exon skipping upon incubation with ASO 888.7 for 14 days. Exon skipping is observed throughout.

Figure 19. ELISA: Isoform switching in T cells after ASO 888.7 incubation. T cells incubated with ASO 888.7 in the medium show a significant increase in the production of the soluble PD-1 protein.

Figure 20. ELISpot: Isoform switching in T cells after ASO 888.7 incubation. A higher number of T cells producing soluble PD-1 were present in the wells containing T cells treated with ASO 888.7.

Figure 21. T cell activation upon culture with targets and in the presence of ASO 888.7. IFN-y and TNF-a levels were used as functional biomarkers of PD-1 ASO efficacy. Left panel: IFN-y+ T cells are more frequent in the TCR+888.7 fraction. Right panel: TNF-a T cells are more frequent in the TCR+888.7 fraction.

Figure 22. Methodology for assessing reduction of membrane-bound PD-1 upon treatment with 888.7.

Human primary T cells were incubated for 5 days either with or without ASO 888.7. They were then treated with Trypsin for 15 minutes to strip off surface proteins. The cells were incubated with aCD28/CD3 beads overnight to stimulate PD-1 production and Brefeldin A was applied to prevent trafficking to the cell surface. After intracellular staining and washing, the cells were incubated in culture with Brefeldin A for an hour recovery. After a further 4-hour incubation with aCD28/CD3 beads, without Brefeldin A, allowing trafficking to the cell surface, levels of membrane-bound PD-1 were assessed via flow cytometry.

Figure 23. Membrane-bound PD-1 expression upon treatment with 888.7. PD-1 expression is lower in T cells treated with ASO 888.7, as the soluble PD-1 isoform has been trafficked out of the cell. This demonstrates that treatment with ASO 888.7 can effectively reduce membrane-bound PD-1 .

Figure 24. Viability of T cells electroporated with ADORA2a and/or TIM-3 ASOs. Data is normalized to the control scrambled ASO (scrASO). High survival rates are seen in all cells. Figure 25. Upper: Skipping of exon 5 (TIM-3) upon electroporation of ADORA2a and /or TIM-3 ASOs. Strong skipping of exon 5 is observed in T cells treated with TIM3 ASO alone, and in T cells treated with a combination of ADORA2a+TIM3 ASOs. Lower: Skipping of exon 2 (ADORA2a) upon electroporation of ADORA2a and /or TIM-3 ASOs. Skipping of exon 2 is observed in T cells treated with ADORA2a ASO alone, and in T cells treated with a combination of ADORA2a+TIM3 ASOs.

Detailed Description of the Invention

Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference. The Example below illustrates one mode of performing the invention.

This invention uses splice-switching ASOs for the intrinsic modification of T cell functions and to generate what we define Armored Redirected T cells (ART cells). A splice-switching ASO modulates target transcript splicing by denying access of specific RNA binding proteins (RNA-BPs) to their splice- regulatory motifs through steric hindrance. Synthesized as a short single-stranded ribonucleic acid whose bases and backbones may be chemically-modified, the splice-switching ASO is directed to bind complementarily to a pre-mRNA target sequence containing splice donor/acceptor sites, splicing silencers or enhancers motifs [28], [29], The inventors and others have demonstrated the flexibility of ASO application in the suppression of transcript abundance by inducing nonsense-mediated decay (NMD) [30], correction of aberrant and mis-splicing events [31]-[37], and selection of alternate splicing [38]-[41],

The inventors have designed and validated novel ASOs modulating the splicing of four T cell genes, namely Programmed cell Death protein-1 , Interferon-y, Perforin and Granzyme B (PD-1 , IFN-y, PRF and GZMB), for the targeted intrinsic engineering of cytotoxicity and cytokine production of primary human T cells (see Example 1 , below). The inventors demonstrate that splice-switching ASOs can be efficiently transfected into primary human T cells concurrently with a synthetic TOR mRNA to create armoured redirected T cells (ART cells). This paves the way for the deployment of a wider range of splice-switching ASOs for modulating relevant genes to improve cell therapies.

The inventors have designed and validated several splice-switching ASOs of the invention. For instance, PD-1 -targeting modified RNA, which may have the base sequence CTG GGT GAG GGG CTG GGG (SEQ ID NO:2). Each ribose may be modified. However, adenine- guanine-, cytosine-, uridine- and thymine-bearing ribose residues do not necessarily all have the same type of 2’ O-bound modification (the 2’ oxygen of the ribose sugar is covalently bonded to a substituent, which may differ for ribose sugars bearing different bases). Exemplary modified nucleotides are as follows:

/MOErG/ is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methoxyethyl moiety; ZMOErAZ is a ribose sugar molecule attached to adenine base and whose 2’ O is bound to a methoxyethyl moiety;

ZMOErCZ is a ribose sugar molecule attached to cytosine base and whose 2’ O is bound to a methoxyethyl moiety;

ZMOErTZ is a ribose sugar molecule attached to thymine base and whose 2’ O is bound to a methoxyethyl moiety; mA is a ribose sugar molecule attached to adenine base and whose 2’ O is bound to a methyl moiety; mG is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methyl moiety; mC is a ribose sugar molecule attached to cytosine base and whose 2’ O is bound to a methyl moiety; mU is a ribose sugar molecule attached to uracil base and whose 2’ O is bound to a methyl moiety; and

* is a phosphorothioate bond linkage joining consecutive ribose sugars.

The PD-1 -targeting modified RNA ASO of the invention may bind to the region of the PD-1 pre-mRNA shown in SEQ ID NO:1 , below, to produce a splice variant of PD-1 that lacks exon 3:

5’-agagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtggttggtgtcgtggg cggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgag-3’ (SEQ ID NO:1).

The inventors designed and validated the following PD-1 -targeting ASOs of the invention:

“887.5”

5’-mG*/MOErA/*/MOErC/*/MOErA/*/MOErC/*/MOErC/*/MOErA/*/MOErA/*/MOErC/*/MOErC/*/MOErA/* /MOErC/*/MOErC/*/MOErA/*mG*mG*mG*/MOErT/*/MOErT/*/MOErT/*mG*mG/-3’ (SEQ ID NO:5)

This 887.5 molecule has the base sequence GAC ACC AAC CAC CAG GGT TTG G (SEQ ID NO:3). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD-1 that lacks exon 3.

“888.5”

5’-/MOErC/*/MOErT/*mG*mG*mG*/MOErT/*mG*/MOErA/*mG*mG*mG*mG*/MOErC/*/MOErT/*mG*mG* mG*mG-3’ (SEQ ID NO:6)

This 888.5 molecule has the base sequence CTG GGT GAG GGG CTG GGG (SEQ ID NO:2). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD- 1 that lacks exon 3. 888.6’

5’-mC7MOErT/7MOErG/7MOErG/7MOErG/7MOErT/7MOErG/7MOErA/7MOErG/7MOErG/7MOErGZ* ZMOErG/*mC7MOErT/7MOErG/7MOErG/7MOErG/7MOErG/-3’ (SEQ ID NO:7)

This 888.6 molecule has the base sequence CTG GGT GAG GGG CTG GGG (SEQ ID NO:2). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD- 1 that lacks exon 3.

“888.7”

5’-/MOErC/7MOErT/7MOErG/7MOErG/7MOErG/7MOErT/7MOErG/*mA7MOErG/7MOErG/7MOErGZ* /MOErG/7MOErC/7MOErT/7MOErG/7MOErG/7MOErG/7MOErG/-3’ (SEQ ID NO:8)

This 888.7 molecule has the base sequence CTG GGT GAG GGG CTG GGG (SEQ ID NO:2). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD- 1 that lacks exon 3.

“888. MOE”

5’-/MOErC/7MOErT/7MOErG/7MOErG/7MOErG/7MOErT/7MOErG/7MOErA/7MOErG/7MOErGZ* /MOErG/7MOErG/7MOErC/7MOErT/7MOErG/7MOErG/7MOErG/7MOErG/-3’ (SEQ ID NO:9)

This 888. MOE molecule has the base sequence CTG GGT GAG GGG CTG GGG (SEQ ID NO:2). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD-1 that lacks exon 3.

“888.OMMOE”

5’-/MOErC/*mU7MOErG/7MOErG/7MOErG/*mU7MOErG/7MOErA/7MOErG/7MOErG/7MOErGZ*

ZMOErG/7MOErC/*mU7MOErG/7MOErG/7MOErG/7MOErG/-3’ (SEQ ID NO:10)

This 888.OMMOE molecule has the base sequence CUG GGU GAG GGG CUG GGG (SEQ ID NO:4). It targets the part of PD-1 pre-mRNA according to SEQ ID NO:1 , set forth above, to produce a splice variant of PD-1 that lacks exon 3.

The inventors designed and validated the two following ASOs of the invention, targeting ADORA2a and TIM-3:

“ADORA2a ASO (Ome)”

5'-mG*mC*mA*mU*mC*mA*mU*mG*mG*mC*mU*mC*mA*mG*mC*mC*mC*mA*mG*mC*mU*mU*mC *mA‘mG‘mG*mG*mU*mU - 3’ (SEQ ID NO:11)

This ADORA2a ASO (Ome) molecule has the base sequence GCA UCA UGG CUC AGC CCA GCU UCA GGG UU (SEQ ID NO: 13). It targets part of ADORA2a pre-mRNA to produce a splice variant of ADORA2a that lacks exon 2. ‘TIM-3 ASO (MOE)

5'- MOErG/*/MOErG/*/MOErT/*/MOErT/*/MOErG/*/MOErC/*/MOErT/*/MOErC/*/MOErC/*/MOErAZ* /MOErG/*/MOErA/*/MOErG/*/MOErT/*/MOErC/*/MOErC/*/MOErC/*/MOErG/*/MOErT/*/MOErA/*/MOErAZ */MOErG/*/MOErTZ - 3' (SEQ ID NO:12)

This TIM-3 ASO (MOE) molecule has the base sequence GGT TGC TCC AGA GTC CCG TAA (SEQ ID NO: 14). It targets part of TIM-3 pre-mRNA to produce a splice variant of TIM-3 that lacks exon 5.

Thus, the invention provides RNA-based ASOs, in which the backbone comprises modified phosphate linkages between modified ribose sugar residues, and in which thymidine (T) bases may be present instead of uridine (U) bases (despite the fact that the ASO is RNA, not DNA). Preferably the modified phosphate linkage is phosphorohioate and the 2’ oxygen of the ribose residues are bound to a methoxyethyl moiety or a methyl moiety. This ASO chemistry allows the ASO to be delivered to the immune cell by ‘free uptake’, without transfection reagents, vectors or electoporative protocols being needed.

Figure 5 shows the efficacy of the splice-switching approach that can be achieved by these exemplary ASOs of the invention.

Subject of therapy

The subject to be treated may be any animal or human. The subject is preferably mammalian, more preferably human. The subject may be a non-human mammal, but is more preferably human. The subject may be male or female. The subject may be a patient. Therapeutic uses may be in human or animals (veterinary use).

EXAMPLE 1: HBV-specific ART cells

Materials and Methods

All patients gave written informed consent. (Approval: H-17-023E.)

Ficoll-Paque blood separation

Peripheral blood mononuclear cells (PBMCs) from healthy donors were obtained from full blood using Ficoll-Paque (GE Healthcare, Chicago, IL) centrifugation. Ficoll-Paque (10 ml) was placed at the bottom of a 50 ml Falcon tube and blood was slowly layered above. After being centrifuged (600g for 30 minutes at 18°C, no brakes), a layer of PBMCs would be visible and collected for further experiments. T cell activation and expansion from PBMCs

Frozen peripheral blood mononuclear cells (PBMCs) were thawed adding 14 mL of warm Hanks' Balanced Salt solution (HBSS, Thermofisher Scientific, Waltham, MA) in a dropwise manner. After wash (427 RCF, 5 minutes, RT), PBMCs were cultured in AIM-V medium (Thermofisher Scientific, Waltham, MA) supplemented with human AB serum (Sigma Aldrich, St. Louis, MO) at a concentration of 1 .5-2x10⁶ cells/ml. T cells were activated adding 50 ng/mL of anti-CD3 (eBioscience, San Diego, CA) and 600 Id/mL of recombinant human interleukin-2 (rhlL-2, Miltenyi Biotec, Bergisch Gladbach, Germany).

HBV-specific TCR mRNA production

We derived the TCR construct from a pUC57-s183cys b2Aa vector that we had previously made, and sub-cloned it into the pVAX1 vector [42], The plasmid was propagated and purified from E. coli using the One Shot Top10 E. coli kit (ThermoFisher Scientific, Waltham, MA), purified using QIAGEN Endo Free Plasmid MaxiKit (QIAGEN, Hilden, Germany), and linearized using the Xbal restriction enzyme (New England Biolabs, Ipswich, MA). The linearized DNA was used to produce the TCR mRNA using the mMESSAGE mMACHINE T7 Ultra kit (ThermoFisher Scientific, Waltham, MA) following the manufacturer’s instructions.

Splicing-modifying antisense oligonucleotides

Splice-switching ASOs were synthesized by Integrated DNA Technologies (Coralville, IA). The ASOs were resuspended in water at a final concentration of 1 mM or 500 pM and kept frozen at -20 degrees.

Electroporation

The ASOs were added in the electroporation mix together with the T cells (and the TCR mRNA, eventually) in electroporation buffer at the desired concentration. T cells were transfected via electroporation method using the 4DNucleofector™ System (Lonza, Basel, Switzerland). T cells were washed twice with PBS and electroporated using the P3 Primary Cell 4D-Nucleofector® X kit following the manufacturer’s instructions with a customized electroporation program. Electroporated T cells were then resuspended in warm AIM-V medium supplemented with 10% AB serum and 100 U/mL rhlL-2. Usually, 5-10x10⁶ cells were electroporated in each reaction. The TCR mRNA was added at 2 pg/10⁶ T cells; ASOs were added at different concentrations ranging from 0.15 to 0.5 femtomoles/T cell.

Free uptake of splice-switching ASOs

Frozen PBMCs were thawed as previously described and T cells were activated using anti CD3 (50 ng/ml) and rhlL-2 600 U/ml as described above. At day 6 of expansion, T cells were resuspended at a concentration of 2M/ml in fresh AIM-V 2% AB serum plus rhlL-2 600 U/ml. ASOs (resuspended in water) were then added directly in the culture at the desired concentration (ranging from 2 to 10 uM) and the culture was rested for 48 hours. After 48 hours, the T cells were counted, the RNA was extracted in order to measure the skipping of the targeted exon, and functional assays were performed. When an exogenous TCR needed to be transfected in T cells, T cells were expanded for 8 days, electroporated with HBV TCR mRNA (as previously described) and the ASO added in culture (in AIM V 10% AB serum supplemented with rhlL-2 100 U/ml) for about 24 hours after the electroporation reaction.

Cell line culture

HepG2.2.15 were cultured in Dulbecco's Modified Eagle's - Medium (DMEM, Thermofisher Scientific, Waltham, MA) supplemented with 10% v/v heat inactivated FBS (Thermofisher Scientific, Waltham, MA), 2% v/v Penicillin/Streptomycin, 1% v/v MeM non-essential amino acids (ThermoFisher Scientific, Waltham, MA), 1 mM sodium pyruvate (ThermoFisher Scientific, Waltham, MA) and 200 pg/mL Geneticin reagent (ThermoFisher Scientific, Waltham, MA) to select for transgene expressing cells. THP-1 cells are cultured in Roswell Park Memorial Institute Medium (RPMI, Thermofisher Scientific, Waltham, MA) supplemented with 10% v/v heat inactivated FBS and 1% v/v Penicillin/Streptomycin.

Real-time cytotoxicity assay

The cytotoxicity assays were performed using the xCELLigence® RTCA DP (ACEA Biosciences Inc, San Diego, CA) following the manufacturer’s specifications. Briefly, 10⁵ HepG2.2.15 cells/180 pL were seeded in the specific plate and were let adhere for 24 hours. At the time of effector addition, 150 pL of supernatant were removed and replaced with AIM-V 2% AB serum. The acquisition was started at the seeding of the targets and continued for 48 hours after T cells addition; the impedance measurements were acquired every 15 minutes. The Cell Index is a measurement of the impedance measured in each well, and the Normalized Cell Index is obtained by normalizing the Cell Index of each well to the Cell Index at a specific time point (the sweep before T cell addition); the AUC (Area Under the Curve) is obtained using the GraphPad 7 algorithm (San Diego, CA).

Co-culture experiments (PD-L1 detection)

Experiments of co-culture were performed using TCR-redirected T cells specific for S183-191 peptide of HBV envelope. THP-1 cells were resuspended at 2M/ml in medium and s183-191 peptides were added at a concentration of 1 pg/mL, at room temperature; after one hour, the supernatant was removed, and the cells were carefully rinsed twice with warm HBSS. HBV-specific TCR-redirected T cells were co-cultured with the peptide-pulsed targets in AIM-V 2% AB serum for 5 hours at different E:T (effectortarget) ratios. The supernatants of the co-culture were then collected and transferred onto other THP-1 cells for 8 hours. These THP-1 cells were then collected and stained for the presence of PD-L1.

Surface and intracellular staining

After culture, cells were collected and washed once (427 RCF, 3 minutes, 4°C) with PBS in 96-well plated (V-bottomed). Live/Dead staining was performed in PBS for 10 minutes at RT, followed by two washes with cold PBS; MHC-I dextramer staining was performed in Staining Buffer (SB; PBS supplemented with 1% BSA (Sigma Aldrich, St. Louis, MO) and 0.1% sodium azide (Sigma-Aldrich, St. Louis, MO)) at RT for 15 minutes followed by one wash in SB; surface staining is done in SB for 30 minutes on ice, followed by two washes and 20 minutes of fixing and permeabilization using Cytofix/Cytoperm solution (BD, Franklin Lakes, NJ) on ice; finally, intracellular staining is performed in Permwash buffer (PBS supplemented with 1% BSA, 0.1% sodium azide and 0.1% saponin (Sigma-Aldrich, St. Louis, MO)) for 30 minutes on ice. After intracellular staining, the sample was washed twice in Permwash buffer, and resuspended in PBS supplemented with 1% formaldehyde for flow cytometry acquisition. The samples were acquired on LSRII (BD, Franklin Lakes, NJ), and analysed using Kaluza (London, UK) or FlowJo (Ashland, ORE) softwares.

RNA extraction and Polymerase Chain Reaction (PCR)

RNA extraction was performed using RNeasy Plus Micro kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Following extraction, the RNA was quantified using NanoDrop and was retro- transcribed using the cDNA iScript synthesis kit (Biorad, Hercules, CA). Polimerase Chain Reaction (PCR) experiments were performed to assess the effect of ASOs in skipping the target exon. Primers flanking the target exon were designed in order to obtain products of different sizes upon treatment with the specific ASO.

After PCR amplification, the products were run on an agarose gel (2%) and stained with SYBR Safe DNA Gel Stain (ThermoFisher Scientific, Waltham, MA) according to the manufacturer instructions. The gel was then imaged, and the images analysed using ImageJ software (NIH). The Percentage Spliced In was calculated after having analysed the luminosity of the bands in the gel.

Antibody list

CD3 (Biolegend, San Diego, CA), CD274 (BD, Franklin Lakes, NJ), CD8 (BD, Franklin Lakes, NJ), (BD, Franklin Lakes, NJ), Granzyme B (BD, Franklin Lakes, NJ), Perforin (Diaclone, Besangon, France), TNF- a (BD, Franklin Lakes, NJ), IFN-y (ThermoFisher Scientific, Waltham, MA), s183-191 MHC-I dextramer (Immudex, Copenhagen, Denmark), Live/Dead fixable stain kit (Thermofisher Scientific, Waltham, MA).

Results

TCR mRNA and splice-switching ASOs can be concurrently electroporated into T cells with no adverse effect

To test our approach of concurrent extrinsic and intrinsic engineering to modulate specificity and function of primary human T cells respectively, we electroporated in the same reaction an mRNA coding for a cognate-specific TCR and a splice-switching ASO. T cell specificity can be transiently modified by electroporating an mRNA encoding for an exogenous TCR. In this Example, the inventors utilized an mRNA coding for a TCR specific for HBV epitopes restricted by HLA-class I molecule A0201 ; they have previously demonstrated that these mRNA-electroporated T cells transiently expressed HBV-TCR up to 72 hours. The HBV-TCR expressing T cells were observed to lyse HCC cells expressing HBV antigens or inhibit HBV replication both in vitro and in vivo [4], [42], [43], 1 >

To assess the efficiency of splice-switching ASO delivery in primary human T cells, a FAM (fluorescein- tagged ASO with a scrambled non-targeting sequence (scrASO) was co-electroporated with the HBV- TCR mRNA [11], An average of 70% co-transfection efficiency was achieved.

Notably, the concurrent transfection of HBV-TCR mRNA (TCR for short) and scrASO did not impinge on the expected biophysical and biological properties of each other. The kinetics of HBV-TCR transfection and scrASO transfection were not affected. Importantly, viability, TCR protein expression as assessed by MHC multimer staining in flow cytometry, and T cell anti-viral activity as measured in a 2D killing assay were not affected. The concomitant mRNA TCR and scrASO electroporation was efficient not just on activated proliferating T cells but also in resting human primary T cells.

Moreover, introduction of the scrASO did not induce an elevation of TLR-related pro-inflammatory genes usually upregulated in presence of naked nucleic acids (figure 1) [44] up to 72 hours after electroporation.

Generation of ART cells with reduced interferon-y secretion capacity

Interferon-y (IFN-y) is a pro-inflammatory cytokine secreted mainly by Th1-type T cells. Besides playing roles in anti-viral function [45], IFN-y can promote activation-induced cell death (AICD) of T cells [46] and is the main inducer of both PD-L1 and PD-L2 expression [47], and thus participates in inducing an immunosuppressive environment [48], [49], Exon 2 of IFNG codes for part of the “interferon-y domain” (the specific cytokine domain), and we hypothesized that its exclusion will result in the expression of a shortened IFN-y protein with attenuated cytokine function. The inventors designed and synthesized a splice-switching ASO to induce specific IFN-y exon 2 skipping (figure 2a) and transfected via electroporation on activated primary human T cells, at three different concentrations. Figure 2b shows the temporal exon skipping efficiencies after transfection: exon 2 was skipped as early as 6 hours after electroporation, and the level of exon skipping, as well as the duration of the effect, are dose-dependent (as the skipping reduced faster at with lower doses of splice-switching ASOs).

At all the tested IFN-y ASO concentrations, cell viability and TCR expression in primary human activated T cells were not affected, while inducing skipping of exon 2 (figure 2c) 24 hours after transfection (0.25 femtomoles/T cell). Similarly, viability and TCR expression are not affected by the splice-switching ASO transfection in resting TCR-redirected T cells in the presence of IFNG exon 2 exclusion.

The inventors then tested via flow cytometry whether the alteration induced by IFN-y splice-switching ASO would lead to a reduction of IFN-y 24 hours after transfection with 0.25 femtomoles/cell (figure 2d). The inventors went on to assess the ability of the T cells supernatant to induce PD-L1 expression in a monocytic cell-line (THP-1) [50], IFN-y ART cells induced monocytes to produce up to 40% less PD-L1 protein when cultured with supernatants from activated IFN-y ART cells, compared to monocytes cultured with supernatants from activated redirected T cells that had received the scrambled control, scrASO (figure 3), demonstrating a functional difference between the splice-switching ASO and the scrASO control.

Generation of ART cells with reduced cytotoxic activity: Perforin and Granzyme B To further test the ability of ASOs to modulate essential T cell functions, the inventors designed ASOs to suppress the expressions of Perforin (PRF) and Granzyme B (GZMB). For the former, the PRF ASO induces the skipping of exon 2b where the translation start codon resides, whereas the GZMB ASO induces exon 3 skipping that generates a frameshifted transcript. In both cases, no protein product is expected from the respective resultant transcripts. The exon skipping efficiency of each splice-switching ASO was quantified 24 hours after electroporation as PSI, as shown in figure 4. Intracellular cytokine staining (ICS) of PRF and GZMB ART cells shows a reduction of the respective proteins. Again, neither the PRF-targeting nor the GZMB-targeting ASOs affected T cell viability nor TCR expression levels compared to the controls. These splice-switching ASOs did inhibit cytolytic capacity (as shown in figure 4) in T cells co-transfected with both splice-switching ASOs. Importantly, modulation of T cells function with ASOs was not demonstrated only on T cells of healthy individuals but on T cells of patients with inherent pathology (i.e. chronic Hepatitis B virus infection).

ART cells can be frozen and thawed, maintaining ASO viability

Most modified immune cells are manufactured and then frozen in large batches for better storing and shipping. When injection in the patient is due, the cells are then thawed and administered[57]. To ensure ART cells maintain their function after freezing and thawing, the inventors prepared primary human T cells in three groups: mock electroporation (control), TOR transfected via electroporation and TOR transfected via electroporation followed by administration of 2 pM of ASO 888.7 (figure 11). After 16 hours in culture, a portion of all three cell groups was frozen. 3 samples were frozen in foetal bovine serum with 10% DMSO and 4 samples were frozen in Cryostor®. After a week the cells were thawed, and their function was assessed.

Survival rate, exogenous TCR expression, cytokine production and exon skipping was assessed in all cells. Figure 12 (upper panel) shows there was little difference in the survival rates of the three cell groups after thawing.

TCR expression was maintained after thawing in both groups transfected with TCR (figure 12, lower panel). Strong exon skipping was maintained in ART cells treated with both TCR and ASO 888.7 (figure 13). The cells stored in Cryostor® displayed better retention of 888.7 exon skipping as well as activation upon culture with targets.

A small reduction in TNF-a production was observed post thawing in both TCR+888.7 and TCR control cells (figure 14). Therefore, ART cells maintain their functions post thawing in line with TCR electroporated T cells.

ASO kinetics drop off after day 3

To investigate the longevity of the exon skipping effect, the inventors measured exon skipping every 24 hours for 5 days following a 24-hour incubation with ASO 888.7 or a control (figure 15). Strong exon skipping was observed up until day 3 (figure 16). After this point, inclusion of exon 3 began to rise. This window gives sufficient time for the modified immune cells to have a therapeutic effect, without causing long-lasting toxicity. PD-1 deficiency is known to be involved in autoimmune diseases, and so long-term knock-down of PD-1 is not desirable [58],

The inventors also investigated whether T cells are affected by long incubation with ASOs. T cells were incubated with ASO 888.7 for 14 days, with washes and medium changes occurring when required (figure 17). High survival rates were observed, alongside strong exon skipping, confirming that the ASOs were not toxic to the T cells (figure 18).

ART cells show PD-1 isoform switching

PD-1 is a T cell surface protein commonly referred to as an ‘immune checkpoint’ which is involved in preventing autoimmunity and self-reactivity. It is a target for cancer therapies as downregulating PD-1 has been shown to increase T-cell mediated killing of cancer cells [59], The inventors investigated the ability of ASOs to induce exon skipping in PD-1 pre-mRNA, resulting in an isoform switch from the membrane bound to the soluble isoform. This soluble isoform is removed from cells by exocytosis, and therefore exon skipping is an effective strategy to downregulate PD-1 from the T cell membrane.

The supernatant of ART cells that had been incubated with ASO 888.7 for 24 hours was collected and assayed using a commercial ELISA kit. Figure 19 shows that ASO 888.7 treated T cells showed an increase in soluble PD-1 production as compared to the control. Isoform switching was also assessed via ELISpot. T cells were cultured as before and placed into an ELISpot plate. A portion of the T cells were stimulated with anti-CD3/28 beads. Figure 20 shows that there were a higher number of T cells producing soluble PD-1 in the wells containing T cells treated for 24 hours with ASO 888.7 for both the stimulated and non-stimulated fractions.

T cell activation upon cultures with targets and in the presence of ASOs

The inventors investigated the effect of culturing T cells directly with targets. Human primary T cells were electroporated with an mRNA coding for an HBV-specific TOR then incubated for 24 hours both with and without ASO 888.7. They were then cultured for 24 hours with HVB-expressing targets before T cell activation was measured using intracellular cytokine staining for IFN-y or TNF-a. A higher proportion of T cells that had been incubated with ASO 888.7 were producing these cytokines, indicating a higher level of T cell activation (Figure 21).

PD-1 isoform switching, assessed by flow cytometry

The inventors assessed the ability of ASOs to induce PD-1 isoform switching via flow cytometry. This methodology is shown in Figure 22. Human primary T cells were incubated for 5 days either with or without ASO 888.7. During this time, the trafficking of vesicles to the surface was blocked before the T cells were incubated with aCD28/CD3 beads to stimulate the cells. Isoform switching was then evaluated using flow cytometry. A reduction in PD-1 was seen in the cells that had been incubated with ASO 888.7, as the soluble PD-1 is trafficked out of the cell (figure 23). Generation of ART cells with multiple ASOs

To investigate the possibility of generating ART cells with multiple targets, the inventors electroporated primary human T cells with the following conditions: scramble ASO (control), ADORA2a ASO, TIM-3 ASO, ADORA2a and TIM-3 ASO in the same electroporation reaction. After 24 hours T cells were counted and RNA was extracted to measure the effect at the molecular levels of the ASOs. Figure 24 shows that no significant mortality was detected with electroporation of both ASOs. With both targets, the combined ASO ART cells show the same level of exon skipping as the ART cells electroporated with a single ASO forthat target, indicating that multiple ASOs can be used together (figure 25).

Discussion

To engineer Armored Redirected T cells (ART) cells with specific function and specificity, the inventors used fully chemically-modified splicing-modulating ASOs instead of siRNA, GAPmer, shRNA and CRISPR/Cas9-approaches. The advantages of splicing-modulating ASOs include (i) superior selectivity and stability, (ii) multi-modality, (iii) limited immunogenicity, and (iv) clinical compatibility due to their transient nature and their success in clinic [36], [37], [51], [52], This versatility enables splicing-modulating ASOs to be used in other cell types also used in adoptive transfer (such as NK cells or dendritic cells) to further ameliorate cell-based therapeutic approaches. The manipulation ex vivo of cells used for adoptive cell transfer is relatively straightforward. In fact, high numbers of PBMCs can be easily obtained via phlebotomy and they can be expanded in vitro for several days before re-infusion into the patient. During the expansion phase, concurrent modifications can be implemented for intrinsic or extrinsic engineering of these cells: from redirection, to the boosting of their function using cytokines or other drugs [53], [54],

The advantage of the co-transfection approach disclosed herein is evident when considering its practicality in a clinical setting, where substantial and subsequent manipulations of the samples could lead to higher risk of contamination and/or loss of the sample itself. The choice of transfection (over transduction) offers an advantage in regard to safety. Transient redirection is safer for the patient, as the specificity receptor is lost within few days, with lower risk of collateral effects [8], After the exogenous specificity receptor is lost, T cells still maintain their natural receptor; therefore, any stable functional modification induced would alter indefinitely their function against the natural targets. Another advantage of a splice-switching ASO lies in its non-catalytic action, which does not require a functional RNAi machinery or RNase H activity, unlike siRNA and GAPmer, respectively [40], Given patient variability, potential deregulation of the two endogenous cellular factors in exhausted primary T cells and cytotoxicity effects from dose-induced saturation of these factors [55], [56], anticipating the efficacy and the toxicity of both siRNA and GAPmer is not straightforward.

The results discussed herein show that splice-switching ASO-mediated intrinsic engineering of primary human T cells from healthy donors does not impinge on the ART cells viability and TOR expression, nor on the T cell antiviral or cytotoxic functions mediated by extrinsic engineering. On the other hand, the inventors were able to modify immune-modulatory and cytotoxic functions of ART cells targeting IFN-y, PRF and GZMB production singly and in combination, and in conjunction with extrinsic engineering. Thus, this disclosure demonstrates that targeted intrinsic engineering of immune cells for adoptive immunotherapy is possible with splice-switching oligonucleotides, paving the way for clinical applications of this technology.

The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.

While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.

Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Throughout this specification, including the claims which follow, unless the context requires otherwise, the word “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example +/- 10%.

References

A number of publications are cited above in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Full citations for these references are provided below. The entirety of each of these references is incorporated by reference herein. [1] Anthony-gonda K, A Bardhi, A Ray, N Flerin.M Li, W Chen, C Ochsenbauer, JC Kappes, W Krueger et al. (2019). Multi-specific anti-HIV duoCAR-T cells display broad antiviral activity and potent elimination of HIV-infected cells in vivo. Sci Transl Med 11 (504).

[2] Krebs K, N Bbttinger, LR Huang, M Chmielewski, S Arzberger, G Gasteiger, C Jager, E Schmitt, F Bohne et al. (2013). T Cells Expressing a Chimeric Antigen Receptor That Binds Hepatitis B Virus Envelope Proteins Control Virus Replication in Mice. Gastroenterology 145(2):456-465.

[3] Sautto GA, K Wisskirchen, N Clementi, M Castelli, RA Diotti, J Graf, M Clementi, R Burioni, U Protzer, and N Mancini. (2016). Chimeric antigen receptor (CAR)-engineered T cells redirected against hepatitis C virus (HCV) E2 glycoprotein. Gut 65(3):512-523.

[4] Kah J, S Koh, T Volz, E Ceccarello, L Allweiss, M Lutgehetmann, A Bertoletti, and M Dandri. (2017). Lymphocytes transiently expressing virus-specific T cell receptors reduce hepatitis B virus infection. J Clin Invest 127(8):3177-3188.

[5] Proff J, CU Brey, A Ensser, W Holter, and M Lehner. (2018) Turning the tables on cytomegalovirus: Targeting viral Fc receptors by CARs containing mutated CH2-CH3 IgG spacer domains. J Transl Med 16(26):1— 12.

[6] Kumaresan PR, PR Manuri, ND Albert, S Maiti, H Singh, T Mi, J Roszik, B Rabinovich, S Olivares, et al. (2014). Bioengineering T cells to target carbohydrate to treat opportunistic fungal infection. Proc Natl Acad Sci USA 111 (29):10660-10665.

[7] Varela-Rohena A, PE Molloy, SM Dunn, Y Li, MM Suhoski, RG Carroll, A Milicic, T Mahon, DH Sutton, et al. (2008). Control of HIV-1 immune escape by CD8 T cells expressing enhanced T-cell receptor. Nat Med 14(12): 1390— 1395.

[8] Bertoletti A and AT Tan. (2020). Challenges of CAR- And TCR-T cell-based therapy for chronic infections. J Exp Med 217(5):4-6.

[9] Friedman KM, TE Garrett, JW Evans, HM Horton, HJ Latimer, SL Seidel, CJ Horvath, and RA Morgan. (2018). Effective Targeting of Multiple B-Cell Maturation Antigen-Expressing Hematological Malignances by Anti-B-Cell Maturation Antigen Chimeric Antigen Receptor T Cells. Hum Gene Ther 29(5):585-601.

[10] Maude SL, TW Laetsch, J Buechner, S Rives, M Boyer, H Bittencourt, P Bader, MR Verneris, HE Stefanski, et al. (2018). Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med 378:439-448.

[11] Tan AT, N Yang, TL Krishnamoorthy, V Oei, A Chua, Z Xinyuan, TH Si, A Chia, N Le Bert, et al. (2019). Use of Expression Profiles of HBV-DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology 156(6): 1 —15.

[12] Draper LM, MLM Kwong, A Gros, S Stevanovic, E Tran, S Kerkar, M Raffeld, SA Rosenberg, and CS Hinrichs. (2015). Targeting of HPV-16+epithelial cancer cells by TCR gene engineered T cells directed against E6. Clin Cancer Res 21 (19):4431-4439.

[13] Kato D, T Yaguchi, T Iwata, Y Katoh, K Morii, K Tsubota, Y Takise, M Tamiya, H Kamada et al. (2020). GPC1 specific CAR-T cells eradicate established solid tumor without adverse effects and synergize with anti-PD-1 ab. Elife 9:1-20. [14] Brown CE, D Alizadeh, R Starr, L Weng, JR Wagner, A Naranjo, JR Ostberg, MS Blanchard, J Kilpatrick, et al. (2016). Regression of Glioblastoma after Chimeric Antigen Receptor T-Cell Therapy. N Engl J Med 375(26):2561-2569.

[15] Schuberth PC, C Hagedorn, SM Jensen, P Gulati, M van den Broek, A Mischo, A Soltermann, A Jlingel, O Marroquin Belaunzaran, et al. (2013). Treatment of malignant pleural mesothelioma by fibroblast activation protein-specific re-directed T cells. J Transl Med 11 (1):1— 11.

[16] Majzne RG, JL Theruvath, A Nellan, S Heitzeneder, Y Cui, CW Mount, SP Rietberg, MH Linde, P Xu, et al. (2019). CAR T cells targeting B7-H3, a pan-cancer antigen, demonstrate potent preclinical activity against pediatric solid tumors and brain tumors. Clin Cancer Res 25(8):2560-2574.

[17] Morgan RA, N Chinnasamy, D Abate-Daga, A Gros, PF Robbins, Z Zheng, ME Dudley, SA Feldman, JC Yang, et al. (2013). Cancer regression and neurological toxicity following anti-MAGE-A3 TCR gene therapy. J Immunother 36(2): 133— 151 .

[18] Roth E and H Pircher. (2004). IFN- Promotes Fas Ligand- and Perforin-Mediated Liver Cell Destruction by Cytotoxic CD8 T Cells. J Immunol 172(3):1588-1594.

[19] Rafiq S, GO Yeku, HJ Jackson, TJ Purdon, DG van Leeuwen, DJ Drakes, M Song, MM Miele, Z Li, et al. (2018). Targeted delivery of a PD-1-blocking scFv by CAR-T cells enhances anti-tumor efficacy in vivo. Nat Biotechnol 36(9):847-856.

[20] Hu B, J Ren, Y Luo, B Keith, RM Young, J Scholler, Y Zhao, and CH June. (2017). Augmentation of Antitumor Immunity by Human and Mouse CAR T Cells Secreting IL-18. Cell Rep 20(13):3025-3033.

[21] Pegram HJ, JC Lee, EG Hayman, GH Imperato, TF Tedder, M Sadelain, and RJ Brentjens.

(2012). “Tumor-targeted T cells modified to secrete IL-12 eradicate systemic tumors without need for prior conditioning. Blood 119(18):4133— 4141 .

[22] Ligtenberg MA, Y Pico de Coana, T Shmushkovich, Y Yoshimoto, I Truxova, Y Yang, M Betancur-Boissel, AV Eliseev, AD Wolfson, and R Kiessling. (2018). Self-Delivering RNAi Targeting PD-1 Improves Tumor-Specific T Cell Functionality for Adoptive Cell Therapy of Malignant Melanoma. Mol Ther 26(6):1482-1493.

[23] Newick K, S O'Brien, J Sun, V Kapoor, S Maceyko, A Lo, E Pure, E Moon, and SM Albelda. (2016). Augmentation of CAR T-cell trafficking and antitumor efficacy by blocking protein kinase a localization. Cancer Immunol Res 4(6):541-551 .

[24] Qasim W, H Zhan, S Samarasinghe, S Adams, P Amrolia, S Stafford, K Butler, C Rivat, G Wright, et al. (2017). Molecular remission of infant B-ALL after infusion of universal TALEN gene-edited CAR T cells. Sci Transl Med 9(374):eaaj2013.

[25] Stadtmauer EA, JA Fraietta, MM Davis, AD Cohen, KL Weber, E Lancaster, PA Mangan, I Kulikovskaya, M Gupta, et al. (2020). CRISPR-engineered T cells in patients with refractory cancer. Science 367(6481):1-20.

[26] Zou F, L Lu, J Liu, B Xia, W Zhang, Q Hu, W Liu, Y Zhang, Y Lin, et al. (2019). Engineered triple inhibitory receptor resistance improves anti-tumor CAR-T cell performance via CD56. Nat Commun 10(1):1— 14.

[27] Zhao L, Y Liu, F Zhao, Y Jin, J Feng, R Geng, J Sun, L Kang, L Yu, and Y Wei. (2020). Inhibition of Cholesterol Esterification Enzyme Enhances the Potency of Human Chimeric Antigen Receptor T Cells against Pancreatic Carcinoma. Mol Ther-Oncolytics 16(23):262-271 . [28] Watanabe N, T Nagata, Y Satou, S Masuda, T Saito, H Kitagawa, H Komaki, K Takagaki, and S Takeda. (2018). NS-065/NCNP-01 : An Antisense Oligonucleotide for Potential Treatment of Exon 53 Skipping in Duchenne Muscular Dystrophy. Mol Ther-Nucleic Acids 13(December):442-449.

[29] Rigo F, Y Hua, SJ Chun, TP Prakash, AR Krainer, and CF Bennett. (2016). Synthetic Oligonucleotides Recruit ILF2/3 to RNA Transcripts to Modulate Splicing. Nat Chem Biol 8(6):555-561 .

[30] Lin J, JHJ Lee, K Paramasivam, E Pathak, Z Wang, ZAD Pramono, B Lim, KB Wee, and U Surana. (2017). Induced-Decay of Glycine Decarboxylase Transcripts as an Anticancer Therapeutic Strategy for Non-Small-Cell Lung Carcinoma. Mol Ther-Nucleic Acids 9(December):263-273.

[31] Georgilis A, S Klotz, CJ Hanley, N Herranz, B Weirich, B Morancho, AC Leote, L D'Artista, S Gallage, et al. (2018). PTBP1 -Mediated Alternative Splicing Regulates the Inflammatory Secretome and the Pro-tumorigenic Effects of Senescent Cells. Cancer Cell 34(1):85-102.

[32] Koh CM, M Bezzi, DHP Low, WX Ang, SX Teo, FPH Gay, M Al-Haddawi, SY Tan, M Osato, et al. (2015). MYC regulates the core pre-mRNA splicing machinery as an essential step in lymphomagenesis. Nature 523(7558):96-100.

[33] Pao PW, KB Wee, WC Yee, and ZAD Pramono. (2014). Dual masking of specific negative splicing regulatory elements resulted in maximal exon 7 inclusion of SMN2 gene. Mol Ther 22(4):854- 861.

[34] Pramono ZAD, KB Wee, JL Wang, YJ Chen, QB Xiong, PS Lai, and WC Yee. (2012). A Prospective Study in the Rational Design of Efficient Antisense Oligonucleotides for Exon Skipping in the DMD Gene. Hum Gene Ther 23(7):781-790, 2012.

[35] Wee KB, ZAD Pramono, JL Wang, KF MacDorman, PS Lai, and WC Yee. (2008). Dynamics of co-transcriptional pre-mRNA folding influences the induction of dystrophin exon skipping by antisense oligonucleotides. PLoS One 3(3):e1844.

[36] Mercuri E, BT Darras, CA Chiriboga, JW Day, C Campbell, AM Connolly, ST lannaccone, J Kirschner, NL Kuntz, et al. (2018). Nusinersen versus sham control in later-onset spinal muscular atrophy. N Engl J Med 378(7):625-635.

[37] Kim J, C Hu, C Moufawad El Achkar, LE Black, J Douville, A Larson, MK Pendergast, SF Goldkind, EA Lee, et al. (2019). Patient-customized oligonucleotide therapy for a rare genetic disease. N Engl J Med 381 (17):1644-1652, 2019.

[38] Zhou Y, C Han, E Wang, AH Lorch, V Serafin, BK Cho, BT Guttierrez Diaz, J Calvo, C Fang, et al. (2020). Posttranslational regulation of the exon skipping machinery controls aberrant splicing in leukemia”. Cancer Discov CD-19-1436.

[39] Tabaglio T, DHP Low, WKL Teo, PA Goy, P Cywoniuk, H Wollmann, J Ho, D Tan, J Aw, et al. (2018). MBNL1 alternative splicing isoforms play opposing roles in cancer. Life Sci Alliance 1 (5):1— 14.

[40] Do DV, B Strauss, E Cukuroglu, I Macaulay, KB Wee, TX Hu, I Ruiz De Los Mozos, C Lee, A Harrison, et al. (2018). SRSF3 maintains transcriptome integrity in oocytes by regulation of alternative splicing and transposable elements. Cell Discov 4(1).

[41] Toh CXD, JW Chan, ZS Chong, HF Wang, HC Guo, S Satapathy, D Ma, GYL Goh, E Khattar, et al. (2016). RNAi Reveals Phase-Specific Global Regulators of Human Somatic Cell Reprogramming. Cell Rep 15(12):2597-2607. [42] Koh S, N Shimasaki, R Suwanarusk, ZZ Ho, A Chia, N Banu, SW Howland, ASM Ong, AJ Gehring, et al. (2013). A practical approach to immunotherapy of hepatocellular carcinoma using T cells redirected against hepatitis B virus. Mol Ther Nucleic Acids 2(August):e114.

[43] Koh S, J Kah, CYL Tham, N Yang, E Ceccarello, A Chia, M Chen, A Khakpoor, A Pavesi, et al. (2018). Nonlytic Lymphocytes Engineered to Express Virus-Specific T-Cell Receptors Limit HBV Infection by Activating APOBEC3. Gastroenterology 155(1 ): 180-193.

[44] Mann CJ, XM Anguela, J Montane, M Obach, C Roca, A Ruzo, P Otaegui, LM Mir, and F Bosch. (2012). Molecular signature of the immune and tissue response to non-coding plasmid DNA in skeletal muscle after electrotransfer. Gene Ther 19(12):1177-1186.

[45] Schroder K, P Hertzog, T Ravasi, and DA Hume. (2004). Interferon gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75(February):163-189.

[46] Refaeli Y, L Van Parijs, SI Alexander, and AK Abbas. (2002). Interferon y is required for activation-induced death of T lymphocytes. J Exp Med 196(7):999-1005.

[47] Garcia-Diaz A, DS Shin, B Hornet Moreno, J Saco, H Escuin-Ordinas, G Abril-Rodriguez, JM Zaretsky, L Sun, W Hugo, et al. (2017). Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 Expression. Cell Rep 19(6):1189-1201 .

[48] Kruger S, M llmer, S Kobold, BL Cadilha, S Endres, S Ormanns, G Schuebbe, BW Renz, JG D'Haese, et al. (2019). Advances in cancer immunotherapy 2019 - Latest trends. J Exp Clin Cancer Res 38(1):1— 11 .

[49] Lee SWL, G Adriani, E Ceccarello, A Pavesi, AT Tan, A Bertoletti, RD Kamm, and SC Wong. (2018). Characterizing the role of monocytes in T cell cancer immunotherapy using a 3D microfluidic model. Front Immunol vol. 9(416).

[50] Ni L and J Lu. (2018). Interferon gamma in cancer immunotherapy. Cancer Med 7(9):4509-4516.

[51] Aartsma-Rus A, AAM Janson, WE Kaman, M Bremmer-Bout, GJB Van Ommen, JT den Dunnen, and JCT van Deutekom. (2004). Antisense-Induced Multiexon Skipping for Duchenne Muscular Dystrophy Makes More Sense. Am J Hum Genet 74(1):83-92.

[52] Bauman J, N Jearawiriyapaisarn, and R Kole. (2009). Therapeutic potential of splice-switching oligonucleotides. Oligonucleotides 19(1):1— 13.

[53] Barrero MJ. (2017). Epigenetic Strategies to Boost Cancer Immunotherapies. Int J Mol Sci 18(6):1108.

[54] Roberti MP, MM Barrio, Al Bravo, YS Rocca, JM Arriaga, M Bianchini, J Mordoh, and EM Levy. (2011). IL-15 and IL-2 increase Cetuximab-mediated cellular cytotoxicity against triple negative breast cancer cell lines expressing EGFR. Breast Cancer Res Treat 130:465-475.

[55] Grimm D, L Wang, JS Lee, N Schurmann, S Gu, K Borner, TA Storm, and MA Kay. (2010). Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver. J Clin Invest 120(9): 3106-3119.

[56] Grimm D. (2011). The dose can make the poison: Lessons learned from adverse in vivo toxicities caused by RNAi overexpression. Silence 2(1):8.

[57] Baboo, J., Kilbride, P., Delahaye, M., Milne, S., Fonseca, F., & Blanco, M. et al. (2019). The Impact of Varying Cooling and Thawing Rates on the Quality of Cryopreserved Human Peripheral Blood T Cells. Scientific Reports, 9(1). [58] Francisco, L., Sage, P., & Sharpe, A. (2010). The PD-1 pathway in tolerance and autoimmunity. Immunological Reviews, 236(1): 219-242.

[59] Driessens, G., Kline, J., & Gajewski, T. (2009). Costimulatory and coinhibitory receptors in antitumor immunity. Immunological Reviews, 229(1): 126-144.

For standard molecular biology techniques, see Sambrook, J., Russel, D.W. Molecular Cloning, A Laboratory Manual. 3 ed. 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press

Claims

25 Claims:

1 . A method of producing an engineered immune cell that is capable of contributing to an immune response in a subject, the method comprising contacting an immune cell with a composition comprising a splice-switching antisense oligonucleotide (ASO), wherein the ASO backbone comprises multiple ribose residues that are covalently bonded at the 2’ oxygen to chemical moieties that are not hydrogen, wherein adjacent ribose residues are linked by a phosphorothioate group, and wherein the composition is an aqueous composition consisting essentially of the ASO dissolved in a buffer.

2. The method according to claim 1 , wherein the cell is contacted with the ASO in the absence of an applied electric field.

3. The method according to claim 1 , wherein the ASO is introduced into the cell by electroporation, by contacting the cell with the ASO in the presence of an applied electric field.

4. The method according to any one of the preceding claims, wherein the ASO comprises a ribose residue that has a 2’ oxygen that is covalently bonded to a methoxyethyl group.

5. The method according to any one of the preceding claims, wherein the ASO comprises a ribose residue has a 2’ oxygen that is covalently bonded to a methyl group.

6. The method according to any one of the preceding claims, wherein one or more of the ribose residues bears a thymine (T) base.

7. The method according to claim 6, wherein the one or more T-bearing ribose residues are covalently bonded at the 2’ oxygen with a methoxyethyl group.

8. The method according to any one of the preceding claims, further comprising freezing the engineered immune cell after it has been treated with the ASO.

9. The method according to claim 8, further comprising thawing the engineered immune cell after it has been frozen.

10. A splice-switching antisense oligonucleotide (ASO) capable of modulating the expression of a target gene in an immune cell, wherein the ASO comprises: one or more ribose residues that have a 2’ oxygen that is covalently bonded to a methyl group, and/or one or more ribose residues that have a 2’ oxygen that is covalently bonded to a methoxyethyl group; wherein adjacent ribose residues are linked by a phosphorohioate group.

11 . The ASO according to claim 10, or the method according to any one of claims 1 -7, wherein the ASO can modulate the expression of a gene selected from the following list: PD-1 , IFN-y, Granzyme B, Perforin, PD-L1 , TIM-3, LAG3, ADORA2A, TIGIT, PRDM1 , CD40LG, NDFIP1 , PDCD1 LG2, REL, BTLA, CD80, CD160, CD244, CTLA4.

12. The ASO or the method according to claim 11 , wherein the ASO modulates the expression of IFN-y, Granzyme B, or Perforin.

13. The ASO or the method according to claim 12, wherein the ASO specifically modulates IFN-y expression by hybridising to exon 2 of the IFN-y transcript, wherein the ASO specifically modulates Granzyme B expression by hybridising to exon 3 of the GZMB transcript, and/or wherein the ASO specifically modulates perforin expression by hybridising to exon 2 of the PRF1 transcript.

14. The ASO according to any one of claims 10-13, wherein the, wherein one or more of the ribose residues bears a thymine (T) base.

15. The ASO according to claim 14, wherein the T-bearing ribose residues are covalently bonded at the 2’ oxygen with a methoxyethyl group.

16. The ASO or the method according to claim 11 , or the ASO according to claim 14 or 15, wherein the ASO modulates the expression of PD-1 .

17. The ASO or the method according to claim 16, wherein the ASO specifically hybridises to exon 3 of the PD-1 transcript within the nucleotide sequence set out in SEQ ID NO:1.

18. The ASO or the method according to claim 17, wherein the base sequence comprises CTG GGT GAG GGG CTG GGG (SEQ ID NO:2).

19. The ASO or the method according to claim 18, wherein the ASO comprises the sequence:

5’-/MOErC/*/MOErT/*mG*mG*mG*/MOErT/*mG*/MOErA/*mG*mG*mG*mG*/MOErC/*/MOErT/* mG*mG*mG*mG-3’; or

5’-mC*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErT/*/MOErG/*/MOErA/*/MOErG/*/MOErG/* /MOErG/*/MOErG/*mC*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErG/-3’; or

5’-/MOErC/*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErT/*/MOErG/*mA*/MOErG/*/MOErG/* /MOErG/*/MOErG/*/MOErC/*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErG/-3’; or

5’-/MOErC/*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErT/*/MOErG/*/MOErA/*/MOErG/* /MOErG/*/MOErG/*/MOErG/*/MOErC/*/MOErT/*/MOErG/*/MOErG/*/MOErG/*/MOErG/-3’, wherein /MOErG/ is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methoxyethyl moiety;

/MOErA/ is a ribose sugar molecule attached to adenine base and whose 2’ O is bound to a methoxyethyl moiety;

/MOErC/ is a ribose sugar molecule attached to cytosine base and whose 2’ O is bound to a methoxyethyl moiety;

/MOErT/ is a ribose sugar molecule attached to thymine base and whose 2’ O is bound to a methoxyethyl moiety; mG is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methyl moiety; mC is a ribose sugar molecule attached to cytosine base and whose 2’ O is bound to a methyl moiety; mA is a ribose sugar molecule attached to adenine base and whose 2’ O is bound to a methyl moiety; and

* is a phosphorothioate bond linkage joining consecutive ribose sugars.

20. The ASO or the method according to claim 17, wherein the ASO comprises the sequence:

5’-mG7MOErA/7MOErC/7MOErA/7MOErC/7MOErC/7MOErA/7MOErA/7MOErC/7MOErCZ* ZMOErA/7MOErC/7MOErC/7MOErA/*mG*mG*mG7MOErT/7MOErT/7MOErT/*mG*mG/-3’; or

5’-/MOErC/*mU7MOErG/7MOErG/7MOErG/*mU7MOErG/7MOErA/7MOErG/7MOErGZ* /MOErG/7MOErG/7MOErC/*mU7MOErG/7MOErG/7MOErG/7MOErG/-3, wherein ZMOErGZ is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methoxyethyl moiety;

ZMOErAZ is a ribose sugar molecule attached to adenine base and whose 2’ O is bound to a methoxyethyl moiety;

ZMOErTZ is a ribose sugar molecule attached to thymine base and whose 2’ O is bound to a methoxyethyl moiety; mG is a ribose sugar molecule attached to guanine base and whose 2’ O is bound to a methyl moiety; mU is a ribose sugar molecule attached to uracil base and whose 2’ O is bound to a methyl moiety; and

* is a phosphorothioate bond linkage joining consecutive ribose sugars.

21 . An engineered immune cell that is capable of contributing to an immune response in a subject, wherein the engineered immune cell contains the ASO according to any one of claims 10-20.

22. An engineered immune cell produced by the method according to any one of claims 1-9.

23. An engineered immune cell that is capable of contributing to an immune response in a subject, wherein the engineered immune cell contains two or more exogenous splice-switching antisense oligonucleotides (ASOs) which respectively modulate the expression of one or more genes involved in immune cell suppression, cytotoxicity, cytokine production, growth factor production, autocrine and/or paracrine signalling, antigen presentation, priming and activation, trafficking, infiltration of engineered immune cells.

24. The engineered immune cell according to claim 23, wherein the ASOs do not modulate expression of an antigen receptor or an immunoglobulin expression.

25. The engineered immune cell according to any one of claims 21-24, wherein at least one of the ASOs modulates the expression of a gene selected from the following list: PD-1 , IFN-y, Granzyme B, 28

Perforin, PD-L1 , TIM-3, LAG3, ADORA2A, TIGIT, PRDM1 , CD40LG, NDFIP1 , PDCD1 LG2, REL, BTLA, CD80, CD160, CD244, CTLA4.

26. The engineered immune cell according to any one of claims 21-25, wherein the at least two or more ASOs modulate the expression of one gene, wherein the one gene is either PD-1 or ADORA2A.

27. The engineered immune cell according to any one of claims 23-25, wherein the at least two or more ASOs modulate the expression of two or more genes.

28. The engineered immune cell according to any one of claims 21-27, wherein the two or more genes comprise Perforin and Granzyme B.

29. The engineered immune cell according to any one of claims 21-28, wherein the cell is a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell.

30. The engineered immune cell according to claim 29, wherein the cell is a T cell.

31 . The engineered immune cell according to claim 30, wherein the cell is a CAR T cell or TCR T cell.

32. An engineered immune cell that is capable of contributing to an immune response in a subject, wherein the immune cell contains an exogenous splice-switching antisense oligonucleotides (ASO) that modulates the expression of PD-1 , wherein the ASO is according to any one of claims 10, 11 and 14-20.

33. The engineered immune cell according to claim 32, wherein at least 70%, at least 75%, or at least 80% of the PD-1 expressed by the engineered immune cell lacks the region encoded by exon 3.

34. An engineered immune cell that is capable of contributing to an immune response in a subject, wherein the immune cell contains an exogenous splice-switching antisense oligonucleotides (ASO) that modulates the expression of IFN-y, wherein the ASO is according to any one of claims 10-15.

35. The engineered immune cell according to claim 34, wherein at least 60%, at least 65%, or at least 70% of the IFN-y lacks the region encoded by exon 2.

36. The engineered immune cell according to any one of claims 32-35, wherein the cell is a T cell, an NK cell, a macrophage, a monocyte, a dendritic cell (DC), or a B cell.

37. The engineered immune cell according to claim 36, wherein the cell is a T cell.

38. The engineered immune cell according to any one of claims 21-37, wherein the engineered immune cell is stored in a frozen sample.

39. The engineered immune cell according to any one of claims 21-37, wherein the engineered immune cell is thawed from a frozen sample.

40. A population of engineered immune cells, said population comprising a plurality of engineered cells according to any one of the claims 21-39, wherein at least 60% of the engineered immune cells remain viable one day after the introduction of the ASOs into the cells. 29

41 . The engineered immune cell according to any one of claims 21-39, for use in a method of treating the human or animal body by therapy.

42. The engineered immune cell according to any one of claims 21-39, for use in a method of treatment of an autoimmune condition in a subject in need thereof.

43. The engineered immune cell according to any one of claims 21-39, for use in a method of treatment of a cancer and/or an infectious disease in a subject in need thereof.

44. The engineered immune cell for the use according to claim 43, wherein the subject has, or has had, a Hepatitis B Virus (HBV) infection.

45. The engineered immune cell for the use according to claim 44, wherein the treatment treats the HBV infection.

46. The engineered immune cell for the use according to claim 44 or claim 45, wherein the treatment treats an HBV-associated cancer.