WO2022080886A1 - 2-keto-4-hydroxybutyrate biosynthetic system - Google Patents

Abstract

The present invention relates to a 2-keto-4-hydroxybutyrate biosynthetic system, and provides Achromobacter xylosoxidans, Deinococcus radiodurans R1, and Pseudomonas aeruginosa PAO1-derived aldolases and aldolase variants, which have more than twice the activity of conventional E.coli K12-derived aldolases, and the objective of the present invention is to contribute to production of various high value-added compounds by means of biosynthesis of 2-keto-4-hydroxybutyrate with the aldolases or aldolase variants.

Description

2-keto-4-hydroxybutate biosynthetic system

The present invention relates to a 2-keto-4-hydroxybutate biosynthetic system.

Recently, various C1 gas utilization technologies have emerged, but they are focused on the production of basic C1 chemicals or fuels such as methanol and formic acid. However, due to the price of C1 chemical, which is only about 300-500 USD per ton, it is difficult to secure economic feasibility when simple C1 material is produced by C1 gas refinery. Therefore, it is very important to use C1 chemicals to produce high value-added substances higher than C3. Among them, formaldehyde is known as a very important intermediate in the metabolism of C1 compounds.

It is known that the enzyme that binds formaldehyde-pyruvate to carbon, which has been discovered so far, is 2-keto-4-hydroxybutyrate aldolase derived from E. coli. (ACS Synth. Biol. 2019, 8, 2483-2493) However, it is known that the activity is still insignificant and the enzyme stability is poor.

Accordingly, the present inventors confirmed an enzyme that binds formaldehyde-pyruvate carbon after a long study, and discovered three new enzyme groups with more than twice the activity than previously known enzymes. Thereafter, mutations were induced in the active site to enhance the activity of aldolase, and two single mutant enzymes whose activity was increased by 1.7 times compared to the wild-type enzyme among aldolases derived from Pseudomonas aeruginosa PAO1 and wild-type enzymes from aldolase derived from Deinococcus radiodurans R1 Three single mutant enzymes with 1.33, 1.64, and 1.71 times higher than the enzyme were obtained. In addition, in order to draw the maximum production with a small amount of enzyme and substrate, the optimal reaction conditions in which the production is saturated were confirmed. Finally, the present invention was completed by clearly demonstrating that the final product was synthesized when methanol and pyruvate as substrates were reacted together with methanol dehydrogenase and aldolase in a test tube.

One aspect of the present invention is an aldolase variant in which any one amino acid of P195, G196, S222, L227, L247 and R250 is substituted in the amino acid sequence of SEQ ID NO: 2 or V121, V237 and L241 in the amino acid sequence of SEQ ID NO: 3 An object of the present invention is to provide an aldolase variant in which one or more amino acids are substituted.

Another aspect of the present invention is a composition for biosynthesis of 2-keto-4-hydroxybutyrate comprising the aldolase variant or aldolase of any one of SEQ ID NOs: 1 to 3 is intended to provide

Another aspect of the present invention is to provide a polynucleotide encoding the aldolase variant or aldolase.

And, another aspect of the present invention aims to provide a recombinant microorganism having the ability to produce 2-keto-4-hydroxybutate from formaldehyde and pyruvic acid including the polynucleotide.

In addition, another aspect of the present invention aims to provide a method for producing 2-keto-4-hydroxybutate comprising the step of culturing the recombinant microorganism in the presence of formaldehyde.

One aspect of the present invention is an aldolase variant in which any one amino acid of P195, G196, S222, L227, L247 and R250 is substituted in the amino acid sequence of SEQ ID NO: 2 or V121, V237 and L241 in the amino acid sequence of SEQ ID NO: 3 Provided are aldolase variants in which any one or more amino acids are substituted.

In one embodiment of the present invention, in the amino acid sequence of SEQ ID NO: 2, P195 is substituted with serine (S) or glutamine (Q), G196 and S222 are substituted with alanine (A), and L227 and L247 are valine ( is substituted with V), R250 is substituted with alanine (A), and V121, V237 and L241 in the amino acid sequence of SEQ ID NO: 3 are substituted with alanine (A).

Another aspect of the present invention is a composition for biosynthesis of 2-keto-4-hydroxybutyrate comprising the aldolase variant or aldolase of any one of SEQ ID NOs: 1 to 3 provides

In one embodiment of the present invention, the aldolase variant or aldolase binds formaldehyde and pyruvic acid.

Another aspect of the present invention provides a polynucleotide encoding the aldolase variant or aldolase of any one of SEQ ID NOs: 1 to 3.

Another aspect of the present invention provides a recombinant microorganism having the ability to produce 2-keto-4-hydroxybutate from formaldehyde and pyruvic acid including the polynucleotide.

Another aspect of the present invention provides a method for producing 2-keto-4-hydroxybutate comprising the step of culturing the recombinant microorganism in the presence of formaldehyde.

The 2-keto-4-hydroxybutate biosynthetic system of the present invention has superior activity compared to that of conventional aldolase, and thus can contribute to the production of various high-addition compounds.

1 to 12 show the temperature (FIG. 1, FIG. 3, FIG. 5), pH (FIG. 2, FIG. 4, FIG. 6), metal ion (FIG. 7, FIG. 9, and FIG. 11) of Example 2, and MgCl ₂ It is a graph showing the activity of aldolase according to the concentration (Fig. 8, Fig. 10, Fig. 12).

13　 to 16 are results according to Example 2, showing the activity of aldolase according to the aldolase concentration (FIG. 13), the substrate concentration (FIGS. 14 and 15) and the reaction time (FIG. 16).

17 and 18 are graphs comparing the relative activity of the conventional aldolase according to Example 3 and the present aldolase of the present invention.

19 and 20 are graphs comparing the activity of the aldolase variant of the present invention according to Example 4;

One aspect of the present invention is an aldolase variant in which any one amino acid of P195, G196, S222, L227, L247 and R250 is substituted in the amino acid sequence of SEQ ID NO: 2 or V121, V237 and L241 in the amino acid sequence of SEQ ID NO: 3 Provided are aldolase variants in which any one or more amino acids are substituted.

The amino acid sequence of SEQ ID NO: 2 is an aldolase derived from Deinococcus radiodurans R1 , and SEQ ID NO: 3 is an amino acid sequence of aldolase derived from Pseudomonas aeruginosa PAO1 , as described below.

As an embodiment of the present invention, in the amino acid sequence of SEQ ID NO: 2, P195 is substituted with serine (S) or glutamine (Q), G196 and S222 are substituted with alanine (A), and L227 and L247 are valine ( is substituted with V), R250 is substituted with alanine (A),

In the amino acid sequence of SEQ ID NO: 3, V121, V237 and L241 are aldolase variants substituted with alanine (A).

The aldolase variant has the effect of having superior activity compared to the aldolase derived from Deinococcus radiodurans R1 of SEQ ID NO: 2 or the aldolase derived from Pseudomonas aeruginosa PAO1 of SEQ ID NO: 3 through the above-described mutation (FIGS. 19 and 20) .

Another aspect of the present invention is a composition for biosynthesis of 2-keto-4-hydroxybutyrate comprising the amino acid sequence of any one of the above-described aldolase variants or SEQ ID NOs: 1 to 3 provides

In the aldolase variant, in the amino acid sequence of SEQ ID NO: 2, P195 is substituted with serine (S) or glutamine (Q), G196 and S222 are substituted with alanine (A), and L227 and L247 are valine (V) ), R250 is to be substituted with alanine (A), V121, V237 and L241 in the amino acid sequence of SEQ ID NO: 3 are substituted with alanine (A), and the egg of any one of SEQ ID NOs: 1 to 3 Specifically, SEQ ID NO: 1 is an aldolase derived from Achromobacter xylosoxidans , SEQ ID NO: 2 is an aldolase derived from Deinococcus radiodurans R1 , and SEQ ID NO: 3 is an aldolase derived from Pseudomonas aeruginosa PAO1 .

The term "biosynthesis" used in the present invention means not chemically synthesized, but biologically synthesized, specifically, the amino acid sequence of any one of SEQ ID NOs: 1 to 3, synthesized by aldolase do.

In the present invention, aldolase is specifically pyruvate aldolase, and is an enzyme that decomposes sugars such as aldol or causes aldol condensation.

In one embodiment of the present invention, the aldolase mutant or aldolase may combine formaldehyde and pyruvic acid. Specifically, as shown in Formula 1 below, formaldehyde produced by methane monooxygenase and methanol dehydrogenase and pyruvic acid produced by glycolysis are subjected to an aldol condensation reaction and 2-keto-4-hydroxybutate is produced. create The 2-keto-4-hydroxybutate, as a precursor of 1,3-propane diol, undergoes additional reaction and is used in industrial materials such as biodiesel, adhesives, laminations, coatings, molds, aliphatic compounds, and copolyesters. can be

It was confirmed that the aldolase of the present invention has >2 times more activity than the previously known aldolase (YfaU) (see FIGS. 17 and 18), and the aldolase variant is Deinococcus radiodurans R1 of SEQ ID NO: 2 The derived aldolase or SEQ ID NO: 3 has superior activity compared to the aldolase derived from Pseudomonas aeruginosa PAO1 , and thus can contribute to the production of various high value-added compounds.

Another aspect of the present invention provides a polynucleotide encoding the amino acid sequence of any one of the aldolase variants or SEQ ID NOs: 1 to 3.

The polynucleotide may be DNA or RNA, and when the polynucleotide of the present invention is RNA, it may be understood that T (thymine) of DNA is replaced with uracil (U). The polynucleotide can be prepared by a known chemical synthesis method.

Another aspect of the present invention provides a recombinant microorganism having the ability to produce 2-keto-4-hydroxybutate from formaldehyde and pyruvic acid including the polynucleotide.

The recombinant microorganism inserts the aldolase variant or a polynucleotide encoding any one of SEQ ID NOs: 1 to 3 into the chromosome of the microorganism, or inserts the recombinant vector onto the plasmid of the microorganism. It can be prepared by introducing

In the present invention, "vector" means a DNA preparation containing a DNA sequence operably linked to suitable regulatory sequences capable of expressing the DNA in a suitable host. A vector can be a plasmid, a phage particle or simply a potential genomic insert. Upon transformation into an appropriate host, the vector may replicate and function independently of the host genome, or in some cases may be integrated into the genome itself. Since a plasmid is currently the most commonly used form of vector, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) an initiation point of replication that allows efficient replication to include hundreds of plasmid vectors per host cell, and (b) a selection of host cells transformed with the plasmid vector. It has a structure including an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated by using a synthetic oligonucleotide adapter or linker according to a conventional method. After ligation, the vector must be transformed into an appropriate host cell.

The vector according to one embodiment of the present invention may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors. Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1). , pHV14, pGEX series, pET series, pUC19, etc.), phage (eg, λgt4λB, λ-Charon, λΔz1, M13, etc.) or viral vectors (eg, adeno-associated virus (AAV) vectors, etc.) It may be manufactured based on, but is not limited to.

In the present invention, the preferred host cell is a prokaryotic cell. Suitable prokaryotic host cells include E. coli XL-1Blue (Stratagene), E. coli DH5α, E. coli JM101, E. coli K12, E. coli W3110, E. coli X1776, E. coli BL21, and the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera and the like may also be used. In addition to the above E. coli, Agrobacterium sp. strains such as Agrobacterium A4, bacilli such as Bacillus subtilis, Salmonella typhimurium or Serratia marcescens ) and other Enterobacteriaceae and various Pseudomonas genus strains can be used as host cells.

As a method of inserting the gene into the chromosome of a host cell in the present invention, a commonly known genetic manipulation method may be used. For example, as a physical method, there are microinjection (injecting DNA directly into the cell), liposome, directed DNA uptake, receptor mediated DNA transfer, or DNA transport using Ca ++. Recently, virus Gene transfer methods are widely used. Examples include methods using retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, poxvirus vectors or lentiviral vectors, etc. In particular, retroviruses have high gene transfer efficiency and It can be used in a wide range of cells without binding by host DNA and rearrangement (rearrangement: changing a region similar to self DNA in host DNA, resulting in change in host DNA function).

In the present invention, the microorganism is Agrobacterium, Aspergillus, Acetobacter, Aminobacter, Agromonas, Acidphilium, Bulleromyces, Bullera, Brevundimonas, Cryptococcus, Chionosphaera, Candida, Cerinosterus, Escherichia, Exisophiala, Exobasidium, Fellomyces, Filobasidium, Geotrichum, Graphiola, Gluconobacter, Kockovaella, Curtzmanomyces, Lalaria, Leucospoidium, Legionella, Psedozyma, Paracoccus, Petromyc, Rhodotorula, Rhodotorula , Rhizomonas, Rhodobium, Rhodoplanes, Rhodopseudomonas, Rhodobacter, Sporobolomyces, Spridobolus, Saitoella, Schizosaccharomyces, Sphingomonas, Sporotrichum, Sympodiomycopsis, Sterigmatosporidium, Traporille genera, Tilletia, Tolyposporium, Tilletiposis, Ustilago, Udenlomyce, Xanthophilomyces, Xanthobacter, Paecilomyces, Acremonium, Hyhomonus, Rhizobium, and the like.

Another aspect of the present invention provides a method for producing 2-keto-4-hydroxybutate comprising the step of culturing the recombinant microorganism in the presence of formaldehyde.

As described above, since the recombinant microorganism includes a polynucleotide encoding the amino acid sequence of the aldolase variant or the amino acid sequence of any one of SEQ ID NOs: 1 to 3, the amino acid or SEQ ID NO: 1 of the aldolase variant in culture Any one of amino acids to 3, aldolase can be expressed, and the aldolase can produce 2-keto-4-hydroxybutate by aldol condensation reaction of formaldehyde and pyruvic acid produced in microorganisms. there is.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

Example 1: Selection of aldolase

Among the known pyruvate aldolases, the enzyme reported to have the best activity is 2-keto-3-deoxy-L-rhamnonate aldolase (YfaU) derived from Escherichia coli K12 . Through the comparison of the enzyme and the newly discovered enzyme group, the most active pyruvate aldolase was selected and improved through molecular evolution to secure an enzyme with increased enzyme activity and substrate affinity.

Specifically, the sequence was searched based on the pyruvate aldolase sequence derived from Escherichia coli K12, and the sequence of the candidate enzyme group of aldolase, an essential enzyme, was obtained through sequence mining. As a result, three pyruvate aldolases derived from Achromobacter xylosoxidans , Deinococcus radiodurans R1 and Pseudomonas aeruginosa PAO1 were selected.

These aldolase candidate genes were cloned into pET28a vector containing T7 promoter-based, Maltose binding site, TEV cleavage site, and His tag. Each cloned gene was transformed into C2566 Escherichia coli (NEB), and a single colony was selected after culturing at 37° C. for 16 hours. A single colony was inoculated into LB containing 50 μg/ml ampicillin in a 10 ml tube, incubated at 37° C. for more than 4 hours, and when OD ₆₀₀ was 0.6, 0.1 mM IPTG was added. After incubation for 1 hour, it was incubated for 20 hours at 150 rpm in an incubator at 20°C. Then, after recovering the cells from the culture medium using a centrifuge, the cells were disrupted with a sonicator, only the supernatant was selected and purified using FPLC and His tag affinity chromatography to obtain aldolase (SEQ ID NOs: 1 to 3).

Example 2: Evaluation of the activity of aldolase of the present invention

In Example 1, the activity of the secured aldolase was evaluated.

2-1 Confirmation of activity of a protein having the amino acid sequence of SEQ ID NO: 1, 2, 3

Specifically, 50 mM PIPES containing 0.05 mg/ml of protein having the amino acid sequence of SEQ ID NOs: 1, 2, and 3 purified and isolated in Example [1], 100 mM pyruvate, 100 mM formaldehyde, and 1 mM CoCl ₂ It was added to a buffer solution (pH 7.0), reacted at 37° C. for 10 minutes, and the reaction was terminated at -80° C., and the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed was measured.

The produced 2-keto-4-hydroxybutate was pretreated with o -benzylhydroxylamine hydrochloride and then analyzed by HPLC. The pretreatment process is to make a BnONH 2 solution by dissolving 21 mg of BnONH ₂ ( o -benzylhydroxylamine hydrochloride), 660 μl of pyridine, 900 μl of methanol, and 40 μl of distilled water to make a BnONH ₂ solution, and 15 μl of the sample to be analyzed is BnONH ₂ solution 80 It was put in μl and reacted at room temperature for 2 hours. Then, centrifuged at 13000 rpm for 10 minutes, the supernatant was extracted, filtered with a 0.2 μm filter, and components were analyzed through HPLC.

50 μl of the pretreated sample prepared as above was subjected to high pressure liquid chromatography equipped with a variable wavelength detector (VWD), 215 nm and a reversed-phase C18 column (Gemini® 5 μm C18 110 Å, LC Column 250 x 4.6 mm column) (Phenomenex). The amount of 2-keto-4-hydroxybutate produced was measured. The mobile phase used to perform the high-pressure liquid chromatography as described above consists of a mixture of acetonitrile containing 0.1% trifluoroacetic acid (mobile phase A) and 0.095% TFA and H₂O in a ratio of 4:1 (mobile phase B), It was flowed for 30 minutes at a flow rate of 1 ml/min, and the concentration of mobile phase B was increased to 10% to 100%.

As a result, all 2-keto-4-hydroxybutrate was detected in the buffer solution in which the reaction was completed as described above, and SEQ ID NOs 1,2,3 purified and separated in Example 1 from the results generated as a result of the above reaction It was confirmed that a protein having an amino acid sequence of

2-2． Activity evaluation according to temperature and hH

In order to confirm the effect of temperature on the enzymatic activity of the protein having the amino acid sequence of SEQ ID NOs: 1, 2, 3, purified and separated in Example [1], 50mM PIPES pH7.0, 1mM CoCl₂ The protein having the amino acid sequence of SEQ ID NOs: 1, 2, 3 was mixed with 0.05 mg/ml, 100 mM pyruvate, and 100 mM formaldehyde, and reacted at 20, 25, 30, 35, 40, 45, 50 and 55 ° C for 10 minutes, respectively. made it And, in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and the relative values were compared. As a result, it was confirmed that AxADL and DrADL showed the highest activity at 50°C and PaADL at 45°C, as shown in FIGS. 1, 3, and 5 .

In order to confirm the effect of pH on the enzymatic activity of the protein having the amino acid sequence of SEQ ID NOs: 1, 2, and 3, having the amino acid sequences of SEQ ID NOs: 1, 2, and 3 purified and separated in Example [1] Protein 0.05mg/ml, 100mM pyruvate, 100mM formaldehyde and 1mM CoCl₂ together with PIPES buffer at pH 6.5 to 7.5, EPPS buffer at pH 7.5 to 8.5 and CHES buffer at pH 8.5 to 10, respectively , were reacted in the range of pH 6.5 to 10, respectively. And, in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and the relative values were compared. As a result, it was confirmed that AxADL showed the highest activity at pH 9.0, and DrADL and PaADL at pH 8.5, as shown in FIGS. 2, 4, and 6 .

2-3． Activity evaluation according to metal salt type　 and concentration

The effect of metal ions on aldolase in Example 1 was confirmed.

In order to confirm the effect of the type of metal cation on the activity of the enzyme of the protein having the amino acid sequence of SEQ ID NOs: 1,2,3, the purified and separated SEQ ID NOs: 1,2,3 in Example [1] AxADL containing amino acid sequence protein 0.05 mg/ml, 100mM pyruvate and 100mM formaldehyde at pH9.0, DrADL and PaADL at pH8.5 buffer solution with 1mM EDTA or 1mM metal cations (MgCl₂, CaCl₂, MnCl₂ , NiCl₂, CoCl₂, CuCl₂ and ZnCl₂) were added, and AxADL and DrADL were reacted at 50℃ and PaADL at 45℃ for 10 minutes, respectively. And, in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and the relative values were compared. As a result, as shown in FIGS. 7, 9, and 11 , the aldolases of the present invention exhibited the highest activity in 1 mM MgCl₂. Based on this, in order to find the optimal concentration of the metal salt, the metal salt added to the enzyme mixture was changed to 0, 0.5, 1.0, 2.5, 5.0, and 10 mM MgCl₂ as a result of the experiment, as shown in FIGS. 8, 10, and 12, AxADL At 5 mM silver, it was confirmed that DrADL and PaADL were saturated with activity at 1 mM.

2-4. Activity evaluation according to aldolase concentration

The effect of the concentration of the enzyme on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 3 was confirmed. Specifically, the protein having the amino acid sequence of SEQ ID NO: 3 contained in 50 mM EPPS pH 8.5, 1 mM MgCl ₂ , 100 mM pyruvate and 100 mM formaldehyde was purified and separated in Example [1], 0.01, 0.05, 0.1, 0.5, 1.0, 2.5 and 5.0 mg/ml were mixed and reacted at 45°C for 10 minutes, respectively. And in the same manner as in Example 2, the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and compared.

As a result, as shown in FIG. 13 , it was confirmed that the activity was saturated at an enzyme concentration of 0.1 mg/ml.

2-5. Activity evaluation according to substrate concentration

The effect of formaldehyde on the enzymatic activity of the protein having the amino acid sequence of SEQ ID NO: 3 was confirmed. Specifically, 0.1 mg/ml of the protein having the amino acid sequence of SEQ ID NO: 3 purified and isolated in Example [1], 100 mM pyruvate, and 1 mM MgCl₂ were mixed in 50 mM EPPS pH 8.5 buffer, 20, 40, 60, 80, 100, 150, 200, 300 and 400 mM formaldehyde were added and reacted, respectively. And in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and compared.

As a result, as shown in FIG. 14 , it was confirmed that the highest activity was exhibited at 150 mM formaldehyde, and enzyme activity was inhibited at a higher formaldehyde concentration.

In addition, the effect of pyruvate on the enzymatic activity of the protein having the amino acid sequence of SEQ ID NO: 3 was confirmed. Specifically, 0.1 mg/ml of the protein having the amino acid sequence of SEQ ID NO: 3 purified and isolated in Example [1], 150 mM formaldehyde, and 1 mM MgCl₂ were mixed in 50 mM EPPS pH 8.5 buffer, 20, 40, 60, 80, 100, 150, 200 and 300 mM pyruvate were added and reacted, respectively. And in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured and compared.

As a result, as shown in FIG. 15 , it was confirmed that the activity was saturated in 150 mM pyruvate.

2-6. Activity evaluation according to the reaction time

The effect of the enzyme reaction time on the activity of the enzyme having the amino acid sequence of SEQ ID NO: 3 was confirmed. Specifically, 50 mM EPPS pH8.5 containing 0.1 mg/ml of the protein having the amino acid sequence of SEQ ID NO: 3 purified and isolated in Example [1], 1 mM MgCl, 150 mM pyruvate, and 150 mM formaldehyde The buffer was reacted at 45° C. for 0, 10, 30, 60, 90, 120, 150 and 180 minutes. And in the same manner as in Example [2-1], the production amount of 2-keto-4-hydroxybutate in the buffer solution was measured and the relative values were compared.

As a result, as shown in FIG. 16 , it was confirmed that the activity of the wild-type aldolase of the present invention was saturated in 60 minutes and the L241A mutant in 20 minutes.

Example 3: Comparison of activity of aldolase of the present invention

YfaU derived from E. coli , which has previously been reported to produce 2-keto-4-hydroxybutate from pyruvate and formaldehyde, and activity was compared.

Each activity was performed under optimal conditions as shown in the table of FIG. 18 . Then, in the same manner as in Example 2-1, the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured, and the relative values were compared.

As a result, as shown in FIGS. 17 and 18 , compared to the activity of YfaU, PaADL is about 2 times higher, AxADL is about 9 times, and DrADL is about 31 times higher (see FIG. 17 ), 2-keto-4-hydr It was also confirmed that the production of hydroxybutrate was superior to that of the conventional YfaU, AxADL, PaADL, and DrADL of the present invention.

Example 4: Confirmation of aldolase and mutant activity of the present invention

As a result of confirming the activity of the aldolase of the present invention as described above, it was found that the aldolase of Deinococcus radiodurans R1 had excellent activity.

4-1. Selection of point mutations

Proteins having the amino acid sequences of SEQ ID NOs: 2 and 3 were obtained, and residues interacting with the substrate pyruvate at a distance of 20 Å in the active site of the crystal structure were selected (see Tables 1 and 2). Based on the nucleotide sequences of SEQ ID NOs: 2 and 3 to replace selected residues in the protein having the amino acid sequence of SEQ ID NOs: 2 and 3, primers of SEQ ID NOs: 4 to 109 as shown in Table 1 and Table 2 were designed respectively.

DrADL mutation	SEQ ID NO:	primer pair	sequence (5'->3')
Trp28Ala	4	forward primer	gcagatcggtctggcgctgggtctggcg
Trp28Ala	5	reverse primer	cgccagacccagcgccagaccgatctgc
Asp51Ala	6	forward primer	tggctgctgatcgccggtgaacacgcg
Asp51Ala	7	reverse primer	cgcgtgttcaccggcgatcagcagcca
Arg79Ala	8	forward primer	GGTTGCGCCGGTTGTTGCTCCGCCGGTTGG
Arg79Ala	9	reverse primer	CCAACCGGCGGAGCAACAACCGGCGCAACC
Val127Ala	10	forward primer	CGTGGTGCTGGTTCT
Val127Ala	11	reverse primer	GATACCCTGCGGCGG
Leu131Ala	12	forward primer	CGTGCGTCTCGTTGG
Leu131Ala	13	reverse primer	CGCCGCCGCAGAACCAAC
Asn138Ala	14	forward primer	CGTTGGGCCGCGGTTCCG
Asn138Ala	15	reverse primer	AGACGCACGCGCCAG
Pro182Ala	16	forward primer	acggtgttttcatcggtgcggcggacc
Pro182Ala	17	reverse primer	ggtccgccgcaccgatgaaaacaccgt
Pro195Ala	18	forward primer	GTCACCTGGGTCACGCGGGTCACCCGGACG
Pro195Ala	19	reverse primer	CGTCCGGGTGACCCGCGTGACCCAGGTGAC
Pro195Ser	20	forward primer	cacctgggtcactcgggtcacccgGA
Pro195Ser	21	reverse primer	Tccgggtgacccgagtgacccaggtg
Pro195Val	22	forward primer	tcacctgggtcacgtgggtcacccggac
Pro195Val	23	reverse primer	gtccgggtgacccacgtgacccaggtga
Pro195Glu	24	forward primer	tcacctgggtcacgagggtcacccggac
Pro195Glu	25	reverse primer	gtccgggtgaccctcgtgacccaggtga
Pro195Gln	26	forward primer	cctgggtcaccagggtcacccggAC
Pro195Gln	27	reverse primer	GTccgggtgaccctggtgacccagg
Pro195Arg	28	forward primer	GTccgggtgaccccggtgacccagg
Pro195Arg	29	reverse primer	cctgggtcaccggggtcacccggAC
Gly196Ala	30	forward primer	CACCCGGCTCACCCGGACGTTG
Gly196Ala	31	reverse primer	CAACGTCCGGGTGAGCCGGGTG
Gly196Leu	32	forward primer	cctgggtcacccgctacacccggacgttg
Gly196Leu	33	reverse primer	caacgtccgggtgtagcgggtgacccagg
Gly196Val	34	forward primer	cctgggtcacccggttcacccggacgttg
Gly196Val	35	reverse primer	caacgtccgggtgaaccgggtgacccagg
Gly196Glu	36	forward primer	cctgggtcacccggagcacccggacgttg
Gly196Glu	37	reverse primer	caacgtccgggtgctccgggtgacccagg
Gly196Gln	38	forward primer	cctgggtcacccgcagcacccggacgttg
Gly196Gln	39	reverse primer	caacgtccgggtgctgcgggtgacccagg
Gly196Lys	40	forward primer	cctgggtcacccgaagcacccggacgttg
Gly196Lys	41	reverse primer	caacgtccgggtgcttcgggtgacccagg
Leu221Ala	42	forward primer	GGTATCGCGTCTGCGGAC
Leu221Ala	43	reverse primer	CGCCCGCTTTACCCGC
Ser222Ala	44	forward primer	ggcgggtatcctggctgcggacgaacg
Ser222Ala	45	reverse primer	cgttcgtccgcagccaggatacccgcc
Ala223Gln	46	forward primer	AGCGGCGGGTATCCTGTCTCAGGACGAACGT
Ala223Gln	47	reverse primer	acgttcgtcctgagacaggatacccgccgct
Asp224Ala	48	forward primer	GCGGCCGAACGTCTG
Asp224Ala	49	reverse primer	AGACAGGATAACCCGC
Glu225Ala	50	forward primer	GCGGACGCACGTCTG
Glu225Ala	51	reverse primer	AGACAGGATAACCCGC
Arg226Ala	52	forward primer	atcctgtctgcggacgaagctctggcgcgt
Arg226Ala	53	reverse primer	acgcgccagagcttcgtccgcagacaggat
Leu227Ala	54	forward primer	TGCGGACGAACGTGCGGCGCGTCACTACCT
Leu227Ala	55	reverse primer	AGGTAGTGACGCGCCGCACGTTCGTCCGCA
Leu227Val	56	forward primer	tgtctgcggacgaacgtgtggcgcgtc
Leu227Val	57	reverse primer	gacgcgccacacgttcgtccgcagaca
Val243Ala	58	forward primer	cgttgcggttggtgctgacaccaccctgc
Val243Ala	59	reverse primer	gcagggtggtgtcagcaccaaccgcaacg
Thr246Ala	60	forward primer	GACACCGCCCTGCTG
Thr246Ala	61	reverse primer	AACACCAACCGCAAC
Leu247Ala	62	forward primer	TGTTGACACCACCGCGCTGGCCGTGCGGC
Leu247Ala	63	reverse primer	GCCGCACGCGCCAGCGCGGTGGTGTCAACA
Leu247Val	64	forward primer	gttgacaccaccgtgctggcgcgtgCGG
Leu247Val	65	reverse primer	CCGcacgcgccagcacggtggtgtcaac
Arg250Ala	66	forward primer	CCCTGCTGGCGGCTGCGGCGCGTACCCTGG
Arg250Ala	67	reverse primer	CCAGGGTACGCGCCGCAGCCGCCAGCAGGG

PaADL mutation	SEQ ID NO:	primer pair	sequence (5'->3')
Trp22Ala	68	forward primer	gcagatcggtctggcgctgggtctggcg
	69	reverse primer	cgccagacccagcgccagaccgatctgc
	Asp45Ala	70	forward primer	ggctgctgctggccggtgaacacgc
71		reverse primer	gcgtgttcaccggccagcagcagcc
Arg73Ala	72	forward primer	ggtcagccggttatcgctccggttcagggtg
	73	reverse primer	caccctgaaccggagcgataaccggctgacc
Val121Ala	74	forward primer	gggtgttcgtggtgctggttctgcgctgg
	75	reverse primer	ccagcgcagaaccagcaccacgaacaccc
Leu125Ala	76	forward primer	gtgttggttctgcggcggcgcgtgcgtctc
	77	reverse primer	gagacgcacgcgccgccgcagaaccaacac
Asn132Ala	78	forward primer	gcgtgcgtctcgttgggcctctgttgcggaatac
	79	reverse primer	gtattccgcaacagaggcccaacgagacgcacgc
	Pro176Ala	80	forward primer	acggtgttttcatcggtgcggcggacc
81		reverse primer	ggtccgccgcaccgatgaaaacaccgt
Pro189Ala	82	forward primer	caccgtggtaacgcgggtcacccgg
	83	reverse primer	ccgggtgacccgcgttaccacggtg
Gly190Ala	84	forward primer	cgtggtaacccggctcacccggaagtt
	85	reverse primer	aacttccgggtgagccgggttaccacg
Leu215Ala	86	forward primer	aaagcggcgggtatcgcgtctgcggacgaaac
	87	reverse primer	gtttcgtccgcagacgcgatacccgccgcttt
Ser216Ala	88	forward primer	ggcgggtatcctggctgcggacgaaac
	89	reverse primer	gtttcgtccgcagccaggatacccgcc
	Ala217Gln	90	forward primer	gcggcgggtatcctgtctcaggacgaaaccc
91		reverse primer	gggtttcgtcctgagacaggatacccgccgc
Asp218Ala	92	forward primer	atcctgtctgcggccgaaaccctggcg
	93	reverse primer	cgccagggtttcggccgcagacaggat
Glu219Ala	94	forward primer	tgtctgcggacgcaaccctggcgcg
	95	reverse primer	cgcgccagggttgcgtccgcagaca
Leu221Ala	96	forward primer	ctgcggacgaaaccgcggcgcgtcgttacc
	97	reverse primer	ggtaacgacgcgccgcggtttcgtccgcag
Val237Ala	98	forward primer	cgttgcggttggtgctgacacctctctgc
	99	reverse primer	gcagagaggtgtcagcaccaaccgcaacg
	Ser240Ala	100	forward primer	ggttggtgttgacaccgctctgctgatgcgttc
101		reverse primer	gaacgcatcagcagagcggtgtcaacaccaacc
Leu241Ala	102	forward primer	ggttggtgttgacacctctgcgctgatgcgttctct
	103	reverse primer	agagaacgcatcagcgcagaggtgtcaacaccaacc
Leu241Val	104	forward primer	cggttggtgttgacacctctgtgctgatgcgt
	105	reverse primer	acgcatcagcacagaggtgtcaacaccaaccg
Leu241Gly	106	forward primer	ggttggtgttgacacctctgggctgatgcgttctct
	107	reverse primer	agagaacgcatcagcccagaggtgtcaacaccaacc
Arg244Ala	108	forward primer	cacctctctgctgatggcttctctgcgtgaactg
	109	reverse primer	cagtcacgcagagaagccatcagcagagaggtg

The nucleotide sequence primers of SEQ ID NOs: 4 to 109 were synthesized at the request of Macrogen, and PCR was performed using each of the designed primer pairs of SEQ ID NOs: 4 to 109 using the nucleotide sequences of SEQ ID NOs: 2 and 3 as a template. Each PCR product amplified by PCR using polymerases such as Phusion, STAR max, etc. was used by itself or ligation / kynation method was used to connect the end of the nucleotide sequence, and sequencing (Macrogen) was performed. Through this, it was confirmed that the residues were correctly substituted with the nucleotide sequence encoding the intended amino acid. Each of the base sequences was transformed into E. coli C2566 strain (Novagen, USA), and 20% glycerin solution was added and stored frozen before use.

4-2. Aldolase 　 mutant 　 activity 　 confirmation

In order to confirm the activity of the aldolase mutant to which the selected point mutation is applied, a single colony is inoculated into LB containing 50 μg/ml ampicillin in a 10 ml tube and cultured at 37° C. for more than 4 hours and the OD ₆₀₀ is 0.6 days. When 0.1 mM IPTG was added. After incubation for 1 hour, it was incubated for 20 hours at 150 rpm in an incubator at 20 °C. After recovering the cells from the culture medium using a centrifuge, the cells were disrupted with a sonicator, and only the supernatant was selected and purified using His tag affinity chromatography. The concentrations of the purified mutant enzymes were measured using BSA assay, and 0.005 mg/ml of DrADL variant protein or 0.05 mg/ml PaADL variant protein and 100 mM pyruvate, 100 mM formaldehyde and 1 mM MgCl₂ in pH 8.5 buffer solution. The reaction was carried out at 50°C or 45°C for 10 minutes. Then, in the same manner as in Example [2-1], the amount of 2-keto-4-hydroxybutate produced in the buffer solution where the reaction was completed as described above was measured, and the relative values were compared.

As a result, it was found that among the point mutation mutants derived from SEQ ID NO: 2, aldolase having G196A, S222A and L247V mutants showed 1.71, 1.33 and 1.64 times higher activity than the wild-type enzyme, respectively, as shown in Fig. 19. Confirmed. In addition, as shown in FIG. 20 , it was confirmed that aldolase having V121A, L241A, and V121A/L241A mutants among the point mutations derived from SEQ ID NO: 3 showed about 1.4 times higher activity than the wild-type enzyme. ．

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Claims (7)

1. In the amino acid sequence of SEQ ID NO: 2, any one of amino acids P195, G196, S222, L227, L247 and R250 is substituted aldolase variant, or in the amino acid sequence of SEQ ID NO: 3, any one or more amino acids of V121, V237 and L241 are substituted aldolase variants.
2. The method of claim 1,

   In the amino acid sequence of SEQ ID NO: 2, P195 is substituted with serine (S) or glutamine (Q), G196 and S222 are substituted with alanine (A), and L227 and L247 are substituted with valine (V), R250 is substituted with alanine (A),

   In the amino acid sequence of SEQ ID NO: 3, V121, V237 and L241 are aldolase variants substituted with alanine (A).
3. A composition for biosynthesis of 2-keto-4-hydroxybutyrate comprising the aldolase variant of claim 1 or the aldolase of any one of SEQ ID NOs: 1 to 3.
4. 4. The method of claim 3,

   The aldolase variant or aldolase is a composition for binding formaldehyde and pyruvic acid.
5. The aldolase variant of claim 1 or a polynucleotide encoding the aldolase of any one of SEQ ID NOs: 1 to 3.
6. A recombinant microorganism having the ability to produce 2-keto-4-hydroxybutate from formaldehyde and pyruvic acid comprising the polynucleotide of claim 5.
7. A method for producing 2-keto-4-hydroxybutate comprising the step of culturing the recombinant microorganism of claim 6 in the presence of formaldehyde.

Images