WO2022072787A1 - Compounds for modulating chmp7 - Google Patents
Compounds for modulating chmp7 Download PDFInfo
- Publication number
- WO2022072787A1 WO2022072787A1 PCT/US2021/053107 US2021053107W WO2022072787A1 WO 2022072787 A1 WO2022072787 A1 WO 2022072787A1 US 2021053107 W US2021053107 W US 2021053107W WO 2022072787 A1 WO2022072787 A1 WO 2022072787A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- modified
- oligomeric compound
- certain embodiments
- oligomeric
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
- a 2’-deoxynucleoside is a 2’-p-D-deoxynucleoside and comprises a 2’-p-D-deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
- 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
- a 5-methyl cytosine is a modified nucleobase.
- antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
- sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
- Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
- Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
- complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
- complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
- Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine ( m C) and guanine (G).
- Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
- conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
- Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
- conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
- oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
- contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
- cEf means a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
- a “cEt sugar moiety” is a bicyclic sugar moiety with a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
- cEf ’ means constrained ethyl.
- chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
- the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
- chirally controlled in reference to an intemucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
- deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2’-p-D-deoxynucleosides.
- each nucleoside is selected from a 2’- -D- deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside.
- a deoxy region supports RNase H activity.
- a deoxy region is the gap or internal region of a gapmer.
- gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
- the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
- the internal region is a deoxy region.
- the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region.
- each nucleoside of the gap is a 2’-p-D-deoxynucleoside.
- the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-p- D-deoxynucleosides.
- MOE gapmer indicates a gapmer having a gap comprising 2’-p-D- deoxynucleosides and wings comprising 2’-MOE nucleosides.
- the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
- hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
- hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
- modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
- Phosphorothioate intemucleoside linkage or “PS intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
- linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
- non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
- mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
- nucleobase means an unmodified nucleobase or a modified nucleobase.
- an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
- a “5-methyl cytosine” is a modified nucleobase.
- a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
- nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
- nucleoside means a compound, or a fragment of a compound, comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
- Modified nucleosides include abasic nucleosides, which lack a nucleobase.
- Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- pharmaceutical composition means a mixture of substances suitable for administering to a subject.
- a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
- a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
- RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics.
- RNAi agents may comprise conjugate groups and/or terminal groups.
- an RNAi agent modulates the amount and/or activity, of a target nucleic acid.
- the term RNAi agent excludes antisense agents that act through RNase H.
- RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
- an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
- the term RNAi compound excludes antisense compounds that act through RNase H.
- RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNase H agents are singlestranded.
- RNase H agents are double-stranded.
- RNase H compounds may comprise conjugate groups and/or terminal groups.
- an RNase H agent modulates the amount and/or activity of a target nucleic acid.
- the term RNase H agent excludes antisense agents that act principally through RISC/Ago2.
- standard in vitro assay means the assay described in Example 1 and reasonable variations thereof.
- sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
- Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
- Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a CHMP7 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- Embodiment 4 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion within nucleobases 3950-3983 of SEQ ID NO: 1; an equal length portion within nucleobases 4242-4266 of SEQ ID NO: 1; an equal length portion within nucleobases 4480-4525 of SEQ ID NO: 1; an equal length portion within nucleobases 4534-4566 of SEQ ID NO: 1; an equal length portion within nucleobases 5205-5232 of SEQ ID NO: 1; an equal length portion within nucleobases 5404-5430 of SEQ ID NO: 1; an equal length portion within nucleobases 8323-8344 of SEQ ID
- Embodiment 5 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from:
- modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide comprises at least one modified nucleoside.
- Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
- Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
- Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2 ’-4’ bridge, wherein the 2 ’-4’ bridge is selected from -O-CH 2 -; and -O-CH(CH 3 )-.
- Embodiment 14 The oligomeric compound of embodiment 13, wherein the sugar surrogate is selected from any of morpholino, modified morpholino, PNA, THP, and F-HNA.
- Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide is a gapmer.
- Embodiment 17 The oligomeric compound of any of embodiments 1-16 wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 linked 2’-deoxynucleosides.
- Embodiment 18 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 linked 2’-p-D-deoxynucleosides.
- Embodiment 19 The oligomeric compound of embodiment 17 or embodiment 18, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
- Embodiment 20 The oligomeric compound of any of embodiments 17-19, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
- Embodiment 21 The oligomeric compound of any of embodiments 17-20, wherein the deoxy region is flanked on the 5’-side by a 5’-extemal region consisting of 1-6 linked 5’-extemal region nucleosides and on the 3’-side by a 3 ’-external region consisting of 1-6 linked 3 ’-external region nucleosides; wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ external region comprises a modified sugar moiety.
- Embodiment 24 The oligomeric compound of any of embodiments 1-23, wherein the modified oligonucleotide comprises: a 5 ’-region consisting of 1-7 linked 5 ’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3 ’-region consisting of 1-7 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyfuranosyl sugar moiety.
- Embodiment 26 The oligomeric compound of any of embodiments 1-25, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
- Embodiment 27 The oligomeric compound of embodiment 26, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
- Embodiment 28 The oligomeric compound of embodiment 26 or embodiment 27 wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
- Embodiment 29 The oligomeric compound of embodiment 26 or embodiment 28 wherein the modified oligonucleotide comprises at least one phosphodiester intemucleoside linkage.
- Embodiment 30 The oligomeric compound of any of embodiments 26, 28, or 29, wherein each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
- Embodiment 31 The oligomeric compound of embodiment 27, wherein each modified intemucleoside linkage is a phosphorothioate intemucleoside linkage
- Embodiment 33 The oligomeric compound of any of embodiments 1-32, wherein the modified oligonucleotide comprises at least one modified nucleobase.
- Embodiment 34 The oligomeric compound of embodiment 33, wherein the modified nucleobase is a 5-methyl cytosine.
- Embodiment 35 The oligomeric compound of embodiment 34, wherein each cytosine is a 5-methyl cytosine.
- Embodiment 36 The oligomeric compound of any of embodiments 1-35, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-18, 16-20, 17-20, 18-20 or 18-22 linked nucleosides.
- Embodiment 38 The oligomeric compound of any of embodiments 1-35, wherein the modified oligonucleotide consists of 20 linked nucleosides.
- Embodiment 42 The oligomeric compound of embodiment 41, wherein the conjugate linker consists of a single bond.
- Embodiment 43 The oligomeric compound of embodiment 41 or embodiment 42, wherein the conjugate linker is cleavable.
- Embodiment 44 The oligomeric compound of embodiment 41 or embodiment 43, wherein the conjugate linker comprises 1-3 linker-nucleosides.
- Embodiment 45 The oligomeric compound of any of embodiments 41-43, wherein the conjugate linker does not comprise any linker nucleosides.
- Embodiment 46 The oligomeric compound of any of embodiments 40-45, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
- Embodiment 47 The oligomeric compound of any of embodiments 40-45, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- Embodiment 48 The oligomeric compound of any of embodiments 40-47, wherein the conjugate group comprises a lipid.
- Embodiment 50 The oligomeric compound of any of embodiments 1-49, further comprising a terminal group.
- Embodiment 54 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-53.
- Embodiment 58 The antisense agent of any of embodiments 55-57, wherein the antisense agent comprises a conjugate group, wherein the conjugate group comprises a cell-targeting moiety.
- Embodiment 59 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-53, the oligomeric duplex of embodiment 54, or the antisense agent of any of embodiments 55-58, and a pharmaceutically acceptable diluent.
- Embodiment 66 The chirally enriched population of embodiment 63, wherein the population is enriched for oligomeric compounds having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
- oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
- Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
- Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
- modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
- modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
- Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
- one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched.
- 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH 3 (“OMe” or “O-methyl”), and 2'-O(CH 2 )2OCH 3 (“MOE” or “O-methoxyethyl”).
- these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
- Examples of 4 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
- Examples of 5 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5’-methyl (R or S), 5'-vinyl, and 5’-methoxy.
- non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
- a non-bridging 2’-substituent group selected from: F, NH 2 , N
- a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCH 3 , and OCH2CH 2 OCH 3 .
- modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
- a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration.
- modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
- Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
- Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN).
- BNAs bicyclic nucleosides
- locked nucleosides locked nucleosides
- CNN conformationally restricted nucleotides
- the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
- the furanose ring is a ribose ring.
- 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 )3-2', 4'-CH 2 -O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEf ’ when in the S configuration), 4’- CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 OCH 3 )-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
- each R, R a , and Ri is, independently, H, a protecting group, or Ci- Ci 2 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
- bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
- an LNA nucleoside (described herein) may be in the a-L configuration or in the -D configuration.
- general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the -D configuration, unless otherwise specified.
- modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
- modified sugar moieties are sugar surrogates.
- the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
- such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
- certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
- sugar surrogates comprise rings having other than 5 atoms.
- a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
- THP tetrahydropyran
- Such tetrahydropyrans may be further modified or substituted.
- Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
- F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and
- F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran
- nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of the modified THP nucleosides:
- Bx is a nucleobase moiety
- T 3 and T 4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, i .
- modified THP nucleosides are provided wherein q 1, q 2 , q 3 , q 4 , q 5 , qe and q 7 are each H. In certain embodiments, at least one of q 3 , q 2 , q 3 , q 4 , q ⁇ , e and q 7 is other than H. In certain embodiments, at least one of qi, q 7 , q 3 , q 4 , qs, qe and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
- morpholino means a sugar surrogate having the following structure:
- morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
- sugar surrogates are referred to herein as “modifed morpholinos.”
- sugar surrogates comprise acyclic moieites.
- nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
- nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
- the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
- Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
- intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
- modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate intemucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkage in a particular, independently selected stereochemical configuration.
- the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 65% of the molecules in the population.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (see, for example: Carbohydrate Modifications in Antisense Research', Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
- oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif.
- sugar motifs include but are not limited to any of the sugar modifications discussed herein.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
- each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- each nucleoside of a uniformly modified oligonucleotide comprises the same 2 ’-modification.
- the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing],
- a 5- 10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
- a 5-10-5 MOE gapmer consists of 5 linked 2 ’-MOE nucleosides in the 5 ’-wing, 10 linked a 2’-p-D-deoxynucleosides in the gap, and 5 linked 2 ’-MOE nucleosides in the 3 ’-wing.
- modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-7 MOE gapmers. In certain embodiments, modified oligonucleotides are 7-10-3 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-9-5 MOE gapmers.
- modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2’-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
- oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
- each nucleobase is modified.
- none of the nucleobases are modified.
- each purine or each pyrimidine is modified.
- each adenine is modified.
- each guanine is modified.
- each thymine is modified.
- each uracil is modified.
- each cytosine is modified.
- each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
- each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
- the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
- the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
- the terminal intemucleoside linkages are modified.
- the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester intemucleoside linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
- oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
- a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model.
- Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
- target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
- oligonucleotides can have any of a variety of ranges of lengths.
- oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
- oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
- modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
- the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
- sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
- Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for -D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
- the modified oligonucleotides of a chirally enriched population are enriched for both -D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
- oligonucleotides are further described by their nucleobase sequence.
- oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
- oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
- Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
- conjugate groups or terminal groups are attached at the 3’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
- the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, CH alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- a conjugate moiety selected from any of a C
- Conjugate moieties are attached to oligonucleotides through conjugate linkers.
- the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
- the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
- conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
- oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
- certain conjugate linkers may comprise one or more cleavable moieties.
- a cleavable moiety is a cleavable bond.
- a cleavable moiety is a group of atoms comprising at least one cleavable bond.
- a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphodiester intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate intemucleoside linkage.
- the cleavable moiety is 2'-deoxyadenosine.
- n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
- a conjugate group comprises a cell-targeting conjugate moiety.
- a conjugate group has the general formula:
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-477; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the CHMP7 nucleic acid.
- the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- a conjugate moiety selected from any of a
- the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3 ’ ends.
- the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.
- a glycol linker such as a tetraethylene glycol linker.
- Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid encodes a protein.
- the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
- the target nucleic acid is a mature mRNA.
- the target nucleic acid is a pre- mRNA.
- the target region is entirely within an intron.
- the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
- oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the oligonucleotide is improved.
- the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
- the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’-end of the gap region.
- the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5’-end of the 5’ wing region or the 3’ wing region.
- oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is a CHMP7 nucleic acid.
- the CHMP7 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (ENSEMBLGene ID ENSG00000147457.14 from ENSEMBL Release 101: August 2020) or SEQ ID NO: 2 (GENBANK Accession No. NM_152272.5).
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of CHMP7 RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of CHMP7 protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- compositions comprising one or more oligomeric compounds.
- the one or more oligomeric compounds each consists of a modified oligonucleotide.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
- the sterile water is pharmaceutical grade water.
- aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate.
- the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.
- oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
- pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and, potassium, calcium, and magnesium salts.
- prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
- oligomeric compounds are lyophilized and isolated as sodium salts.
- the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent.
- the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.
- the sodium salt of an oligomeric compound is mixed with PBS.
- the sodium salt of an oligomeric compound is mixed with aCSF.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions.
- Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- compositions comprise a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- compositions are prepared for oral administration.
- pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
- a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated/de- protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.
- modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
- nucleobases in the ranges specified below comprise a hotspot region of CHMP7 nucleic acid.
- modified oligonucleotides that are complementary to a hotspot region of CHMP7 nucleic acid achieve an average of more than 60% reduction of CHMP7 RNA in the standard in vitro assay
- nucleobases 3950-3983 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 3950-3983 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 220, 302, and 345 are complementary to a portion of nucleobases 3950-3983 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos. : 1447312, 1447488, and 1447549 are complementary to a portion within nucleobases 3950-3983 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 3950-3983 of SEQ ID NO: 1 achieve at least 84% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 3950-3983 of SEQ ID NO: 1 achieve an average of 88.7% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 4242-4266 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 4242-4266 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 21, 131, 191, and 465 are complementary to a portion within nucleobases 4242-4266 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447338, 1447449, 1447242, and 1447606 are complementary to a portion within nucleobases 4242-4266 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 4242-4266 of SEQ ID NO: 1 achieve at least 60% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 4242-4266 of SEQ ID NO: 1 achieve an average of 68% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 4480-4525 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 4480-4525 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 34, 116, 184, 242, 257, 340, and 474 are complementary to a portion within 4480-4525 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos. : 1447297, 1447361, 1447311, 1447634, 1447299, 1447279, and 1447636 are complementary to a portion within nucleobases 4480-4525 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 4480-4525 of SEQ ID NO: 1 achieve at least 41% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 4480-4525 of SEQ ID NO: 1 achieve an average of 61% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 4534-4566 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 4534-4566 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 55, 118, 202, 267, 372, and 422 are complementary to a portion within nucleobases 4534-4566 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447461, 1447313, 1447507, 1447343, 1447400, and 1447387 are complementary to a portion within nucleobases 4534-4566 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 4534-4566 of SEQ ID NO: 1 achieve at least 58% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 4534-4566 of SEQ ID NO: 1 achieve an average of 66% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 5205-5232 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 5205-5232 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 73, 136, 197, and 421 are complementary to a portion within nucleobases 5205-5232 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447304, 1447369, 1447481, and 1447520 are complementary to a portion within nucleobases 5205-5232 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 5205-5232 of SEQ ID NO: 1 achieve at least 75% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 5205-5232 of SEQ ID NO: 1 achieve an average of 83% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 5404-5430 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 5404-5430 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 79, 160, 168, 230, 313, 331, and 464 are complementary to a portion within nucleobases 5404-5430 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos. : 1447206, 1447236, 1447553, 1447564, 1447595, 1447604, and 1447624 are complementary to a portion within nucleobases 5404-5430 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 5404-5430 of SEQ ID NO: 1 achieve at least 68% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 5404-5430 of SEQ ID NO: 1 achieve an average of 84.3% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 8323-8344 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 8323-8344 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 157, 186, and 265 are complementary to a portion within nucleobases 8323-8344 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447315, 1447331, and 1447602 are complementary to a portion within nucleobases 8323-8344 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 8323-8344 of SEQ ID NO: 1 achieve at least 89% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 8323-8344 of SEQ ID NO: 1 achieve an average of 92% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 16927-16950 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 16927-16950 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 128, 182, and 309 are complementary to a portion within nucleobases 16927-16950 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447285, 1447434, and 1447579 are complementary to a portion within nucleobases 16927-16950 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 16927- 16950 of SEQ ID NO: 1 achieve at least 64% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 16927-16950 of SEQ ID NO: 1 achieve an average of 70.7% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 17298-17340 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 17298-17340 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 44, 76, 153, 206, 283, 363, and 416 are complementary to a portion within nucleobases 17298-17340 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos. : 1447397, 1447283, 1447435, 1447433, 1447416, 1447587, and 1447525 are complementary to a portion within nucleobases 17298-17340 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 17298- 17340 of SEQ ID NO: 1 achieve at least 43% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 17298-17340 of SEQ ID NO: 1 achieve an average of 65% reduction of CHMP7 RNA in the standard in vitro assay.
- nucleobases 18287-18313 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion within nucleobases 18287-18313 of SEQ ID NO: 1.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- the gapmers are MOE gapmers.
- all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
- the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 85, 121, 189, 300, and 354 are complementary to a portion within nucleobases 18287-18313 of SEQ ID NO: 1.
- nucleobase sequence of Compound Nos.: 1447326, 1447379, 1447395, 1447535, and 1447599 are complementary to a portion within nucleobases 18287-18313 of SEQ ID NO: 1.
- modified oligonucleotides complementary to a portion within nucleobases 18287- 18313 of SEQ ID NO: 1 achieve at least 63% reduction of CHMP7 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion within nucleobases 18287-18313 of SEQ ID NO: 1 achieve an average of 79% reduction of CHMP7 RNA in the standard in vitro assay.
- RNA nucleoside comprising a 2’-OH sugar moiety and a thymine base
- RNA methylated uracil
- nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
- Certain compounds described herein e.g., modified oligonucleotides
- Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
- Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
- Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
- Oligomeric compounds having a plurality of phosphorothioate intemucleoside linkages include such compounds in which chirality of the phosphorothioate intemucleoside linkages is controlled or is random.
- compounds described herein are intended to include corresponding salt forms.
- the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
- compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 4 H hydrogen atoms.
- Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
- non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
- radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
- Example 1 Effect of 5-10-5 MOE mixed backbone modified oligonucleotides on human CHMP7 RNA in vitro, single dose
- Modified oligonucleotides complementary to human CHMP7 nucleic acid were designed and tested for their single dose effects on CHMP7 RNA in vitro.
- the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
- the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS intemucleoside linkages.
- the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2’-0-D- deoxynucleosides, and wherein the 5 ’ and 3 ’ wing segments each consist of five 2 ’ -MOE modified nucleosides.
- the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2'-0-D-dcoxyribosyl sugar, and ‘e’ represents a 2’-MOE modified sugar moiety.
- the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssooss; wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage.
- Each cytosine residue is a 5-methyl cytosine.
- “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (ENSEMBLGene ID ENSG00000147457.14 from ENSEMBL Release 101: August 2020), to SEQ ID NO: 2 (GENBANK Accession No. NM 152272.5), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
- CHMP7 RNA levels were measured by human primer probe set RTS50844 (forward sequence CAAGTGGACTCTTTCTAACATGC, designated herein as SEQ ID NO: 5; reverse sequence GCGAGTTCTGATACAGACGAT, designated herein as SEQ ID NO: 6; probe sequence CCTCCTCAGCCTTTTCCTTCAACAGC, designated herein as SEQ ID NO: 7).
- CHMP7 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of CHMP7 RNA is presented in the tables below as percent CHMP7 RNA relative to the amount in untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- Example 2 Dose-dependent inhibition of human CHMP7 in A431 cells by modified oligonucleotides
- Modified oligonucleotides selected from Example 1 above were tested at various doses in A431 cells.
- Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
- CHMP7 RNA levels were measured by quantitative real-time RTPCR.
- Human CHMP7 primer-probe set RTS50844 (described herein in Example 1) was used to measure RNA levels as described above. CHMP7 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
- CHMP7 RNA Reduction of CHMP7 RNA is presented in the tables below as percent CHMP7 RNA, relative to untreated control cells (% UTC).
- Modified oligonucleotides marked with an “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- IC50 half maximal inhibitory concentration
- Modified oligonucleotides complementary to human CHMP7 nucleic acid were designed and synthesized. “Start site” in all the tables below indicates the 5’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” in all the tables below indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either SEQ ID NO: 1 (described herein above), and/or to SEQ ID NO: 2 (described herein above). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.
- IC50 half maximal inhibitory concentration
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21876566.7A EP4222261A4 (en) | 2020-10-01 | 2021-10-01 | COMPOUNDS TO MODULATE CHMP7 |
| JP2023520049A JP2023544162A (ja) | 2020-10-01 | 2021-10-01 | Chmp7を調節するための化合物 |
| US18/247,311 US20240002852A1 (en) | 2020-10-01 | 2021-10-01 | Compounds for modulating chmp7 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063086576P | 2020-10-01 | 2020-10-01 | |
| US63/086,576 | 2020-10-01 | ||
| US202063119448P | 2020-11-30 | 2020-11-30 | |
| US63/119,448 | 2020-11-30 | ||
| US202163139715P | 2021-01-20 | 2021-01-20 | |
| US63/139,715 | 2021-01-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022072787A1 true WO2022072787A1 (en) | 2022-04-07 |
Family
ID=80950932
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/053107 Ceased WO2022072787A1 (en) | 2020-10-01 | 2021-10-01 | Compounds for modulating chmp7 |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20240002852A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4222261A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2023544162A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022072787A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022103838A1 (en) | 2020-11-10 | 2022-05-19 | The Johns Hopkins University | Methods for inhibiting chmp7 expression in neuronal cells for the treatment of neurodegenerative disorders |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130190385A1 (en) * | 2010-04-30 | 2013-07-25 | Cellectis | Method for modulating double-strand break-induced homologous recombination |
| US9689040B2 (en) * | 2011-03-04 | 2017-06-27 | Children's Medical Center Corporation | Selective inhibitors of tumor-initiating cells |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL300258A (en) * | 2020-08-07 | 2023-03-01 | Ionis Pharmaceuticals Inc | Compounds and methods for modulating SCN2A |
-
2021
- 2021-10-01 JP JP2023520049A patent/JP2023544162A/ja active Pending
- 2021-10-01 EP EP21876566.7A patent/EP4222261A4/en active Pending
- 2021-10-01 WO PCT/US2021/053107 patent/WO2022072787A1/en not_active Ceased
- 2021-10-01 US US18/247,311 patent/US20240002852A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130190385A1 (en) * | 2010-04-30 | 2013-07-25 | Cellectis | Method for modulating double-strand break-induced homologous recombination |
| US9689040B2 (en) * | 2011-03-04 | 2017-06-27 | Children's Medical Center Corporation | Selective inhibitors of tumor-initiating cells |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4222261A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022103838A1 (en) | 2020-11-10 | 2022-05-19 | The Johns Hopkins University | Methods for inhibiting chmp7 expression in neuronal cells for the treatment of neurodegenerative disorders |
| EP4243616A4 (en) * | 2020-11-10 | 2024-10-16 | The Johns Hopkins University | METHODS OF INHIBITING CHMP7 EXPRESSION IN NEURONAL CELLS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS |
Also Published As
| Publication number | Publication date |
|---|---|
| US20240002852A1 (en) | 2024-01-04 |
| EP4222261A1 (en) | 2023-08-09 |
| JP2023544162A (ja) | 2023-10-20 |
| EP4222261A4 (en) | 2025-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2022246251A2 (en) | Compounds for modulating unc13a expression | |
| WO2020023737A1 (en) | Compounds and methods for reducing atxn2 expression | |
| EP3918073A1 (en) | Compounds and methods for reducing app expression | |
| EP4281084A1 (en) | Compounds and methods for reducing dux4 expression | |
| EP4189090A1 (en) | Compounds and methods for reducing app expression | |
| EP4192476A2 (en) | Compounds and methods for modulating scn2a | |
| WO2023092057A1 (en) | Compounds and methods for modulating progranulin expression | |
| EP4355338A1 (en) | Compounds and methods for reducing ifnar1 expression | |
| WO2020132558A1 (en) | Compounds and methods for reducing pmp22 expression | |
| AU2022219976A1 (en) | Compounds and methods for reducing pln expression | |
| US12180479B2 (en) | Compounds and methods for modulating ATXN1 | |
| WO2020243292A1 (en) | Compounds and methods for reducing fus expression | |
| WO2022246204A2 (en) | Compounds for reducing ptbp1 expression | |
| WO2022072787A1 (en) | Compounds for modulating chmp7 | |
| WO2020072887A1 (en) | Oligonucleotide mediated no-go decay | |
| WO2024064854A2 (en) | Compounds and methods for reducing mecp2 expression | |
| WO2021178769A1 (en) | Compounds and methods for modulating kcnq2 | |
| WO2023073661A2 (en) | Compounds and methods for reducing psd3 expression | |
| WO2021102341A2 (en) | Compounds for modulating beta globin expression | |
| US20250340874A1 (en) | Compounds and methods for reducing pcdh19 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21876566 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2023520049 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021876566 Country of ref document: EP Effective date: 20230502 |