WO2022056078A1 - Rnase h-assisted detection assay for rna (radar) - Google Patents

Abstract

A simple, rapid, and low-cost method for the detection of RNA is described. The method provides a sensitive and accurate molecular diagnostic assay for the identification of specific RNA molecules, such as viral RNA, including SARS-CoV-2 RNA and influenza virus RNA. Synthetic oligonucleotides and kits for the detection of SARS-CoV-2 RNA are also described.

Description

RNASE H-ASSISTED DETECTION ASSAY FOR RNA (RADAR) CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Application No.63/077,123, filed September 11, 2020, which is herein incorporated by reference in its entirety. FIELD This disclosure concerns a rapid, sensitive and comparatively low-cost method for detection of a target RNA, such as a viral RNA. This disclosure further concerns an assay kit for the RNA detection method. ACKNOWLEDGMENT OF GOVERNMENT SUPPORT This invention was made with government support under project number ZIA BC 010307 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND Several viral epidemics such as the epidemics caused by H1N1 influenza virus, human immunodeficiency virus (HIV), Ebola virus, Zika virus, severe acute respiratory syndrome (SARS) virus, Middle East respiratory syndrome (MERS) virus and SARS-CoV-2, have profoundly impacted human health and societies in recent history. The majority of these viruses are suspected to have “jumped” from animal hosts followed by rapid human-to-human transmission capabilities. One of the most effective and evident measures to prevent the human-to-human spreading is early identification of infected and/or infectious persons and isolating them from the population (Rothan and Byrareddy, J Autoimmun 109:102433, 2020). The same holds true for the novel coronavirus identified in 2019, SARS-CoV-2, which is an RNA virus and the causative agent of the COVID-19 pandemic. SUMMARY The present disclosure describes an RNase-H-assisted detection assay for RNA (RADAR). The assay can detect any RNA of interest, including cellular or viral RNA in a sequence-specific manner. The assay uses a modified isothermal rolling circle amplification (RCA) method that utilizes RNase H (or other enzyme that cleaves RNA:DNA hybrids) and an RNA reporter molecule for the specific detection of a target RNA. Provided is a method for detecting a target RNA in a sample. The method includes an annealing step, a circularization step, an RNase H-assisted isothermal amplification step and an RNase H-assisted detection step. In some embodiments, the annealing step includes contacting the sample in a reaction vessel with a single-stranded DNA (ssDNA) probe having a 5ʹ end complementary to a first region of the target RNA, a 3ʹ end complementary to a second region of the target RNA that is adjacent to the first region, and an internal region between the 5ʹ end and the 3ʹ end having a unique sequence that is not complementary to the target RNA, wherein the 5ʹ and 3ʹ ends of the probe anneal in a head-to-tail fashion to the target RNA present in the sample; the circularization step includes adding a DNA ligase to the reaction vessel to circularize the probe annealed to the target RNA by ligating the 5ʹ end to the 3ʹ end; the RNase H-assisted isothermal amplification step includes adding to the reaction vessel a mixture of deoxynucleotide triphosphates (dNTPs), a DNA polymerase, RNase H, and a single-stranded RNA reporter molecule comprising a sequence complementary to a first portion of the internal region of the probe and comprising at least one detectable label or affinity tag, wherein the RNase H cleaves (i) the target RNA hybridized to the probe, thereby priming isothermal rolling circle amplification of the probe, and (ii) the RNA of the reporter molecule hybridized to the rolling circle amplified probe, thereby releasing the detectable label; and the detection step includes detecting cleavage of the RNA reporter molecule (such as by detecting an increase in free fluorophore), thereby detecting the target RNA in the sample. In some examples, the RNase H-assisted isothermal amplification step further includes adding to the reaction vessel an initiator primer that specifically hybridizes to a second portion of the internal region of the probe. The nature of the label to be detected can be modified to adapt detection of the released label to various quantitative technologies. In some embodiments, the detection step is performed using a lateral flow assay or a fluorometric assay. In some examples, the detection step includes in- tube visual detection of fluorescence. In some embodiments, the target RNA is viral RNA, such as SARS-CoV-2 RNA (for example, N gene or spike gene RNA) or influenza virus RNA. In other embodiments, the target RNA is cellular RNA, such as messenger RNA (mRNA) or non-coding RNA (for example, miRNA). Also provided are synthetic oligonucleotides that can be used as ssDNA probes (padlock probes) or RNA reporter molecules for the detection of SARS-CoV-2 RNA. Further provided are kits for the detection of SARS-CoV-2 RNA. In some embodiments, the kits include a synthetic oligonucleotide(s) (padlock probe(s), initiator primer, and/or RNA reporter molecule) and one or more of a DNA ligase, a DNA polymerase, RNase H, dNTPs, a reaction vessel, and a lateral flow test strip. The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1 is a schematic depiction of the disclosed RNase H-assisted detection assay for RNA (RADAR) method. To detect a target RNA in a sample, linear padlock probes are added to a sample containing RNA (such as viral RNA). The target RNA acts as an adapter for sequence specific single-stranded DNA (ssDNA) padlock probes that bring the 5ʹ and 3ʹ ends of the probes in juxtaposition in a head-to-tail fashion. The ends of the probes are ligated using a DNA ligase (such as SplintR® ligase) to generate circular ssDNA. The circular ssDNA acts as a template for isothermal rolling circle amplification (RCA). The sequence-specific ssDNA annealed to the target RNA also creates an RNase H substrate. The RNA in the circular ssDNA-RNA hybrid regions is cleaved by RNase H to generate 3ʹ-OH RNA ends, which act as priming sites for RCA of the circular ssDNA templates. A labeled RNA reporter molecule complementary to a unique repeated sequence on the RCA product is added to the reaction. The RNA reporter hybridizes to the RCA product and is subsequently cleaved by RNase H to release the label. Detection of the label (and thereby detection of the target RNA) can be accomplished for example, using a lateral flow or fluorometric assay, or other assay, depending on the nature of the label(s). FIG.2 is a schematic depiction of an agarose gel for an assay to analyze the circularization efficiency of linear padlock probes. RNA splinted ligation (circularization) efficiency is analyzed in the presence of in vitro transcribed RNA of the target gene. The linear padlock oligonucleotide is incubated with equimolar target RNA and SplintR® DNA ligase at 37°C for 15 minutes, followed by polyacrylamide gel electrophoresis to determine the relative amount of circular probe. FIG.3 is a schematic depiction of a lateral flow assay for visual detection of a target RNA using the RADAR method. A single-stranded RNA reporter molecule complementary to the constant region of the padlock probe is added to the RNase H-assisted RNA primed rolling circle amplification (RAP-PRCA) reaction. The reporter RNA is labelled, for example with biotin, at its 3ʹ end for its retention in the control band of a lateral flow assay. The 5ʹ end of the reporter RNA is labeled with a fluorescent dye (such as FAM), which is cleaved off by RNase H after hybridization of the probe to the repeated complementary binding sites that are generated by RCA. The decrease of the intact RNA probe thereby increases the free FAM, which is detected by an increased signal at the test band of the paper strip based HybriDetect Dipstick lateral flow assay. FIGS.4A-4B are agarose gels showing in vitro transcription (IVT) of a part of the SARS- CoV-2 nucleocapsid (N) gene. In vitro transcription of the N gene region of the SARS-CoV-2 genome was performed using synthetic DNA template corresponding to the region of the SARS- CoV-2 N gene using T7 RNA polymerase (RiboMAX kit, Promega) according to the manufacturer’s protocol. RNA (1.8 µg) was resolved in a 3% agarose gel in TBE buffer and stained with ethidium bromide. (FIG.4B) To demonstrate the RNA nature of the product, 0.9 µg RNA was digested with RNase A, resolved in a 3% agarose gel in TBE buffer and stained with ethidium bromide. FIGS.5A-5B show the results of an assay to test the circularization efficiency of SARS- CoV-2 N gene padlock probes. (FIG.5A) Padlock probe ligation. Padlock probes (10 pmol) were hybridized with equimolar RNA followed by a 1-hour ligation at 37°C with SplintR® DNA ligase. An aliquot (10µl) of the ligation reaction was resolved in a 10% urea (8M) polyacrylamide gel followed by staining with ethidium bromide. Circularization of the probes specifically occurred in a SARS-CoV-2 N RNA-dependent manner. Circular probes are indicated by the arrow. The positions of the padlock probes in relation to N gene RNA are depicted in the schematic. (FIG.5B) The rest of the ligation reaction (10 µl) was digested with 1 µg of RNase A to remove template RNA, resolved in a 10% urea (8M) polyacrylamide gel followed by staining with ethidium bromide. FIGS.6A-6B show RNase H dose titration for optimal RNase H-assisted RCA using the N1 padlock probe (SEQ ID NO: 1). (FIG.6A) Probe circularization. Ten pmol of the N1 padlock probe was hybridized with equimolar RNA, followed by a 15 minute ligation at 37°C with SplintR® DNA ligase in a 10 µl reaction volume. A total of seven ligation reactions were performed and one reaction was run on a 10% urea polyacrylamide gel. (FIG.6B) The other six ligation reactions were amplified using Bst2.0 DNA polymerase in the presence of 0.01-5.0 units RNase H for 30 minutes at 65°C. The amplified products were resolved in a 0.8% agarose gel and stained with ethidium bromide. RCA amplification was observed in the presence of all RNase H concentrations tested with an optimal concentration range of 0.1-1.0 unit. The greatest amplification was observed at 0.1 unit RNase H. FIG.7 depicts the RADAR reporter and dipstick lateral flow assay. To test the RNA reporter as well as dipstick lateral flow assay system, 20 pmol of reporter RNA was digested either with 1 µg RNase A or 5 units RNase H in 1x RNase H buffer for 2 minutes at room temperature. The reaction volume was adjusted to 100 µl by Hybridirect assay buffer followed by placing the dipstick in the tube. The test line showed a positive signal in the presence of RNase A (probe digested), but not with RNase H (no digestion without complementary DNA). Control probe (lane 1) also showed a faint signal at the test line. FIG.8 shows lateral flow assays to evaluate N1 padlock probe circularization and RNase H dose titration for optimal RNase H-assisted RCA. RADAR assay using 0.1, 1.0 and 10 pmol of RNA were performed. Ten pmol of the reporter was spiked in into the RNase H-assisted RCA reaction at the last 15 minutes of the 30-minute amplification reaction. Reporter cleavage was assayed by dipstick lateral flow. Ten pmol RNA (dipstick #5) showed significantly higher signal at the test line compared to no template (dipstick #2) or only reporter (dipstick #1). FIG.9 shows a fluorescent reporter design for in-tube visual detection for RADAR. An RNA reporter (SEQ ID NO: 5) was designed against the conserved region of the padlock probes. The reporter binds the RCA amplified product and is subsequently cleaved by RNase H activity in the reaction tube. The RNA reporter is labelled with a fluorophore (e.g., FAM) at the 5ʹ end and a quencher (e.g., Iowa Black® FQ) at the 3ʹ end (FAM-RAD-FQ). The FAM fluorescence is quenched by the FQ quencher in an intact reporter. Amplification-dependent RNase H-mediated cleavage of the reporter releases the FAM fluorophore thereby indicating the presence of target RNA. One skilled in the art will appreciate that other combinations of fluorophores and quenchers can be used (such as Oregon Green® fluorophore, rhodamine, tetrachlorofluorescein (TET), JOE^TM fluorophore or hexachlorofluorescein (HEX) with Black Hole Quencher® 1 (BHQ-1); Alexa 555^TM fluorophore, Cy3® fluorophore, TAMRA^TM fluorophore, or Texas Red® fluorophore with Black Hole Quencher® 2 (BHQ-2); and Alexa 633^TM fluorophore, Cy5® fluorophore, or Alexa 647^TM fluorophore with Black Hole Quencher® 3 (BHQ-3)). FIGS.10A-10B show in-tube visual and fluorometric detection of RADAR. RADAR reactions were performed in triplicate in the presence of 1 pmol or 10 pmol RNA template in reactions containing 25 nM FAM-RAD-FQ reporter. (FIG.10A) In-tube fluorescence was recorded under a blue light (488 nm) at the indicated timepoints of the RCA reaction in the iBright Imaging system. (FIG.10B) Endpoint fluorescence was measured by transferring the reaction mixture to a real-time PCR compatible plate to read relative fluorescence value (a.u) in the FAM excitation channel. Both in-tube visual fluorescence and relative fluorescence were significantly greater in the presence of RNA template compared to no template control (NTC) reactions. FIGS.11A-11C show that a single nucleotide mismatch at the end of the padlock probe abrogates template dependent probe circularization. (FIG.11A) N1 padlock probe and terminal nucleotide-mutated N1 probes (N1-5ʹ T>A, N1-3ʹ T>A). (FIG.11B) Probes shown in FIG.11A were hybridized with equimolar RNA followed by a 10-minute ligation at 37°C with SplintR^® DNA ligase. The ligation reactions were digested with 1 µg RNase A followed by electrophoresis through a 10% urea (8M) polyacrylamide gel and staining with ethidium bromide. Circularization of the probes specifically occurred in the presence of template, but was disrupted by either a 5ʹ or 3ʹ single nucleotide mismatch on the probe. (FIG.11C) RADAR reactions were performed in the presence of 10 pmol RNA template and 25 nM FAM-RAD-BQ reporter with either the N1 padlock probe or a mutated N1 probe (N1-5ʹ T>A, N1-3ʹ T>A). In-tube fluorescence was recorded under a blue light (488nm) after 30 minutes of the RCA reaction in the iBright Imaging system. Both mutations of the padlock probe significantly diminished the fluorescent signals. FIGS.12A-12B show that inclusion of an initiator primer increases sensitivity of the assay. (FIG.12A) Schematic depicting the binding region of a complementary initiator primer on the padlock probe. The initiator primer initiates the RCA reaction upon SplintR^® ligase mediated template dependent padlock probe ligation. (FIG.12B) A RADAR reaction was performed in the presence of the indicated amounts of RNA template as described in FIG.10, in the presence and absence of an initiator primer that is complementary to the conserved region of the padlock probes. In-tube fluorescence was recorded under a blue light (488 nm) at the indicated timepoints of the RCA reaction in the iBright Imaging system. FIG.13A shows detection of single nucleotide mutations in the spike gene. RADAR reactions were performed in the presence of padlock probes corresponding to D614G (nucleotide change GAU to GGU), N501Y (nucleotide change AAU to UAU), L542R (nucleotide change CUG to CGG), E484K (nucleotide change GAA to AAA) or E484Q (nucleotide change GAA to CAA) mutations with 10 pmol cognate mutated RNA templates or corresponding parental RNA template (WT). In-tube fluorescence was recorded under a blue light (488nm) at the indicated times of the RCA reaction in the iBright Imaging system. FIG.13B shows verification of WT RNA template amplification by WT padlock probes. RADAR reactions were performed in the presence of padlock probes corresponding to parental (WT) spike gene spanning D614 (nucleotide GAU), N501 (nucleotide AAU), L542 (nucleotide CUG) and E484 (nucleotide GAA) regions with 10 pmol parental RNA template (WT). In-tube fluorescence was recorded under a blue light (488nm) at the indicated times of the RCA reaction in the iBright Imaging system. SEQUENCE LISTING The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R.1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on September 8, 2021, 5.14 KB, which is incorporated by reference herein. In the accompanying sequence listing: SEQ ID NOs: 1-3 are nucleotide sequences of exemplary padlock probes for detection of SARS-CoV-2 RNA. SEQ ID NO: 4 is the nucleotide sequence of an exemplary RADAR reporter molecule for detection of target RNA. SEQ ID NO: 5 is the nucleotide sequence of an exemplary RADAR reporter molecule for fluorescent detection of target RNA. SEQ ID NOs: 6 and 7 are nucleotide sequences of padlock probes with a single nucleotide mutation at the 5ʹ or 3ʹ end. SEQ ID NO: 8 is the nucleotide sequence of an initiator primer. SEQ ID NOs: 9-17 are nucleotide sequences of exemplary padlock probes for the detection of WT and SARS-CoV-2 variants. SEQ ID NO: 18 is the nucleotide sequence of an RNA template shown in FIG.11A. DETAILED DESCRIPTION I. Abbreviations %CE percent circularization efficiency COVID-19 coronavirus disease 2019 CRISPR clustered regularly interspaced short palindromic repeats dNTPs deoxynucleotide triphosphates FAM 6-carboxyfluorescein HIV human immunodeficiency virus IVT in vitro transcription MERS Middle East respiratory syndrome NTC no template control qRT-PCR quantitative reverse transcriptase polymerase chain reaction RADAR RNase H-assisted detection assay for RNA RAP-PRCA RNase H-assisted RNA primed rolling circle amplification RCA rolling circle amplification RdRp RNA-dependent RNA polymerase SARS severe acute respiratory syndrome ssDNA single-stranded DNA ssRNA single-stranded RNA WT wild type II. Summary of Terms Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishers, 2009; and Meyers et al. (eds.), The Encyclopedia of Cell Biology and Molecular Medicine, published by Wiley-VCH in 16 volumes, 2008; and other similar references. As used herein, the singular forms “a,” “an,” and “the,” refer to both the singular as well as plural, unless the context clearly indicates otherwise. For example, the term “a target RNA” includes single or plural target RNA molecules and can be considered equivalent to the phrase “at least one target RNA.” As used herein, the term “comprises” means “includes.” It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. To facilitate review of the various embodiments, the following explanations of terms are provided: Amplification (of nucleic acid): Increasing the number of copies of a nucleic acid molecule. The products of an amplification reaction are called amplification products or amplicons. An example of in vitro amplification is the polymerase chain reaction (PCR), in which a sample (such as a biological sample containing nucleic acid molecules) is contacted with one or more oligonucleotide primers, under conditions that allow for hybridization of the primer(s) to a nucleic acid molecule in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid molecule. Other examples of in vitro amplification techniques include real-time PCR, quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), quantitative RT-PCR (qRT-PCR), real-time RT-PCR, loop-mediated isothermal amplification (LAMP; see Notomi et al., Nucl. Acids Res.28:e63, 2000), reverse-transcription LAMP (RT- LAMP), rolling circle amplification (RCA; see U.S. Patent No.5,714,320; and Fire and Xu, Proc Natl Acad Sci USA, 92:4641-4645, 1995), strand displacement amplification (see U.S. Patent No. 5,744,311), transcription-mediated amplification (U.S. Patent No. 5,399,491), transcription-free isothermal amplification (see U.S. Patent No. 6,033,881), repair chain reaction amplification (see WO 90/01069), ligase chain reaction amplification (see U.S. Patent No.5,686,272), gap filling ligase chain reaction amplification (see U.S. Patent No. 5,427,930), coupled ligase detection and PCR (see U.S. Patent No.6,027,889), and NASBA™ RNA transcription-free amplification (see U.S. Patent No.6,025,134). Anneal: To pair two single-stranded nucleic acid sequences via hydrogen bonds. For example, a DNA primer or probe can anneal to a complementary sequence of DNA. Biotin: A molecule (also known as vitamin H or vitamin B₇) that binds with high affinity to avidin and streptavidin. Biotin is often used to label nucleic acids and proteins for subsequent detection by avidin or streptavidin linked to a detectable label, or for subsequent isolation using avidin/ streptavidin or an anti-biotin antibody linked to a solid support (such as a lateral flow assay paper strip). The term “biotin” includes derivatives or analogs that participate in a binding reaction with avidin. Biotin analogs and derivatives include, but are not limited to, N-hydroxysuccinimide- iminobiotin (NHS-iminobiotin), amino or sulfhydryl derivatives of 2-iminobiotin, amidobiotin, desthiobiotin, biotin sulfone, caproylamidobiotin and biocytin, biotinyl-ε-aminocaproic acid-N- hydroxysuccinimide ester, sulfo-succinimide-iminobiotin, biotinbromoacetylhydrazide, p- diazobenzoyl biocytin, 3-(N-maleimidopropionyl) biocytin, 6-(6- biotinamidohexanamido)hexanoate and 2-biotinamidoethanethiol. Biotin derivatives are also commercially available, such as DSB-X^TM Biotin (Invitrogen). Additional biotin analogs and derivatives are known (see, for example, U.S. Patent No.5,168,049; U.S. Patent Application Publication Nos.2004/0024197, 2001/0016343, and 2005/0048012; and PCT Publication No. WO 1995/007466). Contacting: Placement in direct physical association; includes both in solid and liquid form. “Contacting” is often used interchangeably with “exposed.” For example, contacting can occur in vitro with one or more primers and/or probes and a biological sample (such as a sample containing RNA) in solution. Control: A reference standard, for example a positive control or negative control. A positive control is known to provide a positive test result. A negative control is known to provide a negative test result. However, the reference standard can be a theoretical or computed result, for example a result obtained in a population. Coronavirus: A large family of positive-sense, single-stranded RNA viruses that can infect humans and non-human animals. Coronaviruses get their name from the crown-like spikes on their surface. The viral envelope is comprised of a lipid bilayer containing the viral membrane (M), envelope (E) and spike (S) proteins. Most coronaviruses cause mild to moderate upper respiratory tract illness, such as the common cold. However, three coronaviruses have emerged that can cause more serious illness and death: severe acute respiratory syndrome coronavirus (SARS-CoV), SARS-CoV-2, and Middle East respiratory syndrome coronavirus (MERS-CoV). Other coronaviruses that infect humans include human coronavirus HKU1 (HKU1-CoV), human coronavirus OC43 (OC43-CoV), human coronavirus 229E (229E-CoV), and human coronavirus NL63 (NL63-CoV). COVID-19: The disease caused by the coronavirus SARS-CoV-2. Detectable label: A compound or composition that is conjugated (e.g., covalently linked) directly or indirectly to another molecule (such as a nucleic acid molecule) to facilitate detection of that molecule. Specific non-limiting examples of labels include fluorescent and fluorogenic moieties (e.g., fluorophores), chromogenic moieties, haptens (such as biotin, digoxigenin, and fluorescein), affinity tags, and radioactive isotopes (such as ³²P, ³³P, ³⁵S, and ¹²⁵I). The label can be directly detectable (e.g., optically detectable) or indirectly detectable (for example, via interaction with one or more additional molecules that are in turn detectable). Methods for labeling nucleic acids, and guidance in the choice of labels useful for various purposes, are discussed, e.g., in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Fourth Edition, 2012, and Ausubel et al., Short Protocols in Molecular Biology, Current Protocols, Fifth Edition, 2002. In some embodiments herein, the detectable label includes a fluorophore or one member of a specific binding pair (such as biotin). DNA ligase: A type of enzyme that catalyzes the formation of a phosphodiester bond to join two DNA ends. In some embodiments herein, the DNA ligase is SplintR® DNA ligase (New England Biolabs), which is also known as PBCV-1 DNA ligase or Chlorella virus DNA ligase. SplintR® DNA ligase catalyzes the ligation of adjacent, single-stranded DNA splinted by a complementary RNA strand. In other embodiments herein, the DNA ligase is T4 DNA ligase or T4 RNA ligase 2. DNA polymerase: A type of enzyme that catalyzes the synthesis of DNA molecules from nucleoside triphosphates. Isothermal DNA amplification methods typically employ a DNA polymerase with a high strand displacement activity and/or high processivity. In some embodiments herein, the DNA polymerase is Bst 2.0 DNA polymerase (New England Biolabs), Bst 3.0 DNA polymerase (New England Biolabs), Bsm DNA polymerase (Thermo Fisher) or Phi29 DNA polymerase (available from several commercial sources). Fluorophore: A chemical compound, which when excited by exposure to a particular wavelength of light, emits light (fluoresces), for example at a different wavelength than that to which it was exposed. Also encompassed by the term “fluorophore” are luminescent molecules, which are chemical compounds that do not require exposure to a particular wavelength of light to fluoresce; luminescent compounds naturally fluoresce. Therefore, the use of luminescent signals eliminates the need for an external source of electromagnetic radiation, such as a laser. An example of a luminescent molecule includes, but is not limited to, aequorin (Tsien, Ann Rev Biochem 67:509, 1998). In some embodiments herein, an oligonucleotide (such as a probe or reporter molecule) is labeled with (e.g., has attached thereto) a fluorophore, such as at the 5 ^ end and/or the 3ʹof the oligonucleotide. Fluorophores suitable for use with methods provided herein, such as PCR or RCA, include, but are not limited to, 6-carboxyfluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TMR), hexachlorofluorescein (HEX), JOE^TM fluorophore, 6-carboxy-X- rhodamine (ROX), CAL Fluor^TM, Pulsar^TM, Quasar^TM, Texas Red® fluorophore , Cy3® fluorophore and Cy5® fluorophore. Other examples of fluorophores that can be used in the methods provided herein are provided in U.S. Patent No.5,866,366. These include: 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'- aminoethyl)amino-naphthalene-1-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]- naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)-maleimide, anthranilamide, Brilliant Yellow, coumarin and derivatives such as coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'- diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethyl-amino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethyl-aminophenylazo)benzoic acid (DABCYL); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives such as eosin and eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives such as 5-carboxyfluorescein (FAM), 5-(4,6- dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1-pyrene butyrate; Reactive Red 4 (Cibacron® Brilliant Red 3B-A); rhodamine and derivatives such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red® fluorophore); N,N,N',N'- tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives. Other fluorophores that can be used include thiol-reactive europium chelates that emit at approximately 617 nm (Heyduk and Heyduk, Analyt. Biochem. 248:216-27, 1997; J. Biol. Chem. 274:3315-22, 1999). Other fluorophores that can be used include cyanine, merocyanine, stryl, and oxonyl compounds, such as those disclosed in U.S. Patent Nos.5,627,027; 5,486,616; 5,569,587; and 5,569,766, each of which is incorporated herein by reference. Specific examples of fluorophores disclosed in one or more of these patent documents include Cy3® fluorophore and Cy5® fluorophore, for instance, and substituted versions of these fluorophores. Other fluorophores that can be used include GFP, Lissamine™, diethylaminocoumarin, fluorescein chlorotriazinyl, naphthofluorescein, 4,7-dichlororhodamine and xanthene (as described in U.S. Patent No.5,800,996 to Lee et al., herein incorporated by reference) and derivatives thereof. Numerous fluorophores are commercially available from known sources. Hybridization: Oligonucleotides (such as primers and probes) and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as “base pairing.” More specifically, A will hydrogen bond to T or U, and G will bond to C. “Complementarity” refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence. “Specifically hybridizable” and “specifically complementary” are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not share 100% complementarity to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when there is a sufficient degree of complementarity to out-compete non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization. Influenza virus: A segmented negative-strand RNA virus that belongs to the Orthomyxoviridae family. There are three types of human influenza viruses: influenza A virus (IAV), influenza B virus (IBV) and influenza C virus (ICV). Influenza A viruses can be classified into subtypes based on allelic variations in antigenic regions of two genes that encode surface glycoproteins, namely hemagglutinin (HA) and neuraminidase (NA), which are required for viral attachment and cellular release. There are currently 18 different IAV HA antigenic subtypes (H1 to H18) and 11 different IAV NA antigenic subtypes (N1 to N11). H1-H16 and N1-N9 are found in wild bird hosts and may be a pandemic threat to humans. H17-H18 and N10-N11 have been described in bat hosts and are not currently thought to be a pandemic threat to humans. Specific examples of IAV include, but are not limited to: H1N1 (such as 1918 H1N1), H1N2, H1N7, H2N2 (such as 1957 H2N2), H2N1, H3N1, H3N2, H3N8, H4N8, H5N1, H5N2, H5N8, H5N9, H6N1, H6N2, H6N5, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H8N4, H9N2, H10N1, H10N7, H10N8, H11N1, H11N6, H12N5, H13N6, and H14N5. In one example, IAV includes those that circulate in humans such as H1N1, H1N2 and H3N2, or cause zoonotic infections, such as H7N9 and H5N1. Influenza B viruses are classified into two lineages – B/Yamagata and B/Victoria, which are further divided into clade(s) and/or sub-clades. For example, the B/Yamagata lineage includes the Y1, Y2 and Y3 clades, but no subclades. The B/Victoria lineage includes the V1A clade, which is divided into the V1A.1, V1A.2 and V1A.3 sub-clades (see the Centers for Disease Control and Prevention website: cdc.gov/flu/about/viruses/types). Influenza C viruses differ from IAV and IBV by having only seven RNA segments (IAV and IBV have eight segments). ICV does not have the HA and NA proteins, but instead expresses a single glycoprotein called hemagglutinin-esterase fusion (HEF). ICV is divided into lineages, including C/Taylor, C/Mississippi, C/Aichi, C/Yamagata, C/Kanagawa and C/Sao Paulo. Isolated: An “isolated” biological component (such as a nucleic acid molecule, protein or virus) has been substantially separated or purified away from other biological components (such as cell debris, or other proteins or nucleic acid molecules). Biological components that have been “isolated” include those components purified by standard purification methods. The term also embraces recombinant nucleic acids or proteins, as well as chemically synthesized nucleic acids or peptides. Isothermal amplification: Nucleic acid amplification that is not dependent on significant changes in temperature (in contrast to PCR, for example). Isothermal amplification is carried out substantially at about the same single temperature. In some examples, isothermal amplification is substantially isothermal, for example, may include small variations in temperature, such as changes in temperature of no more than about 1-2°C during the amplification reaction. In one example, isothermal amplification is carried out at about 50°C or about 65°C. Lateral flow assay (LFA): A paper-based assay for the detection and quantification of analytes in a sample. LFA is a simple, rapid, portable and low-cost detection method. The LFA paper strip typically includes an absorbent pad at one end where the sample is added, a conjugate release pad that contains labelled antibodies that bind the target analyte, a test line containing analyte-specific antibodies and a control line that has antibodies specific for a control analyte (such as anti-biotin antibodies or anti-IgG antibodies). To perform a LFA, the sample is applied to the absorbent pad and the sample moves along the paper strip through capillary action. If the analyte of interest is present in the sample, it will bind to the labelled analyte-specific antibodies and the anti-analyte antibodies located at the test strip (see, e.g., Koczula and Estrela, Essays Biochem 60(1): 111-120, 2016; and Ma et al., BMC Infect Dis 19: 108, 2019). Primer: Primers are short nucleic acids, generally DNA oligonucleotides 10 nucleotides or more in length (such as 10-60, 15-50, 20-40, 20-50, 25-50, or 30-60 nucleotides in length). Primers may be annealed to a complementary target RNA or DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target RNA or DNA strand, and then extended along the target strand by a polymerase enzyme. Primer pairs or sets of primers (such as 2, 3, 4, 5, 6, or more primers) can be used for amplification of a target nucleic acid, e.g., by PCR, LAMP, RCA, RT- LAMP, or other nucleic acid amplification methods. In the context of the present disclosure, an initiator primer is a primer that hybridizes to the internal region of a padlock probe and initiates/primes rolling circle amplification (see FIG.12A). Probe: An isolated nucleic acid (for example, at least 10 or more nucleotides in length), generally with an attached detectable label or reporter molecule. Exemplary labels include radioactive isotopes, ligands, haptens, chemiluminescent agents, fluorescent molecules (e.g., fluorophores), and enzymes. Methods for labeling oligonucleotides and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Fourth Edition, 2012, and Ausubel et al., Short Protocols in Molecular Biology, Current Protocols, Fifth Edition, 2002. Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2^nd ed., vol.1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al. Short Protocols in Molecular Biology, 4^th ed., John Wiley & Sons, Inc., 1999; and Innis et al. PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990. A padlock probe is a linear, single-stranded DNA probe in which the 5ʹ and 3ʹ termini of the probe are complementary to immediately adjacent sequences of the target nucleic acid. Padlock probes also have an internal region that is not complementary to the target. When the padlock probe hybridizes to its target, the 5ʹ and 3ʹ termini are brought into proximity and can then be ligated using a DNA ligase (such as SplintR® ligase) to form a circular probe. Padlock probes can be used in rolling circle amplification methods. In some embodiments herein, the padlock probe is at least 50 nucleotides in length, such as at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 125, at least 130, at least 140, at least 150 nucleotides in length, for example about 50- 150 nucleotides in length, such as about 50-140, 50-130, 50-120, 50-110, 50-100, 60-150, 60-140, 60-130, 60-120, 60-110, 60-100, 70-150, 70-140, 70-130, 70-120, 70-110, 70-100, 80-150, 80-140, 80-130, 80-120, 80-110, 80-100, 90-150, 90-140, 90-130, 90-120, 90-110 or 90-100 nucleotides in length. Quencher: A substance that absorbs excitation energy from a fluorophore when in close proximity. Probes used for nucleic acid amplification and detection methods can include a fluorophore and a quencher, for example one at the 5’terminus of the probe, and the other at the 3’ terminus of the probe. Quenchers suitable for use with such methods include, but are not limited to, ZEN^TM, Iowa Black^TM FQ (IBFQ), Iowa Black^TM RQ (IBRQ), tetramethylrhodamine (TAMRA), Black Hole Quencher^TM (BHQ)0, BHQ1, BHQ2, BHQ3, nonfluorescent quencher (NFQ) 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL). QSY7 (Molecular Probes), QSY33 (Molecular Probes), and ECLIPSE^TM Dark Quencher (Epoch Biosciences). Reaction vessel: Any container suitable for holding the samples to be analyzed for the presence of target RNA according to the methods disclosed herein. Reaction vessels include, but are not limited to, microfuge tubes, test tubes, and wells of a multi-well plate. In some examples a reaction vessel is made of glass, metal, or plastic. RNase H: An endonuclease that specifically hydrolyzes the phosphodiester bonds of RNA when it is hybridized to DNA. Rolling circle amplification: An isothermal nucleic acid amplification method in which a short DNA or RNA primer is amplified to form a long, single-stranded DNA or RNA using a circular DNA template (see, e.g., U.S. Patent No.5,714,320; and Fire and Xu, Proc Natl Acad Sci USA, 92:4641-4645, 1995). Sample: Any sample that contains or could contain RNA. Samples can be from an animal, a plant, or the environment, including samples that are unfixed, frozen, or fixed in formalin and/or paraffin. A biological sample is a sample obtained from a subject (such as a human or veterinary subject). Biological samples include, for example, fluid samples (such as bodily fluids), cell samples, aspirate samples and/or tissue samples. Specific biological samples include, but are not limited to, sputum, saliva, mucus, nasal wash, serum, urine, blood, plasma, feces, cerebral spinal fluid (CSF), bronchoalveolar lavage (BAL) fluid, nasopharyngeal samples, oropharyngeal samples, biopsy samples, needle aspirates, and tissue sections. In some embodiments herein, the sample is a nasopharyngeal, oropharyngeal, sputum, saliva, or blood sample. Samples may be concentrated or diluted before analysis. SARS-CoV-2: A coronavirus of the genus betacoronavirus that first emerged in humans in 2019. This virus is also known as Wuhan coronavirus, 2019-nCoV, or 2019 novel coronavirus. Several variants of SARS-CoV-2 have emerged, which are referred to as the Alpha (B.1.1.7), Beta (B.1.351, B.1.351.2, B.1.351.3), Delta (B.1.617.2, AY.1, AY.2, AY.3), and Gamma (P.1, P.1.1, P.1.2) variants. The Delta variant causes more infections and spreads faster than other forms of SARS-CoV-2. Several variants have at least one amino acid substitution in their spike protein, such as D614G, N501Y, L542R, E484K and/or E484Q (for other mutations see the CDC website: cdc.gov/coronavirus/2019-ncov/variants/variant-info). Symptoms of SARS-CoV-2 infection include fever, chills, dry cough, shortness of breath, fatigue, muscle/body aches, headache, new loss of taste or smell, sore throat, nausea or vomiting, and diarrhea. Patients with severe disease can develop pneumonia, multi-organ failure, and death. The time from exposure to onset of symptoms is approximately 2 to 14 days. The SARS-CoV-2 virion includes a viral envelope with large spike glycoproteins. The SARS-CoV-2 genome, like most coronaviruses, has a common genome organization with the replicase gene included in the 5'-two thirds of the genome, and structural genes included in the 3'-third of the genome. The SARS-CoV-2 genome encodes the canonical set of structural protein genes in the order 5' - spike (S) - envelope (E) - membrane (M) and nucleocapsid (N) - 3'. Specific binding pair: A pair of molecules that interact by means of specific, non-covalent interactions that depend on the three-dimensional structures of the molecules involved. Exemplary pairs of specific binding pairs include antigen/antibody, hapten/antibody, ligand/receptor, nucleic acid strand/complementary nucleic acid strand, substrate/enzyme, inhibitor/enzyme, carbohydrate/lectin, biotin/avidin (such as biotin/streptavidin), and virus/cellular receptor. Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human animals (such as birds, pigs, mice, rats, rabbits, sheep, horses, cows, and non- human primates). In some examples, a subject serves as the source of a sample to be analyzed using RADAR. Synthetic: Produced by artificial means in a laboratory, for example a synthetic nucleic acid or protein (for example, a probe) can be chemically synthesized in a laboratory. III. Introduction Diagnosis of COVID-19 cases is typically carried out by one of two methods: detection of the genomic/transcriptomic RNA of SARS-CoV-2 by quantitative RT-PCR (qRT-PCR) or detection of viral proteins. Although the tests for viral proteins are rapid and require minimal equipment, their usefulness is limited due to their reportedly low sensitivity and low accuracy. Serological assessment of SARS-CoV-2 neutralizing antibodies in human blood may indicate a prior infection by SARS-CoV-2. These antibody tests are also useful for detecting infection at the later stages because it takes several days after infection for a patient to produce detectable amounts of antibody in their blood. The qRT-PCR detection method, which converts the viral RNA into complementary DNA followed by real-time PCR amplification, is highly sensitive and efficient, and, therefore, is reliably used for COVID-19 testing. However, this method demands sophisticated laboratory infrastructures and instrumentation, and often sample transportation to equipped laboratories. As a result, the average processing time for diagnosis of suspected patients is delayed. Thus, the limitation of infrastructure and inadequate reagents have impeded the rate of qPCR-based diagnosis specifically in developing countries. These hurdles call for the development of a simple and low-cost method of rapid, sensitive, and accurate molecular testing for SARS-CoV- 2, which could also be applicable to detection of any type of RNA, including other RNA viruses. IV. Methods for Detection of a Target RNA Ongoing efforts by the global scientific community have developed several promising CRISPR-Cas-based rapid detection assays for SARS-CoV-2 RNA with varying sensitivity (Zhang et al., broadinstitute.org/files/publications/special/COVID-19%20detection%20(updated).pdf (2020); Broughton et al., Nat Biotechnol 38(7): 870-874, 2020; Azhar et al., BioRxiv, doi.org/10.1101/2020.04.07.028167, 2020 (preprint)). All of these methods require conversion of the viral RNA into cDNA by reserve transcriptase, followed by isothermal amplification of the cDNA, either by loop-mediated amplification (RT-LAMP) (Broughton et al., Nat Biotechnol 38(7): 870-874, 2020) or by recombinase polymerase amplification (RT-RPA) (Zhang et al., broadinstitute.org/files/publications/special/COVID-19%20detection%20(updated).pdf (2020); Azhar et al., BioRxiv, doi.org/10.1101/2020.04.07.028167, 2020 (preprint)). Detection of the amplicon is achieved by specific interaction of RNA-guided-Cas protein complexes (Kellner et al., Nat Protoc, 14, 2986-3012, 2019; Chen et al., Science 360(6387): 436-439, 2018). Therefore, the specificity and sensitivity of these assays depend on the stability of the large gRNA-Cas protein complex, which may be compromised with changes in temperature that occur under some testing conditions. To expand the diagnostic testing capabilities for SARS-CoV-2 and other types of cellular and viral RNA, the present disclosure describes the development of a specific, sensitive, inexpensive and minimally equipment-dependent RNase H-assisted detection assay for RNA (RADAR) (see FIG.1). RADAR enables testing in settings of limited infrastructures and means. The disclosed assay uses RNA, such as purified or isolated RNA, as the starting material. The first step of the assay performs a reverse transcription-independent detection of specific target RNA using probe ligation and isothermal rolling circle amplification (RCA) (Takahashi et al. Sci Rep 8: 7770, 2018). The target RNA acts as an adapter for sequence-specific ssDNA probes that bring the 5ʹ and 3ʹ ends of the probes in juxtaposition, which can then be ligated using DNA ligase to generate circular ssDNA. The circular ssDNA acts as a template for isothermal RCA. Thus, this assay bypasses the requirement for a reverse transcription reaction, as used for standard RT-PCR- based detection methods. Sequence-specific ssDNA annealing to the target RNA not only acts as a splint for ligation/circularization, but it also creates an RNase H substrate. The RNA in the circular ssDNA-RNA hybrid regions is cleaved by RNase H to generate 3ʹ-OH RNA ends, which act as priming sites for RCA of the circular ssDNA templates. Takahashi et al. (Sci Rep 8: 7770, 2018) employed a fluorometric assay or agarose gel electrophoresis for detection of the RCA product, which required additional instrumentation. Moreover, the SYBRII dye, which was used for fluorometric readout, produced increased background because it nonspecifically intercalates with any nucleic acid present in the sample. However, a visual signal detection, such as a colorimetric lateral flow assay or visual fluorometric detection (such as in a vessel, such as a microfuge tube), is more suitable for diagnostic use, particularly for point-of-care diagnostics (Broughton et al., Nat Biotechnol 38(7): 870-874, 2020; Kellner et al., Nat Protoc, 14, 2986-3012, 2019; Chen et al., Science 360(6387): 436-439, 2018). The RADAR method disclosed herein introduces labeled RNA probes to combine the sensitivity of RCA with the advantageous colorimetric detection of enzymatically released labels. Following the isothermal RCA step, a labelled RNA reporter complementary to a specific, repeated target sequence on the RCA product is hybridized with the RCA product and then cleaved by RNase H, which results in the release of the label (for example, FAM or HEX). This label can then be visually detected by a lateral flow dipstick (such as HybriDetect, Milenia Biotec) or a fluorometric assay. Isothermal RCA amplification using simple heating blocks and colorimetric reporter detection (such as by lateral flow or visual fluorometric detection) allow the RADAR assay to be run with minimal equipment requirements in approximately 30–45 minutes. In addition, the availability of thermostable variants of the required enzymes renders this method well-suited for field applications. Lastly, this assay can be adopted for detection of any target RNA sequence. Provided herein is a method for detecting a target RNA in a sample. The method includes an annealing step, a circularization step, an RNase H-assisted isothermal amplification step and a detection step. In some embodiments, the annealing step includes contacting the sample in a reaction vessel with a single-stranded DNA (ssDNA) probe having a 5ʹ end complementary to a first region of the target RNA, a 3ʹ end complementary to a second region of the target RNA that is adjacent to the first region, and an internal region between the 5ʹ end and the 3ʹ end that is not complementary to the target RNA, wherein the 5ʹ and 3ʹ ends of the probe anneal to the target RNA present in the sample; the circularization step includes adding a DNA ligase to the reaction vessel to circularize the probe annealed to the target RNA by ligating the 5ʹ end to the 3ʹ end; the RNase H-assisted isothermal amplification step includes adding to the reaction vessel a mixture of dNTPs, a DNA polymerase, RNase H, and a single-stranded RNA reporter molecule comprising a sequence complementary to a first portion of the internal region of the probe and comprising at least one detectable label, wherein the RNase H cleaves (i) the target RNA hybridized to the probe, thereby priming isothermal rolling circle amplification of the probe, and (ii) the RNA of the reporter molecule hybridized to the rolling circle amplified probe, thereby releasing the detectable label; and the detection step includes detecting cleavage or the RNA reporter molecule (such as by detecting the released detectable label), thereby detecting the target RNA in the sample. In some embodiments of the disclosed method, the RNase H-assisted isothermal amplification step further includes adding to the reaction vessel an initiator primer that specifically hybridizes to a second portion of the internal region of the probe. The first portion of the internal region of the probe (to which the RNA reporter molecule hybridizes) and the second portion of the internal region of the probe (to which the initiator primer hybridizes) are non-overlapping. In some examples, the initiator primer is 100% complementary to the second portion of the internal region of the probe. In particular examples, the initiator primer is about 10, about 15, about 20, about 25 or about 30 nucleotides in length, such as 10-30, 10-25, 10-20, 15-30, 15-25 or 15-20 nucleotides in length. In specific non-limiting examples, the initiator primer is 15 nucleotides in length. In general, the length of the initiator primer is about equal to or longer than the length of the 5ʹ or 3ʹ complementary end of the padlock probe. The disclosed methods permit multiplexing. In one example, the method allows simultaneous or contemporaneous detection of a plurality of target RNA molecules, such as at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 96, at least 100, at least 200, at least 384, at least 500, at least 1000, at least 1536, at least 5000, or at least 10,000 different target RNA molecules, for example in the same sample. In some examples, the method allows simultaneous or contemporaneous analysis of one or more target RNA molecules in a plurality of different samples (such as different patient samples), such as at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 96, at least 100, at least 200, at least 384, at least 500, at least 1000, at least 1536, at least 5000, or at least 10,000 different samples. The lengths of the 5ʹ end, the 3ʹ end and the internal region of the ssDNA probe can vary depending upon the target RNA. In some embodiments, the 5ʹ end and the 3ʹ end are each individually at least 10, at least 15 or at least 20 nucleotides in length, such as 10-15 nucleotides in length or 15-20 nucleotides in length. In some examples, each end is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 nucleotides in length. In specific examples, the 5ʹ end and the 3ʹ end are the same length. In other examples, the 5ʹ end and the 3ʹ end are different lengths. In some examples, the 5ʹ end has 100% complementarity to the first region of the target RNA; however, 100% complementarity is not required. In some examples, the 5ʹ end has less than 100% complementarity to the first region of the target RNA, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% complementarity to the first region of the target RNA. In some examples, the 3ʹ end has 100% complementarity to the second region of the target RNA; however, 100% complementarity is not required. In some examples, the 3ʹ end has less than 100% complementarity to the first region of the target RNA, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% complementarity to the second region of the target RNA. In some examples in which the 5ʹ end and/or the 3ʹ end have less than 100% complementarity to the first and second regions of the target RNA, respectively, at least the terminal 1, 2, 3, 4 or 5 nucleotides, such as 3 nucleotides, are 100% complementary to the target RNA. In some embodiments, the internal region of the ssDNA probe is at least 10 nucleotides longer than the combined length of the 5ʹ and 3ʹ ends (for example, if each end is 15 nucleotides in length, the internal region is at least 40 nucleotides in length). In some examples, the internal region of the ssDNA probe is at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65 or at least 70 nucleotides in length, such as about 30-70 nucleotides in length, 40-70 nucleotides in length, 50-70 nucleotides in length, 30-60 nucleotides in length, 40-60 nucleotides in length, 50-60 nucleotides in length, 30-50 nucleotides in length or 40-50 nucleotides in length. In some examples, the internal region of the ssDNA probe is about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length. In some embodiments, the total length of the ssDNA probe is about 50 to about 150 nucleotides in length, such as about 50-140, 50-130, 50- 120, 50-110, 50-100, 60-150, 60-140, 60-130, 60-120, 60-110, 60-100, 70-150, 70-140, 70-130, 70- 120, 70-110, 70-100, 80-150, 80-140, 80-130, 80-120, 80-110, 80-100, 90-150, 90-140, 90-130, 90- 120, 90-110 or 90-100 nucleotides in length. The DNA ligase can be any DNA ligase capable of ligating adjacent, single-stranded DNA splinted by RNA. In some embodiments, the DNA ligase is SplintR® ligase (also known as Chlorella virus DNA ligase or PBCV-1 DNA ligase), T4 DNA ligase or T4 RNA ligase 2. The DNA polymerase can be any DNA polymerase suitable for isothermal DNA amplification methods, such as a DNA polymerase with a high strand displacement activity and/or high processivity. In some embodiments, the DNA polymerase is Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Bsm DNA polymerase or Phi29 DNA polymerase. The RNA reporter molecule can very in length, depending upon, for example, the target RNA and the ssDNA probe utilized in the method. In some embodiments, the RNA reporter molecule is about 10 to about 50 nucleotides in length, such as about 15 to 45 nucleotides in length, 20 to 40 nucleotides in length, or 15 to 30 nucleotides in length. In some examples, the RNA reporter molecule is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the RNA reporter molecule has a deoxy base (dNTP) at the 5ʹ terminus, the 3ʹ terminus, or both, to minimize degradation of the reporter. The RNA reporter molecule includes at least one detectable label, such as two detectable labels, for example, one label at the 5ʹ terminus of the RNA reporter molecule and one label at the 3ʹ terminus of the RNA reporter molecule. In some embodiments, the detectable label is a fluorophore, an enzyme substrate, a radioactive isotope, or one member of a specific binding pair (biotin and avidin are one example of a binding pair). In some examples, the fluorophore is 6- carboxyfluorescein (FAM), hexachlorofluorescein (HEX), tetrachlorofluorescein (TET), Texas Red® flurophore, or tetramethylrhodamine (TMR). In some examples, the enzyme substrate is a substrate for horseradish peroxidase (HRP), alkaline phosphatase, glucose oxidase or beta galactosidase. In some examples, the radioactive isotope is ³²P, ³⁵S, or ¹²⁵I. In some examples, the member of the specific binding pair is biotin. In specific examples, the reporter molecule includes two detectable labels and the detectable labels are FAM and biotin, or HEX and biotin. In other specific examples, the RNA reporter molecule has two detectable labels and the detectable labels are a fluorophore and a quencher, such as FAM and a quencher or HEX and a quencher. In specific non-limiting examples, the RNA reporter molecule includes FAM and Iowa Black® FQ, or HEX and Iowa Black® FQ. In specific non-limiting examples, the RNA reporter molecule has two detectable labels, namely a fluorophore and a quencher, such as Oregon Green® fluorophore, rhodamine, tetrachlorofluorescein (TET), JOE^TM fluorophore or hexachlorofluorescein (HEX) with Black Hole Quencher® 1 (BHQ-1); Alexa 555^TM fluorophore, Cy3® fluorophore, TAMRA^TM fluorophore, or Texas Red® fluorophore, and Black Hole Quencher® 2 (BHQ-2); or Alexa 633^TM fluorophore, Cy5® fluorophore, or Alexa 647^TM fluorophore with Black Hole Quencher® 3 (BHQ-3). The temperatures used for each step of the RNA detection method can vary depending upon, for example, the target RNA, the ssDNA probe and the reporter RNA molecule sequences, and properties of the enzymes. For example, the annealing temperature will vary depending upon the melting temperature (Tm) of the probe. In some embodiments, the annealing step is performed at a temperature of about 40°C to about 70°C, such as about 45°C to about 65°C, about 50°C to about 65°C, or about 50°C to about 60°C. In some examples, the annealing step is performed at 65°C. In some embodiments, the circularization step is performed at about 32°C to about 42°C, such as about 34°C to about 40°C, about 36°C to about 38°C, or about 37°C. In some examples, the circularization step is performed at a temperature of about 32°C, about 33°C, about 34°C, about 35°C, about 36°C or about 37°C. In specific examples, the circularization step is performed at a temperature of about 37°C. In some embodiments, the RNase H-assisted isothermal amplification step is performed at a temperature of about 55°C to about 70°C, such as about 60°C to about 65°C. In some examples, the RNase H-assisted isothermal amplification step is performed at a temperature of about 60°C, about 61°C, about 62°C, about 63°C, about 64°C or about 65°C. In specific examples, the RNase H-assisted isothermal amplification step is performed at a temperature of 65°C. In some embodiments, the detection step is performed using a lateral flow assay (LFA) (see section VI below). In other embodiments, the detection step is performed using a fluorometric assay, such as any endpoint fluorescence assay. Fluorescence can be measured using any device that can quantify fluorescence, such as a plate reader. Fluorescence can also be detected visually. The disclosed RNA detection method can detect any target RNA of interest. In some embodiments, the target RNA is viral RNA. For example, the viral RNA can be from a positive- strand RNA virus or a negative-strand RNA virus. Exemplary positive-strand RNA viruses that can be detected with the disclosed methods include, but are not limited to: Picornaviruses (such as Aphthoviridae [for example foot-and-mouth-disease virus (FMDV)]), Cardioviridae; Enteroviridae (such as Coxsackie viruses, Echoviruses, Enteroviruses, and Polioviruses); Rhinoviridae (Rhinoviruses)); Hepataviridae (Hepatitis A viruses); Togaviruses (examples of which include rubella; alphaviruses (such as Western equine encephalitis virus, Eastern equine encephalitis virus, and Venezuelan equine encephalitis virus)); Flaviviruses (examples of which include Dengue virus, St. Louis encephalitis virus, West Nile virus, Japanese encephalitis virus, hepatitis C virus); Calciviridae (which includes Norovirus and Sapovirus); and Coronaviruses (examples of which include SARS coronaviruses, such as SARS-CoV, SARS-CoV-2, and MERS-CoV). Exemplary negative-strand RNA viruses that can be detected with the disclosed method include, but are not limited to: Orthomyxyoviruses (such as the influenza viruses, including IAV, IBV, and ICV), Rhabdoviruses (such as Rabies virus), Arenaviruses (such as Lassa virus), Filoviruses (such as Ebola virus) and Paramyxoviruses (examples of which include measles virus, respiratory syncytial virus, and parainfluenza viruses). In some examples, the RNA is from a retrovirus, such as human immunodeficiency virus type 1 (HIV-1), such as subtype C; HIV-2; equine infectious anemia virus; feline immunodeficiency virus (FIV); feline leukemia viruses (FeLV); simian immunodeficiency virus (SIV); or avian sarcoma virus. In some examples, the viral RNA is coronavirus RNA. In specific examples, the coronavirus is SARS-CoV-2. In other examples, the viral RNA is influenza virus RNA, such as RNA from a circulating strain of influenza virus. In some examples, the viral RNA is influenza A, such as H1N1 (such as 1918 H1N1), H1N2, H1N7, H2N2 (such as 1957 H2N2), H2N1, H3N1, H3N2, H3N8, H4N8, H5N1, H5N2, H5N8, H5N9, H6N1, H6N2, H6N5, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H8N4, H9N2, H10N1, H10N7, H10N8, H11N1, H11N6, H12N5, H13N6, or H14N5. In some examples, the viral RNA is influenza B or influenza C RNA. In some examples in which the target viral RNA is SARS-CoV-2 RNA, the ssDNA probe is designed to hybridize with the SARS-CoV-2 N gene or the S gene. For example, the ssDNA probe can be designed to detect the presence of any variant of SARS-CoV-2 (or a corresponding WT sequence), such as the Alpha, Beta, Delta or Gamma variant. In particular non-limiting examples, the nucleotide sequence of the ssDNA probe comprises or consists of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17 and/or the nucleotide sequence of the RNA reporter comprises or consists of SEQ ID NO: 4 or SEQ ID NO: 5. In other embodiments, the target RNA is cellular RNA, such as messenger RNA or non- coding RNA. Examples of non-coding RNA includes ribosomal RNA (rRNA), transfer RNA (tRNA), siRNA, lncRNA and miRNA. In some embodiments, the sample is a biological sample. In some examples, the biological sample includes sputum, saliva, mucus, nasal wash, serum, urine, blood, plasma, feces, cerebral spinal fluid (CSF), bronchoalveolar lavage (BAL) fluid, nasopharyngeal samples, oropharyngeal samples, biopsy samples, needle aspirates, and tissue sections. In some examples, the biological sample is a type of sample used for detection of SARS-CoV-2 RNA, such as a nasopharyngeal, oropharyngeal, sputum, saliva, or blood sample. In some embodiments, the sample is an environmental sample, such as one that includes nucleic acid molecules. Exemplary environmental samples that can be analyzed using the disclosed RADAR methods include water, soil, air, as well as samples obtained from inanimate surfaces (e.g., swabbing). In one example the sample is or is obtained from a plant or seed. In some examples, the sample is a food sample (such as a fruit, meat, fish, dairy product, or vegetable), or a sample obtained from the surface or interior of such a food sample. In some examples, the sample is from a surface that comes into contact with food (such as equipment in a production or packaging plant). In some embodiments, the method further includes isolating RNA from the sample (such as the biological or environmental sample) before the annealing step. In some embodiments, the method further includes concentrating and or filtering the sample (such as the biological sample) before the annealing step. In some examples, the sample is treated with a protease, such as proteinase K, prior to the annealing step. In some embodiments, the reaction vessel includes a microcentrifuge tube, a test tube or a microwell plate (such as a 96-, 384-, or 1536-well microtiter plate). V. Probes, Reporter Molecules and Kits for Detection of SARS-CoV-2 RNA Also provided herein are synthetic oligonucleotides that function as ssDNA (padlock) probes and RNA reporter molecules, for the detection of SARS-CoV-2 RNA. In some embodiments, the SARS-CoV-2 RNA is N gene, S gene, M gene or RdRp gene RNA. In some embodiments, the RNA is N gene RNA. In other embodiments, the RNA is S gene RNA. Exemplary SARS-CoV-2 N gene padlock probes: TGGGGTCCATTATCAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAGCATTTCGCTGATTT (SEQ ID NO: 1) TCTCCATTCTGGTTAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTACGCGCCCCACTGCGT (SEQ ID NO: 2) ACCAAACGTAATGCGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTATGAATCTGAGGGTCC (SEQ ID NO: 3) Exemplary SARS-CoV-2 S gene padlock probes: CCCTGATAAAGAACAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTATCTGTGCAGTTAACA (SEQ ID NO: 9; targets D614G) AAGTGGGTTGGAAACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAGGTAACCAACACCAT (SEQ ID NO: 10; targets N501Y) GGTAATTATAATTACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTATAAACAATCTATACC (SEQ ID NO: 11; targets L452R) TAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAAACAATTAAAACCTT (SEQ ID NO: 12; targets E484K) GAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAAACAATTAAAACCTT (SEQ ID NO: 13; targets E484Q) TCCTGATAAAGAACAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTATCTGTGCAGTTAACA (SEQ ID NO: 14; targets WT D614) TAGTGGGTTGGAAACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAGGTAACCAACACCAT (SEQ ID NO: 15; targets WT N501) GGTAATTATAATTACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTATAAACAATCTATACA (SEQ ID NO: 16; targets WT L452) CAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAG GACTTCTTAAACAATTAAAACCTT (SEQ ID NO: 17; targets WT E484) In the synthetic oligonucleotide sequences (padlock probes) shown above, the nucleotides in bold represent the internal (non-complementary) region of the probe. Exemplary RNA reporter molecules: ArACrArUrCrArGrUrGrUrArCrArGrGrArCrUT (SEQ ID NO: 4) AUCAUGAACAUCAGUGUACAGGAC (SEQ ID NO: 5) In specific non-limiting examples, the sequence of the synthetic oligonucleotide (padlock probe or reporter molecule) is at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17. In specific non-limiting examples, the sequence of the probe comprises or consists of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17. In some examples, the synthetic oligonucleotide (RNA reporter molecule) includes a detectable label at one or both the 5ʹ terminus and 3ʹ terminus. In specific examples, the synthetic oligonucleotide includes a fluorophore at the 5ʹ terminus, such as FAM or HEX. In specific examples, the synthetic oligonucleotide includes biotin or a quencher at the 3ʹ terminus. Further provided herein are kits for detecting SARS-CoV-2 RNA. In some embodiments, the kit includes one or more synthetic oligonucleotides disclosed herein (such as one or more padlock probes and/or one or more reporter RNA molecules), and one or more of a DNA ligase, a DNA polymerase, RNase H (or any enzyme that cleaves RNA:DNA hybrids), dNTPs, a reaction vessel, and a lateral flow test strip. In specific examples, the kit includes at least one synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17; a synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 4, a fluorophore at the 5ʹ terminus, and biotin at the 3ʹ terminus; lateral flow test strips capable of detecting the fluorophore and biotin; a DNA ligase, a DNA polymerase, RNase H and dNTPs. In other specific examples, the kit includes at least one synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17; a synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 5, a fluorophore at the 5ʹ terminus, and a quencher at the 3ʹ terminus; a DNA ligase, a DNA polymerase, RNase H and dNTPs. In some examples, the kit further includes one or more buffers, instructions, a reaction vessel (for example, a microfuge tube), or any combination thereof. The DNA ligase included in the kit can be any DNA ligase capable of ligating adjacent, single-stranded DNA splinted by RNA. In some embodiments, the DNA ligase is SplintR® ligase (also known as Chlorella virus DNA ligase or PBCV-1 DNA ligase), T4 DNA ligase or T4 RNA ligase 2. The DNA polymerase included in the kit can be any DNA polymerase suitable for isothermal DNA amplification methods, such as a DNA polymerase with a high strand displacement activity and/or high processivity. In some embodiments, the DNA polymerase is Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Bsm DNA polymerase or Phi29 DNA polymerase. In specific examples, the DNA ligase is Chlorella virus DNA ligase and the DNA polymerase is Bst 2.0 DNA polymerase. VI. Lateral Flow Assay In some embodiments of the disclosed methods, the detection step includes a lateral flow assay (LFA) to detect the released detectable label. LFA is a simple, rapid, portable and low-cost method for detecting an analyte in a sample. In view of these features, LFA is well-suited for point-of-care diagnostics, particularly in settings where rapid test results are necessary (Koczula and Estrela, Essays Biochem 60(1): 111-120, 2016). LFA has been used for a wide variety of applications in medicine, such as for detecting antigens, antibodies, and gene amplification products (Boisen et al., J Infect Dis 212(Suppl 2): S359-S367, 2015; Nielsen et al., J Immunoassay Immunochem 29:10-18, 2008; Rohrmann et al., PLoS One 7:e45611, 2012; Kamphee et al., PLoS One 10:e0137791, 2015). Many different biological samples are compatible with LFA, including blood, serum, plasma, saliva, sweat and other bodily fluid samples (Moreno et al., Gut 66(2):250- 257, 2017; Carrio et al., Sensors (Basel) 15(11):29569-29593, 2015; Pacifici et al., J Anal Toxicol 25:144-146, 2001; De Giovani and Fucci, Curr Med Chem 20:545-561, 2013; Magambo et al., J Int AIDS Soc 17:19040, 2014; Schramm et al., Anal Biochem 477:78-85, 2015; Ang et al., Biosens Bioelectron 78:187-193, 2015). LFA uses a fluid sample that contains, or is suspected of containing, the analyte of interest (such as a target RNA), which moves via capillary action through various zones of a paper test strip. The lateral flow test strip contains multiple zones of polymeric strips on which molecules capable of interacting with the analyte of interest are attached. Typically, a lateral flow test strip is made up of overlapping membranes that are mounted on a stable backing card. To perform the assay, the sample (here, the products of the RNase H-assisted isothermal amplification step) is applied to an adsorbent sample pad located at one end of the lateral flow test strip. As shown in FIG.3, if the lateral flow strip is for a dipstick lateral flow assay (such as HybriDetect Dipstick lateral flow assay by Milenia Biotec), the end of the strip with the adsorbent sample pad is placed directly in the reaction vessel with the isothermal amplification products. The volume in the reaction vessel can be adjusted as needed with an appropriate buffer (for example, to reach a sample fluid volume of about 100 µl). The sample pad is impregnated with buffer salts and surfactants that make the sample suitable for interaction with the detection system. The sample pad also holds the excess of the fluid sample and once soaked, the fluid flows to the conjugate release pad, which contains labelled antibodies specific to the target analyte. The labelled antibodies are typically conjugated to colored or fluorescent particles, such as colloidal gold or latex microspheres. In some embodiments herein, the conjugate release pad contains anti-FAM antibodies conjugated to gold nanoclusters. If the target analyte is present in the fluid sample, the labelled antibodies bind the analyte and the fluid containing the conjugates continue their migration to the detection zone, which contains a test line and a control line. The detection zone is generally composed of nitrocellulose and contains specific biological components (such as antibodies or antigens) immobilized in lines. The test line will show a signal if the target analyte is present in the sample. In the context of the methods disclosed herein, the test band will show a signal when the RNA reporter molecule is cleaved by RNase H during the RNase H-assisted isothermal amplification step, thereby freeing the fluorescent moiety (such as FAM; see FIG.3). In some examples herein, the test band contains antibodies specific for FAM (FIG.3). The control line typically contains affinity ligands that provide an indication of whether the sample has properly migrated along the paper strip and that the reagents in the conjugate pad are active. In the disclosed methods, a signal from the control band indicates the presence of biotin from the RNA reporter molecule, which will be detected regardless of whether the RNA reporter molecule is cleaved by RNase H (see FIG.3 and FIG.7). Therefore, a signal on the control line indicates that the fluid sample has properly migrated along the test strip as it will be positive regardless of whether the target analyte (such as the target RNA) is present in the sample being tested. In some examples, the control band includes an affinity conjugate for biotin, such as streptavidin. To maintain capillary flow along the test strip an absorbent pad is included at the end of the paper strip. The absorbent pad wicks away excess reagents and prevents backflow of the liquid. The results of a LFA can be read visually (by eye) or by using a lateral flow reader. Exemplary LFAs are described in U.S. Patent Nos.6,136,610; 6,841,159; 7,871,781; 8,399,261; and 10,048,251; and U.S. Patent Application Publication Nos.2003/0119203; 2007/0020699; 2010/00015658; 2013/0137189; 2018/0149600; and 2020/0166473, each of which is herein incorporated by reference in its entirety. The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described. EXAMPLES The following examples describe the development and optimization of the disclosed RNase H-assisted detection assay for RNA (RADAR) and visual readout by lateral flow or fluorescent assay. The assay provides a rapid, low-cost, sensitive and accurate method for the detection of any RNA of interest. RADAR differs from prior RNA detection methods by using a highly sensitive rolling-circle amplification (RCA) method to amplify target sequences, labeled RNA probes (reporter molecules) and RNase H to release the label from the probe in a sequence specific manner. Because RNase H is already present in the reaction as part of the RCA step, the RNA probe cleavage happens simultaneously with the RCA reaction step, which greatly simplifies and reduces the time required for the detection assay. A lateral flow assay (see FIGS.1, 3, 7 and 8) or a fluorometric assay (FIG.9) can be used for visualization of the released label. Example 1: Generation and standardization of padlock probes against SARS-CoV-2 RNA for rolling circle amplification Padlock probe circularization is a highly specific method to detect the presence of target RNA. Sequence specific hybridization of padlock probes to their target RNA juxtaposes the 5ʹ- and 3ʹ-termini of a linear probe, allowing DNA ligase to efficiently ligate two ends of the probe resulting in circularization of the probe (Takahashi et al., Sci Rep 8: 7770, 2018). The efficiency of probe circularization is highly sensitive to the exact complementarity of the 5ʹ and 3ʹ terminal sequences of the probes to the target RNA, which enhances the specificity of the padlock probe. However, the secondary structure in the vicinity of the probe binding site on the target RNA can affect the probe hybridization and subsequent probe circularization. To find efficient padlock probes for the SARS-CoV-2 N gene, 3 different padlock probes (SEQ ID NOs: 1-3) targeting the N gene were screened to identify the most efficient probe. RNA splinted ligation (circularization) efficiency of each of these probes was analyzed in the presence of in vitro transcribed RNA of the corresponding gene. The linear padlock oligo was incubated with equimolar target RNA and SplintR® DNA ligase at 37°C for 15 minutes, followed by gel electrophoresis to analyze the relative amount of circular fraction (slower migrating than linear ssDNA) over linear probe (see schematic shown in FIG.2). Percent circularization efficiency (%CE) was calculated using the following formula; %CE= [circular probe intensity/ (circular + linear probe intensity] x 100. The most efficient probes were used for downstream assay development (see Example 5). Example 2: Determination of the sensitivity and specificity of RNase H-assisted RNA primed rolling circle amplification (RAP-PRCA) Using the selected padlock probes for the N gene (SEQ ID NOs: 1-3), RAP-PRCA was performed in the presence of varying concentrations (0, 0.1, 1, and 10 pmol) of in vitro transcribed viral RNA to analyze the minimal sensitivity of the probes. The padlock probe and the viral RNA (0-10 pmol) were incubated in the presence of SplintR® DNA ligase at 37°C for 15 minutes. The reaction was supplemented with dNTP mix, RNase H and Bst 2.0 DNA polymerase, followed by RNA primed rolling circle amplification of the circularized probe at 65°C for 30 minutes. RCA amplified DNA product (ssDNA) was analyzed in agarose gel electrophoresis and visualized by ethidium bromide reagent. Ethidium bromide fluorescent intensity of each lane was plotted against input target RNA concentration to determine the minimal sensitivity and linearity of the RCA assay. To assess the specificity of the probes, a known amount of target RNA was spiked into purified total RNA (2 µg) isolated from a human epithelial cell line. The spiked-in RNA and corresponding amount of human total RNA was used for RAP-PRCA as described above to determine the specificity of the assay. This assay determined the specificity of the SARS-CoV-2 padlock probes. Example 3: Lateral flow assay development for visual analysis of RAP-PRCA product Detection of RAP-PRCA amplification products by agarose gel electrophoresis is useful for the standardization of the assay. However, for rapid detection of the RAP-PRCA product in a field setting, a colorimetric visual readout assay can be useful. To achieve this aim, a single stranded RNA (ssRNA) reporter corresponding to the constant region of the padlock probe is added into the RAP-PRCA reaction. The ssRNA is labelled with biotin at its 3ʹ end for its retention in the control band of a lateral flow assay. The 5ʹ end of the ssRNA is labeled with 6-FAM dye, which is cleaved off by RNase H after hybridization of the probe to the repeated complementary binding sites that are generated by RCA. The free FAM is determined by a paper strip based HybriDetect Dipstick lateral flow assay at the test band (Ma et al., BMC Infect Dis 19: 108, 2019) (FIG.3). The lateral flow assay is performed with varying concentrations of RNA target (1 to 10 pmol) to determine the sensitivity of the visual readout system. Alternatively, the ssRNA reporter cleavage is monitored by the fluorescence of the FAM. For this fluorometric assay, 3ʹ biotin is replaced with a quencher on the ssRNA reporter. RNase H- mediated cleavage of the reporter releases the FAM from the quencher, which is quantitatively measured by a fluorimeter. Example 4: Validation against existing assays and patient samples The sensitivity and specificity of RADAR is compared in parallel against existing testing kits and validated on actual patient samples with known SARS-CoV-2 status. Reagents:

Equipment 1. Isothermal water/dry baths 2. Micropipette Protocol The method is composed of three steps starting from RNA (same input as used for qRT- PCR based method). 1. DNA probe annealing and splint ligation (~15 min) 2. RNase H-assisted isothermal amplification in the presence of RNA probes (~30 min) 3. Paper strip detection (~2-3 min) 1. DNA probe annealing and splint ligation (~15 min) a. In a 0.2 ml microfuge tube, add RNA template, 100 nM padlock probe in 1X SplintR® ligation reaction buffer on ice b. Heat in 50°C bath for 2 min and cool 1 min on ice c. Add 1 µl SplintR® ligase and incubate at 37°C for 15 min (for standardization: agarose gel electrophoresis for ligation efficiency test) 2. RNase H-assisted isothermal amplification (~30 min) a. To the same reaction tube, add 1 mM dNTP mix, MgSO4, RNase H, Bst2.0 DNA polymerase and RNA reporter in isothermal amplification b. Incubate at 50°C for 30 min (for standardization: agarose gel electrophoresis for confirmation of the RCA product) 3. Paper strip detection (~2-3 min) a. Add 60 µl strip assay buffer to each reaction b. Place the tubes in a tube rack at room temperature c. Place a paper strip into each reaction tube and wait for the solution to flow through the strip d. The negative control will show a single line at the bottom and the positive control will show two bands, one at the control band region and another at the top. (agarose gel for standardization assays) Example 4: In vitro transcription (IVT) of the SARS-CoV-2 N-gene region In vitro transcription of the N gene of the SARAS-CoV2 genome was performed using a synthetic DNA template corresponding to the region of the SARS-CoV2 N gene using T7 RiboMAX™ kit (Promega) according to the manufacturer’s protocol. After the reaction, the DNA template was digested with RNase-free DNase followed by phenol:chloroform extraction, precipitation and resuspension of the RNA pellet in nuclease-free water. RNA (1.8 µg) was resolved in a 3% agarose gel in TBE buffer and stained with ethidium bromide (FIG.4A), or RNA (0.9 µg) was digested with RNase A, resolved in a 3% agarose gel in TBE buffer and stained with ethidium bromide (FIG.4B). The presence of the in vitro transcribed SARS-CoV-2 N gene RNA is shown in FIG.4A and in FIG.4B when no RNase A was added to the reaction. Example 5: Circularization efficiency This example describes an assay to test the circularization efficiency of SARS-CoV-2 N gene padlock probes. Padlock probes N1-pad (SEQ ID NO: 1), N2-pad (SEQ ID NO: 3) and N3- pad (SEQ ID NO: 2) (10 pmol) were hybridized with equimolar RNA followed by a 1-hour ligation at 37°C with SplintR® DNA ligase. An aliquot (10 µl) of the ligation reaction was resolved in a 10% urea (8M) polyacrylamide gel followed by staining with ethidium bromide (FIG.5A). Circularization of the probes specifically occurred in a SARS-CoV-2 N RNA-dependent manner. Circular probes are indicated by the arrow in FIG.5A. The rest of the ligation reaction (10 µl) was digested with 1 µg of RNase A to remove template RNA (FIG.5B). Padlock probes N1 and N3 exhibited higher circularization efficiency than N2. Padlock probes for SARS-CoV-2 N gene: N1 pad /5PHOS/TGGGGTCCATTATCAATGTTGCCAACTCTAGGACCATCATGAACATCAGTG TACAGGACTTCTTAGCATTTCGCTGATTT (SEQ ID NO: 1) N3 pad /5PHOS/TCTCCATTCTGGTTAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGT ACAGGACTTCTTACGCGCCCCACTGCGT (SEQ ID NO: 2) N2 pad /5PHOS/ACCAAACGTAATGCGATGTTGCCAACTCTAGGACCATCATGAACATCAGTG TACAGGACTTCTTATGAATCTGAGGGTCC (SEQ ID NO: 3) Example 6: RNase H dose titration for optimal RNase H-assisted RCA This example describes RNase H dose titration for optimal RNase H-assisted RCA using the N1 padlock probe (SEQ ID NO: 1). Ten pmol of the N1 padlock probe was hybridized with equimolar RNA, followed by a 15 minute ligation at 37°C with SplintR® DNA ligase in a 10 µl reaction volume. Seven ligation reactions were performed. One reaction was run on a 10% urea polyacrylamide gel (FIG.6A). The other six ligation reactions were amplified using Bst 2.0 DNA polymerase in the presence of 0.01-5.0 units RNase H for 30 minutes at 65°C. The amplified products were resolved in a 0.8% agarose gel and stained with ethidium bromide (FIG.6B). RCA amplification was observed in the presence of all RNase H concentrations with an optimal concentration range of 0.1-1.0 unit. The greatest amplification was observed at 0.1 unit RNase H. Example 7: RADAR reporter and dipstick lateral flow assay To test the RNA reporter as well as dipstick lateral flow assay system, 20 pmol of reporter RNA (SEQ ID NO: 4) was digested either with 1 µg RNase A or 5 units RNase H in 1x RNase H buffer for 2 minutes at room temperature. The reaction volume was adjusted to 100 µl by Hybridirect assay buffer followed by placing the dipstick in the tube. The test line showed a positive signal in the presence of RNase A (probe digested), but not with RNase H (no digestion without complementary DNA) (FIG.7). Control probe (lane 1) also showed faint signal at the test line suggesting the probe is not 100% pure or contains fragmented reporter molecule that contributes to the background. HPLC-purified RADAR reporter can be used to eliminate any impurities. RADAR reporter: /5ʹ6-FAM/ArACrArUrCrArGrUrGrUrArCrArGrGrArCrUT/3ʹBiotin/ (SEQ ID NO: 4) Example 8: Optimization of RADAR and the lateral flow assay This example describes lateral flow assays to evaluate N1 padlock probe circularization and RNase H dose titration for optimal RNase H-assisted RCA. RADAR assays using 0.1, 1.0 and 10 pmol of RNA were performed. Ten pmol of the reporter was spiked in into the RNase H-assisted RCA reaction at the last 15 minutes of the 30-minute amplification reaction. Reporter cleavage was assayed by dipstick lateral flow. Ten pmol RNA showed significantly higher signal at the test line compared to no template or only reporter (FIG.8). Example 9: In-tube visual detection for RADAR assay This example describes a RADAR assay using a fluorometric detection method. An RNA fluorescence reporter molecule labelled with FAM at the 5ʹ end and Iowa Black® FQ quencher at the 3ʹ end was designed: FAM-AUCAUGAACAUCAGUGUACAGGAC-BKFQ (SEQ ID NO: 5) This reporter is referred to as FAM-RAD-FQ (see also FIG.9). The FAM-RAD-FQ reporter was designed against the conserved region of the padlock probes so that it does not interfere with target RNA recognition. FAM fluorescence in the intact reporter is quenched by the FQ quencher. Upon RCA amplification, the FAM-RAD-FQ reporter binds specifically with the amplified products to generate DNA-RNA (reporter) substrates for the RNase H enzyme, which is subsequently cleaved by RNase H to release the FAM fluorescence. The fluorescence reporter was tested in RADAR reactions in the presence of 1 pmol or 10 pmol SARS-CoV-2 N-RNA template. Higher fluorescence was observed in both RADAR reactions containing SARS-CoV-2 N-RNA, compared to no template control (NTC) reactions (FIG.10A). Endpoint fluorescence measurements of the reaction product also showed higher fluorescence of the positive reactions compared to the NTC control (FIG.10B). Example 10: Sequence-specificity of the padlock probe This example describes a study to evaluate the sequence specificity of the RADAR padlock probes. Padlock probes with a single nucleotide mutation (T to A) at either the 5ʹ end (SEQ ID NO: 6) or 3ʹ end (SEQ ID NO: 7) of the N1-padlock probe were designed (see also FIG.11A).

Assessment of RNA template dependent padlock probe circularization showed that N1 padlock probe circularization occurred in the presence of the cognate RNA template, but was disrupted by either a 5ʹ or 3ʹ single nucleotide mismatch on the probe (FIG.11B). Similarly, an in- tube fluorescence RADAR assay with the N1 and mutated N1 padlock probes showed specific fluorescence signal with the N1 probe, but was significantly diminished with either the 5ʹ or 3ʹ single nucleotide mismatch probe (FIG.11C). These data indicate that the RADAR assay is highly sequence-specific and sensitive to single nucleotide changes in the template RNA. This single nucleotide sensitivity can be leveraged for the identification of emerging variants of a virus (such as SARS-CoV-2) using the RADAR assay (see Example 12). Example 11: Enhanced sensitivity of the RADAR assay As described in the examples above, consistent detection of target RNA was observed with RADAR using 1 pmol or 10 pmol of RNA template. This example describes a modification of RADAR to enable detection of lower RNA template concentrations. To increase the sensitivity of the assay, an initiator primer (GGTCCTAGAGTTGGC; SEQ ID NO: 8) was incorporated into the RADAR reaction. Upon binding to the conserved complementary region of the padlock probes, the initiator primer initiates the rolling circle amplification reaction of the RNA template dependent circularized padlock probes (FIG.12A). Consistent with previous results, an in-tube fluorescence RADAR assay with padlock probes (without initiator primer) showed higher signal in the reaction with 1 pmol target RNA compared to NTC. However, inclusion of the initiator primer enabled in-tube fluorescence signal detection of 0.1 pmol RNA template (FIG.12B). These data indicate that inclusion of an initiator primer improves the sensitivity of RADAR by at least 10-fold. Example 12: Identification of single nucleotide mutations in the SARS-CoV-2 spike gene by RADAR This example describes the use of RADAR to detect single nucleotide variations in RNA templates. Mutation of the viral genome can lead to the emergence of variants, such as variants of SARS-CoV-2 (e.g., alpha, beta, gamma, and delta variants), which have important implications on the epidemiology of the disease. Several SARS-CoV-2 variants have been reported and classified according to their clinical implications. Whole genome or targeted genome sequencing of representative population level samples is the primary method for the identification and monitoring of new variants. However, there are currently no non-sequencing-based end-point diagnostic methods for the identification of SARS-CoV-2 variants. The results obtained when testing the single nucleotide mismatch sensitivity of RADAR by mutation of the padlock probe (Example 10, FIGS.11A-11C) indicated that the disclosed RADAR assay may permit one to distinguish variants of SAR-CoV-2. To test the capability of variant identification, mutations included on the “variants of concern” list generated by the CDC, which include the D614G, N501Y, L452R, and E488K mutations in the spike gene, were evaluated. To test the feasibility of detection of single nucleotide mutations, padlock probes and synthetic RNA templates with the variant sequences were designed. The padlock probe sequences for each variant (SEQ ID NOs: 9-13) and corresponding WT sequences (SEQ ID NOs: 14-17) are shown in the table below.

In-tube fluorescence RADAR assay showed that all padlock probes preferentially amplified their cognate variant templates. The D614 and E484K assays also showed reactivity over baseline against the WT template (FIGS.13A-13B). These data demonstrate that using mutation-specific padlock probes with the disclosed RADAR assay can specifically identify clinically relevant mutations in SARS-CoV-2. In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

CLAIMS 1. A method for detecting a target RNA in a sample, comprising: an annealing step, comprising contacting the sample in a reaction vessel with a single- stranded DNA (ssDNA) probe having a 5ʹ end complementary to a first region of the target RNA, a 3ʹ end complementary to a second region of the target RNA that is adjacent to the first region, and an internal region between the 5’ end and the 3’ end that is not complementary to the target RNA, wherein the 5ʹ and 3ʹ ends of the probe anneal to the target RNA present in the sample; a circularization step, comprising adding a DNA ligase to the reaction vessel to circularize the probe annealed to the target RNA by ligating the 5’ end to the 3’ end; an RNase H-assisted isothermal amplification step, comprising adding to the reaction vessel a mixture of deoxynucleotide triphosphates (dNTPs), a DNA polymerase, RNase H, and a single- stranded RNA reporter molecule comprising a sequence complementary to a first portion of the internal region of the probe and comprising at least one detectable label, wherein the RNase H cleaves (i) the target RNA hybridized to the probe, thereby priming isothermal rolling circle amplification of the probe, and (ii) the RNA of the reporter molecule hybridized to the rolling circle amplified probe, thereby releasing the detectable label; and a detection step, comprising detecting cleavage of the RNA reporter molecule, thereby detecting the target RNA in the sample.

2. The method of claim 1, wherein the 5ʹ end and 3ʹ end of the probe are each about 15 to about 30 nucleotides in length.

3. The method of claim 1 or claim 2, wherein the 5ʹ end and 3ʹ end of the probe are each about 15 nucleotides in length.

4. The method of any one of claims 1-3, wherein the internal region of the probe is about 40 to about 70 nucleotides in length.

5. The method of any one of claims 1-4, wherein the internal region of the probe is about 50 nucleotides in length.

6. The method of any one of claims 1-5, wherein the DNA ligase is Chlorella virus DNA ligase, T4 DNA ligase or T4 RNA ligase 2.

7. The method of any one of claims 1-6, wherein the DNA polymerase is Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Bsm DNA polymerase or Phi29 DNA polymerase.

8. The method of any one of claims 1-7, wherein the RNA reporter molecule is about 15 to about 30 nucleotides in length.

9. The method of any one of claims 1-8, wherein the RNA reporter molecule is about 20 nucleotides in length.

10. The method of any one of claims 1-9, wherein the detectable label comprises a fluorophore, an affinity tag, an enzyme substrate, a radioactive isotope, or one member of a specific binding pair.

11. The method of any one of claims 1-10, wherein the RNA reporter molecule comprises one or two detectable labels.

12. The method of claim 11, wherein the RNA reporter comprises a detectable label at its 5ʹ terminus and/or a detectable label at its 3ʹ terminus.

13. The method of claim 11 or claim 12, wherein the RNA reporter comprises two detectable labels and the detectable labels are 6-carboxyfluorescein (FAM) and biotin.

14. The method of claim 11 or claim 12, wherein the RNA reporter comprises two detectable labels and the detectable labels are FAM and a quencher.

15. The method of any one of claims 1-14, wherein the RNase H-assisted isothermal amplification step further comprises adding to the reaction vessel an initiator primer that specifically hybridizes to a second portion of the internal region of the probe, wherein the first portion and second portion of the internal region of the probe are non-overlapping.

16. The method of claim 15, wherein the initiator primer is about 15 nucleotides in length.

17. The method of claim 15 or claim 16, wherein the nucleotide sequence of the initiator primer comprises or consists of SEQ ID NO: 8.

18. The method of any one of claims 1-17, wherein the annealing step is performed at a temperature of about 65°C.

19. The method of any one of claims 1-18, wherein the circularization step is performed at a temperature of about 37°C.

20. The method of any one of claims 1-19, wherein the RNase H-assisted isothermal amplification step is performed at a temperature of about 65°C.

21. The method of any one of claims 1-20, wherein the detection step is performed using a lateral flow assay or a fluorometric assay.

22. The method of any one of claims 1-21, wherein the target RNA is viral RNA.

23. The method of claim 22, wherein the viral RNA is coronavirus RNA or influenza virus RNA.

24. The method of claim 23, wherein the coronavirus is a SARS-CoV-2.

25. The method of claim 24, wherein the target RNA is a SARS-CoV-2 N gene RNA or spike gene RNA.

26. The method of claim 24 or claim 25, wherein the nucleotide sequence of the probe comprises or consists of any one of SEQ ID NOs: 1, 2 and 9-17.

27. The method of any one of claims 24-26, wherein the nucleotide sequence of the RNA reporter comprises or consists of SEQ ID NO: 4 or SEQ ID NO: 5.

28. The method of any one of claims 1-21, wherein the target RNA is messenger RNA or non-coding RNA.

29. The method of any one of claims 1-28, wherein the sample is a nasopharyngeal, oropharyngeal, sputum, saliva, or blood sample.

30. The method of any one of claims 1-29, further comprising isolating RNA from the sample before the annealing step.

31. The method of any one of claims 1-30, wherein the reaction vessel comprises a microcentrifuge tube or a microwell plate.

32. A synthetic oligonucleotide, wherein the nucleotide sequence of the synthetic oligonucleotide comprises or consists of: TGGGGTCCATTATCAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAGCATTTCGCTGATTT (SEQ ID NO: 1); TCTCCATTCTGGTTAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGAC TTCTTACGCGCCCCACTGCGT (SEQ ID NO: 2); ArACrArUrCrArGrUrGrUrArCrArGrGrArCrUT (SEQ ID NO: 4); AUCAUGAACAUCAGUGUACAGGAC (SEQ ID NO: 5); GGTCCTAGAGTTGGC (SEQ ID NO: 8); CCCTGATAAAGAACAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTATCTGTGCAGTTAACA (SEQ ID NO: 9); AAGTGGGTTGGAAACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAGGTAACCAACACCAT (SEQ ID NO: 10); GGTAATTATAATTACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTATAAACAATCTATACC (SEQ ID NO: 11); TAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAAACAATTAAAACCTT (SEQ ID NO: 12); GAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAAACAATTAAAACCTT (SEQ ID NO: 13); TCCTGATAAAGAACAATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTATCTGTGCAGTTAACA (SEQ ID NO: 14); TAGTGGGTTGGAAACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAGGTAACCAACACCAT (SEQ ID NO: 15); GGTAATTATAATTACATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTATAAACAATCTATACA (SEQ ID NO: 16); or CAACACCATTACAAGATGTTGCCAACTCTAGGACCATCATGAACATCAGTGTACAGGA CTTCTTAAACAATTAAAACCTT (SEQ ID NO: 17).

33. The synthetic oligonucleotide of claim 32, comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and a detectable label at one or both the 5ʹ terminus and the 3ʹ terminus.

34. The synthetic oligonucleotide of claim 33, comprising a fluorophore at the 5ʹ terminus.

35. The synthetic oligonucleotide of claim 34, further comprising biotin or a quencher at the 3ʹ terminus.

36. A kit for detecting SARS-CoV-2 RNA, comprising: the synthetic oligonucleotide of any one of claims 32-35; and one or more of a DNA ligase, a DNA polymerase, RNase H, dNTPs and a lateral flow test strip.

37. The kit of claim 36, comprising: at least one synthetic oligonucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 1, 2 and 9-17; a synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, a fluorophore at the 5ʹ terminus, and biotin or a quencher at the 3ʹ terminus; lateral flow test strips capable of detecting the fluorophore and biotin; and a DNA ligase, a DNA polymerase, RNase H and dNTPs.

38. The kit of claim 36, comprising: at least one synthetic oligonucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 1, 2 and 9-17; a synthetic oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, a fluorophore at the 5ʹ terminus, and biotin or a quencher at the 3ʹ terminus; and a DNA ligase, a DNA polymerase, RNase H and dNTPs.

39. The kit of claim 37 or claim 38, comprising at least two, at least three, at least four, or at least five synthetic oligonucleotides, wherein each synthetic oligonucleotide has a different nucleotide sequence selected from any one of SEQ ID NOs: 1, 2 and 9-17.

40. The kit of any one of claims 37-39, further comprising a primer, wherein the nucleotide sequence of the primer comprises or consists of the nucleotide sequence of SEQ ID NO: 8.

41. The kit of any one of claims 36-40, further comprising one or more buffers, instructions, a reaction vessel, or any combination thereof.

42. The kit of any one of claims 36-41, wherein the DNA ligase is Chlorella virus DNA ligase and/or the DNA polymerase is Bst 2.0 DNA polymerase or Phi29 DNA polymerase.