WO2022072244A1 - Methods for reducing apociii expression - Google Patents
Methods for reducing apociii expression Download PDFInfo
- Publication number
- WO2022072244A1 WO2022072244A1 PCT/US2021/052001 US2021052001W WO2022072244A1 WO 2022072244 A1 WO2022072244 A1 WO 2022072244A1 US 2021052001 W US2021052001 W US 2021052001W WO 2022072244 A1 WO2022072244 A1 WO 2022072244A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- weeks
- once
- less
- administering
- therapeutically effective
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/05—Dipeptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
Definitions
- FCS Familial Chylomicronemia Syndrome
- FPL Familial Partial Lipodystrophy
- SHTG Severe Hypertriglyceridemia
- reducing APOCIII RNA or reducing APOCIII protein in a human subject in need thereof.
- methods are useful for ameliorating at least one symptom of FCS, FPL, or SHTG.
- FCS Such symptoms of FCS include, but are not limited to, severe elevations in chylomicrons (severe chylomicronemia) and extremely elevated TG levels (always reaching well above 1000 mg/dL and not infrequently rising as high as 10,000 mg/dL or more; severe hypertriglyceridemia) with episodes of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly.
- FCS Familial Chylomicronemia Syndrome
- FCS Familial Chylomicronemia Syndrome
- FCS Fibrospinal xanthomas
- LPL lipoprotein lipase
- Apolipoprotein C-III (also called APOC3, APOC-III, ApoCIII, and APO C-III) is a constituent of HDL and of triglyceride (TG)-rich lipoproteins. Elevated ApoCIII levels are associated with elevated TG levels and diseases such as cardiovascular disease, metabolic syndrome, obesity and diabetes (Chan et al., Int J Clin Pract, 2008, 62:799-809; Onat e/ at., Atherosclerosis, 2003, 168:81-89; Mendivil et al., Circulation, 2011, 124:2065-2072; Manger et al., J. Lipid Res, 2006. 47: 1212-1218; Chan et al., Clin. Chem, 2002.
- Antisense technology is emerging as an effective means for reducing the expression of certain gene products and may prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of ApoCIII.
- Antisense compounds targeting ApoCIII and associated methods for inhibiting ApoCIII have been previously disclosed (see e.g., U.S. Patent 7,598,227, U.S. Patent 7,750,141, PCT publication WO 2004/093783, PCT publication WO 2012/149495, PCT/US 14/016546, and WO 2014/179626, all incorporated-by-reference herein).
- methods for ameliorating Familial Chylomicronemia Syndrome (FCS), Familial Partial Lipodystrophy (FPL), or Severe Hypertriglyceridemia (SHTG), and methods of reducing APOCIII RNA and/or APOCIII protein in a human subject in need thereof.
- methods comprise administering a therapeutically effective amount of a modified oligonucleotide.
- the modified oligonucleotide is ISIS 678354.
- the therapeutically effective amount is within the range of about 40 mg to about 100 mg.
- the therapeutically effective amount is about 50 mg.
- the therapeutically effective amount is about 80 mg.
- the therapeutically effective amount is administered once about every 4 weeks.
- 2 ’-deoxyribonucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
- a 2 ’-deoxyribonucleoside is a 2’-P-D deoxyribonucleoside and comprises a 2’-P-D-deoxyribosyl sugar moiety, which has the P-D configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2 ’-deoxyribonucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
- 2 ’-MOE means a 2’-OCH2CH2OCH3 group in place of the 2 ’-OH group of a ribosyl sugar moiety.
- a “2’-M0E sugar moiety” is a sugar moiety with a 2’-OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-M0E sugar moiety is in the P-D configuration.
- MOE means O-methoxyethyl.
- 2’-M0E nucleoside means a nucleoside comprising a 2’-M0E sugar moiety.
- 5 -methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
- a 5-methyl cytosine is a modified nucleobase.
- administering means providing a pharmaceutical agent to a human subject.
- “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
- amelioration is the reduction in the severity or frequency of a symptom, or the delayed onset or slowing of progression in the severity or frequency of a symptom.
- pancreatitis event is a formally confirmed event of pancreatitis. Events of confirmed pancreatitis may be further classified as acute, chronic, or unknown type (i.e. indeterminate: events that may have met the definition of pancreatitis but were unable to be classified as either acute or chronic).
- AE can be any unfavorable and unintended sign (including an abnormal laboratory finding, for example), symptom, or disease temporally associated with the use of the medicinal (investigational) product, whether or not the AE is considered related to the medicinal (investigational) product.
- the medicinal (investigational) product is ISIS 678354.
- APOCIII RNA is the RNA expression product of the human gene, APOCIII.
- APOCIII protein is the protein expression product of APOCIII RNA.
- an ApoCIII means any nucleic acid or protein sequence encoding ApoCIII.
- an ApoCIII includes a DNA sequence encoding ApoCIII, a RNA sequence transcribed from DNA encoding ApoCIII (including genomic DNA comprising introns and exons), a mRNA sequence encoding ApoCIII, or a peptide sequence encoding ApoCIII.
- ApoCIII nucleic acid means any nucleic acid encoding ApoCIII.
- an ApoCIII nucleic acid includes a DNA sequence encoding ApoCIII, a RNA sequence transcribed from DNA encoding ApoCIII (including genomic DNA comprising introns and exons), and a mRNA sequence encoding ApoCIII.
- baseline is defined as the average of all pre-dose measurements and/or assesments. In certain embodiments, “baseline is defined as the last assessment prior to the first dose of the drug. In certain embodiments, the drug is ISIS 678354.
- diabetes mellitus or “diabetes” is a syndrome characterized by disordered metabolism and abnormally high blood sugar (hyperglycemia) resulting from insufficient levels of insulin or reduced insulin sensitivity.
- the characteristic symptoms are excessive urine production (polyuria) due to high blood glucose levels, excessive thirst and increased fluid intake (polydipsia) attempting to compensate for increased urination, blurred vision due to high blood glucose effects on the eye's optics, unexplained weight loss, and lethargy.
- diabetes dyslipidemia or “type 2 diabetes with dyslipidemia” means a condition characterized by Type 2 diabetes, reduced HDL-C, elevated triglycerides (TG), and elevated small, dense LDL particles.
- dose means a quantity of a pharmaceutical agent administered.
- dyslipidemia refers to a disorder of lipid and/or lipoprotein metabolism, including lipid and/or lipoprotein overproduction or deficiency. Dyslipidemias can be manifested by elevation of lipids such as chylomicron, cholesterol and triglycerides as well as lipoproteins such as low-density lipoprotein (LDL) cholesterol.
- LDL low-density lipoprotein
- hypercholesterolemia means a condition characterized by elevated cholesterol or circulating (plasma) cholesterol, LDL-cholesterol and VLDL-cholesterol, as per the guidelines of the Expert Panel Report of the National Cholesterol Educational Program (NCEP) of Detection, Evaluation of Treatment of high cholesterol in adults (see, Arch. Int. Med. (1988) 148, 36-39).
- NCEP National Cholesterol Educational Program
- hyperlipidemia or “hyperlipemia” is a condition characterized by elevated serum lipids or circulating (plasma) lipids. This condition manifests an abnormally high concentration of fats.
- the lipid fractions in the circulating blood are cholesterol, low density lipoproteins, very low density lipoproteins, chylomicrons and triglycerides.
- hypertriglyceridemia means a condition characterized by elevated triglyceride levels. Hypertriglyceridemia is the consequence of increased production and/or reduced or delayed catabolism of triglyceride (TG)-rich lipoproteins: VLDL and, to a lesser extent, chylomicrons (CM).
- TG triglyceride
- VLDL triglyceride-rich lipoproteins
- CM chylomicrons
- intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
- modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
- Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
- loading dose means a therapeutically effective amount of a pharmaceutical agent administered during an initial dosing phase during which steady state concentration of the pharmaceutical agent is achieved.
- Initial loading dose means the first loading dose administered.
- Last loading dose means the loading dose administered most recently prior to administering a first maintenance dose.
- maintenance dose means a therapeutically effective amount of a pharmaceutical agent administered during a dosing phase after steady state concentration of the pharmaceutical agent has been achieved.
- nucleobase means an unmodified nucleobase or modified nucleobase.
- An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
- a “5-methyl cytosine” is a modified nucleobase.
- nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
- nucleoside means a compound comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
- Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a human subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension, and lozenges for the oral ingestion by a human subject.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- potassium salt means a salt of a modified oligonucleotide, wherein the cation of the salt is potassium.
- RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- sodium salt means a salt of a modified oligonucleotide, wherein the cation of the salt is sodium.
- subject means a human or non-human animal. In certain embodiments, the subject is a human subject.
- a “subject in need thereof,” is a subject who would benefit from administration of a modified oligonucleotide disclosed herein. In certain embodiments, the subject in need thereof has FCS.
- sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
- Unmodified sugar moiety means a 2’-0H(H) P-D ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) ⁇ -D deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”).
- Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
- Modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
- symptom means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing the subject.
- terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a human subject. For example, a therapeutically effective amount improves a symptom of a disease.
- week means 7 days.
- Embodiment 1 A method of ameliorating Familial Chylomicronemia Syndrome (FCS) in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure:
- Embodiment 2 The modified oligonucleotide of embodiment 1, which is the sodium salt or the potassium salt.
- Embodiment 3 A method of ameliorating FCS in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure:
- Embodiment 4 A method of ameliorating FCS in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5’ to 3’): Ae S Ge S m Ce S Te S Te S m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es Te S Te S Ae S Te (SEQ ID NO: 3); wherein,
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2 ’-MOE sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- the modified oligonucleotide has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'- nucleoside:
- Embodiment 5 The method of any one of embodiments 1-4, wherein at least one symptom of FCS is ameliorated.
- Embodiment 6 The method of embodiment 5, wherein the at least one symptom comprises severe chylomicronemia, severe hypertriglyceridemia (always reaching well above 1000 mg/dL and not infrequently rising as high as 10,000 mg/dL or more), frequent and severe abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly or a combination thereof.
- severe chylomicronemia severe hypertriglyceridemia (always reaching well above 1000 mg/dL and not infrequently rising as high as 10,000 mg/dL or more), frequent and severe abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly or a combination thereof.
- Embodiment 7 A method of reducing APOCIII RNA in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure:
- Embodiment 8 The modified oligonucleotide of embodiment 7, which is the sodium salt or the potassium salt.
- Embodiment 9 A method of reducing APOCIII RNA in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure:
- Embodiment 10 A method of reducing APOCIII RNA in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5’ to 3’): Ae S Ge S m Ce S Te S Te S m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es Te S Te S Ae S Te (SEQ ID NO: 3); wherein,
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2 ’-MOE sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- the modified oligonucleotide has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'- nucleoside:
- Embodiment 11 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is 50 mg.
- Embodiment 12 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is 60 mg.
- Embodiment 13 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is 70 mg.
- Embodiment 14 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is 80 mg.
- Embodiment 15 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.
- Embodiment 16 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, and about 100 mg.
- Embodiment 17 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43.0 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44.0 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45.0 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg
- Embodiment 18 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of about 40.0 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41.0 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42.0 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43.0 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44.0 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 4
- Embodiment 19 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is within the range of any of 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, and 90 mg to 100 mg,.
- Embodiment 20 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, and less than 40 mg.
- Embodiment 21 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of less than about less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, and less than about 40 mg.
- Embodiment 22 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least about 100 mg.
- Embodiment 23 The method of any one of embodiments 1-10, wherein the therapeutically effective amount is any of at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.
- Embodiment 24 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide once every 4 weeks.
- Embodiment 25 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide once every 8 weeks.
- Embodiment 26 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide once every 12 weeks.
- Embodiment 27 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide once every 16 weeks.
- Embodiment 28 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide once every 20 weeks.
- Embodiment 29 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide about once every 4 weeks.
- Embodiment 30 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide about once every 8 weeks.
- Embodiment 31 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide about once every 12 weeks.
- Embodiment 32 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide about once every 16 weeks.
- Embodiment 33 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide about once every 20 weeks.
- Embodiment 34 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide any of once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.
- Embodiment 35 The method of any one of embodiments 1-23, comprising administering the modified oligonucleotide any of once about every 1 week, once about every 2 weeks, once about every 3 weeks, once about every 4 weeks, once about every 5 weeks, once about every 6 weeks, once about every 7 weeks, once about every 8 weeks, once about every 9 weeks, once about every 10 weeks, once about every 11 weeks, once about every 12 weeks, once about every 13 weeks, once about every 14 weeks, once about every 15 weeks, once about every 16 weeks, once about every 17 weeks, once about every 18 weeks, once about every 19 weeks, and once about every 20 weeks.
- Embodiment 36 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein, in a human subject in need thereof, the method comprising subcutaneously administering to the human subject a therapeutically effective amount of 50 mg or about 50 mg of a modified oligonucleotide according to the following chemical structure:
- Embodiment 37 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein, in a human subject in need thereof, the method comprising subcutaneously administering to the human subject a therapeutically effective amount of 80 mg or about 80 mg of a modified oligonucleotide according to the following chemical structure:
- Embodiment 38 The modified oligonucleotide of embodiment 36 or embodiment 37, which is the sodium salt or the potassium salt.
- Embodiment 39 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein, in a human subject in need thereof, the method comprising intrathecally administering to the human subject a therapeutically effective amount of 50 mg or about 50 mg of a modified oligonucleotide according to the following chemical structure:
- Embodiment 40 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein, in a human subject in need thereof, the method comprising subcutaneously administering to the human subject a therapeutically effective amount of 80 mg or about 80 mg of a modified oligonucleotide according to the following chemical structure:
- Embodiment 41 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject in need thereof, the method comprising subcutaneously administering to the human subject a therapeutically effective amount of 50 mg or about 50 mg of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5’ to 3’): Ae S Ge S m Ce S Te S Te S m Cd S T ds T ds Gd S T ds m Cd S m C ds A ds Gd S m Cd S Te S Te S Ae S Te (SEQ ID NO: 3); wherein,
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2 ’-MOE sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- the modified oligonucleotide has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'- nucleoside:
- Embodiment 42 A method of ameliorating FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject in need thereof, the method comprising subcutaneously administering to the human subject a therapeutically effective amount of 80 mg or about 80 mg of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5’ to 3’): Ae S Ge S m Ce S Te S Te S m Cd S T ds T ds Gd S T ds m Cd S m C ds A ds Gd S m Cd S Te S Te S Ae S Te (SEQ ID NO: 3); wherein,
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2 ’-MOE sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- the modified oligonucleotide has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'- nucleoside:
- Embodiment 43 The method of any one of embodiments 36-42, comprising administering the modified oligonucleotide about once every 4 weeks.
- Embodiment 44 The method of any one of embodiments 36-42, comprising administering the modified oligonucleotide about once every 8 weeks.
- Embodiment 45 The method of any one of embodiments 36-42, comprising administering the modified oligonucleotide about once every 16 weeks.
- Embodiment 46 The method of any one of embodiments 36-45, wherein at least one symptom of FCS is ameliorated.
- Embodiment 47 The method of embodiment 46, wherein the at least one symptom comprises severe chylomicronemia, severe hypertriglyceridemia (always reaching well above 1000 mg/dL and not infrequently rising as high as 10,000 mg/dL or more), frequent and severe abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly, or a combination thereof.
- Embodiment 48 The method of any of embodiments 1-47, wherein APOCIII RNA is reduced.
- Embodiment 49 The method of any of embodiments 1-47, wherein APOCIII protein is reduced.
- Embodiment 50 The method of any one of embodiments 1-49, comprising detecting fasting triglyceride levels in a biological sample from the human subject.
- Embodiment 51 The method of any one of embodiments 1-49, comprising detecting fasting apoB-48 levels in a biological sample from the human subject.
- Embodiment 52 The method of any of embodiments 50 and 51, wherein the biological sample is plasma.
- Embodiment 53 The method of any one of embodiments 1-49, comprising recording the adjudicated acute pancreatits event rate of the human subject.
- Embodiment 54 The method of any of embodiments 50-52, wherein the detecting occurs before the administering.
- Embodiment 55 The method of any of embodiments 50-52, wherein the detecting occurs after the administering.
- Embodiment 56 The method of any of embodiments 50-52, wherein the detecting occurs before and after the administering.
- Embodiment 57 The method of any one of embodiments 50-56, comprising adjusting the initial therapeutically effective amount administered after detecting the amount of APOCIII RNA, or APOCIII protein, or combination thereof.
- Embodiment 58 The method of embodiment 57, wherein the dose is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 90%, or at least about 100% greater than the therapeutically effective amount.
- Embodiment 59 The method of any one of embodiments 50-58, wherein the therapeutically effective amount is about 50 mg or 80 mg.
- Embodiment 60 A method of ameliorating Familial Chylomicronemia Syndrome (FCS), severe hypertriglyceridemia (SHTG), or Familial Partial Lipodystrophy (FPL) in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound according to the following chemical structure:
- FCS Familial Chylomicronemia Syndrome
- SHTG severe hypertriglyceridemia
- FPL Familial Partial Lipodystrophy
- Embodiment 61 The compound of embodiment 1, which is the sodium salt or the potassium salt.
- Embodiment 62. A method of ameliorating Familial Chylomicronemia Syndrome (FCS), severe hypertriglyceridemia (SHTG), or Familial Partial Lipodystrophy (FPL) in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound according to the following chemical structure:
- Embodiment 63 A method of ameliorating Familial Chylomicronemia Syndrome (FCS), severe hypertriglyceridemia (SHTG), or Familial Partial Lipodystrophy (FPL) in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound comprising a modified oligonucleotide having the following chemical notation (5’ to 3’): Ae S Ge S m Ce S Te S Te S m Cd S T ds T ds Gd S T ds m Cd S m C ds A ds Gd S m Cd S Te S Te S Te S Ae S Te (SEQ ID NO: 3); wherein,
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’- OCH2CH2OCH3 modified ribosyl sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- the modified oligonucleotide has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'- nucleoside:
- Embodiment 64 The method of any one of embodiments 60-63, wherein at least one symptom of Familial Chylomicronemia Syndrome (FCS), severe hypertriglyceridemia (SHTG), or Familial Partial Lipodystrophy (FPL) is ameliorated.
- FCS Familial Chylomicronemia Syndrome
- SHTG severe hypertriglyceridemia
- FPL Familial Partial Lipodystrophy
- Embodiment 65 The method of embodiment 64, wherein the at least one symptom of FCS comprises chylomicronemia, hypertriglyceridemia of at least 1000 mg/dL triglycerides, abdominal pain, colicky pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly, or a combination thereof.
- Embodiment 66 The method of embodiment 64, wherein the at least one symptom of SHTG comprises chylomicronemia, abdominal pain, colicky pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly, or a combination thereof.
- Embodiment 67 The method of embodiment 64, wherein the at least one symptom of FPL comprises chylomicronemia, abdominal pain, colicky pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly, or a combination thereof.
- Embodiment 68 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is 50 mg.
- Embodiment 69 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is 60 mg.
- Embodiment 70 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is 70 mg.
- Embodiment 71 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is 80 mg.
- Embodiment 73 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, and about 100 mg.
- Embodiment 74 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg,
- Embodiment 75 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of about 40.0 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41.0 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42.0 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43.0 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44.0 mg, about 44.
- Embodiment 76 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is within the range of any of 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, and 90 mg to 100 mg.
- Embodiment 77 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, and less than 40 mg.
- Embodiment 78 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of less than about less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, and less than about 40 mg.
- Embodiment 79 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least about 100 mg.
- Embodiment 80 The method of any one of embodiments 60-67, wherein the therapeutically effective amount is any of at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.
- Embodiment 81 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide once every 4 weeks.
- Embodiment 82 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide once every 8 weeks.
- Embodiment 83 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide once every 12 weeks.
- Embodiment 84 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide once every 16 weeks.
- Embodiment 85 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide once every 20 weeks.
- Embodiment 86 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide about once every 4 weeks.
- Embodiment 87 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide about once every 8 weeks.
- Embodiment 88 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide about once every 12 weeks.
- Embodiment 89 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide about once every 16 weeks.
- Embodiment 90 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide about once every 20 weeks.
- Embodiment 91 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide any of once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.
- Embodiment 92 The method of any one of embodiments 60-80, comprising administering the modified oligonucleotide any of once about every 1 week, once about every 2 weeks, once about every 3 weeks, once about every 4 weeks, once about every 5 weeks, once about every 6 weeks, once about every 7 weeks, once about every 8 weeks, once about every 9 weeks, once about every 10 weeks, once about every 11 weeks, once about every 12 weeks, once about every 13 weeks, once about every 14 weeks, once about every 15 weeks, once about every 16 weeks, once about every 17 weeks, once about every 18 weeks, once about every 19 weeks, and once about every 20 weeks.
- Embodiment 93 The method of any one of embodiments 60-92, wherein the subject has FCS.
- Embodiment 94 The method of any one of embodiments 60-92, wherein the subject has FPL.
- Embodiment 95 The method of any one of embodiments 60-94, wherein the subject has STHG. I. APOCIII
- APOCIII RNA is encoded by the human APOCIII gene.
- APOCIII protein is the protein expression product of APOCIII RNA.
- a representative nucleobase sequence for a human APOCIII gene is provided at GENBANK Accession No. NT_035088. 1 truncated from nucleobases 6238608 to 6242565, incorporated herein as SEQ ID NO: 1.
- a representative nucleobase sequence for a human APOCIII RNA is provided at GENBANK Accession No. NM_000040.2, incorporated herein as SEQ ID NO: 2.
- ISIS 678354 is characterized as a 5-10-5 MOE gapmer covalently bound at the 5’-end to triantenary N-acetyl galactosamine (GalN AcQ. a high affinity ligand for the hepatocyte-specific asialoglycoprotein receptor (ASGPR) (Prakash TP, Graham MJ, Yu J, et al Nucleic Acids Res 2014; 42: 8796-8807).
- GalN AcQ triantenary N-acetyl galactosamine
- ASGPR hepatocyte-specific asialoglycoprotein receptor
- ISIS 678354 has a sequence of (from 5’ to 3’) AGCTTCTTGTCCAGCTTTAT (incorporated herein as SEQ ID NO: 3), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-M0E nucleosides and each of nucleosides 6-15 are 2’-p-D deoxyribonucleosides, wherein the intemucleoside linkages are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
- ISIS 678354 has a 5’-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the structure below, wherein the phosphate group is attached to the 5'-oxygen atom of the 5 '-nucleoside:
- ISIS 678354 is represented by the following chemical notation (5’ to 3’):
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2 ’-MOE sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- ISIS 678354 is represented by the following chemical structure:
- the sodium salt of ISIS 678354 is represented by the following chemical structure:
- ISIS 678354-CS1 was a Phase 1, double-blind, placebo-controlled, dose-escalation study designed to assess the safety, tolerability and pharmacokinetics of single and multiple doses of ISIS 678354 administered by subcutaneous (SC) injection to healthy subjects (age 18 to 65).
- SC subcutaneous
- SAD single -ascending dose
- MAD multiple -ascending dose
- 2 dose levels (15 and 30 mg) were evaluated at weekly dosing for 6 weeks and 1 dose level (60 mg) was evaluated at every-4-week dosing for 3 months.
- the SAD and weekly MAD dose levels were studied in a cohort of 8 subjects, where 6 were randomized to active treatment with ISIS 678354 and 2 were randomized to placebo. In the every-4-week MAD cohort 10 subjects were studied (6 active and 4 placebo). In the 90 and 120 mg SAD and all of the MAD cohorts, the pharmacodynamic effects of ISIS 678354 vs. placebo were examined in healthy subjects with elevated triglycerides (TG > 200 mg/dL and ⁇ 500 mg/dL).
- the Phase 2 study was a multicenter, randomized, double-blind, placebo-controlled, dose-ranging study.
- a total of 114 patients with established cardiovascular disease (CVD), or being at risk for CVD, with fasting TG levels of > 200 mg/dL and ⁇ 500 mg/dL, and on standard-of-care preventative therapy for their known CVD risk factors were randomly assigned to 1 of the 4 parallel dosing cohorts, with each cohort having a 4: 1 ratio to receive ISIS 678354 or matching volume of placebo, respectively, by SC injection for up to 12 months.
- the study evaluated 3 different doses of ISIS 678354: 10, 15, and 50 mg, and 3 different dosing regimens: weekly, every 2 weeks, and every 4 weeks (Q4W).
- the range of dosing covered the equivalent monthly drug exposure of 10 mg to 50 mg. Treatment duration was 6 to 12 months. The treatment portion of the study was complete when the last patient reached 6 months of exposure. All patients then entered a 13-week Post-Treatment Pollow-up Period.
- the primary efficacy analysis for the primary endpoint was the pairwise comparison of percent change from Baseline to the primary analysis time point in fasting TG between ISIS 678354-treated groups and pooled-placebo group.
- the primary efficacy analysis time point was at Week 25 for patients who received every 4-week dosing and at Week 27 for patients who received every 2-week or weekly dosing.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- the pharmaceutical composition comprises or consists essentially of a sterile saline solution and the modified oligonucleotide ISIS 678354.
- the sterile saline is pharmaceutical grade saline.
- the pharmaceutical composition comprises or consists essentially of sterile water and the modified oligonucleotide ISIS 678354.
- the sterile water is pharmaceutical grade water.
- the pharmaceutically acceptable diluent or carrier is water or saline. The water may be water for injection (WFI).
- the saline may be phosphate-buffered saline.
- compositions comprise one or more excipients and the modified oligonucleotide ISIS 678354.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
- compositions comprising the modified oligonucleotide ISIS 678354 encompass any pharmaceutically acceptable salt of the modified oligonucleotide ISIS 678354, esters of the modified oligonucleotide ISIS 678354, or salts of such esters.
- pharmaceutical compositions comprising the modified oligonucleotide ISIS 678354 are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof upon administration to a human subject.
- the disclosure is also drawn to pharmaceutically acceptable salts of the modified oligonucleotide ISIS 678354, prodrugs of the modified oligonucleotide ISIS 678354, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- compositions comprise one or more lipid moieties and the modified oligonucleotide ISIS 678354.
- lipid moieties are used to increase distribution of ISIS 678354 to a particular cell or tissue.
- the modified oligonucleotide ISIS 678354 is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- compositions disclosed herein comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions.
- Certain delivery systems are useful for preparing pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- compositions comprise one or more tissue-specific delivery molecules designed to deliver modified oligonucleotides described herein to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissuespecific antibody.
- compositions comprise a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV)).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as aCSF, water, or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
- Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- the modified oligonucleotide ISIS 678354 acts as an acid.
- ISIS 678354 may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form
- aqueous solutions of ISIS 678354 exist in equilibrium among such forms.
- a phosphate linkage of ISIS 678354 in aqueous solution exists in equilibrium among free acid, anion, and salt forms.
- the term, “ISIS 678354,” is intended to include all such forms.
- ISIS 678354 has several such linkages, each of which is in equilibrium.
- ISIS 678354 exists in solution in an ensemble of forms at multiple positions all at equilibrium.
- ISIS 678354 is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms.
- a structure depicting the free acid of ISIS 678354 followed by the term “or a salt thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
- ISIS 678354 is in aqueous solution with sodium. In certain embodiments, ISIS 678354 is in aqueous solution with potassium. In certain embodiments, ISIS 678354 is in PBS. In certain embodiments, ISIS 678354 is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
- ISIS 678354 in milligrams indicates the mass of the free acid form of ISIS 678354.
- the free acid in equilibrium with anionic and salt forms.
- ISIS 678354 exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
- ISIS 678354 may be partially or fully deprotonated and in association with Na+ ions.
- a dose of 80 mg of ISIS 678354 equals the number of fully protonated molecules that weighs 80 mg.
- administration is subcutaneous.
- described herein are methods of administering to a subject a therapeutically effective amount of the modified oligonucleotide ISIS 678354.
- the amount may be therapeutically effective in treating or ameliorating a human subject having a disease or condition described herein, for example, Familial Chylomicronemia Syndrome (FCS), severe hypertriglyceridemia (SHTG), or Familial Partial Lipodystrophy (FPL).
- FCS Familial Chylomicronemia Syndrome
- SHTG severe hypertriglyceridemia
- FPL Familial Partial Lipodystrophy
- the amount is therapeutically effective in treating Familial Chylomicronemia Syndrome (FCS).
- the therapeutically effective amount is 50 mg.
- the therapeutically effective amount is 60 mg.
- the therapeutically effective amount is 70 mg.
- the therapeutically effective amount is 80 mg.
- the therapeutically effective amount is any of 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.
- the therapeutically effective amount is any of about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, and about 100 mg.
- the therapeutically effective amount is any of 40.0 mg, 40. 1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43.0 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44.0 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45.0 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9
- 61.8 mg 61.9 mg, 62.0 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63.0 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64.0 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65.0 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66.0 mg, 66.1 mg, 66.2 mg, 66.3 mg,
- the therapeutically effective amount is any of about 40.0 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41.0 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42.0 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43.0 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44.0 mg, about 44.
- the therapeutically effective amount is any of 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, and 90 mg to 100 mg,.
- the therapeutically effective amount is any of less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, and less than 50 mg.
- the therapeutically effective amount is any of less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, and less than about 50 mg.
- the therapeutically effective amount is any of at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least 100 mg.
- the therapeutically effective amount is any of at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.
- the therapeutically effective amount is about 10 to 25 mg per week, which is administered to the subject in one administration every 4 weeks, one administration every 3 weeks, one administration every 2 weeks, or one administration every week. In certain embodiments, the therapeutically effective amount is about 12.5 to 20 mg per week. In certain embodiments, the therapeutically effective amount is about 12.5 mg per week. In certain embodiments, the therapeutically effective amount is about 20 mg per week.
- methods of administering to a subject a therapeutically effective amount of the modified oligonucleotide ISIS 678354 one or more times.
- methods comprise administering the therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times.
- methods comprise administering the therapeutically effective amount once every 2 weeks.
- methods comprise administering the therapeutically effective amount once every 4 weeks.
- methods comprise administering the therapeutically effective amount once every 8 weeks.
- methods comprise administering the therapeutically effective amount once every 16 weeks.
- methods comprise administering the therapeutically effective amount about every 1 week, about every 2 weeks, about every 3 weeks, about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, about every 18 weeks, about every 19 weeks, or about every 20 weeks.
- methods comprise administering the therapeutically effective amount for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.
- described herein are methods of reducing APOCIII RNA and/or APOCIII protein in a cell or biological fluid of a human subject, wherein the methods comprise administering a therapeutically effective amount of ISIS 678354 to the subject.
- methods comprise reducing APOCIII RNA and/or APOCIII protein by 1- 100%, or a range defined by any two of these values. In certain embodiments, methods comprise reducing APOCIII RNA and/or APOCIII protein by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%
- methods comprise reducing APOCIII RNA or APOCIII protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25 %, at least about 30%, at least about 35 %, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
- the reduction in APOCIII RNA or APOCIII protein is relative to a pretreatment level.
- methods comprise reducing APOCIII RNA or APOCIII protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%.
- the reduction in APOCIII RNA or APOCIII protein is relative to a pretreatment level.
- methods comprise reducing triglycerides by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100% when compared to a pretreatment level.
- methods comprise reducing triglycerides to no more than about 50 mg/dL, about 100 mg/dL, about 150 mg/dL, about 200 mg/dL, about 250 mg/dL, about 300 mg/dL, about 400 mg/dL, or about 500 mg/dL.
- the triglyceride levels may be fasting levels.
- a subject has at triglycerides of at least 500 mg/dL. In certain embodiments, the subject has triglycerides of at least 880 mg/dL. In certain embodiments, the subject has triglycerides of at least 1000 mg/dL.
- FCS Fibrosis originating from a fibroblast
- the biomarkers may be one or more of, for example, liver enzymes, and/or markers associated with inflammation (e.g., vascular inflammation), vascular injury, lipid and lipoprotein metabolism, migration and infiltration of monocytes and/or macrophages.
- Such biomarkers include hsCRP, IL6, IL10, ILlb, TNFa, IL8, INFg, ICAM1, OxPL- apoB, MCP1, LpPLA2 activity, and fibrinogen.
- amelioration of FCS, SHTG, or FPL is determined by modulation of one or more biomarkers following administration of ISIS 678354.
- FCS Fibrocronemia
- SHTG Percentive xanthomas
- FPL FPL
- the symptom may be chylomicronemia, abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, or hepatosplenomegaly, or a combination thereof.
- amelioration of FCS, SHTG, or FPL is indicated by modulation of one or more symptoms.
- methods comprise administering ISIS 678354 to a subject and detecting or quantifying an amount of APOCIII RNA or APOCIII protein in a cell or a biological fluid of the subject.
- methods comprise detecting/quantifying a first amount of APOCIII RNA or APOCIII protein in a first biological sample obtained before administering and detecting/quantifying a second amount of APOCIII RNA or APOCIII protein in a second biological sample obtained after administering, and detecting or quantifying a reduction in APOCIII RNA or APOCIII protein by comparing the first amount to the second amount.
- the second biological sample is obtained less than about 24 hours after administering.
- the second biological sample is obtained less than about 1 week after administering. In certain embodiments, the second biological sample is obtained about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, or about 18 weeks after administering. In certain embodiments, methods comprise increasing or decreasing the dose after comparing the first amount to the second amount. In certain embodiments, methods comprise administering more frequently or less frequently after comparing the first amount to the second amount.
- FCS Familial Chylomicronemia Syndrome
- FCS is characterized by frequent and severe abdominal pain, repetitive colicky pain, repeated episodes of potentially fatal acute pancreatitis, and in children, can result in a failure to thrive (Brunzell JD. Familial Lipoprotein Lipase Deficiency. In GeneReviews edited by Adam MP Pagon RA, Bird TD, et al. 1999-2011. Seattle, WA: University of Washington, Seattle; Tremblay K, Methot J, Brisson D, et al. J Clin Lipidol 2011; 5: 37-44). Physical examination frequently reveals eruptive xanthomas, lipemia retinalis and hepatosplenomegaly, and plasma from patients appears lactescent, interfering with determination of other laboratory parameters. Fasting plasma TG levels in FCS patients are typically 10-fold to 100-fold above normal (1,500 to 15,000 mg/dL), despite extreme dietary fat restriction (20 g or approximately 15-20% of daily calorie intake.
- FCS blood pressure
- LPL lipoprotein lipase
- pancreatic capillaries While the pathophysiology underlying chylomicron-related pancreatitis has not been completely elucidated, one hypothesis is that large chylomicrons lodged in pancreatic capillaries are exposed to pancreatic lipase, resulting in release of free fatty acids through the hydrolysis of chylomicron-associated TGs. High concentrations of free fatty acids are thought to damage pancreatic cells leading to emergent pancreatitis (Yang F, Wang Y, Stemfeld L, et al. Acta Physiol (Oxf) 2009; 195: 13-28.; Berglund L, Brunzell JD, Goldberg AC, et al. J Clin Endocrinol Metab 2012; 97: 2969-2989).
- FCS significantly affects patients’ HRQoL. Bloating, generalized abdominal pain, asthenia, anxiety about potential painful attacks and overall health, difficulty concentrating and “brain fog” are commonly reported symptoms of FCS. The psychosocial burden of FCS is also increased by dietary fat restriction and overall interference with social interactions and ability to work (Davidson M, Stevenson M, Hsieh A, et al. Expert Rev Cardiovasc Ther 2017; 15: 415-423; Gelrud A, Williams KR, Hsieh A, et al. Expert Rev Cardiovasc Ther 2017; 15: 879-887; Davidson M, Stevenson M, Hsieh A, et al. J Clin Lipidol 2018; 12: 898- 9O7.e892; Fox RS, Peipert JD, Llonch MV, et al. Expert Rev Cardiovasc Ther 2020: 1-8).
- LPL normally functions to hydrolyze TGs in chylomicrons along the luminal surface of capillaries, mainly in heart, skeletal muscle, and adipose tissue, promoting TG clearance from the circulation.
- LPL is regulated by a number of key genes, and loss-of-function mutations in one of these genes, or the LPL gene itself, results in FCS (Surendran RP, Visser ME, Heemelaar S, et al. J Intern Med 2012; 272: 185-196).
- apolipoprotein C-II a cofactor for LPL (Schuster KB, Wilfert W, Evans D, et al. Clin Chim Acta 2011; 412: 240-244); apolipoprotein A-V (APOA5) (Schaap FG, Rensen PC, Voshol PJ, et al.
- LMF1 lipase maturation Factor 1
- GP1HBP1 glycosylphosphotidylinositol-anchored HDL-binding protein 1
- GP1HBP1 glycosylphosphotidylinositol-anchored HDL-binding protein 1
- Familal Partial Lipodystrohpy refers to a familial disorder characterized by selective, progressive loss of body fat (adipose tissue) from various areas of the body. Individuals with FPL often have reduced subcutaneous fat in the arms and legs, and the head and trunk regions may or may not have loss of fat. Conversely, affected individuals may also have excess subcutaneous fat accumulation in other areas of the body, especially the neck, face and intra-abdominal regions. In many cases, adipose tissue loss begins during puberty.
- FPL can be associated with a variety of metabolic abnormalities. FPL is associated with certain metabolic complications. These complications can include an inability to metabolize glucose, elevated levels of triglycerides, and diabetes.
- Six different subtypes of FPL have been identified. Each subtype is caused by a mutation in a different gene. Four forms of FPL are inherited as autosomal dominant traits; one form is inherited as an autosomal recessive trait. The mode of inheritance of FPL, Kobberling variety is unknown
- FPL FPL2 (Dunnigan variety), FPL1 (Kobberling variety), FPL3 (PPARG Mutations), FPL4 (PLIN1 Mutations), FPL5 (AKT2 Mutations), and Autosomal Recessive FPL (Type 6, CIDEC mutation).
- Severe Hypertriglyceridemia refers to a condition in which a subject has trigycerides at a level at which chylomicrons appear in the blood.
- a subject has at triglycerides of at least 500 mg/dL.
- SHTG may be acquired or familial.
- a subject having FCS or FPL may also be diagnosed as having SHTG.
- the subject has triglycerides of at least 880 mg/dL.
- the subject has triglycerides of at least 1000 mg/dL.
- SHTG may arise in subjects having obesity, a history of alcohol abuse, and/or diabetes.
- SHTG may arise due to a combination of weak genetic factors combined with secondary factors such as certain medications (e.g., oral estrogens, glycocorti-costeroids, protease inhibitors, some antihypertensive medications such as hydrochlorothiazide, and nonselective beta-blockers, retinoic acid (isotretinoin), tamoxifen, raloxifen, cyclosporin, sirolimus, bile acid-binding resins, and antipsychotic medications including clozapine and olanzapine) or metabolic disorders (e.g., obesity, diabetes, hypothyroidism, or kidney disease), or from genetic factors alone.
- Patients having SHTG are at risk for acute pancreatitis. See, e.g., Cybulska, B. et al., Kardiologia Polska 2013; 71, 10: 1007-1012.
- methods described herein are sufficiently effective to ameliorate at least one symptom of FCS in a human subject.
- the at least one symptom is severe elevations in chylomicrons.
- the at least one symptom is extremely elevated TG levels (always reaching well above 1000 mg/dL and not infrequently rising as high as 10,000 mg/dL or more).
- the at least one symptom is episodes of abdominal pain.
- the at least one symptom is recurrent acute pancreatitis.
- the at least one symptom is repetitive colicky pain.
- the at least one symptom is eruptive xanthomas.
- the at least one symptom is hepatosplenomegaly. In certain embodiments, the at least one symptom is physical fatigue. In certain embodiments, the at least one symptom is difficulty thinking. In certain embodiments, the at least one symptom is diarrhea. In certain embodiments, the at least one symptom is difficulty thinking. In certain embodiments, the at least one symptom is recurrent acute pancreatitis. In certain embodiments, the at least one symptom is lipemia retinalis.
- the at least one symptom is a combination of any one of severe chylomicronemia, severe hypertriglyceridemia, frequent and severe abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly.
- methods described herein are sufficiently effective to ameliorate any one of severe chylomicronemia, severe hypertriglyceridemia, frequent and severe abdominal pain, repetitive colicky pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, lipemia retinalis, and hepatosplenomegaly.
- methods described herein are sufficiently effective to ameliorate at least one symptom of FCS in a human subject as assessed by a clinically relevant test, score or scale.
- the clinical relevant scale is the Patient Global Impression of Severity (PGIS) Scale.
- the clinical relevant scale is the Patient Global Impression of Change (PGIC) Scale.
- the clinically relevant test is fasting triglyceride levels.
- the clinically relevant test is fasting apoB-48 levels. .
- the clinically relevant test, score or scale is a decrease the adjudicated pancreatitis event rate in patients with > 2 events in 5 years prior to enrollment.
- the clinically relevant test, score or scale is number of emergency room (ER) visits, incidence of all -cause hospitalizations, and total inpatient days.
- health-related quality of life is measured by the PROMIS 29+2 Profile vs. 2. 1 questionnaire.
- methods described herein are sufficiently tolerable in safety and tolerability assessments, including adverse events, clinical laboratory tests, ECGs, use of concomitant medications, and independently adjudicated events rates of Major Cardiovascular Events (MACE) for ISIS 678354 as compared to placebo.
- MACE Major Cardiovascular Events
- methods comprise co-administering ISIS 678354 with at least one other pharmaceutical agent.
- the at least one other pharmaceutical agent ameliorates HD or a symptom thereof.
- ISIS 678354 is co-administered with the at least one other pharmaceutical agent to produce a combinational effect.
- ISIS 678354 is coadministered with the at least one other pharmaceutical agent to produce a synergistic effect.
- ISIS 678354 and the at least one other pharmaceutical agent are administered at the same time. In certain embodiments, ISIS 678354 and the at least one other pharmaceutical agent are administered at different times. In certain embodiments, ISIS 678354 and the at least one other pharmaceutical agent are prepared together in a single formulation. In certain embodiments, ISIS 678354 and the at least one other pharmaceutical agent are administered are prepared separately.
- FCS Familial Chylomicronemia Syndrome
- Efficacy parameters tested include percent change in fasting triglycerides (TG) from baseline (defined as the average of the Day 1 pre-dose assessment and the last measurement prior to Day 1) at 6 months (the average of Weeks 23, 25 and 27) compared to placebo, and at 12 months (average of Weeks 51 and 53) compared to placebo.
- TG fasting triglycerides
- Patient inclusion criteria includes a fasting triglyceride level of > 880 mg/dL (lOmmol/L) before treatment.
- Post-treatment evaluation includes determining the proportion of patients who achieve > 40% reduction in fasting TG from baseline, the proportion of patients who achieve fasting TG ⁇ 750 mg/dL (8.4 mmol/L), the proportion of patients who achieve > 70% reduction in fasting TG from baseline, and the proportion of patients who achieve fasting TG ⁇ 500 mg/dL (5.7 mmol/L).
- evaluation criteria include percent change in fasting ApoB-48 from baseline, as well as determining the adjudicated acute pancreatitis event rate.
- pharmacokinetic analysis includes determination of trough (pre-dose) and post-treatment plasma concentrations of Compound No. 678354 in all patients who receive the modified oligonucleotide.
- Safety parameters tested include platelet counts, renal function testing, liver function testing. All patients have liver function monitored every 14 days ( ⁇ 2 days) for the first 3 months of the treatment period, and monthly testing thereafter during the treatment period. Liver function tests include monitoring for appearance of signs of hepatic injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN), followed by liver enzyme and bilirubin evaluation in the event of signs of hepatic injury. All patients have renal function tests monitored every 14 days ( ⁇ 2 days) for the first 3 months of the treatment period, and monthly testing thereafter during the treatment period.
- Renal function surveillance includes serum creatinine and urinalysis including UACR (Urine Albumin/Creatinine Ratio), UPCR (Urine Protein/Creatinine Ratio), urinary red blood cells (RBC). All patients have platelet counts monitored at least every 14 days ( ⁇ 2 days) for the duration of the study treatment period, and at all post-treatment follow-up visits. All patients are evaluated for occurrence of bleeding events continuously after the start of treatment (Day 1) up to the end of the follow-up period.
- UACR Human Albumin/Creatinine Ratio
- UPCR User Protein/Creatinine Ratio
- RBC urinary red blood cells
- the patients may elect to enroll in an OLE (Open Label Extension) study pending study approval of this proposed study by the IRB/IEC and the appropriate regulatory authority.
- OLE Open Label Extension
- the treatment is therapeutically effective in amelioriating or treating FCS (as observed by amelioration of one or more symptoms, or by modulation of one or more biomarkers).
- Example 2 Clinical protocol including dosing parameters, efficacy endpoints and safety endpoints
- Efficacy parameters tested include percent change in fasting triglycerides (TG) from baseline (defined as the average of the Day 1 pre-dose assessment and the last measurement prior to Day 1) at 6 months (the average of Weeks 23, 25 and 27) compared to placebo, and at 12 months (average of Weeks 51 and 53) compared to placebo.
- TG fasting triglycerides
- Patient inclusion criteria includes a fasting triglyceride level of > 880 mg/dL (lOmmol/L) before treatment.
- Post-treatment evaluation includes determining the proportion of patients who achieve > 40% reduction in fasting TG from baseline, the proportion of patients who achieve fasting TG ⁇ 750 mg/dL (8.4 mmol/L), the proportion of patients who achieve > 70% reduction in fasting TG from baseline, and the proportion of patients who achieve fasting TG ⁇ 500 mg/dL (5.7 mmol/L).
- evaluation criteria include percent change in fasting ApoB-48 from baseline, as well as determining the adjudicated acute pancreatitis event rate.
- pharmacokinetic analysis includes determination of trough (pre-dose) and post-treatment plasma concentrations of Compound No. 678354 in all patients who receive the modified oligonucleotide.
- Safety parameters tested include platelet counts, renal function testing, liver function testing. All patients have liver function monitored every 14 days ( ⁇ 2 days) for the first 3 months of the treatment period, and monthly testing thereafter during the treatment period. Liver function tests include monitoring for appearance of signs of hepatic injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN), followed by liver enzyme and bilirubin evaluation in the event of signs of hepatic injury. All patients have renal function tests monitored every 14 days ( ⁇ 2 days) for the first 3 months of the treatment period, and monthly testing thereafter during the treatment period.
- Renal function surveillance includes serum creatinine and urinalysis including UACR (Urine Albumin/Creatinine Ratio), UPCR (Urine Protein/Creatinine Ratio), urinary red blood cells (RBC). All patients have platelet counts monitored at least every 14 days ( ⁇ 2 days) for the duration of the study treatment period, and at all post-treatment follow-up visits. All patients are evaluated for occurrence of bleeding events continuously after the start of treatment (Day 1) up to the end of the follow-up period.
- UACR Human Albumin/Creatinine Ratio
- UPCR User Protein/Creatinine Ratio
- RBC urinary red blood cells
- the treatment is therapeutically effective in amelioriating or treating FPU (as observed by amelioration of one or more symptoms, or by modulation of one or more biomarkers).
- Example 3 Clinical protocol including dosing parameters, efficacy endpoints and safety endpoints
- Efficacy parameters tested include percent change in fasting triglycerides (TG) from baseline (defined as the average of the Day 1 pre-dose assessment and the last measurement prior to Day 1) at 6 months (the average of Weeks 23, 25 and 27) compared to placebo, and at 12 months (average of Weeks 51 and 53) compared to placebo.
- TG fasting triglycerides
- Patient inclusion criteria includes a fasting triglyceride level of > 500 mg/dE before treatment.
- Posttreatment evaluation includes determining the proportion of patients who achieve > 40% reduction in fasting TG from baseline, the proportion of patients who achieve fasting TG ⁇ 500 mg/dE, the proportion of patients who achieve > 70% reduction in fasting TG from baseline, and the proportion of patients who achieve fasting TG ⁇ 135 mg/dE.
- evaluation criteria include percent change in fasting ApoB-48 from baseline, as well as determining the adjudicated acute pancreatitis event rate.
- pharmacokinetic analysis includes determination of trough (pre-dose) and post-treatment plasma concentrations of Compound No. 678354 in all patients who receive the modified oligonucleotide. Safety parameters tested include platelet counts, renal function testing, liver function testing.
- liver function tests include monitoring for appearance of signs of hepatic injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN), followed by liver enzyme and bilirubin evaluation in the event of signs of hepatic injury.
- All patients have renal function tests monitored every 14 days ( ⁇ 2 days) for the first 3 months of the treatment period, and monthly testing thereafter during the treatment period.
- Renal function surveillance includes serum creatinine and urinalysis including UACR (Urine Albumin/Creatinine Ratio), UPCR (Urine Protein/Creatinine Ratio), urinary red blood cells (RBC). All patients have platelet counts monitored at least every 14 days ( ⁇ 2 days) for the duration of the study treatment period, and at all post-treatment follow-up visits. All patients are evaluated for occurrence of bleeding events continuously after the start of treatment (Day 1) up to the end of the follow-up period.
- UACR Human Albumin/Creatinine Ratio
- UPCR User Protein/Creatinine Ratio
- RBC urinary red blood cells
- the treatment is therapeutically effective in amelioriating or treating SHTG (as observed by amelioration of one or more symptoms, or by modulation of one or more biomarkers).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Obesity (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
- Medicinal Preparation (AREA)
- Saccharide Compounds (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2023003855A MX2023003855A (es) | 2020-10-02 | 2021-09-24 | Metodos para reducir la expresion de apociii. |
| EP21876250.8A EP4221720A4 (en) | 2020-10-02 | 2021-09-24 | METHODS FOR REDUCING APOCIII EXPRESSION |
| AU2021353849A AU2021353849A1 (en) | 2020-10-02 | 2021-09-24 | Methods for reducing apociii expression |
| CN202180066569.6A CN116348125A (zh) | 2020-10-02 | 2021-09-24 | 降低apociii表达的方法 |
| BR112023004012A BR112023004012A2 (pt) | 2020-10-02 | 2021-09-24 | Métodos para reduzir a expressão de apociii |
| IL300882A IL300882A (en) | 2020-10-02 | 2021-09-24 | Methods for reducing APOCIII expression |
| US18/247,567 US20240033280A1 (en) | 2020-10-02 | 2021-09-24 | Methods for reducing apociii expression |
| JP2023520059A JP2023543898A (ja) | 2020-10-02 | 2021-09-24 | Apociii発現を減少させるための方法 |
| KR1020237013301A KR20230079394A (ko) | 2020-10-02 | 2021-09-24 | Apociii 발현을 감소시키는 방법 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063087095P | 2020-10-02 | 2020-10-02 | |
| US63/087,095 | 2020-10-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022072244A1 true WO2022072244A1 (en) | 2022-04-07 |
Family
ID=80950871
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/052001 Ceased WO2022072244A1 (en) | 2020-10-02 | 2021-09-24 | Methods for reducing apociii expression |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20240033280A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4221720A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2023543898A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20230079394A (cg-RX-API-DMAC7.html) |
| CN (1) | CN116348125A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2021353849A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112023004012A2 (cg-RX-API-DMAC7.html) |
| IL (1) | IL300882A (cg-RX-API-DMAC7.html) |
| MX (1) | MX2023003855A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022072244A1 (cg-RX-API-DMAC7.html) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024097861A1 (en) * | 2022-11-02 | 2024-05-10 | Ionis Pharmaceuticals, Inc. | Methods for modulating complement factor b expression |
| US12291579B2 (en) | 2023-03-17 | 2025-05-06 | Oxitope Pharma B.V. | Anti-phosphocholine antibodies and methods of use thereof |
| US12391942B2 (en) | 2018-05-11 | 2025-08-19 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods of use thereof |
| US12552743B2 (en) | 2018-04-12 | 2026-02-17 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods of use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040208856A1 (en) * | 2003-04-16 | 2004-10-21 | Isis Pharmaceuticals Inc. | Modulation of apolipoprotein C-III expression |
| US20150376614A1 (en) * | 2013-02-14 | 2015-12-31 | Isis Pharmaceuticals, Inc. | Modulation of apolipoprotein c-iii (apociii) expression in lipoprotein lipase deficient (lpld) populations |
| US20180245076A1 (en) * | 2015-02-27 | 2018-08-30 | Ionis Pharmaceuticals, Inc. | Modulation of apolipoprotein c-iii (apociii) expression in lipodystrophy populations |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL4119569T3 (pl) * | 2015-11-06 | 2024-11-18 | Ionis Pharmaceuticals, Inc. | Sprzężone związki antysensowne do zastosowania w terapii |
-
2021
- 2021-09-24 US US18/247,567 patent/US20240033280A1/en active Pending
- 2021-09-24 JP JP2023520059A patent/JP2023543898A/ja active Pending
- 2021-09-24 EP EP21876250.8A patent/EP4221720A4/en active Pending
- 2021-09-24 IL IL300882A patent/IL300882A/en unknown
- 2021-09-24 KR KR1020237013301A patent/KR20230079394A/ko active Pending
- 2021-09-24 CN CN202180066569.6A patent/CN116348125A/zh active Pending
- 2021-09-24 AU AU2021353849A patent/AU2021353849A1/en active Pending
- 2021-09-24 MX MX2023003855A patent/MX2023003855A/es unknown
- 2021-09-24 BR BR112023004012A patent/BR112023004012A2/pt unknown
- 2021-09-24 WO PCT/US2021/052001 patent/WO2022072244A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040208856A1 (en) * | 2003-04-16 | 2004-10-21 | Isis Pharmaceuticals Inc. | Modulation of apolipoprotein C-III expression |
| US20150376614A1 (en) * | 2013-02-14 | 2015-12-31 | Isis Pharmaceuticals, Inc. | Modulation of apolipoprotein c-iii (apociii) expression in lipoprotein lipase deficient (lpld) populations |
| US20180245076A1 (en) * | 2015-02-27 | 2018-08-30 | Ionis Pharmaceuticals, Inc. | Modulation of apolipoprotein c-iii (apociii) expression in lipodystrophy populations |
Non-Patent Citations (2)
| Title |
|---|
| See also references of EP4221720A4 * |
| T. P. PRAKASH, M. J. GRAHAM, J. YU, R. CARTY, A. LOW, A. CHAPPELL, K. SCHMIDT, C. ZHAO, M. AGHAJAN, H. F. MURRAY, S. RINEY, S. L. : "Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD., vol. 42, no. 13, 1 September 2014 (2014-09-01), pages 8796 - 8807, XP055148318, ISSN: 03051048, DOI: 10.1093/nar/gku531 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12552743B2 (en) | 2018-04-12 | 2026-02-17 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods of use thereof |
| US12391942B2 (en) | 2018-05-11 | 2025-08-19 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods of use thereof |
| WO2024097861A1 (en) * | 2022-11-02 | 2024-05-10 | Ionis Pharmaceuticals, Inc. | Methods for modulating complement factor b expression |
| US12291579B2 (en) | 2023-03-17 | 2025-05-06 | Oxitope Pharma B.V. | Anti-phosphocholine antibodies and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20240033280A1 (en) | 2024-02-01 |
| JP2023543898A (ja) | 2023-10-18 |
| EP4221720A4 (en) | 2024-11-13 |
| EP4221720A1 (en) | 2023-08-09 |
| IL300882A (en) | 2023-04-01 |
| AU2021353849A8 (en) | 2023-03-30 |
| MX2023003855A (es) | 2023-04-14 |
| CN116348125A (zh) | 2023-06-27 |
| AU2021353849A1 (en) | 2023-03-23 |
| BR112023004012A2 (pt) | 2023-04-25 |
| KR20230079394A (ko) | 2023-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4221720A1 (en) | Methods for reducing apociii expression | |
| JP6203707B2 (ja) | アポリポタンパク質ciii(apociii)発現の調節 | |
| McCampbell et al. | Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models | |
| US9593333B2 (en) | Modulation of apolipoprotein C-III (ApoCIII) expression in lipoprotein lipase deficient (LPLD) populations | |
| US20240218361A1 (en) | Modulating apolipoprotein (a) expression | |
| US9909124B2 (en) | Compounds and methods for modulating apolipoprotein C-III expression for improving a diabetic profile | |
| CN119185345A (zh) | 用于治疗和预防肌肉萎缩性脊髓侧索硬化症的组合物和方法 | |
| AU2025267467A1 (en) | METHOD FOR REDUCING THE RISK OF A CARDIOVASCULAR EVENT WITH CONJUGATED ANTISENSE COMPOUNDS TARGETING APO(a) | |
| Mohammadi et al. | RNA therapies in cardio-kidney-metabolic syndrome: advancing disease management | |
| Neverov et al. | HDL causes mesangial cell mitogenesis through a tyrosine kinase-dependent receptor mechanism. | |
| WO2025147604A1 (en) | Methods for treating primary hyperoxaluria via genetic editing of hydroxyacid oxidase 1 | |
| Shoulders | Cardiovascular implications of partial, tissue-specific silencing of MTP | |
| CN108026529A (zh) | 组合疗法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21876250 Country of ref document: EP Kind code of ref document: A1 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023004012 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2021353849 Country of ref document: AU Date of ref document: 20210924 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2023520059 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18247567 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 20237013301 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112023004012 Country of ref document: BR Kind code of ref document: A2 Effective date: 20230303 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021876250 Country of ref document: EP Effective date: 20230502 |