WO2022071890A1

WO2022071890A1 - Guide rnas targeting sars-cov-2

Info

Publication number: WO2022071890A1
Application number: PCT/SG2021/050597
Authority: WO
Inventors: Muhammad Bin Hajis IRFAN; Wei Leong CHEW; Jung Eun Park
Original assignee: Agency For Science, Technology And Research
Priority date: 2020-10-02
Filing date: 2021-10-01
Publication date: 2022-04-07

Abstract

The invention relates to specific guide RNAs comprising a first nucleic acid sequence complementary to a SARS-CoV- 2 nucleic acid and a second nucleic acid sequence capable of directing a Cas nuclease to the SARS-CoV-2 nucleic acid. In a preferred embodiment, the SARS-CoV-2 nucleic acid is a single stranded RNA and the Cas nuclease is a Cas13 nuclease. Also disclosed herein are pharmaceutical compositions comprising the guide RNA and a Cas nuclease for treating SARS-CoV-2 infection in a subject.

Description

GUIDE RNAS TARGETING SARS-CoV-2

Field of Invention

The invention relates generally to the field of virology. In particular, the specification teaches guide RNA sequences, vectors, compositions and methods of treating a SARS- CoV-2 infection in a subject.

Background

The current coronavirus disease 2019 (COVID-19) pandemic is caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus and has affected millions of people around the world. Those who are infected with the virus can have mild to severe symptoms ranging from, for example, fever, chills, cough or shortness of breath.

The SARS-CoV-2 virus is a positive-sense single stranded RNA virus, which typically infects the upper and lower respiratory tracts of humans. The SARS-CoV-2 virus releases its RNA genome into an infected cell and synthesizes viral mRNAs and new copies of the viral genome.

RNA viruses are particularly problematic for the development of therapeutics. This is because traditional drugs are not very effective against RNA viruses. RNA viruses also tend to sequester their RNAs in protected viral replication complexes or other compartments in the cell. Moreover, RNA viruses tend to evolve relatively quickly and can also remain latent in the cell, only to be reactivated to replicate in the future.

It would be desirable to overcome or ameliorate at least one of the above-described problems, or at least to provide a useful alternative.

Summary

Disclosed herein is a guide RNA comprising a first nucleic acid sequence complementary to a SARS-CoV-2 nucleic acid and a second nucleic acid sequence capable of directing a Cas nuclease to the SARS-CoV-2 nucleic acid, wherein at least one of the following applies: a) the first nucleic acid sequence hybridizes to the reverse complement of the nucleic acid sequence of any one of SEQ ID NOs: 47-68 under stringent conditions; b) the first nucleic acid sequence is encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 6-27; and c) the first nucleic acid sequence comprises a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NOs: 47-68.

Disclosed herein is a construct comprising a nucleic acid sequence encoding one or more guide RNAs as defined herein.

Disclosed herein is a vector comprising a construct as defined herein.

Disclosed herein is a pharmaceutical composition comprising a guide RNA or a vector as defined herein.

Disclosed herein is a pharmaceutical composition comprising: a) a Cas nuclease or a nucleic acid encoding a CAS nuclease; and b) a guide RNA or a vector as defined herein.

Disclosed herein is a guide RNA, a vector or a pharmaceutical composition as defined herein for use as a medicament or vaccine.

Disclosed herein is a method of altering the level of SARS-COV-2 nucleic acid in a cell, the method comprising contacting the cell with an effective amount of a guide RNA, a vector or a pharmaceutical composition as defined herein.

Disclosed herein is a method of preventing or treating SARS-CoV-2 infection in a subject, the method comprising administering to a subject an effective amount of a guide RNA, a vector or a pharmaceutical composition as defined herein. Disclosed herein is a guide RNA, a vector or a pharmaceutical composition as defined herein for use in preventing or treating SARS-CoV-2 infection in a subject.

Disclosed herein is the use of a guide RNA, a vector or a pharmaceutical composition as defined herein in the manufacture of a medicament for preventing or treating SARS- CoV-2 infection in a subject.

Disclosed herein is a kit comprising a guide RNA, a vector or a pharmaceutical composition as defined herein.

Brief Description of Drawings

Embodiments of the present invention are hereafter described, by way of non-limiting example only, with reference to the accompanying drawings in which:

Figure 1: CRISPR-Casl3 guide RNA (gRNA) screening platform.

Figure 2. Screening workflow.

Figure 3. Cleavage efficiency of candidate CRISPR-Casl3 gRNAs targeting the SARS-CoV-2 RNA. a-b. The gRNAs targeting the SARS-CoV-2 RNA. c-d. In vitro cleavage assay of the candidate gRNAs shows high cleavage efficiency against the SARS-CoV-2 RNA targets. Note that each ssRNA target corresponds to the tested gRNA, and each ssRNA target is hence different from the rest, c: Raw Ct values of each ssRNA target with or without gRNAs. d: Cleavage efficiency of each CRISPR-Casl3- gRNAs against the SARS-CoV-2 target ssRNA. Cleavage efficiency is calculated as { [1 - (quantified amount of ssRNA with gRNA) / (mean quantified amount of ssRNA without gRNA)] * 100%}; n=3.

Detailed Description

The invention generally relates to guide RNA sequences, vectors, compositions and methods of treating a SARS-CoV-2 infection in a subject. The specification discloses guide RNA sequences that are complementary to a SARS-CoV-2 nucleic acid, which may be used to direct CRISPR-Cas nucleases to target viral genomes. These nucleases have the ability to incapacitate or disrupt a virus within a cell by systematically modifying the viral genome (e.g. via cleavage, substitutions, deletions, insertions or rearrangements) to incapacitate or destroy the virus.

The specification teaches a guide RNA (gRNA) comprising a first nucleic acid sequence complementary to a SARS-CoV-2 nucleic acid and a second nucleic acid sequence capable of directing a Cas nuclease to the SARS-CoV-2 nucleic acid.

Through a CRISPR-Cas gRNA designing bioinformatics pipeline, the inventors have designed candidate gRNAs against target sequences with the relevant in silico predicted on-target, off-target, and performance scores. In order to further evaluate the empirical cleavage efficiency of these designed gRNAs, a convenient and high-throughput assay platform to screen the gRNAs is critical. So far, most gRNA screening tools are for the CRISPR-Cas9 system that targets DNA and use gel-based analysis or sequencing. Here, the inventors disclose a facile in vitro screening assay for CRISPR-Casl3-gRNAs targeting RNA, where the readout of cleavage efficiency is quantified via RT-qPCR. Importantly, this platform was used to develop, and now disclose, CRISPR-Cas 13- gRNA sequences against the SARS-CoV-2 RNA.

As used herein, the term "guide RNA" or “guide RNA” refers to a RNA which is specific for the target nucleic acid and can form a complex with Cas protein (such as Cas 13) and bring Cas protein to the target nucleic acid. The guide RNA may comprise or consist of a spacer sequence (i.e. the first nucleic acid sequence) that is specific to a target nucleic acid and a direct repeat sequence (i.e. the second nucleic acid sequence) that facilitates binding to a Cas protein (such as a Cas 13 protein).

A direct-acting modality like CRISPR-Casl3 can (i) offer a new mode of action, (ii) can access RNA viruses in vivo, (iii) can be programmed to target multiple regions of the viruses, and/or (iv) eliminate latent viruses.

In the context of formation of a CRISPR complex, "target sequence" or “target nucleic acid” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In one embodiment, the “target sequence” is a SARS-CoV-2 nucleic acid or a variant thereof.

In one embodiment, the guide RNA is complementary to a SARS-CoV-2 nucleic acid or a variant thereof. The SARS-CoV-2 nucleic acid may, for example, be between 10 and 30 nucleotides in length. In one embodiment, the SARS-CoV-2 nucleic acid is a single stranded RNA. In one embodiment, the SARS-CoV-2 nucleic acid is a genomic RNA or a genomic RNA fragment from SARS-CoV-2. In another embodiment, the SARS-CoV-2 nucleic acid is a RNA transcript or RNA transcript fragment from SARS- CoV-2. The SARS-CoV-2 nucleic acid may comprise or consist of a 5’UTR from SARS-COV-2 or a gene or corresponding mRNA from SARS-COV-2 such as orflab (nsp2), orflab (nsp3), orflab (nsp4), orflab (nsp6), orflab (RDRP), orflab (exonuclease), orflab nspl6_OMT, S, orf3a, E, M and/or N gene. In one embodiment, the SARS-CoV-2 is a structural protein (i.e. S, E, M or N) or the RDRP enzyme. The SARS-COV-2 nucleic acid may be encoded by a nucleic acid sequence selected from the group consisting of any one of SEQ ID NO: 28-46. In one embodiment, the SARS-CoV-2 is a variant of SARS-CoV-2. The variant of SARS-CoV-2 may be, for example, a B.1.1.7 (Alpha), B.1.351 (Beta), B.1.617.2 (Delta), or P.1 (Gamma) variant.

The first nucleic sequence (or spacer sequence) can be modified to hybridize to any desired sequence within a target nucleic acid. The first nucleic acid sequence can have a length from about 10 nucleotides to about 100 nucleotides. For example, it can have a length of from about 10 nucleotides (nt) to about 90 nt, from about 10 nt to about 80 nt, from about 10 nt to about 70 nt, from about 10 nt to about 60 nt, from about 10 nt to about 50 nt, from about 10 nt to about 40 nt, from about 10 nt to about 30 nt. For example, it can have a length of about 14 nt to about 30 nt, about 15 nt to about 30 nt, about 16 nt to about 30 nt, about 17 nt to about 30 nt, about 18 nt to about 30 nt, about 19 nt to about 30 nt, about 20 nt to about 30 nt, about 21 nt to about 30 nt, about 22 nt to about 30 nt or about 23 nt to about 30 nt. For example, it can have a length of from about 23 nt to about 30 nt, 23 nt to about 29 nt, from about 23 nt to about 28 nt, from about 23 nt to about 27 nt, from about 23 nt to about 26 nt, from about 23 nt to about 25 nt, or from about 23 nt to about 24 nt. The first nucleic acid sequence can be 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt or more in length.

In one embodiment, the first nucleic acid sequence hybridizes to the reverse complement of a nucleic acid sequence of any one of SEQ ID NOs: 47-68 under stringency condition (i.e. any one of SG2 to SG23). The first nucleic acid sequence may, for example, hybridize to the reverse complement of a nucleic acid sequence of any one of SEQ ID NO: 50, 51, 53, 55, 62 or 63 (i.e. any one of SG5, SG6, SG8, SG10, SG17 or SG18). The first nucleic acid sequence may also hybridize to the reverse complement of a nucleic acid sequence of any one of SEQ ID NO: 53, 55, 57, 61, 62 or 64 (i.e. any one of SG8, SG10, SG12, SG16, SG17 or SG19).

In one embodiment, the first nucleic acid sequence hybridizes to the reverse complement of a nucleic acid sequence of any one of SEQ ID NOs: 47-68 under stringent condition (i.e. any one of SG2 to SG23). In one embodiment, the first nucleic acid sequence is encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 6-27. The first nucleic acid sequence may, for example, be encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 9, 10, 12, 14, 21 or 22 (i.e. any one of SG5, SG6, SG8, SG10, SG17 or SGI 8). The first nucleic acid sequence may also be encoded by a nucleic acid sequence of any one of SEQ ID NO: 12, 14, 16, 20, 21 or 23 (i.e. any one of SG8, SG10, SG12, SG16, SG17 or SG19).

In one embodiment, the first nucleic acid sequence comprises a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NOs: 47-68.

In one embodiment, the first nucleic acid sequence comprises a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NOs: 47-68. The first nucleic acid sequence may, for example, comprise a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 50, 51, 53, 55, 62 or 63 (i.e. any one of SG5, SG6, SG8, SG10, SG17 or SG18). The first nucleic acid sequence may also comprise a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 53, 55, 57, 61, 62 or 64 (i.e. any one of SG8, SG10, SG12, SG16, SG17 or SG19).

In one embodiment, the first nucleic acid sequence is joined to the second nucleic acid sequence. The second nucleic acid sequence may be a nucleic acid sequence capable of directing a Cas nuclease (such as a Casl3 nuclease) to the SARS-CoV-2 nucleic acid.

The first nucleic acid sequence may be contiguous with (or positioned adjacent to) the second nucleic acid sequence. Alternatively, the first nucleic acid sequence may be joined to the second nucleic acid sequence by a linker sequence.

In one embodiment, the second nucleic acid sequence is encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of SEQ ID NO: 5. In one embodiment, the guide RNA can be chemically modified. Examples of guide RNA chemical modifications include, without limitation, incorporation of 2'-0-methyl (M), 2'-0-methyl 3 'phosphorothioate (MS), S-constrained ethyl (cEt), or 2'-0-methyl 3'thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guide RNAs can comprise increased stability and increased activity as compared to unmodified guide RNAs. Chemically modified guide RNAs further include, without limitation, RNAs with phosphorothioate linkages and locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2' and 4' carbons of the ribose ring.

The first nucleic acid sequence may be positioned upstream or downstream of the second nucleic acid sequence.

The term “at least 80% sequence identity” includes at least 81% to 99% and all integer percentages there between.

The recitations “sequence identity” or, for example, comprising a “sequence 50% identical to,” as used herein, refer to the extent that sequences are identical on a nucleotide-by- nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I, U) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Vai, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (z.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Included are nucleotides and polypeptides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, typically where the polypeptide variant maintains at least one biological activity of the reference polypeptide. Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include “reference sequence” “comparison window” “sequence identity” “percentage of sequence identity,” and “substantial identity”. A “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a “comparison window” to identify and compare local regions of sequence similarity. A “comparison window” refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res. 25:3389. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons Inc., 1994-1998, Chapter 15.

The terms “nucleic acid” and “polynucleotide', used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, these terms include, but are not limited to, single-, double- , or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate -phosphodiester oligomer. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support. The term “polynucleotide” also encompasses peptidic nucleic acids, PNA and LNA. Polynucleotides may further comprise genomic DNA, cDNA, or DNA- RNA hybrids.

In one embodiment, the gRNAs of the present invention comprise non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogs, and/or chemically modifications. Non-naturally occurring nucleic acids can include, for example, mixtures of naturally and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and/or nucleotide analogs may be modified at the ribose, phosphate, and/or base moiety. In an embodiment of the invention, a guide nucleic acid comprises ribonucleotides and non-ribonucleotides. In one embodiment, a guide RNA comprises one or more ribonucleotides and one or more deoxyribonucleotides . In one embodiment, the guide RNA comprises one or more non- naturally occurring nucleotide or nucleotide analog such as a nucleotide with phosphorothioate linkage, boranophosphate linkage, a locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2' and 4' carbons of the ribose ring, or bridged nucleic acids (BNA). Other examples of modified nucleotides include 2'-0-methyl analogs, 2'-deoxy analogs, 2-thiouridine analogs, N6-methyladenosine analogs, or 2'-fluoro analogs. Further examples of modified bases include, but are not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine ( ), Nl- methylpseudouridine (mel ), S-methoxyuridine(SmoU), inosine, 7-methylguanosine.

“Stringency conditions” refers to conditions under which a nucleic acid may hybridize to its target polynucleotide sequence. Preferably, under stringent conditions the nucleic acid hybridizes to its target polynucleotide sequence, but not other sequences. That is under stringent conditions, hybridisation is specific for the target sequence. Stringent conditions are sequence-dependent (e.g., longer sequences hybridize specifically at higher temperatures). Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and polynucleotide concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Typically, stringent conditions will be those in which the salt concentration is at least about 0.01 to about 1.0 M sodium ion concentration (or other salts) at about pH 7.0 to about pH 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides).

The term “Cas nuclease”, "CRISPR-associated protein", "Cas protein" or “CRISPR- associated nuclease” refers to a wild type Cas protein, a fragment thereof, or a mutant or variant thereof. The term "Cas mutant" or "Cas variant" refers to a protein or polypeptide derivative of a wild type Cas protein, e.g., a protein having one or more point mutations, insertions, deletions, truncations, a fusion protein, or a combination thereof. In certain embodiments, the Cas mutant or Cas variant substantially retains the nuclease activity of the Cas protein. In certain embodiments, the Cas nuclease is mutated such that one or more nuclease domains are inactive. In some embodiments, the Cas nuclease is mutated so that it lacks some or all of the nuclease activity of its wild-type counterpart. The term “Cas nuclease” also contemplates the use of natural and engineered Cas nucleases.

The term "cleavage" or "cleaving" refers to breaking of the covalent phosphodiester linkage in the ribosylphosphodiester backbone of a polynucleotide. The terms "cleavage" or "cleaving" encompass both single- stranded breaks and double-stranded breaks. A “nuclease cleavage site” or “genomic nuclease cleavage site” is a region of nucleotides that comprise a nuclease cleavage sequence that is recognized by a specific nuclease, which acts to cleave the nucleotide sequence of a polynucleotide.

In one embodiment, the guide RNA/Cas nuclease complex is capable of cleaving SARS- CoV-2 nucleic acid.

In one embodiment, the Cas nuclease is a Casl3 nuclease. The Cas nuclease may be a Casl3a, Casl3b, Casl3c or Casl3d nuclease. The Casl3 nuclease may be a Casl3d or CasRx nuclease. The Cas 13 nuclease may, for example, show consistent and strong target-specific cleavage effect. It also has a small size for fitting to the AAV delivery system in clinic. The Cas 13 nuclease may be an engineered Cas 13 nuclease comprising, for example, one or more amino acid substitutions, truncation and/or circular permutation. In one embodiment, the endonuclease function of the Cas 13 nuclease is retained in the engineered Cas 13 nuclease.

In an alternative embodiment, the Cas nuclease is a Cas9 nuclease.

In one embodiment, the Cas nuclease is codon-optimized for expression in a cell, such as in a human cell.

Provided herein is a nucleic acid comprising or encoding a guide RNA as defined herein.

Provided herein is a construct comprising a nucleic acid encoding a guide RNA. The construct may further comprise a nucleic acid encoding a Cas nuclease.

Disclosed herein is a vector comprising a nucleic acid sequence encoding one or more guide RNAs as defined herein. The vector may further comprise a nucleic acid encoding a Cas nuclease. The vector may be designed to target the viral genome at multiple locations, thereby increasing the chance of incapacitating the virus within a cell.

The term “construct” refers to a recombinant genetic molecule including one or more isolated nucleic acid sequences from different sources. Thus, constructs are chimeric molecules in which two or more nucleic acid sequences of different origin are assembled into a single nucleic acid molecule and include any construct that contains (1) nucleic acid sequences, including regulatory and coding sequences that are not found together in nature (i.e., at least one of the nucleotide sequences is heterologous with respect to at least one of its other nucleotide sequences), or (2) sequences encoding parts of functional RNA molecules or proteins not naturally adjoined, or (3) parts of promoters that are not naturally adjoined. Representative constructs include any recombinant nucleic acid molecule such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single stranded or double stranded DNA or RNA nucleic acid molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule where one or more nucleic acid molecules have been operably linked. Constructs of the present invention will generally include the necessary elements to direct expression of a nucleic acid sequence of interest that is also contained in the construct, such as, for example, a guide RNA sequence. Such elements may include control elements such as a promoter that is operably linked to (so as to direct transcription of) the nucleic acid sequence of interest, and often includes a polyadenylation sequence as well. Within certain embodiments of the invention, the construct may be contained within a vector. In addition to the components of the construct, the vector may include, for example, one or more selectable markers, one or more origins of replication, such as prokaryotic and eukaryotic origins, at least one multiple cloning site, and/or elements to facilitate stable integration of the construct into the genome of a host cell. Two or more constructs can be contained within a single nucleic acid molecule, such as a single vector, or can be containing within two or more separate nucleic acid molecules, such as two or more separate vectors. An “expression construct” generally includes at least a control sequence operably linked to a nucleotide sequence of interest. In this manner, for example, promoters in operable connection with the nucleotide sequences to be expressed are provided in expression constructs for expression in an organism or part thereof including a host cell. For the practice of the present invention, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art, see for example, Molecular Cloning: A Laboratory Manual, 3rd edition Volumes 1, 2, and 3. J. F. Sambrook, D. W. Russell, and N. Irwin, Cold Spring Harbor Laboratory Press, 2000. A used herein, a “vector” is a tool that allows or facilitates the transfer of an entity from one environment to another. In general, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DMA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses (AAVs)). Viral vectors also include polynucleotides carried by a virus or viral-like particles for transduction into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.

In some embodiments, the vector is circular. In other embodiments, the vector is linear. In some embodiments, the vector is enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

As used herein, the terms “encode,” “encoding” and the like refer to the capacity of a nucleic acid to provide for another nucleic acid or a polypeptide. For example, a nucleic acid sequence is said to "encode" a polypeptide if it can be transcribed and/or translated to produce the polypeptide or if it can be processed into a form that can be transcribed and/or translated to produce the polypeptide. Such a nucleic acid sequence may include a coding sequence or both a coding sequence and a non-coding sequence. Thus, the terms "encode," "encoding" and the like include an RNA product resulting from transcription of a DNA molecule, a protein resulting from translation of an RNA molecule, a protein resulting from transcription of a DNA molecule to form an RNA product and the subsequent translation of the RNA product, or a protein resulting from transcription of a DNA molecule to provide an RNA product, processing of the RNA product to provide a processed RNA product (e.g., mRNA) and the subsequent translation of the processed RNA product.

"Polypeptide," "peptide” and "protein" are used interchangeably herein to refer to molecules comprising or consisting of a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers.

As used herein the term "recombinant" as applied to "nucleic acid molecules," "polynucleotides" and the like is understood to mean artificial nucleic acid structures (i.e., non-replicating cDNA or RNA; or replicons, self-replicating cDNA or RNA) which can be transcribed and/or translated in host cells or cell-free systems described herein. Recombinant nucleic acid molecules or polynucleotides may be inserted into a vector. Non-viral vectors such as plasmid expression vectors or viral vectors may be used. The kind of vectors and the technique of insertion of the nucleic acid construct would be known to persons skilled in the art. A nucleic acid molecule or polynucleotide according to this disclosure does not occur in nature in the arrangement described by the present invention. In other words, a heterologous nucleotide sequence is not naturally combined with elements of a parent virus genome (e.g., promoter, ORF, polyadenylation signal, DNA-recognition moiety, endonuclease).

The term "operably connected" or "operably linked" as used herein refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For example, a regulatory element or regulatory sequence "operably linked" to a coding sequence refers to positioning and/or orientation of the regulatory sequence relative to the coding sequence to permit expression of the coding sequence under conditions compatible with the regulatory sequence.

The control sequences need not be contiguous with the nucleotide sequence of interest, as long as they function to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, sequences can be present between a promoter and a coding sequence, and the promoter sequence can still be considered “operably linked” to the coding sequence.

By "regulatory element", "regulatory sequence", “control element” or “control sequence” is meant nucleic acid sequences (e.g., DNA) necessary for expression of an operably linked coding sequence in a particular host cell. The regulatory sequences that are suitable for eukaryotic cells include promoters, polyadenylation signals, transcriptional enhancers, translational enhancers, leader or trailing sequences that modulate mRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment.

“Promoter” refers to a nucleotide sequence, usually upstream (5’) to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. “Promoter regulatory sequences” consist of proximal and more distal upstream elements. Promoter regulatory sequences influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, untranslated leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences. An “enhancer” is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. The meaning of the term “promoter” includes "promoter regulatory sequences.”

In an embodiment, the regulatory element is a promoter.

The terms “open reading frame” and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence. The terms “initiation codon” and “termination codon” refer to a unit of three adjacent nucleotides (‘codon’) in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).

In some embodiments, the present invention involve introducing or delivering a guide RNA or vector as defined herein, or any of the therapeutic agents described herein, into a cell of interest. It should be appreciated that agents can be introduced into cells in an in vitro model or an in vivo model.

In some embodiments, the guide RNA or vector as defined herein can be transfected into cells by various methods, including viral vectors and non- viral vectors. Viral vectors may include retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAV). It should be appreciated that any viral vector may be incorporated into the present invention to effectuate delivery of the guide RNA or vector into a cell. Some viral vectors may be more effective than others, depending on the guide RNA or vector designed for digestion or incapacitation. In one embodiment, the vectors contain essential components such as origin of replication, which is necessary for the replication and maintenance of the vector in the host cell.

A retrovirus is a single-stranded RNA virus that stores its nucleic acid in the form of an mRNA genome (including the 5' cap and 3' Poly A tail) and targets a host cell as an obligate parasite. In some methods in the art, retroviruses have been used to introduce nucleic acids into a cell. Once inside the host cell cytoplasm the virus uses its own reverse transcriptase enzyme to produce DNA from its RNA genome, the reverse of the usual pattern, thus retro (backwards). This new DNA is then incorporated into the host cell genome by an integrase enzyme, at which point the retroviral DNA is referred to as a provirus. For example, the recombinant retroviruses such as the Moloney murine leukemia virus have the ability to integrate into the host genome in a stable fashion. They contain a reverse transcriptase that allows integration into the host genome. Retroviral vectors can either be replication- competent or replication-defective. In some embodiments, retroviruses are incorporated to effectuate transfection into a cell, however the Cas/gRNA complexes are designed to target the viral genome.

In some embodiments of the invention, lentiviruses, which are a subclass of retroviruses, are used as viral vectors. Lentiviruses can be adapted as delivery vehicles (vectors) given their ability to integrate into the genome of non-dividing cells, which is the unique feature of lentiviruses as other retroviruses can infect only dividing cells. The viral genome in the form of RNA is reverse-transcribed when the virus enters the cell to produce DNA, which is then inserted into the genome at a random position by the viral integrase enzyme. The vector, now called a provirus, remains in the genome and is passed on to the progeny of the cell when it divides.

As opposed to lentiviruses, adenoviral DNA does not integrate into the genome and is not replicated during cell division. Adenovirus and the related AAV can be used as delivery vectors since they do not integrate into the host's genome. In some aspects of the invention, only the viral genome to be targeted is effected by the Cas/gRNA complex, and not the host's cells. Adeno-associated virus (AAV) is a small virus that infects humans and some other primate species. AAV can infect both dividing and nondividing cells and may incorporate its genome into that of the host cell. For example, because of its potential use as a gene therapy vector, researchers have created an altered AAV called self-complementary adeno-associated virus (scAAV). Whereas AAV packages a single strand of DNA and requires the process of second-strand synthesis, scAAV packages both strands which anneal together to form double stranded DNA. By skipping second strand synthesis scAAV allows for rapid expression in the cell. Otherwise, scAAV carries many characteristics of its AAV counterpart. Methods of the invention may incorporate herpesvirus, poxvirus, alphavirus, or vaccinia virus as a means of delivery vectors. Non-limiting exemplary viral vectors include adeno-associated virus (AAV) vector, lentivirus vectors, adenovirus vectors, helper dependent adenoviral vectors (HDAd), herpes simplex virus (HSV-1) vectors, bacteriophage T4, baculovirus vectors, and retrovirus vectors. In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV2, AAV3, AAV3B, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64Rl, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAVrhlO, or AAVLK03. In other embodiments, the viral vector is a lentivirus vector.

In some embodiments, the vector comprises a nucleotide sequence encoding a Cas nuclease. In some embodiments, the nuclease encoded by the vector may be a Cas protein. In some embodiments, the vector system comprises one copy of the nucleotide sequence encoding the nuclease. In other embodiments, the vector system comprises more than one copy of the nucleotide sequence encoding the nuclease. In some embodiments, the nucleotide sequence encoding the nuclease is operably linked to at least one transcriptional or translational control sequence. In some embodiments, the nucleotide sequence encoding the nuclease is operably linked to at least one promoter.

In some embodiments, the promoter is constitutive or inducible. In some embodiments, the promoter may be a constitutive promoter. Non-limiting exemplary constitutive promoters include cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor-alpha (EFla) promoter, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, a functional fragment thereof, or a combination of any of the foregoing. In some embodiments, the promoter is a CMV promoter. In some embodiments, the promoter is a truncated CMV promoter. In other embodiments, the promoter may be an EFla promoter. In some embodiments, the promoter is an inducible promoter. Non-limiting exemplary inducible promoters include those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments, the inducible promoter is one that has a low basal (non-induced) expression level, such as, e.g., the Tet-On® promoter (Clontech). The vector may comprise a nucleotide sequence encoding the guide RNA described herein. In some embodiments, the vector comprises one copy of the guide RNA. In other embodiments, the vector comprises more than one copy of the guide RNA. In embodiments with more than one guide RNA, the guide RNAs may be non-identical such that they target different target sequences, or may be identical in that they target the same target sequence. In some embodiments where the vectors comprise more than one guide RNA, each guide RNA may have other different properties, such as activity or stability within a complex with a Cas nuclease. In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to at least one transcriptional or translational control sequence, such as a promoter, a 3' UTR, or a 5' UTR. In one embodiment, the promoter may be a tRNA promoter, e.g. , tRNA^Lys3, or a tRNA chimera. In some embodiments, the promoter may be recognized by RNA polymerase III (Pol III). Non-limiting examples of Pol III promoters include U6 and Hl promoters. In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to a mouse or human U6 promoter. In other embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to a mouse or human Hl promoter. In embodiments with more than one guide RNA, the promoters used to drive expression may be the same or different.

In some embodiments, the nucleotide sequence encoding the guide RNA may be located on the same vector comprising the nucleotide sequence encoding a Cas nuclease. In some embodiments, expression of the guide RNA and of the Cas nuclease may be driven by their own corresponding promoters. In some embodiments, expression of the guide RNA may be driven by the same promoter that drives expression of the Cas nuclease such as a Cas protein. In some embodiments, the guide RNA and the Cas nuclease such as a Cas protein transcript may be contained within a single transcript. For example, the guide RNA may be within an untranslated region (UTR) of the Cas nuclease such as a Cas protein transcript. In some embodiments, the guide RNA may be within the 5' UTR of the transcript. In other embodiments, the guide RNA may be within the 3' UTR of the transcript. In some embodiments, the intracellular half-life of the transcript may be reduced by containing the guide RNA within its 3' UTR and thereby shortening the length of its 3' UTR. In additional embodiments, the guide RNA may be within an intron of the transcript. In some embodiments, suitable splice sites may be added at the intron within which the guide RNA is located such that the guide RNA is properly spliced out of the transcript. In some embodiments, expression of the Cas nuclease such as a Cas protein and the guide RNA from the same vector in close temporal proximity may facilitate more efficient formation of the CRISPR RNP complex.

In some embodiments, the compositions comprise a vector system. In some embodiments, the vector system may comprise one single vector. In other embodiments, the vector system may comprise two vectors. In additional embodiments, the vector system may comprise three vectors. When different guide RNAs are used for multiplexing, or when multiple copies of the guide RNA are used, the vector system may comprise more than three vectors.

In certain embodiments of the invention, non-viral vectors may be used to effectuate transfection. Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, micelles, immunoliposomes, polycation or lipidmucleic acid conjugates, naked DNA, artificial virions, and agent- enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those in U.S. Pat. No. 7,166,298 or U.S. Pat. No. 6,890,554.

In one embodiment, there is provided a pharmaceutical composition comprising a guide RNA, vector or construct as defined herein. The pharmaceutical composition may comprise a pharmaceutically acceptable carrier.

Compositions include, but are not limited to pharmaceutical compositions. A “pharmaceutical composition” refers to a composition formulated in pharmaceutically- acceptable or physiologically-acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions may be administered in combination with other agents as well, such as, e.g., cytokines, growth factors, hormones, small molecules, chemotherapeutics, pro-drugs, drugs, antibodies, or other various pharmaceutically-active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the composition.

Disclosed herein is a pharmaceutical composition comprising: a) a Cas nuclease or a nucleic acid encoding a CAS nuclease; and b) a guide RNA or a vector as defined herein. The pharmaceutical composition may comprise a pharmaceutically acceptable carrier.

In one embodiment, there is provided a pharmaceutical composition comprising: a) a Casl3 nuclease or a nucleic acid encoding a CAS13 nuclease; and b) a guide RNA or a vector as defined herein. The pharmaceutical composition may comprise a pharmaceutically acceptable carrier.

The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

By “pharmaceutically acceptable carrier” is meant a solid or liquid filler, diluent or encapsulating substance that can be safely used in topical or systemic administration to an animal, preferably a mammal, including humans. Representative pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient(s), its use in the pharmaceutical compositions is contemplated.

Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials.

In one embodiment, the guide RNA, vector or construct may be encapsulated in a liposome for delivery to a subject.

A "liposome" as used herein refers to a small, spherical vesicle composed of lipids, particularly vesicle-forming lipids capable of spontaneously arranging into lipid bilayer structures in water with its hydrophobic moiety in contact with the interior, hydrophobic region of the bilayer membrane, and its head group moiety oriented toward the exterior, polar surface of the membrane. Vesicle-forming lipids have typically two hydrocarbon chains, particularly acyl chains, and a head group, either polar or nonpolar. Vesicleforming lipids are either composed of naturally-occurring lipids or of synthetic origin, including the phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylinositol, and sphingomyelin, where the two hydrocarbon chains are typically between about 14-22 carbon atoms in length, and have varying degrees of unsaturation. The above-described lipids and phospholipids whose acyl chains have varying degrees of saturation can be obtained commercially or prepared according to published methods. Other suitable lipids for use in the composition of the present invention include glycolipids and sterols such as cholesterol and its various analogs which can also be used in the liposomes.

Similar to a liposome, a micelle is a small spherical vesical composed of lipids, but is arranged as a lipid monolayer, with the hydrophilic head regions of the lipid molecules in contact with surrounding solvent, sequestering the hydrophobic single-tail regions in the center of the micelle. This phase is caused by the packing behaviour of single-tail lipids in a bilayer. The pharmacology of a liposomal formulation of nucleic acid is largely determined by the extent to which the nucleic acid is encapsulated inside the liposome bilayer. Encapsulated nucleic acid is protected from nuclease degradation, while those merely associated with the surface of the liposome is not protected. Encapsulated nucleic acid shares the extended circulation lifetime and biodistribution of the intact liposome, while those that are surface associated adopt the pharmacology of naked nucleic acid once they disassociate from the liposome.

In some embodiments, the guide RNA, construct or vector as defined herein are encapsulated in a liposome. Unlike small molecule drugs, nucleic acids cannot cross intact lipid bilayers, predominantly due to the large size and hydrophilic nature of the nucleic acid. Therefore, nucleic acids may be entrapped within liposomes with conventional passive loading technologies, such as ethanol drop method (as in SALP), reverse-phase evaporation method, and ethanol dilution method (as in SNALP).

In some embodiments, the guide RNA, construct or vector as defined herein are formulated in or administered via a lipid nanoparticle. Any lipid nanoparticle (LNP) known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized with the guide RNAs described herein, as well as either nucleic acid encoding a Cas nuclease or an Cas nuclease protein itself.

In some embodiments, linear polyethylenimine (L-PEI) is used as a non-viral vector due to its versatility and comparatively high transfection efficiency. L-PEI has been used to efficiently deliver genes in vivo into a wide range of organs such as lung, brain, pancreas, retina, bladder as well as tumor. L-PEI is able to efficiently condense, stabilize and deliver nucleic acids in vitro and in vivo.

Disclosed herein is a guide RNA, a vector or a pharmaceutical composition as defined herein for use as a medicament or vaccine. Disclosed herein is a method of altering the level of SARS-COV-2 nucleic acid in a cell, the method comprising contacting the cell with an effective amount of a guide RNA, a vector or a pharmaceutical composition as defined herein.

In one embodiment, the method comprises inhibiting a SARS-COV-2 nucleic acid in a cell.

Disclosed herein is a method of preventing or treating SARS-CoV-2 infection in a subject, the method comprising administering to a subject an effective amount of a guide RNA, a vector or a pharmaceutical composition as defined herein.

The term “treating" as used herein may refer to (1) preventing or delaying the appearance of one or more symptoms of the disorder; (2) inhibiting the development of the disorder or one or more symptoms of the disorder; (3) relieving the disorder, i.e., causing regression of the disorder or at least one or more symptoms of the disorder; and/or (4) causing a decrease in the severity of one or more symptoms of the disorder.

The term “administering” refers to contacting, applying, injecting, transfusing or providing a composition of the present invention to a subject.

The term “subject” as used throughout the specification is to be understood to mean a human or may be a domestic or companion animal. While it is particularly contemplated that the methods of the invention are for treatment of humans, they are also applicable to veterinary treatments, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as primates, felids, canids, bovids, and ungulates. The “subject” may include a person, a patient or individual, and may be of any age or gender.

The methods as defined herein may comprise administering an effective amount of a guide RNA, vector or pharmaceutical composition to a subject in need.

The term “effective amount” as defined herein is meant the administration of an amount of agent to an individual in need thereof, either in a single dose or as part of a series that is effective for that elicitation, treatment or prevention. The effective amount will vary depending upon the health and physical condition of the individual to be treated, the taxonomic group of individual to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.

In one embodiment, the guide RNA, vector or construct is formulated for intranasal delivery.

Disclosed herein is a guide RNA, a vector or a pharmaceutical composition as defined herein for use in preventing or treating SARS-CoV-2 infection in a subject.

Disclosed herein is a kit comprising a guide RNA, a vector or a pharmaceutical composition as defined herein. The kit may comprise additional components, such as administration devices(s), excipient(s), and/or diluent(s). The kits may also include containers for housing the various components and instructions for using the kit components.

Provided herein is a screening platform for a) RNA template targeted by CRISPR- Casl3-gRNA, b) high throughput analysis of candidate gRNAs using 96-well or 384- well format; and c) quantification of the cleavage effect of Casl3-gRNAs.

In one embodiment, there is provided a method of identifying a gRNA that is capable of directing Cas nuclease cleavage of a target nucleic acid sequence, the method comprising: a) contacting a target nucleic acid sequence with a gRNA and a Cas nuclease; and b) amplifying the target nucleic acid sequence to detect cleavage of the target nucleic acid sequence. The Cas nuclease may be a Casl3 nuclease. The target nucleic acid sequence may be a single stranded RNA. The amplification step may comprise the use of a pair of primers. The amplification technique may be via quantitative polymerase chain reaction (qPCR).

As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

As used in this application, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "an agent" includes a plurality of agents, including mixtures thereof.

Throughout this specification and the statements which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

Certain embodiments of the invention will now be described with reference to the following examples which are intended for the purpose of illustration only and are not intended to limit the scope of the generality hereinbefore described.

EXAMPLES

1. Preparation of CRISPR-Casl3d protein

Total 2.5pg of Casl3d expression plasmid is transfected into 2.5xl0⁵ HEK293T cells. After 48hr, cells are lysed with 150j.il of a gentle lysis buffer (lOmM Tris-HCl, pH7.4, 150mM NaCl, 0.25% NP-40, ImM DTT) and cleared by centrifugation at 12000xg for lOmin at 4°C. The resulting supernatants can be readily used for in vitro cleavage assay without further purification of Casl3d protein.

2. In vitro cleavage assay

2.1 Design of gRNAs and ssRNAs template for in vitro transcription ssRNAs used in this study are generated from fragments of an average of 300bp in length, including the T7 promoter and adapter sequences at 5’- and 3’ ends. gRNA templates include T7 promoter and Casl3d (CasRX) scaffold sequences at the 5’ end (ssRNAs and gRNA sequences are provided in Table 1 and 2).

DNA encoding ssRNA target

5’-TAATACGACTCACTATAG(T7 promoter (SEQ ID NO: I ))-

CTTTCCCTACACGACGCTCTTCCGATCT(Adapter (SEQ ID NO: 2))-

(Target sequence)-AGATCGGAAGAGCACACGTCTGAACTCC(Adapter(SEQ ID NO: 3)) -3’

DNA encoding gRNA 5’-AAGCTAATACGACTCACTATAGG(T7 promoter (SEQ ID NO: 4))- caccgaacccctaccaactggtcggggtttgaaaci scaffold (SEQ ID NO: 5))-gRNA spacer sequence-3 ’

2.2 In vitro cleavage assay (~60min)

The cleavage reaction is performed in 30pl of reaction volume containing 40mM Tris- HCl(pH7.4), 60mM NaCl, 6mM MgCh, and 20unit of RNase Inhibitor. First, 5 pl of total cell lysate is incubated with 150nM gRNAs for 10 min at room temperature to generate the Casl3d-gRNA complex. The cleavage reaction is initiated by adding ssRNA templates. Briefly, InM of ssRNAs are mixed with Casl3d alone (negative control) or Casl3d-gRNA complex and incubated at 37°C for various time points (0, 10, 30min). Reaction is quenched by heating at 80°C for 5min.

2.2 High throughput RT-qPCR assay in 96-well format (~ 2hr)

To quantify the cleavage efficiency of each gRNA, the RT-qPCR method was utilized. To do this, 2pl of reaction mixture is used for reverse transcription (RT) using 3’ adaptor primer. The synthesized cDNA template from RT reaction is used for qPCR assay with forward/reverse adaptor primers and the resulting Ct value is further analyzed to quantify the cleavage efficiency of the selected gRNAs. Assay can be done in high- throughput way depending a number of gRNAs and RT-qPCR reactions are simplified by use of same adaptor primers.

3. Validate the in vitro gRNA screening platform

In vitro cleavage assays were performed to quantify the cleavage efficiency of CRISPR- Casl3d-gRNAs targeting SARS-CoV-2 RNA. The candidate gRNAs target the SARS- CoV-2 genomic and sub-genomic regions in Orflab, Orf3, S, E, M, and N with high in silico predicted scores (Fig3a, b). In vitro cleavage assay was done with individual in vitro transcribed gRNAs, in vitro transcribed target RNA templates, and an invariable CasRx protein (Fig3c, d). The data indicates that the optimal CRISPR-Casl3-gRNAs yield 85-90% efficiency in cleavage of target templates within 30 min of incubation, indicating that the CRISPR-Casl3-gRNA technology can directly eliminate SARS- CoV-2 target sequences.

(ii) Nucleotide sequences consisting of:

Table 1. gRNA sequences targeting SARS-CoV-2 RNA:

Table 2. ssRNA sequences

Table 3

Claims

33 Claims

1. A guide RNA comprising a first nucleic acid sequence complementary to a SARS-CoV-2 nucleic acid and a second nucleic acid sequence capable of directing a Cas nuclease to the SARS-CoV-2 nucleic acid, wherein at least one of the following applies: a) the first nucleic acid sequence hybridizes to the reverse complement of the nucleic acid sequence of any one of SEQ ID NOs: 47-68 under stringent conditions; b) the first nucleic acid sequence is encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NO: 6-27; and c) the first nucleic acid sequence comprises a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of any one of SEQ ID NOs: 47-68.

2. The guide RNA of claim 1, wherein the SARS-CoV-2 nucleic acid is a single stranded RNA.

3. The guide RNA of claim 1 or 2, wherein the first nucleic acid sequence is joined to the second nucleic acid sequence.

4. The guide RNA of any one of 1-3, wherein the Cas nuclease is a Casl3 nuclease.

5. The guide RNA of any one of claims 1-4, wherein the second nucleic acid sequence is encoded by a nucleic acid sequence having at least 80% sequence identity to a nucleic acid sequence of SEQ ID NO: 5.

6. A construct comprising a nucleic acid sequence encoding one or more guide RNAs of any one of claims 1-5.

7. The construct of claim 6, wherein the vector comprises a promoter upstream of the one or more guide RNAs. 34 The construct of claim 6 or 7, wherein the construct further encodes a Cas nuclease. A vector comprising a construct of any one of claims 6-8. The vector of claim 9, wherein the vector is a viral vector. The vector of claim 10, wherein the viral vector is an adeno-associated virus (AAV) vector. A pharmaceutical composition comprising a guide RNA of any one of claims 1- 5 or a vector of any one of claims 9-11. A pharmaceutical composition comprising: a) a Cas nuclease or a nucleic acid encoding a CAS nuclease; and b) a guide RNA of any one of claims 1-5 or a vector of any one of claims 9-11. A guide RNA of any one of claims 1-5, a vector of any one of claims 9-11 or a pharmaceutical composition of claim 12 or 13 for use as a medicament or a vaccine. A method of altering the level of SARS-COV-2 nucleic acid in a cell, the method comprising contacting the cell with an effective amount of a guide RNA of any one of claims 1-5, a vector of any one of claims 9-11 or a pharmaceutical composition of claim 12 or 13. A method of preventing or treating SARS-CoV-2 infection in a subject, the method comprising administering to a subject an effective amount of a guide RNA of any one of claims 1-5, a vector of any one of claims 9-11 or a pharmaceutical composition of claims 12 or 13. A guide RNA of any one of claims 1-5, a vector of any one of claims 9-11 or a pharmaceutical composition of claim 12 or 13 for use in preventing or treating SARS-CoV-2 infection in a subject. Use of a guide RNA of any one of claims 1-5, a vector of any one of claims 9- 11 or a pharmaceutical composition of claim 12 or 13 in the manufacture of a medicament for preventing or treating SARS-CoV-2 infection in a subject. A kit comprising a guide RNA of any one of claims 1-5, a vector of any one of claims 9-11 or a pharmaceutical composition of claims 12 or 13.