Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
  • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
  • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/53—Physical structure partially self-complementary or closed
  • C12N2310/531—Stem-loop; Hairpin
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination

Definitions

• TCF4 is a basic helix-loop-helix (bHLH) transcription factor (TF) that forms homo- or heterodimers with itself or other bHLH TFs. Dimerization of TCF4 allows for recognition of E-box binding sites (motif: CANNTG), and direct DNA binding can result in either repression or activation of transcription depending on the protein complex bound to TCF4.
• bHLH basic helix-loop-helix
• TF transcription factor
• Dimerization of TCF4 allows for recognition of E-box binding sites (motif: CANNTG), and direct DNA binding can result in either repression or activation of transcription depending on the protein complex bound to TCF4.
• the TCF4 gene is highly expressed throughout the CNS during human development, but regulation of its expression and splicing is complex, as multiple alternative transcripts containing different 5' exons and internal splicing have been identified.
• the genes regulated downstream of TCF4 are not well understood; this is complicated by the limited specificity of the E-box sequence, as well as context-dependent regulation of TCF4 due to heterodimerization, developmental expression and cell- type specificity.
• the disclosure provides methods and compositions useful for delivery of molecules into cells. [0007]
• the disclosure provides a recombinant nucleic acid construct comprising a mini-promoter operably linked to a coding sequence for a TCF4 polypeptide.
• the nucleic acid further comprises one or more transcription factor binding motifs.
• the one or more transcription factor binding motifs are microE5 motifs.
• the recombinant nucleic acid comprises from 1 to 15 microE5 motifs.
• the recombinant nucleic acid comprises at least 5 microE5 motifs, at least 10 microE5 motifs, or at least 12 microE5 motifs.
• the microE5 motif comprises the nucleotide sequence of SEQ ID NO:10.
• the TCF4 polypeptide is TCF4-B.
• the TCF4 polypeptide comprises an amino acid sequence having at least 85%, 90%, 95%, 98% or greater sequence identity to SEQ ID NO: 2.
• the TCF4 coding sequence comprises a nucleotide sequence that has at least 80%, 85%, 90%, 95% or greater identity to SEQ ID NO:1.
• the TCF4 coding sequence hybridizes under stringent conditions to a sequence consisting of SEQ ID NO:1.
• the mini- promoter of any of the foregoing embodiments comprises a core promoter.
• the mini-promoter comprises a nucleotide sequence that has at least 70%, 80%, 90%, or greater sequence identity to SEQ ID NO:3.
• the mini- promoter comprises the nucleotide sequence of SEQ ID NO:3, optionally with from 1 to 5 nucleotide modifications independently selected from deletions, insertions, and substitutions.
• the nucleic acid construct comprises a nucleotide sequence that is at least 80% identical to any one of SEQ ID Nos: 4, 5, 6, 7 or 8. [0008]
• the disclosure also provides a vector comprising a recombinant nucleic acid of any of the foregoing.
• the vector is a viral vector.
• the viral vector is a retroviral vector.
• the vector is an adeno-associated virus (AAV) vector, lentiviral vector or gamma-retroviral vector.
• the vector is an AAV9 vector.
• the disclosure also provides a method of treating a neurological or neurodevelopmental disease or disorder in a subject, comprising transforming a neuron of the subject with a recombinant nucleic acid of the disclosure or administering a vector of the disclosure, or administering the pharmaceutical composition of the disclosure to the subject.
• the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins Syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome.
• the neurological or neurodevelopmental disease or disorder is Pitt- Hopkins Syndrome, and is associated with TCF4 haploinsufficiency.
• the subject has one or more single nucleotide polymorphisms in a TCF4 gene.
• the subject has a chromosomal deletion including at least a portion of a TCF4 gene. In a further embodiment, the subject has a complete deletion of a TCF4 gene. In still another embodiment, the subject has a chromosomal translocation comprising at least a portion of a TCF4 gene. In another embodiment, the subject has a translocation, frameshift, or non-sense mutation in a TCF4 gene. In another or further embodiment, the subject is an infant or pediatric subject. In a further embodiment, the subject is about 16 years of age or less. In still another embodiment, the subject is about 12 years of age or less.
• the subject is about 8 years of age or less, about 5 years of age or less, or about 2 years of age or less. In another embodiment, the subject is an adult subject.
• the disclosure also provides a method of treating a neurological or neurodevelopmental disease or disorder related to TCF4 haploinsuffiency in a subject, comprising increasing expression of one or more of SOX3 and SOX4 in neurons of said subject. In another embodiment, expression of SOX3 and/or SOX4 are increased by introducing a recombinant nucleic acid expressing TCF4-B polypeptide to said neurons.
• the recombinant nucleic acid comprises a mini-promoter operably linked to a coding sequence for the TCF4-B polypeptide.
• the recombinant nucleic acid further comprises one or more transcription factor binding motifs.
• the one or more transcription factor binding motifs are microE5 motifs.
• the recombinant nucleic acid comprises from 1 to 15 microE5 motifs.
• the recombinant nucleic acid comprises at least 5, at least 10, or at least 12 microE5 motifs.
• the nucleic acids has a general structure of: microE5 n - minipromoter-TCF4 coding sequence, wherein n is an integer in the range of 5 to 15.
• the microE5 motif comprises the nucleotide sequence of SEQ ID NO:10.
• the recombinant nucleic acid expressing TCF4-B polypeptide is delivered to said subject with a viral vector.
• the viral vector is a retroviral vector.
• the vector is an adeno-associated virus (AAV) vector, lentiviral vector or gamma- retroviral vector.
• the vector is an AAV9 vector.
• the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins Syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome. In a further embodiment, the neurological or neurodevelopmental disease or disorder is Pitt- Hopkins Syndrome.
• the subject has one or more single nucleotide polymorphisms in a TCF4 gene.
• the subject has a chromosomal deletion including at least a portion of a TCF4 gene.
• the subject has a complete deletion of a TCF4 gene.
• the subject has a chromosomal translocation comprising at least a portion of a TCF4 gene. In still another or further embodiment of any of the foregoing embodiments, the subject has a translocation, frameshift, or non-sense mutation in a TCF4 gene. In still another or further embodiment of any of the foregoing embodiments, the subject is an infant or pediatric subject. In a further embodiment, the subject is about 16 years of age or less, about 12 years of age or less, about 8 years of age or less, about 5 years of age or less or about 2 year of age or less. In another embodiment, the subject is an adult subject.
• FIG. 1A-B shows levels of expression of TCF4 in neural progenitor cells.
• Each bar represents the TPM expression abundance (transcripts per million) in RNA sequencing libraries produced from PTHS individuals (red bars) and healthy controls, which are parents of afflicted children (black bars).
• the transcript isoforms on the horizontal axis were named according to the Ensembl database entry for the human TCF4 gene.
• FIG. 2A-C shows constructs and validation of a DNA cassette for over-expression of TCF4.
• A Schematic diagrams representing expression constructs where the sequence of the TCF4-B cDNA is under the control of a minimal promoter (minP) preceded by varying numbers of ⁇ E5 boxes.
• B Similar to A, but for GADD45G gene, one of the known targets of TCF4 in human progenitor cells. Bars representing control lines transduced with viral particles are grayed out to highlight the comparison between orange bars (normal levels of GADD45G expression) and blue bars (expression in diseased cells before and after genetic manipulation).
• Figure 4A-E provide exemplary TCF4 cassettes of the disclosure (SEQ ID NO:4-8).
• Figure 5A-E shows PTHS organoids display aberrant development and altered content of neural progenitors and cortical neurons.
• CtO pallial cortical organoids
• B Left: CtO size distribution at 4 weeks of culture in vitro, for 4 parent-child pairs (see Table 1 for a description of subjects involved in this study).
• N 4 subjects per group (indicated by different symbols according to key in Table 1), 12-30 organoids per subject.
• C Microscopy images of control and PTHS subpallial organoids (sPOs) over 4 weeks of culture in vitro. Due to the organoids’ large sizes, images at 4 weeks were taken directly from a 3.5 cm diameter plate.
• E Quantification of the content of cortical neurons expressing CTIP2 at two stages of CtO development.
• N 4 subjects (symbols), 3 batches per subject, 6 organoids per batch, 4 random ROIs per organoid. See Figure 12G for quantification of SATB2+ cells in CtOs.
• Figure 6A-J shows PTHS organoids have increased percentage of neural progenitors and decreased percentage of excitatory cortical neurons and inhibitory interneurons.
• UMAP Uniform Manifold Approximation and Projection
• Color code represents 6 annotated subpopulations: Pr-Glut, neural progenitor cells in glutamatergic lineage; IP-Glut, intermediate progenitors in glutamatergic ineage; N-Glut, glutamatergic neurons; Pr-GABA, neural progenitors in inhibitory lineage; IP-GABA, intermediate progenitors in inhibitory lineage; N-GABA, GABAergic interneurons (see also Figure 13A). Other cell types are not shown.
• B Trajectory analysis indicating the existence of separate cell differentiation lineages in CtOs and sPOs. Colormap represents progression along the pseudotime in each lineage (glutamatergic or GABAergic).
• C Comparison of content of different cell types between parent and PTHS CtOs.
• Color code is the same as in A. Black dots represent cells in other populations not depicted in A.
• D Quantification of percentage of cell types in each subpopulation in CtOs (color code is the same as in A).
• E Left: SOX2 expression levels in Pr-Glut subpopulation in CtOs; each dot represents a single cell. Right: Percentages of cells expressing SOX2 (above threshold equal to 40% of the mean).
• F Comparison of cell populations between parent and PTHS sPOs.
• G Quantification of the percentage of cell types in each subpopulation in sPOs.
• H Left: SOX2 expression levels in Pr-GABA subpopulation in sPOs. Right: Percentages of SOX2+ cells.
• FIG. 7A-H shows PTHS neurons exhibit abnormal electrophysiological properties and gene expression program.
• A Left: CtOs seeded on multi-electrode array (MEA) plate.
• MEA multi-electrode array
• D Patch-clamp electrophysiological interrogation of iPSC-derived neurons, showing reduction in spike rate (top) and intrinsic excitability (bottom) in PTHS neurons.
• N 10 (parent) or 9 (PTHS) neurons.
• E Comparison of sodium and potassium current measurements between PTHS (blue line) and parental control (orange line).
• N 10 (parent) or 9 (PTHS) neurons.
• H Expression of the same genes as in G in single cell transcriptomic data from N-GABA neurons in sPOs. Sample sizes are the same as in F. Bar graphs represent mean + SEM.
• FIG. 8A-J shows PTHS neural progenitors proliferate at a lower rate.
• A Left, Immunostaining of CtOs at week 2 for SOX2 and MAP2. Arrowheads mark rosette examples.
• (D) Live cell count in NPC proliferation assay. N 4 subjects per group (symbols), 3 independent replicates per subject.
• (E) Left: Flow cytometry assessment of EdU-positive (dividing) NPCs. Right: Percentage of EdU+ cells; N 3 subjects per group (symbols), 3 independent replicates per subject, 6 technical replicates.
• (G) Left: Staining for senescence-associated ⁇ -galactosidase (SA- ⁇ -gal) activity (green fluorescence) in NPCs. Quantification is shown on the right. N 4 subjects per group (symbols), 3 independent replicates per subject.
• FIG. 9A-K shows manipulation of Wnt signaling pathway rescues abnormal proliferation of PTHS neural progenitors.
• A Ratio of expression abundances (transcripts per million, TPM) for Wnt signaling pathway genes between parent and PTHS NPCs.
• N 4 parent-child pairs (symbols).
• B Relative expression of selected Wnt signaling genes in NPCs.
• N 4 subjects per group (symbols), 3 independent replicates per subject, 2 technical replicates.
• D Relative expression of selected Wnt genes in post-mortem PTHS cortex sample.
• FIG. 10A-L shows Mechanistic involvement of SOX genes in PTHS cellular pathophysiology.
• TPM Ratio of expression abundances
• N 4 subjects per group (symbols), 3 independent replicates per subject, 2 technical replicates.
• G shRNA-mediated SOX3 knockdown reduces progenitor proliferation.
• N 3 independent replicates (dots) per group, 3 technical replicates.
• H SOX4 expression is reduced in PTHS NPCs. Top: Expression abundance (in TPM). Bottom: Relative expression.
• N 4 subjects per group (symbols), 3 independent replicates per subject, 2 technical replicates.
• SOX4 expression is reduced in intermediate progenitors (IP-Glut) and neurons (N- Glut) in PTHS CtOs.
• N 717 (parent) and 382 (PTHS IP-Glut cells, or 1401 (parent) and 380 (PTHS) N-Glut neurons.
• FIG. 11A-H shows reversal of abnormal phenotypes in PTHS organoids subjected to genetic correction of TCF4 expression.
• A Schematic representation of CRISPR-based trans-epigenetic correction of TCF4 expression using constructs for guide RNA (gRNA), transcriptional activation module MPH and dead Cas9.
• B Top: Virus application regimen.
• E Over- expression construct showing placement of the TCF4-B coding sequence under the control of a synthetic promoter composed of minimal promoter minP and varying number of TCF4 binding sites ( ⁇ E5 boxes).
• F Top: Virus application regimen.
• G Left, Raster plot showing electrical activity of transduced 2-to-3 months-old organoids subjected to multi-electrode array (MEA) analysis. Each row represents an electrode.
• FIG. 1 Vertical red rectangles represent events of bursts of electrical activity that happen at the network level (network bursts). Right, Quantification of mean firing rate (top right) in transduced organoids over time (see also Figure 18L for raster plots), and number of network bursts (bottom).
• H Top: Virus application regimen.
• FIG. 12A-M shows PTHS iPSCs exhibit normal growth rate and can be differentiated into neurons.
• A Structure of the TCF4 exons (numbers on top of each rectangle) in different patients. White rectangles symbolize missing exons due to partial or whole gene deletion. Rectangles with thick borders represent the coding sequence in each case.
• Exons 1 and 2 are shown but they are not part of the main transcript for the TCF4 gene, called TCF4-B. Details on the types of mutation carried by each patient are given on the right (see also Table 1 for further information).
• (G) Percentage of SOX2+ cells in 4 and 10 weeks-old CtOs of parent and PTHS genotypes. N 4 subjects (symbols).
• N 4 subjects (symbols), 2 batches per subject, 6 organoids per batch, 4 random 100 x 100 ⁇ m regions of interest (ROI) per organoid.
• J Quantification of the density of cortical neurons expressing SATB2 in parent and PTHS CtOs at two stages of development in vitro.
• N 4 subjects (symbols), 3 batches per subject, 6 organoids per batch, 4 random ROIs per organoid.
• K Relative expression of neural markers in post-mortem PTHS cortex sample.
• L Quantification of percentage of CTIP2+ cells in post-mortem sample.
• M Quantification of vGLUT1 and GAD65/67 expression, as judged from number of pixels above threshold intensity per unit area in PTHS and control CtOs and sPOs.
• N 6 sections per condition (circles), 4 ROIs per section. Bar graphs represent mean + SEM.
• FIG. 13A-I shows annotation of subpopulations in single cell RNA-Seq experiments and associated controls.
• A Dot plot showing expression of selected marker genes in the six subpopulations of cells depicted in Fig. 6A.
• Pr-Glut neural progenitor cells in glutamatergic lineage; IP-Glut, intermediate progenitors in glutamatergic ineage; N-Glut, glutamatergic neurons; Pr-GABA, neural progenitors in inhibitory lineage; IP-GABA, intermediate progenitors in inhibitory lineage; N-GABA, GABAergic interneurons. ‘Others’ represent a heterogeneous group of cells not included in the previous six categories. Dot sizes are the percentages of cells in each subpopulation that have detectable expression for the corresponding gene. (B) Violin plots for marker genes shown in A, displaying range of expression in the six analyzed subpopulations of cells (and ‘Others’). Color code is the same as in Fig.
• RNA-Seq quality control data Single cell RNA-Seq quality control data. Violin plots represent the number of read counts, number of detected genes (features), and percentage of mitochondrial genes (mtRNA) in the subpopulations listed in A. Color code is the same as in Fig. 6A and ‘Others’ are shown in black.
• D UMAP showing expression of TCF4, neural lineage markers SOX2 and MAP2, mesoderm markers MIXL1 and TBXT (Brachyury), and endoderm markers CFTR and SOX17. Intensity of purple indicates relative expression level.
• Figure 14A-H shows supporting data for investigation of neurons in 2D culture.
• (C) Relative TCF4 expression levels (RT-qPCR) between iPSC-derived PTHS and parent neuronal cultures. N 4 subjects (symbols), 3 independent replicates per subject, 2 technical replicates per sample. Each PTHS sample is compared to the respective parent (expression normalized to 1).
• D Comparison of membrane capacitance between PTHS (blue circles) and parental control neurons (circles) in 2D culture via patch-clamp electrophysiological analysis.
• E Interrogation of sodium (top) and potassium (bottom) current densities, comparing PTHS (blue line) and control (orange line) neurons.
• N 10 (parent) or 9 (PTHS) neurons.
• F Heat map showing the expression levels for the 20,000 most highly expressed genes in RNA-Seq libraries of neurons from one parent and respective PTHS child (PTHS #4 in Table 1). The numbers of differentially expressed (DE) genes in the parent-child comparison are shown above the plot.
• G Dot plot results for Gene Ontology – Biological Processes (top) and Pathway analysis (bottom), for down-regulated DE genes in D. For each analysis, the top 10 categories in terms of adjusted p-value are shown.
• Dot size represents number of DE genes that fall into each classification category, dot color is the adjusted p-value, and the x-axis represents the percentage of genes in each category that are DE expressed genes in the RNA-Seq libraries. Notice the presence of genes involved in glutamatergic and GABAergic transmission.
• H MA plot for genes expressed in control and PTHS neurons. Gray dots are genes that are not statistically significantly differentially expressed between control and PTHS. Blue and red dots are statistically significant DE genes. Red dots represent genes coding for sodium or potassium channels with a log 2 fold change superior to 4 (dashed lines). Bar graphs represent mean + SEM.
• Figure 15A-N shows expression analysis in neural progenitor cells.
• N 4 independent replicates per group, 2 technical replicates per sample. Mean expression in neural progenitor group was normalized to 1.
• C Representative fluorescence microscopy image of NPCs in 2D culture after immunostaining for TCF4 (red) and NPC marker Nestin (green). Higher magnification image in inset.
• N 3 independent replicates (dots) per group, 3 technical replicates per sample. Initial seeding density is 1 ⁇ 10 5 cells.
• Right: Quantification of percentage of EdU-positive NPCs in the same groups; N 3 independent replicates per group (dots).
• N 3 independent replicates per group (dots), 2 technical replicates per sample.
• M Heat map showing the expression levels for the 20,000 most highly expressed genes in RNA-Seq libraries of NPCs from 2 parents and respective PTHS children, as an example. The numbers of differentially expressed (DE) genes in the intersection among all four parent-child comparison are shown above the plot.
• N Dot plot results for Gene Ontology – Biological Processes (top) and Pathway analysis (bottom), for down-regulated DE genes listed in M resulting from the intersection among all 4 parent-child pairs. For each analysis, the top 10 categories in terms of adjusted p-value are shown.
• Dot size represents number of DE genes that fall into each classification category, dot color is the adjusted p-value, and the x-axis represents the percentage of genes in each category that are DE expressed genes in the RNA-Seq libraries. Notice the presence of downregulated genes in the Wnt signaling pathway. Bar graphs represent mean + SEM. *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001; two- sample Welch’s t-test assuming unequal variances (E, F, and K) or ANOVA followed by Tukey-Kramer’s HSD post-hoc test (K). In L, mean gene expression was normalized to 1 in each parent + control shRNA group. Scale bars are 100 ⁇ m.
• Figure 16A-N shows additional controls for Wnt signaling manipulation in organoids.
• Right graphs represent expression levels in NPCs treated with Wnt agonist CHIR99021. Bar graphs represent mean + SEM.
• Pr-Glut neural progenitor cells in glutamatergic lineage
• IP-Glut intermediate progenitors in glutamatergic ineage
• N-Glut glutamatergic neurons
• Pr-GABA neural progenitors in inhibitory lineage
• IP-GABA intermediate progenitors in inhibitory lineage
• N-GABA GABAergic interneurons.
• NPCs used were from parent #4 line (Table 1).
• Color code for violin plots is the same as in B.
• FIG. 18A-O provide details on genetic correction of TCF4 expression.
• A Normalized transcriptional activity from alternative promoters in the TCF4 locus (red bars), in parent and PTHS samples (first row). The second row depicts a schematic representation of the TCF4 locus, showing the location of its exons. The position of the designed gRNAs (blue arrows) is shown for the three chosen TCF4 alternative promoters, upstream of exons 3b, 8a and 10a.
• TCF4 protein isoforms TCF4-B, TCF4-D, and TCF4-A respectively.
• B Testing of transactivation efficiency of five TCF4 gRNAs on the expression of TCF4 in SH-S5Y5 cells.
• scr gRNA control scrambled gRNA; no gRNA, empty expression construct.
• N 4 independent replicates, 3 technical replicates.
• TCF4 expression correction increases CNTNAP2 in SH-S5Y5 cells.
• N 4 independent replicates, 3 technical replicates.
• Relative expression (RT- qPCR) of TCF4 target gene KCNQ1 is greatly increased in PTHS neurons.
• N 4 subjects per group (symbols), 3 independent replicates per subject, 2 technical replicates per sample.
• TCF4 expression correction decreases KCNQ1 expression in transfected SH-S5Y5 cells.
• D Top, Increase in TCF4 expression levels after TCF4 correction. Bottom, ratio between expression abundance for the normal (C at position 959 of the coding sequence) and mutated (T at that position) TCF4 alleles.
• N 3 independent replicates per group (dots), 10 pooled organoids per sample.
• G Relative expression of DCX in post-mortem PTHS cortex tissue.
• N 3 biological replicates per subject, for organoids from parent/child pairs #1 and #4.
• O Current mechanistic model to explain aberrant cellular phenotypes in PTHS neural structures. Due to TCF4 haploinsufficiency in PTHS, Wnt signaling activity diminishes, in turn leading to decreased SOX3 expression in NPCs, impairing proliferation. Moreover, SOX4 was also downregulated in PTHS cells, which suggests it impairs neuronal differentiation and content in PTHS neural tissue.
• scr gRNA scrambled (control) guide RNA. Bar graphs represent mean + SEM.
• Transcription Factor 4 encodes a helix-loop-helix transcription factor implicated in several aspects of neural development, including neurogenesis, cell survival, cell cycle regulation, neuronal differentiation, neural lineage commitment, and neuronal excitability. Numerous alternative transcripts are transcribed from the TCF4 locus, some of which are highly expressed during brain development. [0038] Many studies found TCF4 gene variants to be genetically associated with a range of neuropsychiatric diseases, namely, schizophrenia, bipolar disorder, post-traumatic stress disorder, and major depression disorder.
• PTHS includes severely debilitating clinical symptoms, such as profound cognitive impairment, developmental delay, generalized hypotonia, breathing abnormalities, seizures, lack of speech, typical autistic behaviors, chronic constipation, and a distinctive facial gestalt.
• TCF4 mutations which may be large chromosomal deletions spanning the whole gene, partial gene deletions, translocations, frameshift, nonsense, splice site or missense mutations, most of which are regarded as loss-of-function mutations that impair TCF4’s transcriptional activity.
• TCF4 transgenic mouse lines carrying TCF4 mutations
• Some of these lines display PTHS-like phenotypes, including deficits in social interaction, associative memory, sensorimotor gating, and altered gastrointestinal transit. Examination of brain tissue from these animals revealed abnormal cortical development, altered neuronal migration during hippocampal and pontine nuclei development, and impaired oligodendrocyte differentiation.
• mice do not display the full array of clinically relevant symptoms, including many of the most debilitating ones such as severe motor delay and hypotonia. Moreover, only a few of these mouse lines carry heterozygous mutations like those found in PTHS patients.
• NPCs neural progenitor cells
• iPSCs patient-derived induced pluripotent stem cells
• patterned cortical organoids including pallium and subpallium-type organoids containing excitatory and inhibitory neuronal lineages were also generated.
• PTHS cortical organoids are aberrant in size and structure, containing a higher percentage of NPCs and fewer neurons than control organoids.
• PTHS-derived NPCs exhibit reduced proliferation and impaired ability to differentiate into neurons.
• molecular probing of these neural systems unraveled a pathological mechanism through which mutations in TCF4 lead to reduced canonical Wnt/ ⁇ -catenin signaling, which then leads to reduced expression of SOX transcription factors, resulting in cellular abnormalities.
• the disclosure also demonstrates the pharmacological manipulation of Wnt signaling and that genetically corrected expression of TCF4 itself, results in restoration of neural characteristics at the cellular level.
• the data of the dislcosure reveal novel cellular and molecular PTHS phenotypes in relevant human cell types and show that these are reversible, providing routes for therapeutic intervention in patients with PTHS or other genetic diseases associated with TCF4.
• the patient-derived brain organoids of two types (pallial and subpallial) in combination with neural 2D culture systems were used to investigate the pathophysiology and aberrant molecular mechanisms associated with clinically relevant mutations in TCF4.
• PTHS NPCs proliferate at a slower rate and display impaired neuronal differentiation.
• PTHS organoids exhibit abnormal electrical properties and contain fewer cortical neurons ( Figures 5-7).
• the disclosure demonstrate a model ( Figure 18O) according to which the pathological molecular mechanism includes a chain of molecular events that leads from TCF4 loss-of-function mutations to decreased Wnt signaling activity in the lowly proliferative PTHS NPCs ( Figure 8).
• Wnt signaling is mechanistically downstream of TCF4, in a clear cascade that is dysregulated in patient cells, a result that provides for therapeutic interventions and a better understanding of disease pathology.
• Pharmacological activation of Wnt signaling in PTHS samples can completely correct the aberrant NPC proliferation phenotype, the morphology of organoids, and the expression of senescence markers and of downstream molecular players (Figure 9), providing for pharmacological therapy.
• the disclosure also provides mechanistic evidence that Wnt signaling controls the expression of two SOX transcription factors, SOX3 and SOX4 ( Figure 10).
• SOX4 expression was found to be diminished in PTHS NPCs and in intermediate progenitors and neurons of PTHS organoids (Figure 10).
• SOX4 transcription factor is known to participate in neuronal differentiation, which is consistent with the findings that PTHS organoids contain fewer neurons, and that patient-derived NPCs have slower differentiation rates than control cells, a phenotype also observed when the expression of SOX4 was knocked down in differentiating neuronal cultures ( Figure 10). It is hypothesized that TCF4 haploinsufficiency leads to SOX4 downregulation, resulting in decreased neuronal differentiation (Figure 18O).
• the deficits in cell proliferation and differentiation are factors contributing to the lower content of cortical neurons that are observed in both PTHS organoids and in the post-mortem brain tissue from a PTHS individual. It should be noted that the decreased neuronal content in the organoids and post-mortem sample are consistent with the detection via MRI of small or absent corpus callosum in some PTHS children. It is noteworthy that the PTHS neural tissue exhibits such level of disorganization and reduction in the content of cortical neurons, and it will be interesting to determine which clinical symptoms arise from these abnormalities or whether this effect manifests during neural development or in the fully formed nervous system.
• Tcf4 full knockout mice carrying homozygous loss-of- function mutations exhibit substantially altered populations of cortical neurons, including SATB2- and BRN2-expressing cells, but these alterations are significantly milder in Tcf4 +/- mice, which exhibit phenotypes certainly less prominent than the levels of tissue disorganization and altered gene expression in the post- mortem PTHS cortical sample ( Figures 5 and 12). This suggests that mouse models are not ideal for studying TCF4 heterozygous mutations, like those seen in PTHS patients.
• the data provided herein show severe impairment of cortical neuron differentiation in PTHS organoids, in keeping with the observations in post-mortem brain tissue, signifying that brain organoid models provide a novel window of opportunity to observe neurodevelopmental abnormalities relevant to PTHS.
• the difference in phenotypic severities between the brains of Tcf4 +/- mice and PTHS human organoids or post-mortem sample may reflect important evolutionary distinctions between human and rodent neurodevelopment and, thus, justify the use of patient-derived systems to better understand pathophysiology in the context of this and other neurodevelopmental conditions.
• the disclosure also demonstrates a series of genetic manipulative experiments to enhance the expression of TCF4 and therefore correct its expression in PTHS neural tissue in vitro (Figure 11).
• the methods and compositions of the disclosure also provide benefit in the comprehension of other genetic diseases, including autosomal recessive intellectual disability conditions classified as Pitt-Hopkins-like syndromes, which are caused by mutations in the TCF4 downstream target genes NRXN1 ⁇ and CNTNAP2, as well as schizophrenia and other diseases that may have TCF4 as a genetic component.
• the practice of the technology described herein will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, e.g., Green and Sambrook eds. (2012) Molecular Cloning: A Laboratory Manual, 4th edition; the series Ausubel et al. eds.
• a "protein” or “polypeptide”, which terms are used interchangeably herein, comprises one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds.
• the term “about,” as used herein can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which can depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean plus or minus 10%, per the practice in the art.
• “about” can mean a range of plus or minus 20%, plus or minus 10%, plus or minus 5%, or plus or minus 1% of a given value.
• the term can mean within an order of magnitude, within 5-fold, or within 2-fold, of a value.
• variations can include an amount or concentration of 20%, 10%, 5%, 1 %, 0.5%, or even 0.1 % of the specified amount.
• each intervening number there between with the same degree of precision is explicitly contemplated.
• the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
• AAV adeno-associated virus
• AAV adeno-associated virus
• Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types. At least 11, sequentially numbered, are disclosed in the prior art.
• Non-limiting exemplary serotypes useful for the purposes disclosed herein include any of the 11 serotypes, e.g., AAV2 and AAV9.
• lentivirus as used herein refers to a member of the class of viruses associated with this name and belonging to the genus lentivirus, family Retroviridae.
• Cas9 can refer to a CRISPR associated endonuclease referred to by this name.
• Non-limiting exemplary Cas9s include Staphylococcus aureus Cas9, nuclease dead Cas9, and orthologs and biological equivalents each thereof.
• Orthologs include but are not limited to Streptococcus pyogenes Cas9 (“spCas9”), Cas 9 from Streptococcus thermophiles, Legionella pneumophilia, Neisseria lactamica, Neisseria meningitides, Francisella novicida; and Cpf1 (which performs cutting functions analogous to Cas9) from various bacterial species including Acidaminococcus spp. and Francisella novicida U112.
• spCas9 Streptococcus pyogenes Cas9
• Cas 9 from Streptococcus thermophiles
• Legionella pneumophilia Neisseria lactamica
• Neisseria meningitides Neisseria meningitides
• Francisella novicida Francisella novicida
• Cpf1 which performs cutting functions analogous to Cas9 from various bacterial species including Acidaminococcus spp. and Francisella novici
• Cas9 may further refer to equivalents of the referenced Cas9 having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto, including but not limited to other large Cas9 proteins.
• the Cas9 is derived from Campylobacter jejuni or another Cas9 orthologs 1000 amino acids or less in length.
• the term “cassette” or “expression cassette” refers to a modular polynucleotide construct that can comprise one or more domains such that the cassette can be effectively transferred between different vector systems and when expressed provides a substantially similar encoded construct or expression profile.
• TCF4 cassette is cassette containing a TCF4 coding sequence.
• a TCF4 cassette comprises at least one mini-promoter cassette or a core-promoter cassette operably linked to a polynucleotide encoding a TCF4 polypeptide, suach as a TCF4-B polypeptide.
• the TCF4 cassette can comprise one or more ⁇ E5 boxes.
• a "TCF4 cassette” can comprise a single mini-promoter operably linked to a coding sequence for a TCF4 polypeptide (e.g., a TCF4-B polypeptide), and can comprise one or more ⁇ E5 boxes operably associated with a mini- promoter.
• cassettes are provided in Figure 4A-E (SEQ ID NOs: 4, 5, 6, 7, and 8, respectively). It will be recognized that the sequences provided in Figure 4 can be varied by 1% to 15% (e.g., 85%-99% identical to the sequences in Figure 4A-D or E so long as the variants can still drive transcription of a functional TCF4 polypeptide.
• CRISPR can refer to a technique of sequence specific genetic manipulation relying on the clustered regularly interspaced short palindromic repeats pathway. CRISPR can be used to perform gene editing and/or gene regulation, as well as to simply target proteins to a specific genomic location.
• Gene editing can refer to a type of genetic engineering in which the nucleotide sequence of a target polynucleotide is changed through introduction of deletions, insertions, single stranded or double stranded breaks, or base substitutions to the polynucleotide sequence.
• CRISPR-mediated gene editing utilizes the pathways of nonhomologous end-joining (NHEJ) or homologous recombination to perform the edits.
• Gene regulation can refer to increasing or decreasing the production of specific gene products such as protein or RNA.
• the term “deficiency” as used herein can refer to lower than normal (physiologically acceptable) levels of a particular agent. In context of a protein, a deficiency can refer to lower than normal levels of the full-length protein.
• domain can refer to a particular region of a polypeptide or polynucleotide and is associated with a particular function.
• a domain which binds an RNA binding protein can refer to the domain of a polynucleotide that binds one or more polypeptides that control expression.
• the term “encode” as it is applied to polynucleotides can refer to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof.
• the antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
• gRNA or “guide RNA” as used herein can refer to guide RNA sequences used to target specific polynucleotide sequences for gene editing employing the CRISPR technique. Techniques of designing gRNAs and donor therapeutic polynucleotides for target specificity are well known in the art. For example, Doench, J., et al. Nature biotechnology 2014; 32(12):1262-7, Mohr, S. et al.
• gRNA comprises or alternatively consists essentially of, or yet further consists of a fusion polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRIPSPR RNA (tracrRNA); or a polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRIPSPR RNA (tracrRNA).
• a gRNA is synthetic (Kelley, M. et al. (2016) J of Biotechnology 233 (2016) 74-83).
• Homology or “identity” or “similarity” can refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the disclosure.
• a particular sequence can be at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any sequence described herein (which can correspond with a particular nucleic acid sequence described herein), such particular sequence can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
• the parameters can be set such that the percentage of identity is calculated over the full length of the reference sequence and that gaps in homology of up to 5% of the total reference sequence are allowed.
• identity between a reference sequence query sequence, i.e., a sequence of the disclosure
• subject sequence also referred to as a global sequence alignment
• FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
• the percent identity can be corrected by calculating the number of residues of the query sequence that are lateral to the N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence.
• a determination of whether a residue is matched/aligned can be determined by results of the FASTDB sequence alignment. This percentage can be then subtracted from the percent identity, calculated by the FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score can be used for the purposes of this embodiment. In some cases, only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence are considered for this manual correction. For example, a 90 residue subject sequence can be aligned with a 100 residue query sequence to determine percent identity.
• the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
• the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity can be 90%.
• a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
• Hybridization can refer to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
• the complex can comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these.
• a hybridization reaction can constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
• Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about 10x SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC.
• Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC.
• Examples of high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about 0.1x SSC; formamide concentrations of about 55% to about 75%; and wash solutions of about lx SSC, 0.1x SSC, or deionized water.
• hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes.
• isolated can refer to molecules or biologicals or cellular materials being substantially free from other materials.
• the term “isolated” can refer to nucleic acid, such as DNA or RNA, or protein or polypeptide (e.g., an antibody or derivative thereof), or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source.
• isolated also can refer to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
• an “isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and may not be found in the natural state.
• isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
• isolated is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
• protein protein
• peptide and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics.
• the subunits can be linked by peptide bonds. In another embodiment, the subunit can be linked by other bonds, e.g., ester, ether, etc.
• a protein or peptide can contain at least two amino acids and no limitation is placed on the maximum number of amino acids which can comprise a protein’s or peptide's sequence.
• amino acid can refer to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
• fusion protein can refer to a protein comprised of domains from more than one naturally occurring or recombinantly produced protein, where generally each domain serves a different function.
• linker can refer to a protein fragment that is used to link these domains together – optionally to preserve the conformation of the fused protein domains and/or prevent unfavorable interactions between the fused protein domains which can compromise their respective functions.
• polynucleotide and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown.
• polynucleotides a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
• a polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
• modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide.
• the sequence of nucleotides can be interrupted by non-nucleotide components.
• a polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.
• the term also can refer to both double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of this disclosure that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
• the polynucleotides described herein include “genes” and that the nucleic acid molecules described herein include “vectors” or "plasmids.”
• a polynucleotide encoding a TCF4 can be encoded by an TCF4 gene or homolog thereof.
• the term “gene”, also called a “structural gene” refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non- transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed.
• the transcribed region of the gene may include untranslated regions, including introns, 5'-untranslated region (UTR), and 3'-UTR, as well as the coding sequence.
• the term "nucleic acid” or “recombinant nucleic acid” refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). Any sequence comprising thymine (T) as provided herein can be converted to an RNA sequence by replacing the “T” with “U” (uracil). Accordingly, both DNA and RNA sequences are contemplated herein.
• RNA or RNA compounds differing in their nucleotide sequences can be used to encode a given amino acid sequence of the disclosure.
• the native DNA or RNA sequence encoding TCF4 is only an illustrative embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins utilized in the methods of the disclosure.
• a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity.
• a nucleic acid of the disclosure can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
• the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
• oligonucleotides corresponding to nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
• an isolated nucleic acid molecule encoding a polypeptide homologous to the TCF4 polypeptide described herein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence encoding the particular polypeptide, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into the polynucleotide by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis. In contrast to those positions where it may be desirable to make a non- conservative amino acid substitutions, in some positions it is preferable to make conservative amino acid substitutions.
• a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
• Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
• polynucleotide sequence is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching.
• the term “recombinant expression system” refers to a genetic construct or constructs for the expression of certain genetic material formed by recombination; the term “construct” in this regard is interchangeable with the term “vector” as defined herein.
• the term “restoring” in relation to expression of a protein can refer to the ability to establish expression of full length protein where previously protein expression was truncated due to mutation.
• Transformation refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including viral delivery, electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), etc.
• the terms “treating,” “treatment” and the like are used herein to mean obtaining a desired pharmacologic and/or physiologic effect.
• the effect can be prophylactic in terms of completely or partially preventing a disease, disorder, or condition or sign or symptom thereof, and/or can be therapeutic in terms of a partial or complete cure for a disorder and/or adverse effect attributable to the disorder.
• the term “vector” can refer to a nucleic acid construct deigned for transfer between different hosts, including but not limited to a plasmid, a virus, a cosmid, a phage, a BAC, a YAC, etc.
• a “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro.
• plasmid vectors can be prepared from commercially available vectors.
• viral vectors can be produced from baculoviruses, retroviruses, adenoviruses, AAVs, etc. according to techniques known in the art.
• the viral vector is a lentiviral vector. Examples of viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like.
• Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves (O'Keefe et al. (2009) Proc. Nat. Acad. Sci. USA 106(15):6099-6104).
• Alphavirus vectors such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See, Schlesinger & Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al. (1999) Nat. Med. 5(7):823-827.
• a vector construct can refer to the polynucleotide comprising the retroviral genome or part thereof, and a gene of interest. Further details as to modern methods of vectors for use in gene transfer can be found in, for example, Kotterman et al. (2015) Viral Vectors for Gene Therapy: Translational and Clinical Outlook Annual Review of Biomedical Engineering 17. Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art.
• PTHS can be caused by heterozygous mutations in the TCF4 gene, which encodes a basic helix-loop-helix (bHLH) transcription factor.
• bHLH basic helix-loop-helix
• PTHS patients exhibit severe intellectual disability and cognitive impairment, pronounced developmental delay, complete absence of spoken language, and a characteristic facial gestalt. Most patients display hypotonia, motor delay, and/or ataxic gait. A common manifestation is constipation, probably due to enteric nervous system anomalies.
• the TCF4 gene is located on chromosome 18 (18q21.2) and encompasses 18 coding exons. Its longest and most extensively studied alternatively spliced transcript encodes the TCF4-B protein isoform, a bHLH transcription factor highly expressed throughout the brain during development.
• the TCF4 protein binds to E-box regulatory sequences (consensus CANNTG) and has been implicated in numerous developmental processes in the immune system, in epithelial–mesenchymal transition, and in the nervous system.
• TCF4 human gene TCF4
• OMIM 602272 synonyms E2-2, ITF2, PTHS, SEF2, and bHLHb19
• PTHS Pitt-Hopkins Syndrome
• TCF4 is also a top risk for Schizophrenia based on WGAS studies.
• the disclosure provides a plurality of expression cassettes that can be used with suitable DNA constructs and vectors to deliver and/or increase TCF4 or the expression of TCF4.
• an extra-copy of the TCF4 coding sequence e.g., a TCF4 gene
• the DNA constructs comprises the coding sequence of the TCF4-B transcript or variant is typically preceded by DNA regulatory elements that allow control of the expression rate once the construct is inserted in target cells.
• TCF4-B is used as an example based on its high expression levels in neural progenitor cells and neurons ( Figure 1).
• the expression cassette TCF4-B cDNA sequence can be placed under the control of a synthetic minimal promoter (minP) preceded by varying numbers (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 3, 14, 15) of regulatory sequences recognized by the TCF4 protein itself, known as ⁇ E5 boxes ( Figure 2).
• minP synthetic minimal promoter
• ⁇ E5 boxes Figure 2
• This approach provides for expression of the TCF4 gene only in cell types where it is normally found.
• the results show that the levels of TCF4 expression can be manipulated by changing the number of ⁇ E5 boxes, providing controllable overexpression of the TCF4 gene in target cells ( Figure 2).
• these DNA constructs have been used in lentiviral particles to infect (transduce) diseased target cells derived from PTHS patients.
• the constructs have been introduced into neural progenitor cells (NPCs).
• NPCs neural progenitor cells
• the experiments verified that they can enhance TCF4 expression in these cells (Figure 3A), increasing its expression level 2 to 5-fold, depending on the number of ⁇ E5 boxes in the particular construct tested.
• this genetic manipulation corrected the expression of TCF4 target genes, such as GADD45G ( Figure 3B), bringing its levels back to normal levels seen in control cell lines ( Figure 3B).
• a cassette of the disclosure can comprise a mini-promoter operably linked to a polynucleotide that is at least 85%, 90%, 92%, 95%, 98%, 99% or 100% identical to a TCF4 (TCF4-B) cDNA: ATGCATCACCAACAGCGAATGGCTGCCTTAGGGACGGACAAAGAGCTGAGTGATTTACTGGATTTCA GTGCGATGTTTTCACCTCCTGTGAGCAGTGGGAAAAATGGACCAACTTCTTTGGCAAGTGGACATTT TACTGGCTCAAATGTAGAAGACAGAAGTAGCTCAGGGTCCTGGGGGAATGGAGGACATCCAAGCCCG TCCAGGAACTATGGAGATGGGACTCCCTATGACCACATGACCAGCAGGGACCTTGGGTCACATGACA ATCTCTCTCCACCTTTTGTCAATTCCAGAATACAAAGTAAAACAGAAAGGCTCATACTCATCTTA TGGGAGAATCAAACTTACAGGGTTGCCACCAG
• a ⁇ E5 box has the sequence: cacctg; and in some embodiments, the ⁇ E5 is spaced from the next adjacent ⁇ E5 by about 3 to about 10 nucleotides, such as from about 4 to about 8 nucleotide (e.g., about 6 nucleotides). such that it can comprise a sequence of SEQ ID NO:10).
• An exemplary ⁇ E5 is represented by SEQ ID NO:10.
• An exemplary minimal promoter includes agagggtatataatggaagctcgacttccag (SEQ ID NO:3). Other minimal promoters or core promoters are described herein.
• the minimal promoter of SEQ ID NO:3 is separated from ⁇ E5 domain by spacers (e.g., caagaa).
• the cassette can be positioned into a suitable vector by recombinant molecular biology techniques to promote delivery to a cell.
• the suitable vector can be a DNA construct or a viral vector (e.g., adeno-viral vectors, retroviral vectors such lentiviral vectors and gamma viral vectors).
• Most promoters are rather large; typically over 600 bp and a full sized promoter can be many kilobases.
• a suitable minipromoter can comprise SEQ ID NO:3.
• Other suitable minimporomoters can be derived from "core" promoters described by Kadanaga and collaborators (Juven-Gershon et al., Nature Methods, 11:917-922, 2006). These core promoters are based on the adenovirus major late (AdML) and cytomegalovirus (CMV) major immediate early genes, and the synthetic "super core promoter"-1 (SCP1).
• cellular core promoters include, but are not limited to, the human home oxygenase proximal promoter (121 bp; Tyrrell et al., Carcinogenesis, 14: 761-765, 1993), the CTP:phosphocholine cytidylyltransferase (CCT) promoter (240 bp; Zhou et al., Am. J. Respir. Cell Mol. Biol., 30: 61-68, 2004); the Human ASK (for Activator of S phase Kinase, also known as HsDbf4 gene, 63 bp; Yamada et al. J. Biol.
• these "core" promoters can be used as a starting point for further modifications to improve the activity of the promoter. For example, such modifications including the addition of other domains and sequences to the "core" promoter to improve functionality (e.g., enhancers, Kozak sequences and the like). In one embodiment, such further modifications can include the addition of enhancers or transcription binding protein sequence.
• the length of these core promoters are approximately 30- 80 bp each, thus, when used in a viral vector provide ample additional capacity for transgene sequence.
• the use of such promoters can give useful expression of genes such as a TCF4 gene or coding sequence (e.g., SEQ ID NO:1).
• various promoter-components can be used to optimize expression and stability of vectors and cassettes.
• Such optimized core promoters provide a more effective expression and stability of the viral polynucleotide.
• "designer" promoters can comprise a core promoter that has been further modified to include one or more additional elements suitable for stability and expression.
• a “core promoter” refers to a minimal promoter comprising about 30-100 bp and lacks enhancer elements.
• core promoters include, but are not limited to, SCP1, AdML and CMV core promoters and the promoter of SEQ ID NO:3.
• An exemplary promoter can comprise SEQ ID NO:3.
• Core promoters include certain viral promoters. Viral promoters, as used herein, are promoters that have a core sequence but also usually some further accessory elements.
• the early promoter for SV40 contains three types of elements: a TATA box, an initiation site and a GC repeat (Barrera-Saldana et al., EMBO J, 4:3839-3849, 1985; Yaniv, Virology, 384:369-374, 2009).
• the TATA box is located approximately 20 base-pairs upstream from the transcriptional start site.
• the GC repeat regions is a 21 base-pair repeat containing six GC boxes and is the site that determines the direction of transcription. This core promoter sequence is around 100 bp.
• Adding an additional 72 base-pair repeats, thus making it a "small-promoter,” is useful as a transcriptional enhancer that increase the functionality of the promoter by a factor of about 10.
• the SP1 protein interacts with the 21 bp repeats it binds either the first or the last three GC boxes. Binding of the first three initiates early expression, and binding of the last three initiates late expression.
• the function of the 72 bp repeats is to enhance the amount of stable RNA and increase the rate of synthesis. This is done by binding (dimerization) with the AP1 (activator protein 1) to give a primary transcript that is 3' polyadenylated and 5' capped.
• a core promoter typically encompasses -40 to +40 relative to the +1 transcription start site (Juven-Gershon and Kadonaga, Dev. Biol. 339:225-229, 2010), which defines the location at which the RNA polymerase II machinery initiates transcription.
• RNA polymerase II interacts with a number of transcription factors that bind to DNA motifs in the promoter.
• TFIIA transcription factor for RNA polymerase IIA
• TFIIB transcription factor for RNA polymerase IIB
• TFIID transcription factor for RNA polymerase IIA
• TFIIE transcription factor for RNA polymerase IIA
• TFIIH transcription factor for RNA polymerase IIH
• the pRC/CMV core promoter consists of a TATA box and is 81 bp in length;
• the CMV core promoter consists of a TATA box and a initiator site;
• the SCP synthetic core promoters (SCP1 and SCP2) consist of a TATA box, an Inr (initiator), an MTE site (Motif Ten Element), and a DPE site (Down stream promoter element) and is about 81 bp in length.
• the SCP synthetic promoter has improved expression compared to the simple pRC/CMV core promoter.
• mini-promoter refers to a regulatory domain that promotes transcription of an operably linked gene or coding nucleic acid sequence.
• the mini- promoter includes the minimal amount of elements necessary for effective transcription and/or translation of an operably linked coding sequence.
• a mini-promoter can comprise a "core promoter” in combination with additional regulatory elements or a "modified core promoter”.
• the mini- promoter or modified core promoter will be about 30-600 bp in length while a core promoter is typically less than about 100 bp (e.g., about 30-80 bp).
• the cassette can optionally comprise an enhancer element or another element either upstream or downstream of the core promoter sequence that facilitates expression of an operably linked coding sequence above the expression levels of the core promoter alone.
• mini-promoters e.g., modified core promoters
• the disclosure provides mini-promoters (e.g., modified core promoters) derived from cellular elements as determined for "core promoter" elements that allow ubiquitous expression at significant levels in target cells and are useful for stable incorporation into vectors, in general, and viral vectors, in particular, to allow efficient expression of transgenes.
• mini-promoters comprising core promoters plus minimal enhancer sequences and/or Kozak sequences to allow better gene expression compared to a core-promoter lacking such sequences that are still under 200, 400 or 600 bp.
• Such mini-promoters include modified core promoters and naturally occurring tissue specific promoters such as the elastin promoter (specific for pancreatic acinar cells, (204 bp; Hammer et al., Mol Cell Biol., 7:2956-2967, 1987) and the promoter from the cell cycle dependent ASK gene from mouse and man (63-380 bp; Yamada et al., J. Biol. Chem., 277: 27668-27681, 2002).
• Ubiquitously expressed small promoters also include viral promoters such as the SV40 early and late promoters (about 340 bp), the RSV LTR promoter (about 270 bp) and the HBV X gene promoter (about 180 bp) (e.g., R Anish et al., PLoS One, 4: 5103, 2009) that has no canonical "TATTAA box" and has a 13 bp core sequence of 5'-CCCCGTTGCCCGG-3'.
• viral promoters such as the SV40 early and late promoters (about 340 bp), the RSV LTR promoter (about 270 bp) and the HBV X gene promoter (about 180 bp) (e.g., R Anish et al., PLoS One, 4: 5103, 2009) that has no canonical "TATTAA box" and has a 13 bp core sequence of 5'-CCCCGTTGCCCGG-3'.
• mini-promoters either alone or including additional elements for expression can be used in various cassettes and vectors including replication competent and incompetent viral vectors to express a TCF4 coding sequence (e.g., SEQ ID NO:1).
• the disclosure provides a cassette that can be incorporated into an expression vector or viral vectors.
• Various vectors are known and the cloning of the cassette into such expression vectors or viral vectors can be performed.
• some viral vectors tolerate cloning of a cassette into the long terminal repeats (LTRs).
• Other vectors tolerate cloning of the cassette downstream of the envelope gene, but upstream of the 3’ LTR.
• Another suitable delivery vehicle for the CNS comprises nanoparticles, typically having a size of less than 200 nm, or less than about 150 nm, or less than about 100 nm. These may include lipid-based nanoparticles, polymer nanoparticles, dendrimers and inorganic nanoparticles, some of which may be tailored to pass through the blood brain barrier (BBB).
• BBB blood brain barrier
• the delivery system actively targets delivery by using ligands of transporters or receptors to enhance nanoparticle uptake across the BBB.
• the preferred pathway for this approach is receptor (or transporter)-mediated transcytosis by which a cargo (e.g., nanoparticles) transports between the apical and basolateral surface in the brain ECs.
• a cargo e.g., nanoparticles
• low-density lipoproteins undergo transcytosis through the ECs by a receptor-mediated process, bypassing the lysosomal compartment and releasing at the basolateral surface of the brain side.
• BBB contains transporters to amino acids
• Another vehicle for brain delivery is exosomes which are small extracellular vesicles secreted by cells.
• the disclosure provides methods and compositions for treating and/or reducing the symptoms of a neurological or neurodevelopmental disease and disorder that is associated with the aberrant expression of TCF4 in neuronal cells of the central nervous system (CNS), or peripheral nervous system (PNS), by administering an effective amount of a construct comprising a TCF4 cassette of the disclosure such that the cassette is expressed by the neuronal cell.
• the neurological or neurodevelopmental disease or disorder may also be associated with defective or abnormal TCF4 transcription factor gene expression and/or protein function in the neuronal cells, e.g., through mutation or haploinsufficiency.
• Such neurological or neurodevelopmental diseases and disorders encompass, for example, Pitt-Hopkins Syndrome (PTHS), schizophrenia, autism, autism spectrum disorder, etc.
• a TCF4 cassette can be designed such that a construct comprising the cassette is ectopically expressed in the neuronal cells.
• ectopic expression refers to the expression and/or activity of protein in cells and/or tissues in which it is not normally expressed. In the instant case, aberrant, abnormal, or atypical expression or activity of a TCF4.
• the disclosure provides a method of treating and/or reducing the symptoms of a neurological or neurodevelopmental disease or disorder comprising delivering a TCF4 cassette and expressing the cassette to treat and/or reduce the symptoms of the neurological or neurodevelopmental disease or disorder.
• a vector comprising a TCF4 cassette is an AAV9 vector having a sequence of SEQ ID NO:9 or a sequence that is at least 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% identical to SEQ ID NO:9.
• the neurological or neurodevelopmental disease or disorder is associated with defective or abnormal TCF4 transcription factor gene expression and/or protein function in the neuronal cells.
• the subject in need has, is suspected of having, or is at risk of (for example, has been identified as having a mutation in TCF4) having such a neurological or neurodevelopmental disease or disorder.
• the neurological or neurodevelopmental disease or disorder is Pitt- Hopkins Syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome, etc.
• the disclosure also provides a method of treating and/or reducing the symptoms of a neurological or neurodevelopmental disease or disorder that is associated with abnormal or defective neuronal TCF4 expression and/or function, in a subject in need, by administering to the subject a therapeutically effective amount of a TCF4 construct of the disclosure (e.g., a vector comprising a TCF4 cassette).
• a TCF4 construct of the disclosure e.g., a vector comprising a TCF4 cassette.
• the disclosure also provides pharmaceutical compositions for the administration of a vector and/or cassette of the disclosure can be conveniently presented in dosage unit form and can be prepared by any of the methods well known in the art of pharmacy.
• compositions can be, for example, prepared by uniformly and intimately bringing the vector and/or a cassette-containing composition provided herein into association with a liquid carrier, a finely divided solid carrier or both.
• the compound provided herein is included in an amount sufficient to produce the desired therapeutic effect.
• Systemic formulations include those designed for administration by injection (e.g., subcutaneous, intravenous, infusion, intramuscular, intracerebral, intraspinal, intrathecal, or intraperitoneal injection) as well as those designed for transdermal, transmucosal, oral, or pulmonary administration.
• Useful injectable preparations include sterile suspensions, solutions, or emulsions of the compounds provided herein in aqueous or oily vehicles.
• the compositions can also contain formulating agents, such as suspending, stabilizing, and/or dispersing agents.
• the formulations for injection can be presented in unit dosage form, e.g., in ampules or in multidose containers, and can contain added preservatives.
• the injectable formulation can be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, and dextrose solution, before use.
• the composition provided herein can be dried by any art-known technique, such as lyophilization, and reconstituted prior to use.
• administering can be effected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and can vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of administration are known to those of skill in the art and can vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue.
• Administration can refer to methods that can be used to enable delivery of compounds or compositions to the desired site of biological action (such a DNA constructs, viral vectors, or others). These methods can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), intracerebral and intraspinal.
• a subject can administer the composition in the absence of supervision.
• a subject can administer the composition under the supervision of a medical professional (e.g., a physician, nurse, physician’s assistant, orderly, hospice worker, etc.).
• a medical professional can administer the composition.
• a cosmetic professional can administer the composition.
• Administration or application of a composition disclosed herein can be performed for a treatment duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 days consecutive or nonconsecutive days.
• a treatment duration can be from about 1 to about 30 days, from about 2 to about 30 days, from about 3 to about 30 days, from about 4 to about 30 days, from about 5 to about 30 days, from about 6 to about 30 days, from about 7 to about 30 days, from about 8 to about 30 days, from about 9 to about 30 days, from about 10 to about 30 days, from about 11 to about 30 days, from about 12 to about 30 days, from about 13 to about 30 days, from about 14 to about 30 days, from about 15 to about 30 days, from about 16 to about 30 days, from about 17 to about 30 days, from about 18 to about 30 days, from about 19 to about 30 days, from about 20 to about 30 days, from about 21 to about 30 days, from about 22 to about 30 days, from about 23 to about 30 days, from about 24 to about 30 days, from about 25 to about 30 days, from about 26 to about 30 days, from about 27 to about 30 days, from about 28 to about 30 days, or from about 29 to about 30 days.
• composition disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times a day. In some cases, administration or application of composition disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week.
• composition disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 times a month.
• a composition can be administered/applied as a single dose or as divided doses.
• the compositions described herein can be administered at a first time point and a second time point.
• a composition can be administered such that a first administration is administered before the other with a difference in administration time of 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 4 days, 7 days, 2 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more.
• a “composition” typically intends a combination of the active agent, e.g., a TCF4 cassette of this disclosure, typically in a vector such as a viral vector (e.g., and AAV9 vector), and a naturally-occurring or non-naturally-occurring carrier, inert or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
• the composition comprises a sequence that is at least 80%-100% identical to SEQ ID NO:9.
• Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1- 99.99% by weight or volume.
• Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
• Representative amino acid components which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like.
• Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
• monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like
• disaccharides such as lactose, sucrose
• compositions used in accordance with the disclosure, and pharmaceutical formulations can be packaged in dosage unit form for ease of administration and uniformity of dosage.
• unit dose or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and regimen.
• the quantity to be administered, both according to number of treatments and unit dose, depends on the result and/or protection desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual.
• Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition.
• solutions can be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective.
• the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described herein.
• EXAMPLES [00120] Human subjects. Subjects are members of volunteering families recruited through the Pitt Hopkins Research Foundation. PTHS subjects (Table 1) were selected based on availability of detailed clinical and molecular diagnostics information, including the types of TCF4 mutation they carry.
• TCF4 mutation For patients harboring a point mutation, small indel, or translocation, the details of each TCF4 mutation was confirmed via resequencing of the TCF4 locus.
• a detailed and personalized questionnaire to gather information related to the patients’ PTHS clinical symptoms was answered by all participating families, encompassing questions about neurological findings, cognitive, behavioral and gastroenterological manifestations, age at diagnosis, general quality of life, temporal evolution of motor milestones, communication level, dysmorphic facial features, urological symptoms, vision problems, sensory responsivity, sleep disturbances, respiratory anomalies such as apnea and hyperventilation, feeding habits and bowel symptoms, history of seizures, as well as MRI findings. These data are reported in Table 1. To maximize comparability, only male subjects were selected for this study.
• TCF4 Transcription Factor 4
• TCF-4 T-Cell factor 4
• TCF-4 T-Cell factor 4
• Table 1 Summary of participating subjects and clinical characteristics . Related to all figures .
• FG dysmorphic facial gestal t
• SM/MM severe (SM) or mild (MM) motor delay at age 3
• AS absent speech
• CT constipation
• SZ seizures
• BA breathing problems (hyperventilation or apnea)
• UA urinary abnormalities (retention or incontinence )
• VA visual abnormalities (ocular anomalies )
• RB repetitive behaviors
• abMRI brain anomalies (thinned corpus callosum'; detected by MRI .
• iPSCs induced pluripotent stem cells
• Skin fibroblasts were obtained from biopsies taken f rom PTHS and control subj ects , followed by culturing in DMEM/F12 medium containing 10% fetal bovine serum and penicillin/streptomycin .
• iPSCs were derived from fibroblasts via cellular reprogramming, as described in (Marchetto et al . , 2017 ) . Briefly, fibroblast cultures were transduced with Sendai viruses containing over-expression cassettes for OCT4, SOX2, KLF4, and MYC (Cytotune iPS 2 .
• mEFs murine embryonic fibroblasts
• NEAA non-essential amino acids
• iPSC colonies were identified after 2 wee ks and transferred to 6 cm plates coated with Matrigel® (BD Biosciences), after which time they were maintained in mTeSR1 medium (StemCell Technologies) and passaged by manual picking with the aid of a pipette tip.
• iPSC lines were produced for each subject in the study, all of which were analyzed through a combination of immunostaining and SNP mapping to rule out the presence of unwanted chromosomal abnormalities and mutations (example in FIG. 12B). All iPSC clones were passaged until P10 and 2 clones were chosen for further NPC and organoid derivation after this passage. Most experiments in this study were conducted with one P15 iPSC clone per subject. Cultures were tested every two weeks for mycoplasma, and contamination was never identified at any stage. [00123] Validation of iPSC was performed by immunostaining for SOX2, OCT4, NANOG, and LIN28.
• iPSC colonies were dissociated using Accutase (Thermo Fisher Scientific; diluted with an equal volume of 1 ⁇ PBS) for 12 minutes at 37°C. After centrifugation for 3 min at 150 ⁇ g, the individualized cells were resuspended in mTeSR1 medium (StemCell Technologies) supplemented with 10 mM SB431542 (Stemgent) and 1 mM dorsomorphin (R&D Systems). Approximately 3-4 million cells were seeded onto each well of a low-binding 6-well plate and placed on a shaker inside a CO 2 incubator at 95 rpm.
• Rho kinase inhibitor Y-27632; Calbiochem, Sigma-Aldrich.
• Y-27632 Rho kinase inhibitor
• mTeSR1 neural induction medium consisting of Neurobasal medium (Thermo Fisher Scientific) containing GlutaMAX, 1% Gem21 NeuroPlex supplement (Gemini Bio-Products), 1% N2 NeuroPlex (Gemini Bio-Products), 1% NEAA (Thermo Fisher Scientific), 1% penicillin/streptomycin (Thermo Fisher Scientific), 10 mM SB431542, and 1 mM dorsomorphin, for 7 days.
• Neurobasal medium Thermo Fisher Scientific
• NPC proliferation medium consisting of Neurobasal medium containing GlutaMAX, 1% Gem21, 1% NEAA, 20 ng/mL FGF-2 (Thermo Fisher Scientific) for 7 days, followed by 7 additional days in the same medium further supplemented with 20 ng/mL EGF (PeproTech).
• Neuronal differentiation and organoid maturation were achieved by switching to Neurobasal medium containing 1% GlutaMAX, 1% Gem21, 1% NEAA, 10 ng/mL of BDNF, 10 ng/mL of GDNF, 10 ng/mL of NT-3 (all from PeproTech), 200 mM L-ascorbic acid, and 1 mM dibutyryl-cAMP (Sigma- Aldrich), for 7 days. After this period, CtOs were maintained in Neurobasal medium containing GlutaMAX, 1% Gem21, 1% NEAA for as long as needed, with media changes every 3-4 days.
• neural induction medium Neurodetasal medium supplemented with 1% GlutaMAX, 1% Gem21, 1% N2, 1% NEAA, 1% penicillin/streptomycin, 10 mM SB431542, and 1 mM dorsomorphin
• IWP-2 Basal medium supplemented with 1% GlutaMAX, 1% Gem21, 1% N2, 1% NEAA, 1% penicillin/streptomycin, 10 mM SB431542, and 1 mM dorsomorphin
• NPC proliferation medium consisting of Neurobasal medium containing 1% GlutaMAX, 1% Gem21, 1% NEAA, 20 ng/mL FGF-2, and 100 nM SHH pathway agonist SAG (SelleckChem) for 7 days, followed by 2 additional days in the same medium supplemented with 20 ng/mL EGF (PeproTech). Culturing for an additional 5 days in the same medium, but without SAG, completed the NPC proliferation phase. This was followed by neuronal differentiation and organoid maturation phases, which were conducted using the same types of medium and durations used in the CtO derivation protocol. [00127] Immunofluorescence staining.
• CtOs and sPOs were fixed with 4% paraformaldehyde for 4-8 h at 4°C and cryoprotected in 30% sucrose for 12 h.
• Organoids were then embedded in TissueTek (Leica Microsystems) and sectioned on a Leica VT1000S cryostat to produce 20 ⁇ m sections.
• slides were air dried for 10 min, permeabilized in 1% Triton X-100 / 1 ⁇ PBS for 2 min, and blocked with 0.1% Triton X-100 / 3% BSA / 1 ⁇ PBS for 1 h at 25°C, followed by incubation with primary antibodies in the same solutions, for 16 h at 4°C.
• rat anti-CTIP2 (Abcam; ab18465; 1:500); rabbit anti-SATB2 (Abcam; ab34735; 1:200); chicken anti-MAP2 (Abcam; ab5392; 1:1000); rabbit anti-SOX2 (Cell Signaling Technology; 2748; 1:500); rabbit anti-GAD65/67 (Abcam; ab11070; 1:200); rabbit anti-CUX1 (CUTL1 or CASP) (Abcam; ab54583; 1:200); rabbit anti-TCF4 (Abcam; ab217668; 1:1000); rabbit anti-vGLUT1 (Synaptic Systems; 135311; 1:500); rabbit anti-CC3 (Cleaved Caspase 3) (Cell Signaling; 9664S; 1:500); rabbit anti-doublecortin (DCX) (Abcam; ab18723; 1:200); mouse anti-Cas9 (Abcam; ab210571; 1:200); mouse anti-p16 INK4a (CDKN
• NPCs were also stained to detect senescence associated ⁇ -galactosidase (SA- ⁇ -gal), using the CellEventTM Senescence Green Detection Kit (Thermo Fisher Scientific; C10850) after antigen retrieval as described above. The same method described above for counting weakly and strongly stained SOX2+ cells after p16 INK4a co-staining was applied to NPCs.
• CtOs and sPOs were dissociated to produce a single cell suspension via a combination of mechanical dissociation with forceps and enzymatic digestion with Accutase for 10 min.
• a total of 15 organoids were dissociated and the resulting cells were pooled and subsequently filtered to isolate single cells for RNA sequencing analysis on the same day.
• Dissociated cells were pelleted (3 min, 100 ⁇ g, 4°C) and resuspended in 10 mL of Neurobasal medium. The concentration of single cells in each library was determined using the Chemometec automatic cell counter, and the minimum population viability across all libraries was found to be 85%.
• RNA-seq libraries were prepared using the Chromium Single Cell 3’ v3 Library kit (10x Genomics) according to the manufacturer’s protocol. Approximately 20,000 cells were loaded per sample on the Chromium chip. All steps, including GEM (Gel beads in emulsion) preparation, reverse transcription, PCR amplification, and Illumina library construction were carried out on a T100 thermal cycler (Bio-Rad). cDNA extracted from GEMs was cleaned up using MyOne Silane Beads (Thermo Fisher Scientific), PCR-amplified for a total of 10 cycles, and then purified using SPRIselect Reagent Kit (B23317, Beckman Coulter).
• GEM Gel beads in emulsion
• Reagent Kit B23317, Beckman Coulter
• the cDNA pool was enzymatically fragmented for each library and a double size selection was performed using the SPRIselect Reagent Kit.
• Illumina adapters were ligated to prepare libraries for sequencing, followed by another round of double size selection with the SPRIselect Reagent Kit.
• Final library sizes ranged from 300-700 bp, with an average size around 450 bp.
• Illumina libraries were quantified using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) and size quality control was performed on a High Sensitivity D1000 tapestation (Agilent).
• RNA-Seq libraries were sequenced on a NovaSeq 6000 S4 sequencer (Illumina) to produce 20,000 reads per single cell, or 400 million reads per library, with 26 cycles for read_1, 8 cycles for the index, and 98 cycles for read_2, which contains the gene sequence.
• Feature count matrices for each single-cell RNA-Seq library were generated separately using the ‘cellranger count’ command in the Cell Ranger (version 4.0.0) software and the GRCh38 2020-A reference dataset of human transcripts.
• the independent libraries were then normalized to the same sequencing depth and aggregated into a single feature-barcode matrix using the ‘cellranger aggr’ command. Cell type subpopulations were delineated by a combination of automated annotation and curated manual inspection.
• processed data were transferred to Cell Loupe software (10x Genomics) and analyzed to partition groups of single cells using k-means clustering with 8 groups.
• the expression of marker genes was then visually inspected in each subpopulation assigned by Cell Loupe.
• the expression of each marker gene was analyzed in FIG. 13B and manually adjusted to the k-mean- assigned subpopulations based on the expression pattern of these genes.
• the combined approach of first performing unbiased determination of subpopulations followed by manual curation maximizes the identification of biologically relevant groups of cells.
• Mitochondrial genes were used as a proxy for identifying apoptotic cells, which were generally infrequent in all libraries (less than 5%).
• Seurat library version 3.2.2 (Butler et al., 2018) was used for downstream processing and analysis of the feature-barcode matrix.
• the aggregated matrix generated by Cell Ranger was imported into Seurat and normalized by dividing the feature counts of each cell by the total counts for that cell, followed by scaling the data to 10,000 counts per cell prior to performing a log transformation (‘NormalizeData’ function).
• variable features were identified with the ‘FindVariableFunctions’ function, which fits a polynomial curve to the mean-variance relationship, standardizes feature counts based on their expected variance given their expression, and selects the 3,000 features with the highest variance.
• the highly variable features were then scaled to a distribution (‘ScaleData’ function) with mean expression 0 and variance 1 across cells, which was subsequently used to perform linear dimensional reduction (PCA, ‘RunPCA’ function).
• PCA linear dimensional reduction
• the first 15 PCA dimensions were used to embed the cells into a non-linear reduced dimension space using the UMAP algorithm (‘RunUMAP’ function).
• Unsupervised trajectory (pseudotime) inference (FIG.
• iPSC colonies maintained in mTeSR1 medium were switched to DMEM/F12 medium containing N2 and GEM21 supplements (StemCell Technologies). After 2 days, colonies were lifted from the plate with Accutase and cultured in the same medium with the addition of 10 mM SB431542 and 1 mM dorsomorphin, in suspension on a platform shaker, until embryoid bodies formed.
• the embryoid bodies were plated directly onto Matrigel-coated dishes and maintained in DMEM/F12 medium containing N2 and SM1 supplements (StemCell Technologies), 20 ng/mL FGF-2, and 1% penicillin/streptomycin. After 3 to 5 days, rosettes emerged, and 7 days later the rosettes were manually picked and replated onto Matrigel-coated dishes.
• NPCs were seeded onto plates coated with poly-ornithine and laminin and cultured in NPC medium until they reached 90% confluency, at which time the medium was changed to DMEM/F12 containing N2 and SM1 supplements and 1% penicillin/streptomycin, with media changes occurring every 3 to 4 days.
• FIGs. 7D-E Quantification of neuronal differentiation rates (FIGs.
• RNA sequencing of NPCs and neuronal cultures was accomplished by counting MAP2+ and SOX2+ cells in differentiating neuronal cultures seeded onto LabTek II chambered slides after 2 months of differentiation in BrainPhys medium, followed by immunofluorescence staining as described before.
• RNA sequencing of NPCs and neuronal cultures Using the RNeasy Mini Plus kit (Qiagen), RNA was isolated from NPCs of 4 subjects and 4 respective parental controls at passage 15 for most analyses, from NPCs of 2 subjects and 2 respective controls at passage 5 for analysis in FIG.
• RT-qPCR Real-time quantitative PCR
• RNA extracted from at least 3 independent biological samples per subject/condition and normalized to the following endogenous control genes (TBP, ACTB, and GAPDH).
• Neuronal morphometric measurements Neurons were morphologically analyzed (FIG. 7C) using Neurolucida Neuron Tracing Software (MBF Bioscience). Individual MAP2+ neurons were identified from confocal images that clearly exhibited either the number of processes branching from the cell body, processes of complete root- to-tip length, or complete cell bodies. Only neurons whose shortest dendrite was at least 3 times longer than the diameter of the cell soma were calculated. Random images from at least 2 clones of each cell line were assessed. The ‘contour’ function was used to trace and sum incremental lengths of each curve along the longest path of a complete process to yield its total length.
• Multi-electrode array analysis 12-well multi-electrode array plates from Axion Biosystems were used to acquire electrical activity reads from organoids. Six organoids were plated onto each well at 20 days into the organoid derivation protocol described herein, using Neurobasal medium containing GlutaMAX, 1% Gem21, 1% NEAA, 10 ng/mL of BDNF, 10 ng/mL of GDNF, 10 ng/mL of NT-3, 200 mM L-ascorbic acid and 1 mM dibutyryl-cAMP.
• Network bursts were defined as bursts of more than 10 spikes that occurred in more than 25% of the active electrodes in the well, with a maximum inter-spike interval of 100 ms.
• Patch clamp electrophysiological analysis Whole-cell patch clamp recordings were performed on neurons in bidimensional (monolayer) culture, differentiated from NPCs on 35 mm dishes coated with poly-ornithine and laminin for 4 months after withdrawal of FGF-2. Similar densities of neurons were achieved in all plates.
• the extracellular solution was 130 mM NaCl, 3 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , 10 mM HEPES, and 10 mM glucose, at pH 7.4 adjusted with 1 M NaOH ( ⁇ 4 mM Na + added).
• the internal solution for glass electrodes was 138 mM K-gluconate, 4 mM KCl, 10 mM Na 2 - phosphocreatine, 0.2 mM CaCl 2 , 10 mM HEPES (Na + salt), 1 mM EGTA, 4 mM Mg-ATP, 0.3 mM Na-GTP, at pH 7.4 adjusted with 1 M KOH ( ⁇ 3 mM K + added).
• Pellets were resuspended and incubated in the kit’s fixative solution for 15 min in the dark at 25°C, followed by the addition of 3 mL of 1% BSA in 1 ⁇ PBS to stop fixation. Next, NPCs were pelleted at 500 ⁇ g for 5 min, the supernatant was removed, and the pelleted cells were incubated for 15 min in 1 ⁇ Click-iT saponin-based permeabilization and wash reagent. During incubation, the Click-iT reaction cocktail was prepared based on the manufacturer’s protocol, and then added to the samples, followed by homogenization and incubation for 30 min, protected from light.
• Apoptosis assays on NPCs were conducted using the Dead Cell Apoptosis Kit with Annexin V FITC and PI (V13242, Thermo Fisher Scientific), following the manufacturer’s protocol, and analysis by flow cytometry in the same instrument described above.
• V13242 Annexin V FITC and PI
• TOP-Flash luciferase reporter Wnt functional assay were conducted using the Dead Cell Apoptosis Kit with Annexin V FITC and PI (V13242, Thermo Fisher Scientific), following the manufacturer’s protocol, and analysis by flow cytometry in the same instrument described above.
• This plasmid contains a minimal TA viral promoter driving the expression of a firefly luciferase gene preceded by seven binding sites (AGATCAAAGG; SEQ ID NO:1) for TCF/LEF (Veeman et al., 2003), not to be confused with TCF4.
• Control NPCs were transfected with M51 Super8 ⁇ FOPflash plasmids, which have mutant TCF/LEF binding sites (Addgene plasmid #12457; [http:/]/n2t.net/addgene:12457; RRID:Addgene_12457).
• CtOs or sPOs were treated with 1 ⁇ M CHIR99021 (or DMSO, as a control) on the first day of the progenitor proliferation phase (when FGF-2 is first added to the growing organoids), in the same type of medium as untreated organoids.
• treatment with Wnt antagonist ICG-001 (1 ⁇ M) was performed on the first day of the progenitor proliferation phase. In all cases, treatment was performed on at least 6 independent replicates of each organoid line.
• TCF4 and SOX3 knockdown in NPCs 100,000 cells were tranfected using the Amaxa Nucleofaction Mouse Neural Stem Cell Nucleofector kit (Lonza) with shRNA Mission plasmids (Sigma Millipore), using the manufacturer’s recommendations.
• the SHCLND-NM-005834 (SOX3) and SHCLND-NM_003199 (TCF4) pre-validated Mission shRNA vectors (Sigma Millipore), which are made in the pLKO.1 plasmid backbone (TRC2 series) were used.
• SHC201 empty TRC2 vector was used as a control.
• ASOs antisense oligonucleotides
• TCF4-B transcript variant coding sequence was placed under the control of artificial promoters (FIG. 11E and 18J).
• the coding sequence was placed under control of the artificial minP promoter (AGAGGGTATATAATGGAAGCTCGACTTCCAG; SEQ ID NO:2).
• Other constructs contained the TCF4-B coding sequence preceded by the minP promoter and by varying numbers (6 or 12) of ⁇ E5 TCF4 regulatory DNA binding sites (CACCTG) separated by spacer sequences composed of CAAGAA.
• constructs were prepared via PCR-based reactions to ligate Ultramer oligonucleotides (minP_TCF4, E-box-x6-minP_TCF4, or E-box-x12-minP_TCF4; Integrated DNA technologies) containing the artificial promoter to the TCF4-B coding sequence, which was separately amplified via RT-PCR from human brain cDNA (Promega) using primers TCF4B_cDNA Forward and TCF4B_cDNA Reverse. The resulting PCR fragments were cloned into EcoRI and XhoI restriction sites of pLenti-III-promoterless vector (Applied Biological Materials).
• NPCs were transfected with these plasmids using the protocol as described herein, followed by extraction of total RNA with the RNeasy Mini Plus kit (Qiagen) and RT-qPCR, as before.
• Table 2 Reagents [00161] For organoid transduction experiments (FIGs. 11F-H and 19M-S), lentiviral particles were prepared using the second- generation lentiviral production plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259).
• AAV vectors were ordered from Applied Biological Materials (ABM) of AAV9 serotype with the human growth hormone (hGH) terminator in each construct. All titers were commercially determined as >10 9 IU (particles) per ⁇ L.
• Transduction of organoids (CtOs) was achieved by mixing 3.5 million dissociated iPSCs on the first day of organoid derivation (lentiviruses; FIG. 11F) or by adding AAV virus directly to the medium after the last day of the neural induction phase (FIG. 11H) with the appropriate virus quantities to obtain a multiplicity of infection (MOI) of 5 for each type of vector.
• MOI multiplicity of infection
• RNA sequencing libraries were analyzed from PTHS and control NPCs to determine the transcriptional activity from the numerous alternative promoters of the human TCF4 gene (Sepp et al., 2011). Promoter activity estimation was performed using the junction read counts approach described in (Demircio ⁇ lu et al., 2019). Briefly, exon junction counts were obtained by mapping the RNA-seq reads onto the GRCh38.p13 genome assembly with the STAR aligner (version STAR 2.7.6a), using the GENCODE 34 primary annotation as a reference to determine exon coordinates.
• the proActiv R package (version 0.99.0) was used to estimate promoter activity by counting the junction reads mapping to the first set of introns of each TCF4 transcript, followed by normalization of the counts using the size factors approach and log-transformation of the data.
• This approach identified promoters upstream of exons 3b, 8a, and 10a as the most active in both parent and PTHS samples (FIG. 18A) and were therefore chosen for CRISPR-mediated trans- epigenetic manipulation of TCF4 transcriptional activity.
• gRNAs were designed based on sequences located between -100 and +50 from the corresponding transcriptional start sites (TSS) (Liao et al., 2017) (FIG. 18A).
• gRNAs were validated by first inserting the corresponding sequences into the traditional CRISPR pSpCas9(BB)-2A-Puro plasmid (Addgene #48139; [http:/]/n2t.net/addgene:48139; RRID:Addgene_48139), followed by testing the efficiency of each gRNA to generate indels in pilot experiments.
• pSpCas9(BB)-2A-Puro was digested with BpiI (Thermo Fisher Scientific).
• Each synthesized gRNA oligonucleotide pair was phosphorylated with T4 polynucleotide kinase (Promega) and annealed by incubation in a thermocycler under the following conditions: 30 min at 37°C, 5 min at 95°C, and ramp down to 25°C at 5°C min -1 .
• Phosphorylated oligonucleotide duplexes for each gRNA were then ligated to the digested plasmid by incubation at 25°C for 1 h with T4 DNA ligase (Promega).
• Competent cells (Stbl3 E. coli bacterial strain; Thermo Fisher Scientific) were transformed with each ligation product and plasmid DNA was extracted from each clone with the PureYield Plasmid Miniprep System (Promega), followed by validation via Sanger sequencing with the hU6-F universal primer.
• HEK293T cells ATCC were cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin to 70% confluency and transfected with each gRNA plasmid using polyethylenimine (PEI; Sigma-Aldrich) at a ratio of 3:1 PEI/DNA (w/w), with 1 ⁇ g of DNA per mL of culture medium.
• PEI polyethylenimine
• Both PEI and DNA were diluted in Opti-MEM (Gibco) at a volume 1/20 of the total volume of culture medium, followed by incubation for 30 min before being applied directly on top of the cells. Transfection medium was replaced with culture medium 16 h after transfection. To confirm that the selected TCF4 gRNA sequences indeed targeted TSS 3b, 8a and 10a of the human TCF4 gene, T7 endonuclease I assays were performed. Transformed cells were selected by replacing the transfection medium with culture medium supplemented with 1 ⁇ g mL -1 puromycin until all cells in the negative control died ( ⁇ 72 h). Genomic DNA was then extracted using the Illustra Blood Genomic Prep Minispin kit (GE), according to the manufacturer’s instructions.
• GE Illustra Blood Genomic Prep Minispin kit
• T7 endonuclease I assay 300 ng of amplicons of each sample were incubated with 2 ⁇ L NEBuffer 2 and H 2 O (to a final volume of 19.5 ⁇ L) in a thermocycler, with the following cycling parameters: 5 min at 95°C, ramp down to 85°C at -2°C min -1 , ramp down to 25°C at -0.1 °C min -1 . After denaturation and gradual re-annealing to allow formation of DNA heteroduplexes, 5U of T7 endonuclease I (NEB) were added to the samples and incubated for 30 min at 37°C.
• NTB T7 endonuclease I
• the products were run on a 1.5% agarose gel and the CRISPR-mediated efficiency for creation of indels was estimated for each gRNA based on the ratio between the masses of undigested bands and digested fragments. Additionally, the amplicons were deep sequenced and the percentages of clones with indels were computed.
• gRNAs were also cloned into the pLentiSAMv2 plasmid (Addgene plasmid #75112; [http:/]/n2t.net/addgene:75112; RRID:Addgene_75112), harboring the gRNA sequence with MS2 loops at both the tetraloop and the stem loop 2 under the control of the U6 promoter, along with the dead Cas9 (dCas9) gene fused to the VP64 gene under the control of the EF1 ⁇ promoter. Cloning was performed in pLentiSAMv2 via digestion with Esp3I (Thermo Fisher Scientific).
• lentiviral particles were prepared by transfecting HEK293T cells (ATCC) with suitable pLentiSAMv2 vectors carrying the tested gRNAs or the scrambled gRNA (control).
• ATCC HEK293T cells
• suitable pLentiSAMv2 vectors carrying the tested gRNAs or the scrambled gRNA (control).
• SH-SY5Y cells were transfected with the pLentiSAMv2 and pLentiMPHv2 (Addgene #89308; [http:/]/n2t.net/addgene:89308; RRID:Addgene_89308) plasmids, followed by RT-qPCR to verify the levels of TCF4 transcripts.
• the pLentiMPHv2 vector contains the MS2-P65-HSF1 activator helper (MPH) complex gene under the control of the EF1 ⁇ promoter (Liao et al., 2017), in combination with the gRNA and dead Cas9, for the trans- epigenetic activation of the TCF4 locus.
• MPH MS2-P65-HSF1 activator helper
• SH-SY5Y cells were cultured in DMEM/F12 containing 10% FBS and 1% penicillin/streptomycin.
• SH-SY5Y cells were transfected with FuGENE HD Transfection Reagent (Promega) at a ratio of 4:1 FuGENE/DNA (v/w), with 2 ⁇ g of DNA per mL of culture medium.
• RNA from selected cells was purified with TRIzol reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions.
• cDNA was synthesized with ImProm-II Reverse Transcription System (Promega).
• primer pairs were designed to be able to detect (I) transcripts encoding TCF4-B, TCF4-D, or TCF4-A (depending on the corresponding promoter targeted by each gRNA), (II) transcripts of the endogenous TBP gene, and the exogenous dCas9 (encoded by lentiSAMv2) and MPH (encoded by lentiMPHv2) genes, and (III) transcripts from genes transcriptionally regulated by TCF4. All reactions were performed with technical duplicates, using the PowerUp SYBR Green Master Mix (Applied Biosystems) on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
• the second-generation lentiviral production plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) were used.
• sPOs organoids
• MOI multiplicity of infection
• Organoids in the ‘TCF4 gRNA’ group were co-transduced with lentiviruses produced from pLentiMPHv2 and pLentiSAMv2 plasmids containing gRNA version 3bS3.
• medium was changed and lentiviruses were added again.
• embryoid bodies were formed in the presence of mTeSR1 medium containing SB431542 and dorsomorphin.
• medium was changed according to the regular protocol, without the addition of viruses. Transduction was confirmed by the evaluation of Cas9 expression via immunostaining, using the protocol described herein and above. [00170] Statistical analyses.
• comparisons of means between two groups in experiments that measured organoid size, relative expression levels, or expression abundances used two-sample Welch’s t test, assuming unequal variances and heteroskedasticity.
• ANOVA Analysis of Variance
• Tukey Tukey’s Honestly Significantly Different (HSD) post-hoc test.
• HSD Honestly Significantly Different
• Control (parent) CtOs exhibited the expected three-dimensional organization into spheroids, which grew continuously in size and developed clearly visible rosette-like cellular aggregates (arrowhead in top row in Figure 5A).
• PTHS CtOs are smaller ( Figures 5A-B) and harbor a noticeably fewer discernible rosettes and smaller size ( Figure 5A).
• control CtOs contain a large number of rosettes composed of neural progenitors surrounding a ventricle-like lumen, similar to the distribution of ventricular and sub-ventricular zone progenitors in the developing human brain. As these progenitor-rich structures differentiate into several neuronal subtypes, the rosettes diminish in size.
• PTHS organoids display very few rosette-like structures, and neural progenitors are dispersed throughout the organoid without any apparent organized clustering (see supporting controls in Figure 12F). Moreover, most PTHS CtOs are polarized, with SOX2-positive cells concentrated on one side.
• PTHS CtOs have a significantly lower density, but higher percentage of neural progenitors compared to control organoids ( Figures 5D and 12F), in keeping with fewer rosette structures where progenitors tend to localize.
• PTHS sPOs display a reduction in the content of SOX2+ progenitors ( Figures 12H-I).
• Immunostaining for neuronal marker MAP2 revealed that control CtOs have neurons dispersed throughout the spheroid, particularly around and between rosettes, and neuronal content increases as parent CtO development proceeds.
• PTHS CtOs and sPOs possess less evident MAP2 labeling, even in later stages of organoid development (Figure 12H).
• Parental CtOs exhibit a typical pattern of cortical development, recapitulating the temporal progression of neuronal differentiation in the human cortex, in which deep-layer neurons (i.e., CTIP2+ cells) form first, followed by differentiation of superficial layer neurons (SATB2+ and CUX1+ cells) ( Figure 12J).
• SATB2+ and CUX1+ cells superficial layer neurons
• PTHS CtOs exhibit a severely reduced content of cortical neuron subtypes ( Figures 5E and 12J).
• PTHS CtOs display a reduction in staining for vesicular glutamate transporter family member 1 (vGLUT1) (Figure 12M), a marker of excitatory neurons previously shown to be abundant in CtOs.
• PTHS sPOs have reduced staining for GABAergic neuron markers GAD65/67 ( Figure 12H).
• PTHS organoids exhibit lower percentages of neurons and higher percentages of progenitors.
• single-cell RNA sequencing scRNA- Seq was performed on dissociated cells from CtOs and sPOs.
• Six annotated cellular subpopulations were analyzed – neural progenitors, intermediate progenitors, and mature neurons in both CtOs and sPOs ( Figures 6A, 13A-C).
• PTHS organoids have reduced density of progenitors per area (Figures 5D), but scRNA-Seq data and immunostaining revealed that the percentage of progenitors is higher in PTHS CtOs relative to control organoids ( Figures 6C, 6D, 6E and 12G).
• PTHS sPOs possess higher percentages of subpallial progenitors than control sPOs ( Figures 6F, 6G and 6H).
• astrocytic content is small and similar in PTHS and control organoids ( Figure 13F), ruling astroglia content out as a potential cause for phenotypic abnormalities in PTHS organoids.
• PTHS organoids have proportionally more progenitors and fewer neurons, suggesting that the disease’s pathophysiology includes defects in progenitor proliferation and/or differentiation into neurons.
• PTHS neurons exhibit abnormal firing properties. The diminished neuronal content in PTHS organoids suggests that the formation of neuronal circuits may be impaired in the patients’ neural tissue. Moreover, reduced staining for vGLUT1 in PTHS CtOs may indicate that the mutant neurons establish fewer synapses and exhibit impaired electrical activity. To investigate these issues, PTHS neurons in 2D culture and organoids were used.
• multi- electrode array (MEA) assays were used to analyze neuronal activity and found that mean neuronal firing rates were much lower in PTHS as compared to control CtOs ( Figures 7A and 14A).
• PTHS CtOs contain a substantial amount of neurons ( Figures 5D and 5E), therefore such diminishment in electrical activity likely reflects electrophysiological defects at the cellular level.
• neuronal content is impaired in PTHS CtOs ( Figures 5E, 6I, 12J, 13H and 13I), thus it is formally possible that the PTHS electrical activity defects are the result of poor connectivity or neuronal density in the organoids.
• PTHS neurons exhibited severely decreased intrinsic excitability (Figure 7D), membrane capacitance, and sodium and potassium currents ( Figures 7E, 14D and 14E). Furthermore, lower expression of the surrogate marker of neuronal activity FOS was observed in neurons in PTHS CtOs as compared to control CtOs ( Figure 7F). In combination, these data show that PTHS neurons exhibit severe deficits in electrical properties at the network and cellular levels.
• Such neuronal dysfunctions may arise from abnormal gene expression in PTHS neurons, and therefore RNA sequencing was used to probe transcriptomic alterations in these cells, comparing neurons differentiated from iPSC-derived patient and control neural progenitors under 2D culturing conditions.
• the list of DE genes includes potassium voltage-gated channel subfamily Q member 1 (KCNQ1), previously shown to dysregulate intrinsic excitability of mouse neurons after Tcf4 knockdown (Rannals et al., 2016), as well as a number of other ion channels (Figure 14H), which not only offer mechanistic insight into the PTHS neuronal intrinsic excitability defects but also provide new opportunities for pharmacological therapeutic intervention.
• KCNQ1 potassium voltage-gated channel subfamily Q member 1
• Figure 14H a number of other ion channels
• the senescent NPCs are Nestin+, most are SOX2+; SOX2 expression fades in some NPCs, and are negative for Brachyury and SOX17 (Figure 16E), indicating that they are senescent NPCs and not mis-differentiated cells.
• the expression of senescence markers is also strongly upregulated in the PTHS post-mortem sample ( Figure 8I).
• PTHS CtOs contain many neural lineage cells expressing the CDKN2A gene product, p16 INK4A ( Figures 8J and 15J) and these are not apoptotic cells, which are similarly infrequent in both PTHS and control organoids (Figure 8J).
• CHIR treatment does not lead to an increase in either size (Figure 16F) or progenitor content (Figure 9K) in parent organoids, and CHIR treatment does not lead to increased proliferation ( Figures 9G-H) or to decreased percentage of senescent cells (Figure 9I) in parent NPCs in 2D culture.
• These results rule out fate restriction as the cause for phenotypic correction after Wnt signaling agonistic activation in PTHS cells.
• CHIR treatment increased the expression of TCF4 and TCF4 downstream targets in PTHS NPCs in 2D culture ( Figure 16K), an effect previously reported upon exposure to high CHIR concentrations in other cell types, raising the possibility that the phenotypic correction after Wnt activation is due to increased TCF4.
• neural progenitors in the organoid’s 3D structure do not exhibit an increase in TCF4 levels after CHIR treatment (Figure 16J), allowing us to conclude that the rescue of proliferation defect in PTHS organoids after Wnt signaling activation was not due to increased TCF4 expression itself.
• Figure 9D The smaller number of neural rosettes in PTHS organoids ( Figure 9D) suggests that neuroepithelial architecture of progenitors is defective.
• ⁇ -catenin is a key component of the Wnt signaling pathway and an important regulator of epithelial cell adhesion and integrity
• a plausible hypothesis is that the diminished Wnt signaling in PTHS NPCs results in dysregulated ⁇ - catenin expression, leading to dismantling of rosettes and failure to organize the neural progenitors.
• ⁇ -catenin expression is disorganized in PTHS organoids ( Figure 16L), strengthening the possibility that Wnt signaling downregulation leads to neuroepithelial integrity defects during neurodevelopment in PTHS.
• PCDH15 is significantly downregulated in PTHS NPCs, however CHIR99021 treatment in NPCs further reduces its expression (Figure 16N) in the same condition in which the cellular phenotypes are corrected ( Figures 9G-I), ruling out PCDH15 as a plausible cause for the abnormal phenotypes in PTHS NPCs.
• the experiments confirm the mechanistic involvement of Wnt signaling in PTHS NPC proliferation defects. More importantly, these results demonstrate that the aberrant phenotypes described in PTHS NPCs and organoids can be pharmacologically corrected, an observation that may direct future efforts to treat diseases caused by TCF4 haploinsufficiency.
• the NPC differentiation rate is lower in PTHS, as judged by the neuron-to-progenitor ratio in differentiating 2D cultures ( Figures 10J and 17J). Moreover, intermediate progenitors are scarcer in PTHS as compared to control CtOs and sPOs ( Figure 17K), and cells expressing intermediate progenitor marker POU3F2 (coding for BRN2) are less numerous in PTHS organoids ( Figure 17L). In combination, these results indicate aberrant differentiation of progenitors into neurons in PTHS neural tissue.
• SOX4 and SOX11 SOX transcription factors
• these transcription factor genes are expressed in intermediate progenitors and neurons of CtOs and sPOs ( Figures 10I, 17H-I).
• SOX4 is involved in the generation of intermediate progenitors and in their differentiation into early-born (CTIP2- and TBR1-positive) and late-born (BRN2-, SATB2, and CUX1-positive) cortical neurons.
• TCF4 expression was corrected in PTHS organoids using a CRISPR-based trans-epigenetic strategy (Liao et al., 2017).
• two viral vectors are used to deliver three expression cassettes to target cells: one encodes a short guide-RNA (gRNA) coupled with an engineered RNA hairpin aptamer; the second encodes a transcriptional activation complex (MPH) that binds the aptamer; and the third encodes dead Cas9.
• gRNA short guide-RNA
• MPH transcriptional activation complex
• Expression of these cassettes in target cells is expected to epigenetically transactivate the endogenous TCF4 locus, because Cas9-mediated gRNA binding to the TCF4 promoter congregates MPH, enhancing transcription from the downstream gene (Figure 11A).
• the CRISPR-mediated correction strategy enhances both the endogenous and the mutated alleles ( Figure 18D, lower panel), and the globally increased TCF4 levels are accompanied by correction of GADD45G (Figure 18E), a TCF4 downstream target, revealing functional correction of the TCF4 locus.
• Organoids transduced with the TCF4 gRNA vector display a decrease in the expression of senescence gene CDKN2A, and a correction in the expression of neuronal marker MAP2 (Figure 18E). Also, SOX3 expression increased in these organoids ( Figure 18E), even though the correction was partial, probably because not all cells in the organoids express SOX3.
• the PTHS histological phenotypic abnormalities were rescued in organoids subjected to TCF4 correction ( Figure 11D), yielding normal spheroids devoid of aberrant outgrowths (arrowheads in middle panel).
• SOX2 and MAP2 staining of transduced organoids indicated that the correction in morphology was accompanied by reestablishment of the organoid’s internal architecture, with progenitors forming neural rosettes surrounding a lumen (arrowhead in right panel; Figure 11D).
• the outgrowths in PTHS organoids usually contain aggregates of MAP2+ cells (insets in Figure 11J), an abnormal feature that disappeared in the organoids after TCF4 correction upon transduction with the TCF4 gRNA.
• DCX doublecortin
• the TCF4-B coding sequence was placed under the control of TCF4 binding motifs ( ⁇ E5 boxes) ( Figures 11E and 18J), an approach expected to prevent ectopic TCF4 expression.
• TCF4 and GADD45G expression is corrected in transduced PTHS NPCs ( Figure 18J), indicating that the strategy can be used for TCF4 genetic correction.
• transduction with lentiviral TCF4 OE constructs were observed at the beginning of the organoid derivation protocol and led to increased intensity of TCF4 labeling and corrected TCF4 and CDKN2A levels ( Figure 18K) in organoids.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Zoology (AREA)
• General Health & Medical Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Medicinal Chemistry (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Epidemiology (AREA)
• Toxicology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Virology (AREA)
• Neurology (AREA)
• Neurosurgery (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Hospice & Palliative Care (AREA)
• Psychiatry (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)

Priority Applications (8)

Applications Claiming Priority (2)

Publications (1)

Family

ID=80951835

Family Applications (1)

Country Status (9)

Families Citing this family (3)

Family Cites Families (2)

• 2021
  • 2021-09-30 US US18/028,740 patent/US20230372542A1/en active Pending
  • 2021-09-30 JP JP2023519419A patent/JP7786750B2/ja active Active
  • 2021-09-30 KR KR1020237014851A patent/KR20230079190A/ko active Pending
  • 2021-09-30 IL IL301610A patent/IL301610A/en unknown
  • 2021-09-30 EP EP21876521.2A patent/EP4222268A4/en active Pending
  • 2021-09-30 WO PCT/US2021/052987 patent/WO2022072709A1/en not_active Ceased
  • 2021-09-30 CN CN202180079761.9A patent/CN116670769A/zh active Pending
  • 2021-09-30 AU AU2021351512A patent/AU2021351512A1/en active Pending
  • 2021-09-30 CA CA3194085A patent/CA3194085A1/en active Pending

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events