WO2022055238A1 - Composition for treating bone diseases comprising epidural adipose mesenchymal stem cell-derived exosome - Google Patents

Composition for treating bone diseases comprising epidural adipose mesenchymal stem cell-derived exosome Download PDF

Info

Publication number
WO2022055238A1
WO2022055238A1 PCT/KR2021/012182 KR2021012182W WO2022055238A1 WO 2022055238 A1 WO2022055238 A1 WO 2022055238A1 KR 2021012182 W KR2021012182 W KR 2021012182W WO 2022055238 A1 WO2022055238 A1 WO 2022055238A1
Authority
WO
WIPO (PCT)
Prior art keywords
epidural
mesenchymal stem
bone
stem cell
derived
Prior art date
Application number
PCT/KR2021/012182
Other languages
French (fr)
Korean (ko)
Inventor
이근우
서민수
강경구
성수은
최주희
이시준
김길수
임주현
Original Assignee
주식회사 셀렉소바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210053062A external-priority patent/KR20220033403A/en
Application filed by 주식회사 셀렉소바이오 filed Critical 주식회사 셀렉소바이오
Publication of WO2022055238A1 publication Critical patent/WO2022055238A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2026—IL-4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2066—IL-10
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2086—IL-13 to IL-16
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating bone disease, comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • the present invention relates to a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • the present invention relates to a composition for treating, improving or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
  • AD-MSCs adipose tissue-derived mesenchymal stem cells
  • Adipose tissue-derived stem cells are generally used for regeneration studies using stem cells because they are easy to harvest and obtain sufficient amounts for research (Paschos and Sennett, 2017; Oberringer et al., 2018).
  • AD-MSCs are heterogeneous in shape depending on the location of the adipose tissue, and have different characteristics depending on the extraction process and the donor's physical condition (Reina et al., 2006).
  • the differentiated regeneration and differentiation ability of AD-MSCs was confirmed according to the location of the harvested adipose tissue.
  • subcutaneous fat was used in studies related to the prevention of arteriosclerosis, and in the case of visceral fat, insulin resistance and cardiovascular disease were confirmed. It is used in research related to diseases.
  • adipose stem cells Although adipose stem cells have the advantage of being easier to obtain compared to other sources as described above, they have many problems in actual clinical application or use.
  • the site from which adipose-derived mesenchymal stem cells are extracted should be considered very important.
  • adipose tissue it can be derived from various tissues in the human body, and even if mesenchymal stem cells are derived from such adipose tissue, their characteristics cannot be the same. That is, the extraction of mesenchymal stem cells from adipose tissue in a region where there is little mixing of xenogeneic cells while maintaining certain characteristics of the therapeutic agent can increase the possibility of use as a therapeutic agent.
  • mesenchymal stem cells have been known as a therapeutic method for patient treatment because of their direct anti-inflammatory and immunomodulatory abilities as well as their ability to differentiate into multiple lineages.
  • treatment using mesenchymal stem cells has recently shown a therapeutic effect by direct migration of mesenchymal stem cells to damaged cells or tissues, but rather several factors secreted by mesenchymal stem cells, namely, A number of therapeutic effects due to the paracrine effect have been confirmed, and the need for research and development related thereto is greatly raised.
  • osteoclasts cause the destruction and resorption of abnormal bone tissue due to imbalance with osteoblasts in the bone, and thereby, osteoporosis, in which bone mass and bone density decrease, and osteomalacia, in which lime is lost from the bone ), fibrous ostitis in which the bone marrow becomes fibrous, and rheumatoid arthritis, which causes joint destruction and deformation, are known to cause.
  • osteoclasts if the destruction and resorption of bone tissue by osteoclasts can be effectively inhibited, it is expected that various bone diseases can be treated. Accordingly, various drugs and treatments for osteoclasts are being actively studied. For example, in the treatment of bone damage caused by osteoclasts such as osteoporosis, bisphosphonates such as Fosamax (ingredient name: aledronate), Actonel (ingredient name: risedronate), Zometa (ingredient name: zoledronate), etc. Therapeutic agents are widely used. Most of these bisphosphonate agents act to delay or inhibit bone loss by weakening the function of osteoclasts that destroy bone and inducing the death of osteoclasts.
  • bisphosphonates such as Fosamax (ingredient name: aledronate), Actonel (ingredient name: risedronate), Zometa (ingredient name: zoledronate), etc.
  • Therapeutic agents are widely used. Most of these bisphosphonate agents act to delay or inhibit bone loss by weakening
  • the present inventors have confirmed that the epidural adipose mesenchymal stem cell-derived exosome has different characteristics from the exosome derived from other mesenchymal stem cells, and based on these characteristics, an excellent therapeutic effect on bone disease It was confirmed that the present invention was completed.
  • the inventors of the present invention confirmed that the exosomes derived from epidural adipose tissue-derived stem cells showed low expression of pro-inflammatory cytokines and chemokines, and increased expression of anti-inflammatory cytokines. In addition, it has a feature of containing a large amount of miRNA, which is known to have a low expression level in patients with bone disease, such as hsa-miR-122-5p. Accordingly, it was confirmed that the exosome according to the present invention has an excellent effect in the treatment of bone diseases and inflammatory diseases, and the present invention was completed.
  • a pharmaceutical composition for the prevention or treatment of bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • Another object of the present invention is to provide a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • Another object of the present invention is to provide a pharmaceutical composition for treating or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
  • Another object of the present invention is to provide a food composition for improving or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
  • the present invention provides a pharmaceutical composition for preventing or treating bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • Epidural adipose tissue is an anatomically adipose tissue that exists around the spinal cord, has less connective tissue compared to subcutaneous fat, and is a part that is hardly known except that it functionally facilitates movement during pendulum movement of the spinal cord.
  • epidural adipose mesenchymal stem cells refer to undifferentiated stem cells having the ability to differentiate into two or more new cells while having self-replicating ability derived from fat existing in the epidural space around the spinal cord. .
  • the epidural adipose mesenchymal stem cell according to the present invention is a control capable of extracting exosomes to be injected in that the epidural adipose tissue discarded after surgery can be recycled and the initial yield is very high compared to other stem cells.
  • the amount of medium can be freely adjusted.
  • the advantage can be emphasized in terms of being able to utilize it.
  • anti-inflammatory cytokines and hsa-miR-122-5p unlike exosomes derived from other mesenchymal stem cells, anti-inflammatory cytokines and hsa-miR-122-5p, such as hsa-miR-122-5p, exhibit high expression characteristics of high-relevant miRNAs. It may exhibit an excellent effect in terms of improvement and treatment of bone diseases.
  • the conditioned medium for epidural adipose mesenchymal stem cells includes those prepared through isolation, culture, and special manipulation from an individual, and exo that can be used as a pharmaceutical or food used for the purpose of treatment, diagnosis and prevention moth can be extracted.
  • epidural fat mesenchymal stem cells can be extracted from epidural fat according to a method known in the art.
  • the conditioned medium for epidural adipose mesenchymal stem cells may be a culture solution obtained after culturing the epidural adipose mesenchymal stem cells and removing the cells, a culture supernatant or a concentrate thereof, or a lyophilisate thereof.
  • Epidural adipose mesenchymal stem cells can be conventionally cultured using a stem cell culture medium.
  • the epidural adipose mesenchymal stem cell culture solution may be obtained by culturing epidural adipose mesenchymal stem cells obtained from epidural adipose tissue in serum or iron-free medium.
  • the conditioned medium for exosome extraction the supernatant obtained after removing stem cells and macromolecules by centrifugation or filtration using a filter may be used.
  • the obtained supernatant can be used as it is or used for exosome extraction as a concentrate obtained by concentration.
  • Culture medium and culture conditions for culturing epidural adipose mesenchymal stem cells are well known in the art to which the present invention pertains, and those of ordinary skill in the art may appropriately select or modify them.
  • exosome is a cell-derived vesicle that exists in eukaryotes and is released from the cell when multivesicular bodies (MVBs) fuse with the plasma membrane or are released directly from the plasma membrane. . Specifically, it refers to small vesicles with a membrane structure secreted from various cells. It was observed that exosomes originate in specific compartments within cells called multivesicular bodies (MVBs), rather than directly detach from the plasma membrane, and are released and secreted out of the cells in studies through electron microscopy. That is, when polycystic body and plasma membrane fusion occurs, vesicles are released into the extracellular environment, which is called exosomes.
  • MVBs multivesicular bodies
  • exosomes include red blood cells, B-lymphocytes, T-lymphocytes, dendritic cells, platelets, macrophages, and tumor cells. It is known that stem cells also produce and secrete exosomes in a living state.
  • the exosomes include those that are naturally secreted, or those that are artificially secreted.
  • the exosome according to the present invention is an exosome derived from epidural adipose mesenchymal stem cells.
  • the epidural adipose mesenchymal stem cell-derived exosome may have a diameter of 10 nm to 300 nm.
  • the exosome may preferably have a diameter of 40 nm to 200 nm, more preferably 50 nm to 150 nm.
  • the exosomes may be characterized in that they have a size of 40 to 200 nm, and the exosomes may be characterized in that they are positive for CD63 and CD81.
  • the exosome may be obtained using an exosome extraction method known in the art, but is not limited thereto, and may be obtained by an extraction method comprising, for example, the following steps:
  • TFF tangential flow filtration
  • ultracentrifugation size exclusion chromatography
  • exosome isolation kit consisting of the cell culture supernatant from which the cell residue is removed Obtaining an isolated and purified exosome using one selected from the group.
  • oxygen conditions are not limited thereto, but may be culture conditions in which normal oxygen concentration, that is, 21% oxygen (O 2 ) is supplied, or hypoxic cell sensitizer (hypoxic). cell sensitizer) may be a culture condition in which the cell culture medium is not added.
  • the general culture medium in step 1) any medium for cell culture commonly used in the art can be used, but is not limited thereto, DMEM (Dulbecco's modified eagle medium) medium, MEM (minimal essential medium) medium, Or it may be RPMI 1640 (Rosewell Park Memorial Institute 1640) medium.
  • DMEM Denbecco's modified eagle medium
  • MEM minimal essential medium
  • RPMI 1640 Rosewell Park Memorial Institute 1640
  • auxiliary components may be added to the cell culture medium as needed.
  • auxiliary components include serum from fetal calves, horses or humans, and penicillin G to prevent contamination of microorganisms.
  • antibiotics such as , streptomycin sulfate and gentamycin
  • antifungal agents such as amphotericin B and nystatin, and mixtures thereof You can use more than one.
  • the medium In the culture for extracting the exosomes from the epidural adipose mesenchymal stem cells, the medium is replaced with a serum-free, antibiotic-free, phenol red-free medium if necessary. And it may further include a culture. That is, after performing culturing in a normal culture medium, the medium may be exchanged with a serum-free medium, etc. to further perform culture, and then proceed to step 2).
  • the recovery of the culture supernatant in step 2) may be to recover the culture medium, that is, the conditioned medium.
  • the recovered cell culture supernatant contains cell residues and exosomes secreted from stem cells, and by centrifugation in step 3), the cell residue contained in the cell culture supernatant can be removed.
  • exosome isolation kit An isolated and purified exosome can be obtained by using one selected from
  • the exosome according to the present invention contains a large amount of hsa-miR-122-5p and the like, unlike exosomes derived from other mesenchymal stem cells. That is, the exosome of the pharmaceutical composition according to the present invention may include hsa-miR-122-5p.
  • the exosome according to the present invention contains a large amount of hsa-miR-122-5p, unlike exosomes derived from other mesenchymal stem cells, thereby exhibiting excellent properties of bone resorption inhibitory effect and bone improvement effect. It has been reported that low expression of hsa-miR-122-5p is found in the serum of patients with bone disease. However, the exosome according to the present invention can exhibit an excellent disease treatment effect through a high expression level of hsa-miR-122-5p above.
  • hsa-miR-122-5p has the nucleotide sequence of SEQ ID NO: 1: uggagugugacaaugguguuug
  • PPARG coactivator1 beta PPARGC1B
  • Transcription factor bindingto IGHM enhancer 3 Inhibition of TFE3
  • PPARG coactivator1 beta PPARGC1B
  • TFE3 transcription factor bindingto IGHM enhancer 3
  • Exosomes according to the present invention may contain a large amount of anti-inflammatory cytokines.
  • the exosome according to the present invention exhibits increased expression of IL-4 and IL-13, unlike other exosomes derived from mesenchymal stem cells, and thus has excellent bone resorption inhibitory effect, bone improvement effect and inflammation. The improvement effect can be achieved at the same time.
  • the exosome according to the present invention unlike exosomes of other derived mesenchymal stem cells, osteoclasts through low expression levels of VEGF (Vascular endothelial growth factor), MMP-9 (Matrix Metalloproteinase-9), MIP-1, and GRO By inhibiting cell formation, an excellent therapeutic effect can be exhibited.
  • VEGF Vascular endothelial growth factor
  • MMP-9 Microx Metalloproteinase-9
  • MIP-1 GRO
  • inflammatory factors such as IL-5 and GM-CSF (Granulocyte-macrophage colony-stimulating factor)
  • IL-5 and GM-CSF Granulocyte-macrophage colony-stimulating factor
  • the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteotitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis , avascular necrosis, periprosthetic osteolysis, metabolic bone disease, and may be any one or more selected from the group consisting of osteosclerosis.
  • the epidural adipose mesenchymal stem cell-derived exosomes express CD63 and CD81 to exhibit the characteristics of exosomes.
  • the exosome according to the present invention contains a large amount of IL-4 and/or IL-13, unlike other exosomes derived from mesenchymal stem cells.
  • the epidural adipose mesenchymal stem cell-derived exosomes exhibit a recovery effect on weight loss and/or bone loss in an animal model of bone disease.
  • osteoclast is a cell derived from a macrophage precursor, and the osteoclast precursor cells are macrophage colony stimulating factor (M-CSF), NF- ⁇ B It is differentiated into osteoclasts by receptor activator ligand (RANKL), etc., and means to form multinucleated osteoclasts through fusion.
  • M-CSF macrophage colony stimulating factor
  • RTKL receptor activator ligand
  • Osteoclasts bind to bone through ⁇ v ⁇ 3 integrin, etc. and create an acidic environment, while secreting various collagenases and proteases to cause bone resorption. Osteoclasts do not proliferate into fully differentiated cells and cause apoptosis at the end of their life span of about 2 weeks.
  • the epidural adipose mesenchymal stem cell-derived exosome is stable with low cytotoxicity, and exhibits an effect of inhibiting the differentiation of osteoclasts.
  • TRAP tarrate-resistant acid phosphate
  • osteoclast formation was inhibited by significantly inhibiting TRAP activity in a concentration-dependent manner.
  • the exosome according to the present invention reduces the activity of NFATc1, a transcription factor important for differentiation into osteoclasts, and reduces the expression of TRAP, Cathepsine K, and DC-STAMP involved in osteoclastogenesis. . In addition, it reduces the formation of F-actin ring, a morphological characteristic in the osteoclast differentiation process.
  • the epidural adipose mesenchymal stem cell-derived exosomes can exhibit an excellent therapeutic effect on the inflammatory response, particularly the inflammatory response incidentally occurring in bone disease.
  • the epidural adipose mesenchymal stem cell-derived exosomes reduce the expression of TNF- ⁇ , IL-6 and significantly increase the expression of IL-10 in the LPS-induced inflammation model. It shows an excellent anti-inflammatory effect.
  • osteoblast refers to a cell having the ability to calcify bone tissue by synthesizing and secreting bone matrix, and depositing inorganic salts such as Ca 2+ and Mg 2+ ions in the matrix. .
  • the treatment of exosomes according to the present invention to mouse monocytes differentiated into osteoblasts significantly activates the ALP activity in a concentration-dependent manner in the results of ALP (alkaline phosphatase) staining, which is a marker for osteoblast differentiation, thereby promoting osteoblast formation. do.
  • ALP alkaline phosphatase
  • composition of the present invention may be formulated in various formulations such as solutions, suspensions, emulsions, lotions, ointments, and freeze-drying agents according to conventional methods.
  • the pharmaceutical composition of the present invention may be formulated and administered in a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, and the preparation may be administered effectively by one or several administrations. includes the amount As a formulation suitable for this purpose, an injection, an injection, etc. are preferable as a formulation for parenteral administration.
  • the pharmaceutical composition for preventing or treating cancer may include a conventional pharmaceutically acceptable inert carrier and diluent.
  • Pharmaceutically acceptable carriers and diluents that may be included in the pharmaceutical composition of the present invention include excipients such as starch, sugar, and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, etc. , alginate, and binders such as polyvinyl pyrrolidone, lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, interfacial agents such as polysorbate, cetyl alcohol, and glycerol active agents, but are not limited thereto.
  • the pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the recipient to which it will be transplanted.
  • Diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.
  • preservatives, analgesics, solubilizers or stabilizers, etc. and in the case of formulations for topical administration, a base, excipients, lubricants or preservatives, etc. may be further included.
  • the compositions of the present invention may be used undisturbed or frozen for later use. If frozen, standard cryopreservatives (eg DMSO, glycerol, Epilife® Cell Freezing Medium (Cascade Biologics)) can be added to the cell population prior to freezing.
  • standard cryopreservatives eg DMSO, glycerol, Epilife® Cell Freezing Medium (Cascade Biologics
  • the administration may be administered using an administration method commonly used in the art, and preferably, direct administration to the diseased site of the patient in need of treatment is possible, but is not limited thereto.
  • the administration can be both non-surgical administration using a catheter and surgical administration methods such as injection after incision at the diseased site.
  • the dose may vary depending on the degree of concentration, but 10 ⁇ l/kg to 1 ml/kg of body weight may be administered once or divided into several doses.
  • exosomes are preferably included in the composition of the present invention in an amount of approximately 1 to 150 ⁇ g/ml, or 1 to 100 ⁇ g/ml.
  • the exosome may be administered, for example, by changing its dosage appropriately depending on the subject to be included and applied in the number of particles of 1 X 10 7 ⁇ 1 X 10 12 /ml. It should be understood that the actual dosage of the active ingredient should be determined in light of several related factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's weight, age, and sex, and therefore, the dosage may be It does not limit the scope of the present invention.
  • the present invention provides a method for treating bone disease, comprising administering an epidural adipose mesenchymal stem cell-derived exosome to a subject in need thereof.
  • the present invention provides a method for inhibiting bone loss comprising administering an epidural adipose mesenchymal stem cell-derived exosome to a subject in need thereof.
  • the subject refers to an animal, and typically may be a mammal that can exhibit a beneficial effect by treatment using the epidural adipose mesenchymal stem cell-derived exosome of the present invention.
  • Preferred examples of such subjects may include primates such as humans. Also, such subjects may include all subjects with or at risk of having symptoms of bone disease.
  • the present invention also provides the use of an epidural adipose mesenchymal stem cell-derived exosome in the manufacture of a medicament for the treatment of a bone disease.
  • the present invention also provides a composition comprising an epidural adipose mesenchymal stem cell-derived exosome for use in the treatment of a bone disease.
  • the present invention also provides the use of epidural adipose mesenchymal stem cell-derived exosomes for the treatment of bone diseases.
  • the present invention also provides a pharmaceutical composition for treating or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived stem cells.
  • the inflammatory disease may be, for example, an inflammatory disease occurring in the bone. Specifically, it may be a bone-related inflammatory disease such as osteoarthritis, osteochondritis, osteomyelitis, cystic fibrous osteotitis, gingivitis, densified osteomyelitis, and osteomyelitis.
  • a bone-related inflammatory disease such as osteoarthritis, osteochondritis, osteomyelitis, cystic fibrous osteotitis, gingivitis, densified osteomyelitis, and osteomyelitis.
  • the present invention provides a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
  • the present invention also provides a food composition for preventing or improving inflammatory diseases, including exosomes derived from epidural adipose tissue-derived stem cells.
  • the present invention can be generally used as a commonly used food product.
  • the food composition of the present invention can be used as a health functional food.
  • health functional food means a food manufactured and processed using raw materials or ingredients useful for the human body in accordance with the Health Functional Food Act, and "functionality” refers to the structure and function of the human body. It refers to ingestion for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological effects.
  • the food composition of the present invention may contain conventional food additives, and the suitability as the "food additive” is determined according to the general rules and general test methods of food additives approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the standards and standards related to the item.
  • Food Additives Code include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; Mixed preparations such as sodium L-glutamate preparation, noodle-added alkali agent, preservative agent, and tar color agent can be mentioned.
  • the food composition of the present invention may contain from 0.01 to 95% by weight of the epidural adipose mesenchymal stem cell-derived exosome, preferably from 5 to 90% by weight, based on the total weight of the composition.
  • the food composition of the present invention may be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing and/or improving cancer.
  • hard capsules can be prepared by filling a conventional hard capsule with a mixture of exosomes of epidural adipose mesenchymal stem cells according to the present invention, and additives such as excipients,
  • soft capsules can be prepared by filling a mixture with additives such as the food composition and excipients according to the present invention in a capsule base such as gelatin.
  • the soft capsule formulation may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.
  • the type of food is not particularly limited, and includes all health functional foods in the ordinary sense.
  • the present invention relates to a composition for the treatment, improvement or prevention of bone disease, inflammatory disease, etc., including an epidural adipose mesenchymal stem cell-derived exosome, wherein the exosome contains a large amount of anti-inflammatory factor cytokine, and osteoclast differentiation
  • a composition for the treatment, improvement or prevention of bone disease, inflammatory disease, etc. including an epidural adipose mesenchymal stem cell-derived exosome, wherein the exosome contains a large amount of anti-inflammatory factor cytokine, and osteoclast differentiation
  • Prevention, improvement or treatment of bone diseases, inflammatory diseases, etc. by containing a large amount of miRNA such as hsa-miR-122-5p that can be inhibited and containing or not containing factors that may be involved in osteoclast differentiation can be usefully used for
  • Figure 1a is an observation of the culture results of human skin epithelial cells and human epidural adipose stem cells.
  • Figure 1b shows the surface-specific antigen expression pattern of human epidural adipose stem cells (negative expression (CD14, CD34, CD45) and positive expression (CD73, CD90, CD105)).
  • Figure 2a confirms the morphology of the human skin epithelial cell-derived exosome and human epidural adipose stem cell-derived exosome.
  • Figure 2b confirms the positive expression of CD63 and CD81 in exosomes derived from human skin epithelial cells and human epidural adipose stem cells.
  • Figure 2c shows the size distribution, average diameter, and concentration measurement results of exosomes derived from human skin epithelial cells and human epidural adipose stem cells.
  • Figure 3 is a comparative analysis of the cytokine and chemokine expression patterns of human epidural adipose stem cell-derived exosomes (MSC EV) compared to human skin epithelial cell exosomes (DF EV) (*p-value ⁇ 0.05, ** ⁇ 0.001).
  • Figure 4a shows the results of human monocytic THP-1 cells differentiated into macrophages, treated with LPS and/or EV, and then observed under a microscope.
  • Figure 4b shows the quantification of TNF- ⁇ , IL-6 and IL-10 secretion levels following LPS and/or EV treatment of macrophages (* p-value ⁇ 0.05, *** ⁇ 0.0001, ns non-significant) .
  • FIG. 5 shows the results of confirming that the differentiation of RANKL-treated macrophages into osteoclasts is concentration-dependently inhibited by the treatment with exosomes according to the present invention through nuclear staining through the addition of TRAP chromogenic substrate.
  • FIG. 6 is a quantitative representation of the concentration-dependent inhibition of the differentiation of RANKL-treated macrophages into osteoclasts by the exosome treatment according to the present invention.
  • Human epidural adipose tissue-derived mesenchymal stem cells were obtained from human epidural adipose tissue. Briefly, epidural adipose tissue was isolated, washed with 70% ethanol (EtOH) and ice-cold PBS, and then treated with 0.45 ⁇ m-filtered collagenase type I 2 mg/mL (gibco) at 37 °C. Digested for 30 min in an incubator. Then, the digested solution was put into a 70 ⁇ m strainer, and the filtered solution was centrifuged at 3000 ⁇ g for 5 minutes.
  • EtOH 70% ethanol
  • PBS ice-cold PBS
  • the human dermal fibroblasts and human epidural AD-MSC Adipose-Derived Mesenchymal Stem Cell
  • 10% exosome-depleted FBS gibco
  • penicillin/streptomycin gibco
  • recombinant human FGF-basic 10ug/mL.
  • Peprotech 10 ug/mL recombinant human PDGF-BB
  • 25 ug/mL plasmocin InvivoGen
  • All cells were cultured at 37 °C and 5% CO 2 incubator conditions.
  • Example 1-2 Isolation of human dermal fibroblasts and human epidural AD-MSC exosomes
  • the culture medium of AD-MSCs grown in 175 T-flasks was collected after 48 hours of incubation.
  • the exosomes were purified in cell culture medium and cells were removed by centrifugation at 300 x g for 10 min.
  • the supernatant was then centrifuged again at 2500 x g for 25 min to remove cell debris and apoptosis.
  • the supernatant was ultracentrifuged at 100,000 x g for 120 min using a 90Ti rotor (Beckman Coulter). Discard the supernatant and resuspend the pellet in 200 ⁇ L of 0.22 ⁇ m filtered PBS.
  • Exosome protein concentration was measured with a Pierce TM BCA assay kit (Thermo Fisher science 23225).
  • Flow cytometry was performed using flow cytometry Galios (Beckman Coulter).
  • CD105 Bio-Rad, MCA1557), CD90 (BioLegend, 555596), CD73 (BioLegend, 344004), CD45 (BioLegend, 555482), CD34 (BioLegend, 343504) and CD14 (Bio-Rad) to determine expressed stem cell markers.
  • MCA1568 stained the cells with the same antibody.
  • Antibodies were conjugated with FITC or PE fluorescent dyes.
  • exosome analysis 200 ⁇ L of isolated exosomes were incubated with 10 ⁇ L of aldehyde/sulfate-latex beads 4% w/v (ThermoFishcer Scientific) at room temperature for 15 minutes. A 1 mL volume of PBS (supplemented with 0.1% BSA) was then added to the exosome/bead mixture. Samples were spun overnight and incubated. Bead-coupled exosomes were pelleted by centrifugation at 2000 ⁇ g for 10 min and washed with 500 ⁇ L of PBS.
  • the pellet was resuspended in 50 ⁇ L of PBS containing antibodies CD9 (NOVUS, NBP1-28364), CD81 (NOVUS, NBP1-44859) for 1 h at 4 °C and all antibodies were conjugated with FITC fluorescent dye. Samples were washed with 500 ⁇ L of PBS and centrifuged at 2000 x g for 10 min. The pellet was then resuspended in 150 ⁇ L of PBS. Exosomes treated with 4 ⁇ m diameter beads were gated and analyzed.
  • Freshly isolated exosomes from human dermal fibroblasts and human epidural AD-MSC were resuspended in cold distilled water.
  • the exosome suspension was loaded onto a Pomba carbon coating grid (Ted Pella Inc.) and fixed in 2% paraformaldehyde for 10 minutes, then the solution was removed and the sample was dried.
  • the grid was observed by bioTEM (Hitachi HT7700).
  • NTA analysis was performed with a PMX120 (Particle Metrix) instrument according to the manufacturer's recommendations.
  • Cytokines were quantified in human dermal fibroblasts and human epidural AD-MSC exosome solutions using the Quantibody® Cytokine Array Kit (RayBiotech, QAH-CYT-1). Exosomal proteins were diluted to 300 ⁇ g/mL for each array and 100 ⁇ L of the total sample volume was loaded and performed according to the manufacturer's protocol. Signals were measured with a laser scanner equipped with a Cy3 wavelength (532 nm) from Innopsys Innoscan. Data analysis was quantified with Mapix version 7.2.0.
  • Example 1-7 LPS and EV Treatment for THP-1 Cells
  • Human THP-1 cells were differentiated into macrophages in 100 nM PMA (Sigma-Aldrich, Saint Louis, MO, USA) for 24 h. PMA of THP-1 cells was washed before LPS treatment. EVs derived from human dermal fibroblasts and EVs derived from human epidural fat MSCs (50 ⁇ g/mL) were added simultaneously with 1 ⁇ g/mL LPS (Sigma-Aldrich). As a control, THP-1 derived macrophages were cultured without LPS and EV or with 50 ⁇ g/mL of two cell-derived EVs.
  • Human epidural AD-MSCs were isolated from human epidural adipose tissue, and the isolated human epidural AD-MSCs had typical mesenchymal stem cell characteristics. Cells were attached to plastic culture plates, and the cell shape was long and thin, spindle-shaped, like that of dermal fibroblasts (see Fig. 1a). In addition, flow cytometry analysis confirmed that human epidural AD-MSCs showed positive cell surface marker expression for CD73, CD90 and CD105, and negative cell surface marker expression for CD14, CD34 and CD45 (see Fig. 1b). . Cells were subcultured 12 times for the proliferation of stem cells and isolation of exosomes. These results suggest that isolated human epidural AD-MSCs have typical characteristics of mesenchymal stem cells.
  • exosome membrane was composed of a lipid bilayer, and dark and thick exosome membranes were observed by TEM (see Fig. 2a).
  • Exosomes made from multivesicular bodies (MVBs) have several biomarkers such as tetraspanins, fusion proteins, and MVB biogenesis markers.
  • tetraspanins such as CD9, CD63 and CD81 were expressed in the exosome membrane.
  • tetraspanins CD63 and CD81 were detected using flow cytometry.
  • NTA data represent exosome size distribution and concentration.
  • 99.7% of isolated human dermal fibroblast-derived exosomes had an average size of 144.4 nm and a concentration of 1.06 x 10 10 particles/mL.
  • 99.1% of isolated human epidural AD-MSC-derived exosomes had a diameter of 142.8 nm and a concentration of 1.27 x 10 10 particles/mL (see Fig. 2c).
  • Cytokine and chemokine levels were compared between human dermal fibroblast-derived exosomes and human epidural AD-MSC-derived exosomes.
  • the protein concentration was adjusted to 300 ⁇ g/mL according to the cytokine array manual.
  • Pro-inflammatory factors such as GM-CSF, MIP-1 alpha, MMP-9, IL-5, GRO and VEGF were confirmed to have low expression levels in human epidural AD-MSC-derived exosomes.
  • the anti-inflammatory factors IL-4 and IL-13 were increased in exosomes derived from human epidural AD-MSC, and in particular, IL-13 expression was significantly increased (FIG. 3).
  • the exosome according to the present invention has a high secretion of anti-inflammatory-related cytokines while minimally expressing factors that can affect osteoclast or bone resorption.
  • THP-1 human monocytic leukemia cell line was used to determine if epidural adipose MSC-derived EVs induce anti-inflammatory effects.
  • THP-1 cells cultured without PMA were sufficiently proliferated, and PMA was added to THP-1 cells grown in culture plates.
  • THP-1 cells treated with PMA stopped proliferating, adhered to the bottom of the culture dish, and then differentiated into macrophage-like cells (Fig. 4a).
  • Lipopolysaccharides constitute the outer membrane of Gram-negative bacteria and are considered one of the most characterized pathogen-associated molecular patterns to interact with CD14/TLR4 and activate intracellular signaling.
  • Dermal fibroblasts and epidural adipose MSC-derived EVs treated with LPS were 68.55 ⁇ 49.92 pg / mL and 53.64 ⁇ 33.20 pg / mL, respectively, indicating a significant decrease in TNF- ⁇ production.
  • the cytokine IL-6 was not produced. However, IL-6 production was increased in the LPS-treated group (1489.39 ⁇ 121.92 pg/mL). Moreover, LPS-treated dermal fibroblast-derived EVs increased IL-6 production levels (1321.79 ⁇ 203.60 pg/mL). However, simultaneous treatment of LPS and epidural MSC-derived EVs significantly blocked IL-6 production (167.78 ⁇ 7.69 pg/mL).
  • IL-10 production was confirmed as 406.96 ⁇ 67.94 pg/mL. This is an increased value compared to the case where only LPS (77.49 ⁇ 15.80 pg / mL) and LPS and dermal fibroblast EV (133.23 ⁇ 15.80 pg / mL) were treated.
  • the exosome according to the present invention has an excellent effect in inhibiting the inflammatory reaction.
  • Example 6-1 Evaluation of inhibition of osteoclast differentiation of epidural AD-MSC-derived exosomes (TRAP staining)
  • Mouse macrophages were cultured in a 12 well plate at a density of 2x10 5 /well for 24 h, and exosomes (1, 10, 100*10 8 particles/ml) were cultured in a medium supplemented with FBS, 1% PS, and M-CSF. treated for 2 hours. Then, RANKL was treated and reacted for 24 hours. It was differentiated for 4 days in the same way as above. When macrophages are treated with RANKL, they bind to RANK and differentiate into TRAP-positive cells. After that, the nucleus was stained by adding a chromogenic substrate to Tartrate resistance acid phosphatase (TRAP), a cytochemical marker enzyme of osteoclasts. Cells with three or more nuclei were observed, imaged and quantified.
  • TRAP Tartrate resistance acid phosphatase
  • Example 6-2 Evaluation of gene expression inhibition for osteoclast differentiation of exosomes derived from human epidural AD-MSC (Real-time PCR)
  • Mouse macrophages were treated with RANKL, gene expression for TRAP, Cathepsin K, DC-STAMP, and NFATc1, which are genes related to osteoclast differentiation, was confirmed through real-time PCR.
  • Mouse macrophages were cultured for 24 hours in a medium supplemented with 10% FBS, 1% PS and M-CSF at a density of 2x10 5 /well in a 12 well plate, then replaced with a medium of the same composition and exosomes (100*10 8 particles/ml) was treated for 2 hours. Then, RANKL was treated and reacted for 24 hours.
  • RNA was isolated using TRIzol (Thermo Fisher) solution, and cDNA was synthesized using RT premix based on the RNA quantification value.
  • the synthesized cDNA was amplified through real-time PCR using primers.
  • the primers used were mouse TRAP, Cathesin K, DC-STAMP, and NFATc1 (Table 1), and the relative amounts were compared with the control gene beta-actin.
  • TRAP-positive multinucleated osteoclasts When macrophages are treated with RANKL, they bind to RANK and differentiate into TRAP-positive multinucleated osteoclasts. It also activates NFATc1, a transcription factor important for differentiation into osteoclasts, and increases the expression of TRAP, Cathepsine K, and DC-STAMP, which are involved in osteoclastogenesis.
  • Example 6-3 Evaluation of the regulation of F-actin ring formation formation for osteoclast differentiation of exosomes derived from human epidural AD-MSC (F-actin ring staining)
  • Mouse macrophages were cultured for 24 h in a medium supplemented with 10% FBS, 1% PS and M-CSF at a density of 2x10 5 /well in a 12 well plate, and then replaced with a medium of the same composition and exosomes (100*10 8 particles) /ml) was treated for 2 hours. Then, RANKL was treated and reacted for 24 hours. When macrophages are treated with RANKL, an F-actin ring, a morphological characteristic, is formed in the osteoclast differentiation process. Then, f-actin, a cytoskeletal marker, and nucleus (DAPI) were stained with alexa phalloidin, and fluorescence imaging was performed.
  • next-generation sequencing was performed, and the results were confirmed in comparison with exosomes derived from skin fibroblasts, and their ratios were also indicated.
  • hsa-miR-122-5P was expressed the most.
  • Such hsa-miR-122-5P is highly correlated with osteoclast differentiation, and its expression is known to be significantly low in patients with bone disease. Accordingly, it was confirmed that the exosome according to the present invention exhibits an excellent effect in inhibiting the differentiation of osteoclasts by containing a large amount of the above miRNA.
  • the putative miR-122-5p target sequence was predicted using the database DAVID Bioinformatics Resources 6.8.
  • PPARG coactivator1 beta PPARGC1B
  • transcription factor bindingto IGHM enhancer 3 TFE3
  • PPARG coactivator1 beta and transcription factor bindingto IGHM enhancer 3 TFE3 are known to be genes positively regulating osteoclast differentiation, and through their inhibition, excellent bone disease treatment effects were confirmed.
  • mice C57BL/6 female mice were bred in plastic cages in an environment set at 22 ⁇ 2° C. and 50 ⁇ 10% relative humidity, and a 12-hour light-dark cycle. Mice were acclimatized to breeding conditions for about 1 week in the same environment before ovariectomy.
  • the surgical site of the ovary was removed and disinfected. After making an incision of about 1 cm in the skin, the ovaries were checked along the uterus, taking care not to injure other organs, and the ovaries were ligated with a suture thread, and then both ovaries were excised. After ovarian resection, each organ is repositioned into the abdominal cavity and sutured with a suture thread. After 10 days, the exosome according to the present invention was administered as a therapeutic material for 8 weeks.
  • the experimental group was set up as follows.
  • Non-ovarian control group (sham), 10 animals, PBS (control group) administration
  • OX Ovariectomy test group
  • PBS control group
  • the epidural adipose mesenchymal stem cell-derived exosomes according to the present invention have excellent osteoclast inhibitory effects and bone resorption inhibitory effects.
  • it was also confirmed that it can have a dual effect in bone diseases and inflammatory diseases (especially osteo-inflammatory diseases) by having additionally excellent inflammation inhibition.
  • the exosome according to the present invention can be used as a therapeutic agent for bone diseases and/or inflammatory diseases.

Abstract

The present invention relates to a composition for preventing, ameliorating, or treating bone diseases, comprising an epidural adipose mesenchymal stem cell-derived exosome. The composition of the present invention contains a large amount of anti-inflammatory factors, that is, cytokines, and contains a low amount or no factors that may be involved in the differentiation of osteoclasts, and thus can be effectively used for preventing, ameliorating, or treating bone diseases, inflammatory diseases, and the like.

Description

경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 치료용 조성물Composition for treating bone disease comprising exosomes derived from epidural fat mesenchymal stem cells
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 치료용 약학 조성물에 관한 것이다. The present invention relates to a pharmaceutical composition for preventing or treating bone disease, comprising an epidural adipose mesenchymal stem cell-derived exosome.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 개선용 식품 조성물에 관한 것이다. The present invention relates to a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
본 발명은 경막외지방조직 유래 중간엽 줄기세포로부터 유래한 엑소좀을 포함하는, 염증성 질환 치료, 개선 또는 예방용 조성물 등에 관한 것이다.The present invention relates to a composition for treating, improving or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
성체줄기세포 중 가장 얻기 쉽고 풍부한 양을 얻을 수 있는 방법은 지방조직에서 유래하는 지방 줄기 세포를 분리하는 것이며, 이를 지방 유래 중간엽 줄기세포(adipose tissue-derived mesenchymal stem cell, AD-MSCs)라고 한다. Among adult stem cells, the easiest and most abundant method to obtain abundant amounts is to isolate adipose stem cells derived from adipose tissue, which are called adipose tissue-derived mesenchymal stem cells (AD-MSCs). .
지방 조직 유래 줄기세포는 일반적으로 조직을 채취하기가 쉬우며, 연구에 충분한 양을 얻을 수 있어 줄기 세포를 이용한 재생 연구에 널리 이용되고 있다(Paschos and Sennett, 2017; Oberringer et al., 2018). 다만, AD-MSCs는 지방 조직이 존재하는 위치에 따라 형태가 이질적이고, 추출하는 과정, 공여자의 신체조건 등에 따라 다른 특성을 지니고 있는 것으로 알려져 있다(Reina et al., 2006). 특히, 채취된 지방 조직의 위치에 따라 AD-MSCs의 차별화된 재생 및 분화 능력이 확인되었으며, 예를 들어 피하 지방의 경우 동맥 경화의 예방과 관련된 연구에 이용되고, 내장 지방의 경우 인슐린 저항성 및 심혈관 질환과 연관된 연구에 이용되고 있다.Adipose tissue-derived stem cells are generally used for regeneration studies using stem cells because they are easy to harvest and obtain sufficient amounts for research (Paschos and Sennett, 2017; Oberringer et al., 2018). However, it is known that AD-MSCs are heterogeneous in shape depending on the location of the adipose tissue, and have different characteristics depending on the extraction process and the donor's physical condition (Reina et al., 2006). In particular, the differentiated regeneration and differentiation ability of AD-MSCs was confirmed according to the location of the harvested adipose tissue. For example, subcutaneous fat was used in studies related to the prevention of arteriosclerosis, and in the case of visceral fat, insulin resistance and cardiovascular disease were confirmed. It is used in research related to diseases.
지방 줄기 세포는 위와 같이 타 유래에 비해 얻기 쉬운 장점이 있지만, 실제 임상적 적용이나 사용에 있어서는 많은 문제점을 가진다. 지방줄기세포의 배양을 개시하기 위해 지방 유래 SVF 세포의 bulk culture를 이용한다는 점, 이종세포의 혼합물임에도 불구하고, 이 세포들 중 작은 비율만이 계속해서 플라스틱 배양접시에 부착하고 증식한다는 점, 지방 줄기 세포를 포함하고 있기는 하지만 그것만으로 구성되지는 않은 혼합 세포군이 사용되었을 가능성이 높다는 점과 같이, 실제 임상적 적용이나 사용 상에서의 필요 요건을 만족하지 못하는 문제점이 있다. Although adipose stem cells have the advantage of being easier to obtain compared to other sources as described above, they have many problems in actual clinical application or use. The use of bulk culture of adipose-derived SVF cells to initiate the culture of adipose stem cells, the fact that, despite a mixture of xenogeneic cells, only a small proportion of these cells continue to attach to and proliferate in plastic Petri dishes, adipose There is a problem in that it does not satisfy the requirements for actual clinical application or use, such as that it is highly likely that a mixed cell group that contains stem cells but does not consist of them alone is used.
이러한 문제점을 해결하기 위해서, 우선 지방 유래 중간엽 줄기세포가 추출되는 부위가 매우 중요하게 고려되어야 한다. 지방조직의 경우 인체 내 다양한 조직으로부터 유래될 수 있는데, 이러한 지방 조직으로부터 중간엽 줄기세포가 유래하였다고 하더라도 이들의 특성이 동일할 수는 없다. 즉, 치료제를 목적하는 일정한 특성을 유지하면서 이종세포의 혼합이 적은 부위의 지방 조직으로부터의 중간엽 줄기세포의 추출이 치료제로의 이용 가능성을 높일 수 있다. In order to solve this problem, first, the site from which adipose-derived mesenchymal stem cells are extracted should be considered very important. In the case of adipose tissue, it can be derived from various tissues in the human body, and even if mesenchymal stem cells are derived from such adipose tissue, their characteristics cannot be the same. That is, the extraction of mesenchymal stem cells from adipose tissue in a region where there is little mixing of xenogeneic cells while maintaining certain characteristics of the therapeutic agent can increase the possibility of use as a therapeutic agent.
한편, 중간엽 줄기세포는 직접적인 항염증능, 면역조절능 뿐만 아니라 다계통으로의 분화능 때문에 환자 치료를 위한 치료방법으로 알려져 왔다. 그러나, 여러 연구들에 의하면, 중간엽줄기세포를 이용한 치료는 손상된 세포나 조직에 중간엽줄기세포가 직접 이동하여 치료 효과를 보이는 것 보다는, 최근 들어 중간엽줄기세포에서 분비하는 여러 인자들 즉, 주변 분비 효과(paracrine effect)에 의한 치료 효과가 다수 확인되고 이와 관련된 연구 개발의 필요성이 크게 대두되고 있다. Meanwhile, mesenchymal stem cells have been known as a therapeutic method for patient treatment because of their direct anti-inflammatory and immunomodulatory abilities as well as their ability to differentiate into multiple lineages. However, according to several studies, treatment using mesenchymal stem cells has recently shown a therapeutic effect by direct migration of mesenchymal stem cells to damaged cells or tissues, but rather several factors secreted by mesenchymal stem cells, namely, A number of therapeutic effects due to the paracrine effect have been confirmed, and the need for research and development related thereto is greatly raised.
이에 따라, 다양한 세포 또는 기관 유래의 엑소좀에 대한 새로운 특성을 연구하고자 하는 연구 개발이 다수 진행되고 있으나, 특정 질환에 대해 적합하게 고려될 수 있는 우수한 엑소좀을 도출하는 것은 매우 어려운 것으로 고려되고 있다. Accordingly, a number of research and development to study the new characteristics of exosomes derived from various cells or organs are in progress, but it is considered very difficult to derive excellent exosomes that can be considered suitable for specific diseases. .
한편, 파골세포는 골 내에서 조골세포와의 불균형으로 인하여 비정상적인 골 조직의 파괴 및 흡수를 유발하고 이로 인하여, 골의 질량 및 골밀도가 감소하는 골다공증(osteoporosis), 뼈에서 석회가 탈실되는 골연화증 (osteomalacia), 골수가 섬유화되는 섬유성골염(fibrous ostitis), 관절의 파괴 및 변형을 초래하는 류마티스 관절염(rheumatoid arthritis) 등의 원인이 되는것으로 알려져 있다.On the other hand, osteoclasts cause the destruction and resorption of abnormal bone tissue due to imbalance with osteoblasts in the bone, and thereby, osteoporosis, in which bone mass and bone density decrease, and osteomalacia, in which lime is lost from the bone ), fibrous ostitis in which the bone marrow becomes fibrous, and rheumatoid arthritis, which causes joint destruction and deformation, are known to cause.
따라서 파골세포에 의한 골 조직의 파괴 및 흡수를 효과적으로 억제할 수 있다면, 이로 인한 다양한 골 질환을 치료할 수 있을 것이라 예상되며, 이에 따라 파골세포에 대한 다양한 약물들과 치료법들이 활발히 연구되고 있다. 예를 들어, 골다공증과 같은 파골세포에 의한 골 손상 치료에 포사맥스(Fosamax, 성분명: aledronate), 악토넬(Actonel, 성분명: risedronate), 조메타(Zometa, 성분명: zoledronate) 등과 같은 비스포스포네이트 (bisphosphonate) 계열의 치료제가 널리 이용되고 있다. 이러한 비스포스포네이트 제제들은 대부분 뼈를 파괴하는 파골세포의 기능을 약화시키고 파골세포의 사멸을 유도해 뼈의 손실을 지연시키거나 억제하는 작용을 한다. Therefore, if the destruction and resorption of bone tissue by osteoclasts can be effectively inhibited, it is expected that various bone diseases can be treated. Accordingly, various drugs and treatments for osteoclasts are being actively studied. For example, in the treatment of bone damage caused by osteoclasts such as osteoporosis, bisphosphonates such as Fosamax (ingredient name: aledronate), Actonel (ingredient name: risedronate), Zometa (ingredient name: zoledronate), etc. Therapeutic agents are widely used. Most of these bisphosphonate agents act to delay or inhibit bone loss by weakening the function of osteoclasts that destroy bone and inducing the death of osteoclasts.
그러나 비스포스포네이트 계열의 약제들을 복용하는 환자들에게서 턱뼈 괴사(osteonecrosis), 중증 심방 세동, 뼈 또는 관절의 무력화, 근골격의 통증 등 다양한 부작용이 발생하는 사례가 해마다 증가하고 있다. 또한 유방암, 전립선암 등에서 뼈로 전이된 암세포에 의해서도 파골세포의 형성이 촉진되어 심각한 골 질환들이 발생하는데 이를 치료하기 위한 약물은 개발되어 있지 않은 실정이다.However, the incidence of various side effects such as osteonecrosis, severe atrial fibrillation, incapacity of bones or joints, and musculoskeletal pain in patients taking bisphosphonate drugs is increasing every year. In addition, the formation of osteoclasts is promoted by cancer cells that have metastasized to bone in breast cancer, prostate cancer, etc., and serious bone diseases occur, but drugs for treating them have not been developed.
이와 같이, 기존의 제제들의 단점을 보완하고, 독성이 없으며, 파골세포에 의한 골 흡수를 효과적으로 억제할 수 있는 약제들의 개발이 요구되고 있는 실정이다.As described above, there is a need for development of drugs capable of supplementing the disadvantages of existing agents, having no toxicity, and effectively inhibiting bone resorption by osteoclasts.
이러한 배경하에, 본 발명자들은 경막외 지방 중간엽 줄기세포 유래 엑소좀이 타 유래 중간엽 줄기세포로부터 유래되는 엑소좀과 다른 특성을 가짐을 확인하였고, 이러한 특성을 기초로 골 질환에 대해 우수한 치료 효과를 나타냄을 확인하고 본 발명을 완성하였다. Under this background, the present inventors have confirmed that the epidural adipose mesenchymal stem cell-derived exosome has different characteristics from the exosome derived from other mesenchymal stem cells, and based on these characteristics, an excellent therapeutic effect on bone disease It was confirmed that the present invention was completed.
본 발명의 발명자들은 경막외 지방 조직 유래 줄기 세포에서 유래한 엑소좀이 전 염증성 사이토카인 및 케모카인 발현을 낮게 발현하고, 항염증성 사이토카인 발현은 증가되어 있음을 확인하였다. 또한, hsa-miR-122-5p와 같이 골질환 환자에서 발현 수준이 낮은 것으로 알려져 있는 miRNA를 다량 함유하는 특징을 가진다. 이에 따라 본 발명에 따른 엑소좀이 골질환, 염증성 질환의 치료에 우수한 효과가 있음을 확인하고 본 발명을 완성하였다. The inventors of the present invention confirmed that the exosomes derived from epidural adipose tissue-derived stem cells showed low expression of pro-inflammatory cytokines and chemokines, and increased expression of anti-inflammatory cytokines. In addition, it has a feature of containing a large amount of miRNA, which is known to have a low expression level in patients with bone disease, such as hsa-miR-122-5p. Accordingly, it was confirmed that the exosome according to the present invention has an excellent effect in the treatment of bone diseases and inflammatory diseases, and the present invention was completed.
이에 본 발명의 목적은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 치료용 약학 조성물을 제공하는 것이다. Accordingly, it is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
본 발명의 다른 목적은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 개선용 식품 조성물을 제공하는 것이다. Another object of the present invention is to provide a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
본 발명의 다른 목적은 경막외지방조직 유래 중간엽 줄기세포로부터 유래한 엑소좀을 포함하는, 염증성 질환 치료 또는 예방용 약학 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for treating or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
본 발명의 다른 목적은 경막외지방조직 유래 중간엽 줄기세포로부터 유래한 엑소좀을 포함하는, 염증성 질환 개선 또는 예방용 식품 조성물을 제공하는 것이다. Another object of the present invention is to provide a food composition for improving or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived mesenchymal stem cells.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 치료용 약학 조성물을 제공한다. The present invention provides a pharmaceutical composition for preventing or treating bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
경막 외 지방 조직이란 해부학적으로 척수 주위에 존재하는 지방조직으로, 피하지방에 비해 결합조직이 적고, 기능적으로 척수의 진자 운동시 운동을 원활하게 하는 점 이외에는 거의 알려져 있지 않은 부위이다. 본 발명에 있어서, 경막외 지방 중간엽 줄기세포란 척수 주위의 경막 외 공간에 존재하는 지방에서 유래된 자기 복제 능력을 가지면서 두 개 이상의 새로운 세포로 분화하는 능력을 가진 미분화된 줄기세포를 의미한다. Epidural adipose tissue is an anatomically adipose tissue that exists around the spinal cord, has less connective tissue compared to subcutaneous fat, and is a part that is hardly known except that it functionally facilitates movement during pendulum movement of the spinal cord. In the present invention, epidural adipose mesenchymal stem cells refer to undifferentiated stem cells having the ability to differentiate into two or more new cells while having self-replicating ability derived from fat existing in the epidural space around the spinal cord. .
본 발명에 따른 경막외 지방 중간엽 줄기세포는 타 유래 줄기세포와 대비하여 수술 후 버려지는 경막외 지방 조직의 재활용이 가능하고 초기 수득율이 매우 높다는 점에서 주입해야 하는 엑소좀을 추출할 수 있는 조정 배지의 양을 자유롭게 조절할 수 있다. 특히, spine 수술시 필수로 제거되어야 하는 지방 조직임에도 불구하고, 이를 활용할 수 있다는 측면에서 장점이 강조될 수 있다. The epidural adipose mesenchymal stem cell according to the present invention is a control capable of extracting exosomes to be injected in that the epidural adipose tissue discarded after surgery can be recycled and the initial yield is very high compared to other stem cells. The amount of medium can be freely adjusted. In particular, despite the fact that it is adipose tissue that must be removed during spine surgery, the advantage can be emphasized in terms of being able to utilize it.
또한, 타 유래 중간엽 줄기세포로부터 유래된 엑소좀과 달리 항염증성 사이토카인 및 hsa-miR-122-5p와 같은 파골세포 분화 억제에 효과와 관련성이 높은 miRNA를 높게 발현하는 특성을 나타내기 때문에, 골 질환의 개선 및 치료 측면에서 우수한 효과를 나타낼 수 있다. In addition, unlike exosomes derived from other mesenchymal stem cells, anti-inflammatory cytokines and hsa-miR-122-5p, such as hsa-miR-122-5p, exhibit high expression characteristics of high-relevant miRNAs. It may exhibit an excellent effect in terms of improvement and treatment of bone diseases.
본 발명에 있어서, 경막외 지방 중간엽 줄기세포의 조정 배지는 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 것을 포함하며, 치료, 진단 및 예방의 목적으로 사용되는 의약품 또는 식품으로 사용될 수 있는 엑소좀을 추출할 수 있다. In the present invention, the conditioned medium for epidural adipose mesenchymal stem cells includes those prepared through isolation, culture, and special manipulation from an individual, and exo that can be used as a pharmaceutical or food used for the purpose of treatment, diagnosis and prevention moth can be extracted.
본 발명에 있어서, 경막외 지방 중간엽 줄기세포는 당업계에 알려진 방법에 따라 경막외 지방으로부터 추출가능하다.In the present invention, epidural fat mesenchymal stem cells can be extracted from epidural fat according to a method known in the art.
경막외 지방 중간엽 줄기세포의 조정 배지는 경막외 지방 중간엽 줄기세포를 배양하고 세포를 제거한 후, 수득된 배양액, 배양 상층액 또는 이의 농축물이거나 이의 동결건조물일 수 있다.The conditioned medium for epidural adipose mesenchymal stem cells may be a culture solution obtained after culturing the epidural adipose mesenchymal stem cells and removing the cells, a culture supernatant or a concentrate thereof, or a lyophilisate thereof.
경막외 지방 중간엽 줄기세포는 줄기세포 배양용 배지를 사용하여 통상적으로 배양될 수 있다. 경막외 지방 중간엽 줄기세포 배양액은 경막외 지방 조직으로부터 수득된 경막외 지방 중간엽 줄기세포를 혈청 또는 무혈철 배지에서 배양하여 수득된 것일 수 있다. 엑소좀 추출을 위한 조정 배지는 이를 원심분리나 필터를 이용한 여과에 의해 줄기세포 및 거대분자를 제거한 후에 수득된 상층액을 사용할 수 있다. 또한, 수득된 상층액은 그대로 사용하거나 또는 농축하여 수득된 농축물로 엑소좀 추출에 사용할 수 있다. Epidural adipose mesenchymal stem cells can be conventionally cultured using a stem cell culture medium. The epidural adipose mesenchymal stem cell culture solution may be obtained by culturing epidural adipose mesenchymal stem cells obtained from epidural adipose tissue in serum or iron-free medium. As the conditioned medium for exosome extraction, the supernatant obtained after removing stem cells and macromolecules by centrifugation or filtration using a filter may be used. In addition, the obtained supernatant can be used as it is or used for exosome extraction as a concentrate obtained by concentration.
경막외 지방 중간엽 줄기세포의 배양을 위한 배양용 배지 및 배양 조건은 본 발명이 속하는 기술분야에서 잘 알려져 있으며, 통상의 지식을 가진 자가 적절하게 선택하거나 변형하여 이용할 수 있다.Culture medium and culture conditions for culturing epidural adipose mesenchymal stem cells are well known in the art to which the present invention pertains, and those of ordinary skill in the art may appropriately select or modify them.
본 발명에 있어서, "엑소좀(exosome)"이란 진핵생물에 존재하는 세포 유래 베시클(vesicle)이며 다중 소관체(multivesicular bodies, MVBs)가 원형질막과 융합되거나 원형질막에서 직접 방출될 때 세포로부터 방출된다. 구체적으로, 다양한 세포들로부터 분비되는 막 구조의 작은 소낭을 말한다. 엑소좀은 전자 현미경을 통한 연구에서 원형질막으로부터 직접 떨어져 나가는 것이 아니라 다낭체(multivesicular bodies, MVBs)라고 불리는 세포 내 특정 구획에서 기원하며 세포 밖으로 방출, 분비되는 것으로 관찰되었다. 즉, 다낭체와 원형질막의 융합이 일어나면, 소낭들은 세포 밖 환경으로 방출되는데, 이것을 엑소좀이라고 부른다. 이러한 엑소좀이 어떤 분자적 기작에 의해 만들어지는지 확실히 밝혀진 바가 없으나, 적혈구 세포뿐만 아니라, B-림프구, T-림프구, 수지상 세포, 혈소판, 대식 세포 등을 포함한 다양한 종류의 면역 세포들과 종양포, 줄기세포 등도 살아 있는 상태에서 엑소좀을 생산하여 분비한다고 알려져 있다. 상기 엑소좀은 자연적으로 분비된 것이거나, 혹은 인공적으로 분비된 것을 포함한다.In the present invention, "exosome" is a cell-derived vesicle that exists in eukaryotes and is released from the cell when multivesicular bodies (MVBs) fuse with the plasma membrane or are released directly from the plasma membrane. . Specifically, it refers to small vesicles with a membrane structure secreted from various cells. It was observed that exosomes originate in specific compartments within cells called multivesicular bodies (MVBs), rather than directly detach from the plasma membrane, and are released and secreted out of the cells in studies through electron microscopy. That is, when polycystic body and plasma membrane fusion occurs, vesicles are released into the extracellular environment, which is called exosomes. Although it is not clear by what molecular mechanism these exosomes are made, various types of immune cells including red blood cells, B-lymphocytes, T-lymphocytes, dendritic cells, platelets, macrophages, and tumor cells, It is known that stem cells also produce and secrete exosomes in a living state. The exosomes include those that are naturally secreted, or those that are artificially secreted.
본 발명에 따른 엑소좀은 경막외 지방 중간엽 줄기세포 유래의 엑소좀이다. The exosome according to the present invention is an exosome derived from epidural adipose mesenchymal stem cells.
본 발명에 있어서, 상기 경막외 지방 중간엽 줄기세포 유래의 엑소좀은 직경이 10 nm 내지 300 nm일 수 있다. 상기 엑소좀은 바람직하게는 직경이 40nm 내지 200nm, 더 바람직하게는 50 nm 내지 150nm일 수 있다. In the present invention, the epidural adipose mesenchymal stem cell-derived exosome may have a diameter of 10 nm to 300 nm. The exosome may preferably have a diameter of 40 nm to 200 nm, more preferably 50 nm to 150 nm.
상기 엑소좀(exosomes)은 40~200 nm 크기인 것을 특징으로 할 수 있고, 상기 엑소좀(exosomes)은 CD63 및 CD81 양성인 것을 특징으로 할 수 있다.The exosomes may be characterized in that they have a size of 40 to 200 nm, and the exosomes may be characterized in that they are positive for CD63 and CD81.
상기 엑소좀은 당업계에 알려진 엑소좀 추출 방법을 이용하여 수득할 수 있으며, 이에 제한되지는 않으나, 예를 들어 하기의 단계를 포함하는 추출 방법에 의하여 수득할 수 있다:The exosome may be obtained using an exosome extraction method known in the art, but is not limited thereto, and may be obtained by an extraction method comprising, for example, the following steps:
1) 경막외 지방 중간엽 줄기 세포를 배양하는 단계;1) culturing epidural adipose mesenchymal stem cells;
2) 상기 경막외 지방 중간엽 줄기 세포 배양 상층액을 회수하는 단계; 2) recovering the epidural adipose mesenchymal stem cell culture supernatant;
3) 상기 회수한 세포 배양 상층액을 원심분리하여 세포 잔여물을 제거하는 단계; 및 3) centrifuging the recovered cell culture supernatant to remove cell residues; and
4) 상기 세포 잔여물이 제거된 세포 배양 상층액을 TFF(tangential flow filtration), 초원심분리(ultracentrifugation), 크기배제 크로마토그래피(size exclusion chromatography), 및 엑소좀 분리 키트(exosome isolation kit)로 이루어진 군으로부터 선택된 하나를 이용하여 분리·정제된 엑소좀을 수득하는 단계.4) TFF (tangential flow filtration), ultracentrifugation, size exclusion chromatography, and exosome isolation kit consisting of the cell culture supernatant from which the cell residue is removed Obtaining an isolated and purified exosome using one selected from the group.
상기 경막외 지방 중간엽 줄기세포의 배양에 있어서 산소 조건은 이에 제한되지는 않으나, 정상 산소 농도, 즉 21%의 산소(O2)가 공급되는 배양 조건일 수 있으며, 또는 저산소 세포 감작제(hypoxic cell sensitizer)를 세포 배양 배지에 첨가하지 않은 배양 조건일 수 있다.In the culture of the epidural adipose mesenchymal stem cells, oxygen conditions are not limited thereto, but may be culture conditions in which normal oxygen concentration, that is, 21% oxygen (O 2 ) is supplied, or hypoxic cell sensitizer (hypoxic). cell sensitizer) may be a culture condition in which the cell culture medium is not added.
상기 단계 1) 에서 일반 배양 배지는, 당업계에 통상적으로 사용되는 세포 배양용 배지는 모두 사용 가능하며, 이에 제한되지는 않으나, DMEM(Dulbecco's modified eagle medium) 배지, MEM(minimal essential medium)배지, 또는 RPMI 1640(Rosewell Park Memorial Institute 1640) 배지일 수 있다.The general culture medium in step 1), any medium for cell culture commonly used in the art can be used, but is not limited thereto, DMEM (Dulbecco's modified eagle medium) medium, MEM (minimal essential medium) medium, Or it may be RPMI 1640 (Rosewell Park Memorial Institute 1640) medium.
또한, 상기 세포 배양 배지에는 필요에 따라 한 가지 이상의 보조성분을 첨가할 수 있는데, 이러한 보조성분으로는 태아 송아지, 말 또는 사람 등의 혈청을 비롯하여, 미생물의 오염을 막기 위한 페니실린 G(penicilli G), 스트렙토마이신 설페이트(sterptomycin sulfate) 및 젠타마이신(gentamycin) 등의 항생제, 암포테리신 B(amphotericin B) 및 니스타틴(nystatin) 등의 항진균제(antifungal agent) 및 이들의 혼합물로 이루어진 군에서 선택된 성분 중 하나 이상을 사용할 수 있다. In addition, one or more auxiliary components may be added to the cell culture medium as needed. Such auxiliary components include serum from fetal calves, horses or humans, and penicillin G to prevent contamination of microorganisms. Among the components selected from the group consisting of antibiotics such as , streptomycin sulfate and gentamycin, antifungal agents such as amphotericin B and nystatin, and mixtures thereof You can use more than one.
상기 경막외 지방 중간엽 줄기세포로부터 엑소좀을 추출을 위한 배양에 있어서는 필요에 따라 무혈청(serum-free), 무항생제(antibiotic-free), 무페놀레드(phenol red-free)인 배지로 교체 및 배양을 추가로 더 포함할 수 있다. 즉 일반 배양 배지에서 배양을 수행한 후 무혈청 배지 등으로 배지를 교환하여 배양을 추가로 수행한 후에 단계 2)를 진행하는 것일 수 있다. In the culture for extracting the exosomes from the epidural adipose mesenchymal stem cells, the medium is replaced with a serum-free, antibiotic-free, phenol red-free medium if necessary. And it may further include a culture. That is, after performing culturing in a normal culture medium, the medium may be exchanged with a serum-free medium, etc. to further perform culture, and then proceed to step 2).
상기 단계 2)의 배양 상층액의 회수는 배양 배지, 즉 조건 배지를 회수하는 것일 수 있다. 회수한 세포 배양 상층액에는 세포 잔여물 및 줄기세포로부터 분비된 엑소좀이 포함되어 있으며, 상기 단계 3)에서 원심분리함에 따라 세포 배양 상층액에 포함되어 있는 세포 잔여물을 제거할 수 있다.The recovery of the culture supernatant in step 2) may be to recover the culture medium, that is, the conditioned medium. The recovered cell culture supernatant contains cell residues and exosomes secreted from stem cells, and by centrifugation in step 3), the cell residue contained in the cell culture supernatant can be removed.
이러한 세포 잔여물을 제거한 후에, 세포 배양 상층액을 TFF(tangential flow filtration), 초원심분리(ultracentrifugation), 크기배제 크로마토그래피(size exclusion chromatography), 및 엑소좀 분리 키트(exosome isolation kit)로 이루어진 군으로부터 선택된 하나를 이용하여 분리·정제된 엑소좀을 수득할 수 있다. After removing these cell residues, the cell culture supernatant was subjected to tangential flow filtration (TFF), ultracentrifugation, size exclusion chromatography, and exosome isolation kit. An isolated and purified exosome can be obtained by using one selected from
본 발명에 따른 엑소좀은 다른 유래 중간엽 줄기세포의 엑소좀과 달리 hsa-miR-122-5p 등을 다량함유한다. 즉, 본 발명에 따른 약학 조성물의 엑소좀은 hsa-miR-122-5p을 포함하는 것일 수 있다. 본 발명에 따른 엑소좀은 다른 유래 중간엽 줄기세포의 엑소좀과 달리 hsa-miR-122-5p 를 다량 포함함으로써 골 흡수 억제 효과, 골 개선 효과의 우수한 특성을 나타낼 수 있다. 골질환 환자의 혈청에서는 hsa-miR-122-5p이 낮게 발현되는 것으로 보고되어 있다. 그런데, 본 발명에 따른 엑소좀은 위 hsa-miR-122-5p 의 높은 발현량을 통해서 우수한 질환 치료 효과를 나타낼 수 있다. The exosome according to the present invention contains a large amount of hsa-miR-122-5p and the like, unlike exosomes derived from other mesenchymal stem cells. That is, the exosome of the pharmaceutical composition according to the present invention may include hsa-miR-122-5p. The exosome according to the present invention contains a large amount of hsa-miR-122-5p, unlike exosomes derived from other mesenchymal stem cells, thereby exhibiting excellent properties of bone resorption inhibitory effect and bone improvement effect. It has been reported that low expression of hsa-miR-122-5p is found in the serum of patients with bone disease. However, the exosome according to the present invention can exhibit an excellent disease treatment effect through a high expression level of hsa-miR-122-5p above.
hsa-miR-122-5p는 서열번호 1의 염기서열을 가진다: uggagugugacaaugguguuughsa-miR-122-5p has the nucleotide sequence of SEQ ID NO: 1: uggagugugacaaugguguuug
DAVID 분석을 통해 골질환에 조절의 기초가 될 수 있는 분자 메커니즘을 추가로 탐색하여, 추정되는 miR-145-5p 표적 서열을 예측한 결과, PPARG coactivator1 beta (PPARGC1B) 및 Transcription factor bindingto IGHM enhancer 3(TFE3)를 억제하는 것이 위 표적 서열 예측 결과를 통해 확인된다. 이러한 PPARG coactivator1 beta (PPARGC1B) 및 Transcription factor bindingto IGHM enhancer 3(TFE3)는 파골 세포 분화를 양성 조절하는 유전자로 알려져 있는바, 이의 억제를 통해 우수한 골질환 치료 효과가 있다. As a result of predicting the putative miR-145-5p target sequence by further exploring the molecular mechanism underlying the regulation of bone disease through DAVID analysis, PPARG coactivator1 beta (PPARGC1B) and Transcription factor bindingto IGHM enhancer 3 ( Inhibition of TFE3) is confirmed through the above target sequence prediction results. These PPARG coactivator1 beta (PPARGC1B) and transcription factor bindingto IGHM enhancer 3 (TFE3) are known as genes that positively regulate osteoclast differentiation, and their inhibition has an excellent therapeutic effect on bone diseases.
본 발명에 따른 엑소좀은 항염증성 사이토카인을 다량으로 포함할 수 있다. 예를 들어, 본 발명에 따른 엑소좀은 다른 유래 중간엽 줄기세포의 엑소좀과 달리 IL-4, 및 IL-13의 발현이 증가된 특징을 나타내어, 우수한 골 흡수 억제 효과, 골 개선효과 및 염증 개선 효과를 동시에 달성할 수 있다. Exosomes according to the present invention may contain a large amount of anti-inflammatory cytokines. For example, the exosome according to the present invention exhibits increased expression of IL-4 and IL-13, unlike other exosomes derived from mesenchymal stem cells, and thus has excellent bone resorption inhibitory effect, bone improvement effect and inflammation. The improvement effect can be achieved at the same time.
또한, 본 발명에 따른 엑소좀은 다른 유래 중간엽 줄기세포의 엑소좀과 달리 VEGF(Vascular endothelial growth factor), MMP-9(Matrix Metalloproteinase-9), MIP-1, GRO의 낮은 발현량을 통해 파골세포 형성을 억제함으로써 우수한 치료 효과를 나타낼 수 있다. 상기 언급된 인자들은 골질환을 가진 환자 그룹에서 파골 세포의 분화를 촉진하거나 자극하는 것으로 알려져 있다. 이에 따라 골흡수 작용 등으로 골 질환의 발병, 진행 등에 관여하는 것이 알려져 있다. 따라서, 통상의 줄기세포에서 포함되는 위 인자들을 거의 포함하지 않는 본 발명에 따른 엑소좀은 골질환의 예방, 치료 및 개선의 측면에서 우수한 효과를 나타낼 수 있다. In addition, the exosome according to the present invention, unlike exosomes of other derived mesenchymal stem cells, osteoclasts through low expression levels of VEGF (Vascular endothelial growth factor), MMP-9 (Matrix Metalloproteinase-9), MIP-1, and GRO By inhibiting cell formation, an excellent therapeutic effect can be exhibited. The above-mentioned factors are known to promote or stimulate the differentiation of osteoclasts in a group of patients with bone disease. Accordingly, it is known that bone resorption is involved in the onset and progression of bone diseases. Therefore, the exosome according to the present invention, which hardly contains the above factors included in conventional stem cells, can exhibit excellent effects in terms of prevention, treatment and improvement of bone diseases.
또한, IL-5, GM-CSF(Granulocyte-macrophage colony-stimulating factor)와 같은 염증성 인자의 낮은 발현을 통해서 질환 부위에서의 골형성 뿐만 아니라 염증 개선 측면(특히, pro-inflammatory factors로 이의 최소화 또는 감소는 염증 반응을 개선할 수 있음)에서도 우수한 효과를 함께 발휘할 수 있다. In addition, through low expression of inflammatory factors such as IL-5 and GM-CSF (Granulocyte-macrophage colony-stimulating factor), bone formation at the disease site as well as inflammation improvement aspect (particularly, minimizing or reducing it with pro-inflammatory factors) can improve the inflammatory response) can exert an excellent effect together.
본 발명에 따르면, 골 질환은 치주염, 치조골 결손, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트병(paget's disease), 류마티스 관절염(rheumatoid arthritis), 무혈성괴사, 삽입물주위 골용해증 (Periprosthetic osteolysis), 대사성 골질환 및 골경화증으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다. According to the present invention, the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteotitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis , avascular necrosis, periprosthetic osteolysis, metabolic bone disease, and may be any one or more selected from the group consisting of osteosclerosis.
본 발명의 일실시양태에 따르면, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 CD63 및 CD81 발현하여 엑소좀의 특성을 나타낸다. According to one embodiment of the present invention, the epidural adipose mesenchymal stem cell-derived exosomes express CD63 and CD81 to exhibit the characteristics of exosomes.
본 발명에 따른 엑소좀은 다른 유래 중간엽 줄기세포의 엑소좀과 달리 IL-4 및/또는 IL-13을 다량으로 함유한다. The exosome according to the present invention contains a large amount of IL-4 and/or IL-13, unlike other exosomes derived from mesenchymal stem cells.
본 발명의 일실시양태에 따르면, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 골 질환 동물 모델에서 몸무게 감소 및/또는 골 손실에 대한 회복 효과를 나타낸다. According to one embodiment of the present invention, the epidural adipose mesenchymal stem cell-derived exosomes exhibit a recovery effect on weight loss and/or bone loss in an animal model of bone disease.
본 발명에서 용어, "파골세포(osteoclast)"는 대식 세포 전구체(macrophage precursor)로부터 파생되는 세포로서 파골세포 전구 세포들은 대식 세포 콜로니 자극 인자(macrophage colony stimulating factor, M-CSF), NF-κB의 수용체 활성 인자 리간드(RANKL) 등에 의해 파골세포로 분화되며 융합을 통해 다핵 파골세포(multinucleated osteoclast)를 형성하는 것을 의미한다. 파골세포는 αvβ3 인테그린(integrin) 등을 통해 골(bone)에 결합하며 산성 환경을 조성하는 한편 각종 콜라게네이즈(collagenase) 및 프로테아제(protease)를 분비하여 골 흡수(bone resorption)를 일으킨다. 파골세포는 완전히 분화된 세포로 증식하지 않으며 약 2주간의 수명이 다하면 세포 사멸(apoptosis)를 일으킨다.As used herein, the term "osteoclast" is a cell derived from a macrophage precursor, and the osteoclast precursor cells are macrophage colony stimulating factor (M-CSF), NF-κB It is differentiated into osteoclasts by receptor activator ligand (RANKL), etc., and means to form multinucleated osteoclasts through fusion. Osteoclasts bind to bone through αvβ3 integrin, etc. and create an acidic environment, while secreting various collagenases and proteases to cause bone resorption. Osteoclasts do not proliferate into fully differentiated cells and cause apoptosis at the end of their life span of about 2 weeks.
본 발명의 일실시양태에 따르면, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 세포 독성이 낮아 안정적이며, 파골 세포의 분화를 억제하는 효과를 나타낸다. 구체적으로, 파골세포 분화 표지 인자인 TRAP(tarrate-resistant acid phosphate) 염색을 실시한 결과, 농도 의존적으로 TRAP 활성을 현저하게 저해시킴으로써, 파골세포 형성을 억제함을 확인하였다. According to one embodiment of the present invention, the epidural adipose mesenchymal stem cell-derived exosome is stable with low cytotoxicity, and exhibits an effect of inhibiting the differentiation of osteoclasts. Specifically, as a result of staining with TRAP (tarrate-resistant acid phosphate), a marker for osteoclast differentiation, it was confirmed that osteoclast formation was inhibited by significantly inhibiting TRAP activity in a concentration-dependent manner.
보다 더 구체적으로, 본 발명에 따른 엑소좀은 파골세포로 분화하는데 중요한 전사 인자인 NFATc1의 활성을 감소시키고 파골세포 분화기전(osteoclastogenesis)에 관여하는 TRAP, Cathepsine K, DC-STAMP의 발현을 감소시킨다. 또한, 파골세포 분화과정에서 형태학적 특징인 F-actin ring의 형성을 감소시킨다. More specifically, the exosome according to the present invention reduces the activity of NFATc1, a transcription factor important for differentiation into osteoclasts, and reduces the expression of TRAP, Cathepsine K, and DC-STAMP involved in osteoclastogenesis. . In addition, it reduces the formation of F-actin ring, a morphological characteristic in the osteoclast differentiation process.
본 발명의 일실시양태에 따르면, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 염증 반응, 특히 골질환에 있어서 부수적으로 함께 발생하는 염증 반응에 대하여 우수한 치료 효과를 나타낼 수 있다. 구체적으로, 본 발명의 일실시양태에 따르면, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 LPS 유발 염증 모델에서 TNF-α, IL-6 의 발현을 감소시키고, IL-10의 발현을 크게 증가시킴으로써 우수한 염증 개선 효과를 나타낸다. According to an embodiment of the present invention, the epidural adipose mesenchymal stem cell-derived exosomes can exhibit an excellent therapeutic effect on the inflammatory response, particularly the inflammatory response incidentally occurring in bone disease. Specifically, according to one embodiment of the present invention, the epidural adipose mesenchymal stem cell-derived exosomes reduce the expression of TNF-α, IL-6 and significantly increase the expression of IL-10 in the LPS-induced inflammation model. It shows an excellent anti-inflammatory effect.
본 발명에서의 용어, "조골세포(osteoblast)"는 골기질을 합성, 분비하고, 기질에 Ca2+, Mg2+ 이온 등의 무기염을 침착시킴으로써 골조직을 석회화시키는 능력을 갖고 있는 세포를 의미한다. 조골세포로 분화한 마우스 단핵구 세포에 본 발명에 따른 엑소좀의 처리는 조골세포 분화 표지 인자인 ALP(alkaline phosphatase) 염색을 실시한 결과에서 농도 의존적으로 ALP 활성을 현저하게 활성시킴으로써, 조골세포 형성을 촉진한다. As used herein, the term "osteoblast" refers to a cell having the ability to calcify bone tissue by synthesizing and secreting bone matrix, and depositing inorganic salts such as Ca 2+ and Mg 2+ ions in the matrix. . The treatment of exosomes according to the present invention to mouse monocytes differentiated into osteoblasts significantly activates the ALP activity in a concentration-dependent manner in the results of ALP (alkaline phosphatase) staining, which is a marker for osteoblast differentiation, thereby promoting osteoblast formation. do.
본 발명의 약학 조성물은 통상의 방법에 따라 액제, 현탁액, 에멀젼, 로션, 연고, 동결건조제 등 다양한 제형으로 제제화될 수 있다.The pharmaceutical composition of the present invention may be formulated in various formulations such as solutions, suspensions, emulsions, lotions, ointments, and freeze-drying agents according to conventional methods.
본 발명의 약학 조성물은 약학적 분야의 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 약학적 제제로 제형화시켜 투여할 수 있으며, 상기 제제는 1회 또는 수회 투여에 의해 효과적인 투여량을 포함한다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사제, 주입제 등이 바람직하다. 또한, 상기 암 예방 또는 치료용 약학 조성물은 약학적으로 허용가능한 통상의 불활성 담체 및 희석제를 포함할 수 있다. 본 발명의 약학 조성물에 포함될 수 있는 약학적으로 허용가능한 담체 및 희석제는 전분, 당, 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 및 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌 글리콜과 같은 윤활제, 포비돈, 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 및 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용되는 담체 및 희석제는 이를 이식받을 수혜자에 대해 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제로는 이에 한정되지 않으나, 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있다. 이외에도, 예를 들어, 주사제의 경우에는 보존제, 무통화제, 가용화제 또는 안정화제 등을, 국소투여용 제제의 경우에는 기제(base), 부형제, 윤활제 또는 보존제 등을 추가로 포함할 수 있다. 본 발명의 조성물은 동결되지 않은 채 사용되거나 차후 사용을 위해 동결될 수 있다. 동결되어야 할 경우, 표준 냉동보존제 (예를 들어 DMSO, 글리세롤, 에피라이프 (Epilife®) 세포 동결 배지 (Cascade Biologics))가 동결 전 세포 집단에 첨가될 수 있다.The pharmaceutical composition of the present invention may be formulated and administered in a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, and the preparation may be administered effectively by one or several administrations. includes the amount As a formulation suitable for this purpose, an injection, an injection, etc. are preferable as a formulation for parenteral administration. In addition, the pharmaceutical composition for preventing or treating cancer may include a conventional pharmaceutically acceptable inert carrier and diluent. Pharmaceutically acceptable carriers and diluents that may be included in the pharmaceutical composition of the present invention include excipients such as starch, sugar, and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, etc. , alginate, and binders such as polyvinyl pyrrolidone, lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, interfacial agents such as polysorbate, cetyl alcohol, and glycerol active agents, but are not limited thereto. The pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the recipient to which it will be transplanted. Diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media. In addition, for example, in the case of injections, preservatives, analgesics, solubilizers or stabilizers, etc., and in the case of formulations for topical administration, a base, excipients, lubricants or preservatives, etc. may be further included. The compositions of the present invention may be used undisturbed or frozen for later use. If frozen, standard cryopreservatives (eg DMSO, glycerol, Epilife® Cell Freezing Medium (Cascade Biologics)) can be added to the cell population prior to freezing.
또한, 당업계에서 통상적으로 사용하는 투여방법을 이용하여 투여될 수 있으며, 바람직하게는 치료가 필요한 환자의 질환 부위에 직접 투여가 가능하나 이에 한정되지는 않는다. 또한, 상기 투여는 카테터를 이용한 비외과적 투여 및 질환부위 절개 후 주입 등 외과적 투여방법 모두 가능하다. 투여량은 농축 정도에 따라 그 투여량이 달라질 수 있으나 10 μl/kg 내지 1 ml/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 예를 들어 엑소좀은 본 발명의 조성물 내에 대략 1 ~ 150㎍/ml, 또는 1 ~ 100㎍/ml의 양으로 포함되는 것이 바람직하다. 또한, 상기 엑소좀은 예를 들어 1 X 107~ 1 X 1012/ml의 입자 수로 포함되고 적용되는 대상체에 따라 적절히 이의 투여량이 변경되어 투여될 수 있다. 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.In addition, it may be administered using an administration method commonly used in the art, and preferably, direct administration to the diseased site of the patient in need of treatment is possible, but is not limited thereto. In addition, the administration can be both non-surgical administration using a catheter and surgical administration methods such as injection after incision at the diseased site. The dose may vary depending on the degree of concentration, but 10 μl/kg to 1 ml/kg of body weight may be administered once or divided into several doses. For example, exosomes are preferably included in the composition of the present invention in an amount of approximately 1 to 150 μg/ml, or 1 to 100 μg/ml. In addition, the exosome may be administered, for example, by changing its dosage appropriately depending on the subject to be included and applied in the number of particles of 1 X 10 7 ~ 1 X 10 12 /ml. It should be understood that the actual dosage of the active ingredient should be determined in light of several related factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's weight, age, and sex, and therefore, the dosage may be It does not limit the scope of the present invention.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 이를 필요로 하는 대상체에 투여하는 단계를 포함하는 골 질환의 치료 방법을 제공한다.The present invention provides a method for treating bone disease, comprising administering an epidural adipose mesenchymal stem cell-derived exosome to a subject in need thereof.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 이를 필요로 하는 대상체에 투여하는 단계를 포함하는 골 감소 억제 방법을 제공한다. The present invention provides a method for inhibiting bone loss comprising administering an epidural adipose mesenchymal stem cell-derived exosome to a subject in need thereof.
본 발명에 "경막외 지방 중간엽 줄기세포 유래 엑소좀", "골 질환", "투여" 등의 용어는 상기에서 설명한 바와 동일하다.In the present invention, terms such as “epidural adipose mesenchymal stem cell-derived exosome”, “bone disease”, and “administration” are the same as described above.
상기 대상체는 동물을 말하며, 전형적으로 본 발명의 경막외 지방 중간엽 줄기세포 유래 엑소좀을 이용한 치료로 유익한 효과를 나타낼 수 있는 포유동물일 수 있다. 이러한 대상체의 바람직한 예로 인간과 같은 영장류가 포함될 수 있다. 또한 이와 같은 대상체들에는 골 질환의 증상을 갖거나 이와 같은 증상을 가질 위험이 있는 대상체들이 모두 포함될 수 있다.The subject refers to an animal, and typically may be a mammal that can exhibit a beneficial effect by treatment using the epidural adipose mesenchymal stem cell-derived exosome of the present invention. Preferred examples of such subjects may include primates such as humans. Also, such subjects may include all subjects with or at risk of having symptoms of bone disease.
본 발명은 또한 골 질환의 치료를 위한 약제의 제조에서 경막외 지방 중간엽 줄기세포 유래 엑소좀의 용도를 제공한다. The present invention also provides the use of an epidural adipose mesenchymal stem cell-derived exosome in the manufacture of a medicament for the treatment of a bone disease.
본 발명은 또한 골 질환의 치료에 사용하기 위한 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물을 제공한다. The present invention also provides a composition comprising an epidural adipose mesenchymal stem cell-derived exosome for use in the treatment of a bone disease.
본 발명은 또한 골 질환의 치료를 위한 경막외 지방 중간엽 줄기세포 유래 엑소좀의 용도를 제공한다. The present invention also provides the use of epidural adipose mesenchymal stem cell-derived exosomes for the treatment of bone diseases.
본 발명은 또한 경막외지방조직 유래 줄기세포로부터 유래한 엑소좀을 포함하는, 염증성 질환 치료 또는 예방용 약학 조성물을 제공한다. The present invention also provides a pharmaceutical composition for treating or preventing inflammatory diseases, including exosomes derived from epidural adipose tissue-derived stem cells.
본 발명에 있어서, 염증성 질환은 예를 들어, 골에서 발생하는 염증성 질환일 수 있다. 구체적으로, 골관절염, 골연골염, 변형성 골염, 낭성 섬유성 골염, 치골염, 치밀화 골염, 골수염 등의 골 관련 염증질환일 수 있다. In the present invention, the inflammatory disease may be, for example, an inflammatory disease occurring in the bone. Specifically, it may be a bone-related inflammatory disease such as osteoarthritis, osteochondritis, osteomyelitis, cystic fibrous osteotitis, gingivitis, densified osteomyelitis, and osteomyelitis.
각각의 구성, 용도 방법에 대해서는 앞서는 내용이 본 약학 조성물에도 적절히 적용되어 이해될 수 있다. For each configuration and use method, the foregoing can be understood by being appropriately applied to the present pharmaceutical composition.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 개선용 식품 조성물을 제공한다. The present invention provides a food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
본 발명은 또한 경막외지방조직 유래 줄기세포로부터 유래한 엑소좀을 포함하는, 염증성 질환 예방용 또는 개선용 식품 조성물을 제공한다. The present invention also provides a food composition for preventing or improving inflammatory diseases, including exosomes derived from epidural adipose tissue-derived stem cells.
본 발명은 통상적으로 이용되는 식품으로써 일반적으로 사용될 수 있다. The present invention can be generally used as a commonly used food product.
본 발명의 식품 조성물은 건강기능식품으로서 사용될 수 있다. 상기 "건강기능식품"이라 함은 건강기능식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.The food composition of the present invention can be used as a health functional food. The term "health functional food" means a food manufactured and processed using raw materials or ingredients useful for the human body in accordance with the Health Functional Food Act, and "functionality" refers to the structure and function of the human body. It refers to ingestion for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological effects.
본 발명의 식품 조성물은 통상의 식품 첨가물을 포함할 수 있으며, 상기 "식품 첨가물"로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. The food composition of the present invention may contain conventional food additives, and the suitability as the "food additive" is determined according to the general rules and general test methods of food additives approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the standards and standards related to the item.
상기 "식품 첨가물 공전"에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼륨, 니코틴산, 계피산 등의 화학적 합성물, 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물, L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류들을 들 수 있다.The items listed in the "Food Additives Code" include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; Mixed preparations such as sodium L-glutamate preparation, noodle-added alkali agent, preservative agent, and tar color agent can be mentioned.
본 발명의 식품 조성물은 조성물 총 중량에 대하여 경막외 지방 중간엽 줄기세포 유래 엑소좀을 0.01 내지 95 중량%, 바람직하게는 5 내지 90 중량%로 포함할 수 있다. The food composition of the present invention may contain from 0.01 to 95% by weight of the epidural adipose mesenchymal stem cell-derived exosome, preferably from 5 to 90% by weight, based on the total weight of the composition.
또한, 본 발명의 식품 조성물은 암의 예방 및/또는 개선을 목적으로, 정제, 캡슐, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공할 수 있다.In addition, the food composition of the present invention may be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing and/or improving cancer.
예를 들어, 캡슐 형태의 건강기능식품 중 경질캡슐제는 통상의 경질캡슐에 본 발명에 따른 경막외 지방 중간엽 줄기세포의 엑소좀, 및 부형제 등의 첨가제와의 혼합물을 충진하여 제조할 수 있으며, 연질캡슐제는 본 발명에 따른 식품 조성물 및 부형제 등의 첨가제와의 혼합물을 젤라틴 등 캡슐기제에 충진하여 제조할 수 있다. 상기 연질캡슐제는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다.For example, among health functional foods in the form of capsules, hard capsules can be prepared by filling a conventional hard capsule with a mixture of exosomes of epidural adipose mesenchymal stem cells according to the present invention, and additives such as excipients, , soft capsules can be prepared by filling a mixture with additives such as the food composition and excipients according to the present invention in a capsule base such as gelatin. The soft capsule formulation may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.
상기 부형제, 결합제, 붕해제, 활택제, 교미제, 착향제 등에 대한 용어 정의는 당업계에 공지된 문헌에 기재된 것으로 그 기능 등이 동일 내지 유사한 것들을 포함한다 (대한약전 해설편, 문성사, 한국약학대학협의회, 제 5 개정판, p33-48, 1989).The term definitions for the excipients, binders, disintegrants, lubricants, flavoring agents, flavoring agents, etc. are described in documents known in the art and include those having the same or similar functions (Explanation of the Korean Pharmacopoeia, Moonseongsa, Korea) Association of Colleges of Pharmacy, 5th ed., p33-48, 1989).
상기 식품의 종류에는 특별한 제한이 없으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.The type of food is not particularly limited, and includes all health functional foods in the ordinary sense.
본 발명은 경막외 지방 중간엽 줄기세포 유래 엑소좀은 포함하는, 골질환, 염증성 질환 치료, 개선 또는 예방용 조성물 등에 관한 것으로, 엑소좀이 항염증성인자 사이토카인을 다량 함유하고, 파골 세포 분화를 억제할 수 있는 hsa-miR-122-5p등의 miRNA를 다량함유하고, 파골세포의 분화에 관여할 수 있는 인자들을 낮게 함유하거나 포함하지 않음으로써, 골질환, 염증질환 등의 예방, 개선 또는 치료에 유용하게 이용될 수 있다.The present invention relates to a composition for the treatment, improvement or prevention of bone disease, inflammatory disease, etc., including an epidural adipose mesenchymal stem cell-derived exosome, wherein the exosome contains a large amount of anti-inflammatory factor cytokine, and osteoclast differentiation Prevention, improvement or treatment of bone diseases, inflammatory diseases, etc. by containing a large amount of miRNA such as hsa-miR-122-5p that can be inhibited and containing or not containing factors that may be involved in osteoclast differentiation can be usefully used for
도 1a는 인간 피부상피세포 및 인간 경막외지방줄기세포의 배양 결과를 관찰한 것이다.Figure 1a is an observation of the culture results of human skin epithelial cells and human epidural adipose stem cells.
도 1b는 인간 경막외지방줄기세포의 표면 특이 항원 발현 양상을 나타낸 것이다(음성 발현 (CD14, CD34, CD45) 및 양성 발현 (CD73, CD90, CD105)).Figure 1b shows the surface-specific antigen expression pattern of human epidural adipose stem cells (negative expression (CD14, CD34, CD45) and positive expression (CD73, CD90, CD105)).
도 2a는 인간 피부상피세포유래 엑소좀 및 인간 경막외지방줄기세포유래 엑소좀의 형태를 확인한 것이다.Figure 2a confirms the morphology of the human skin epithelial cell-derived exosome and human epidural adipose stem cell-derived exosome.
도 2b는 인간 피부상피세포유래 및 인간 경막외지방줄기세포유래 엑소좀의 CD63 및 CD81 양성 발현을 확인한 것이다.Figure 2b confirms the positive expression of CD63 and CD81 in exosomes derived from human skin epithelial cells and human epidural adipose stem cells.
도 2c는 인간 피부상피세포유래 및 인간 경막외지방줄기세포유래 엑소좀의 크기 분포도와 평균 직경 및 농도 측정 결과를 나타낸 것이다.Figure 2c shows the size distribution, average diameter, and concentration measurement results of exosomes derived from human skin epithelial cells and human epidural adipose stem cells.
도 3은 인간 피부상피세포 엑소좀(DF EV) 대비 인간 경막외지방줄기세포유래 엑소좀(MSC EV)의 사이토카인 및 케모카인 발현 양상을 비교 분석한 것이다(*p-value < 0.05, ** ≤ 0.001). Figure 3 is a comparative analysis of the cytokine and chemokine expression patterns of human epidural adipose stem cell-derived exosomes (MSC EV) compared to human skin epithelial cell exosomes (DF EV) (*p-value < 0.05, ** ≤ 0.001).
도 4a는 인간 단핵구 THP-1 세포를 대식세포로 분화시키고 LPS 및/또는 EV 처리한 다음 현미경으로 관찰한 결과를 나타낸 것이다.Figure 4a shows the results of human monocytic THP-1 cells differentiated into macrophages, treated with LPS and/or EV, and then observed under a microscope.
도 4b는 대식세포에 LPS 및/또는 EV 처리한 다음 TNF-α, IL-6 및 IL-10 분비 레벨을 정량화한 것이다(* p-값 <0.05, *** <0.0001, n.s. non-significant).Figure 4b shows the quantification of TNF-α, IL-6 and IL-10 secretion levels following LPS and/or EV treatment of macrophages (* p-value <0.05, *** <0.0001, ns non-significant) .
도 5는 RANKL가 처리된 대식세포에서 파골세포로의 분화가 본 발명에 따른 엑소좀 처리에 의해 농도 의존적으로 억제되는 것을 TRAP 발색 기질 첨가를 통한 핵 염색을 통해 확인한 결과를 나타낸 것이다. 5 shows the results of confirming that the differentiation of RANKL-treated macrophages into osteoclasts is concentration-dependently inhibited by the treatment with exosomes according to the present invention through nuclear staining through the addition of TRAP chromogenic substrate.
도 6은 RANKL가 처리된 대식세포에서 파골세포로의 분화가 본 발명에 따른 엑소좀 처리에 의해 농도 의존적으로 억제되는 것을 정량적으로 나타낸 것이다. 6 is a quantitative representation of the concentration-dependent inhibition of the differentiation of RANKL-treated macrophages into osteoclasts by the exosome treatment according to the present invention.
도 7은 파골세포 분화기전(osteoclastogenesis)에 관여하는 TRAP, Cathepsine K, DC-STAMP의 발현이 본 발명에 따른 엑소좀 처리에 의해 농도 의존적으로 억제되는 것을 확인한 결과를 나타낸 것이다. 7 shows the results of confirming that the expression of TRAP, Cathepsine K, and DC-STAMP involved in osteoclastogenesis is concentration-dependently inhibited by the exosome treatment according to the present invention.
도 8은 RANKL가 처리된 대식세포에서 본 발명에 따른 엑소좀 처리에 의해 f-actin ring의 형성이 감소하는 것을 확인한 결과를 나타낸 것이다. 8 shows the results confirming that the formation of the f-actin ring is reduced by the exosome treatment according to the present invention in RANKL-treated macrophages.
본 발명의 이해를 돕기 위하여 실시예, 제조예를 제시한다. 하기의 실시예, 제조예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예, 제조예에 의해 본 발명의 내용이 한정되는 것은 아니다.Examples and preparation examples are presented to help the understanding of the present invention. The following Examples and Preparation Examples are only provided for easier understanding of the present invention, and the content of the present invention is not limited by the Examples and Preparation Examples.
<실시예 1: 방법 및 재료><Example 1: Method and Materials>
실시예 1-1. 세포 분리 및 배양Example 1-1. Cell Isolation and Culture
인간 경막외지방조직 유래 중간엽 줄기세포는 인간경막외지방조직으로부터 수득하였다. 요약하면, 경막외 지방 조직을 분리하고 70 % 에탄올(EtOH) 및 아이스-콜드 PBS로 세척한 다음, 0.45 μm로 필터된 콜라게나아제 I 형 2mg/mL (gibco)을 처리 후 37 °C 조건의 인큐베이터에서 30 분 동안 소화시켰다. 그 다음, 70 μm 스트레이너(strainer)에 상기 소화된 용액을 넣어, 여과된 용액을 3000 × g에서 5 분간 원심분리하였다.Human epidural adipose tissue-derived mesenchymal stem cells were obtained from human epidural adipose tissue. Briefly, epidural adipose tissue was isolated, washed with 70% ethanol (EtOH) and ice-cold PBS, and then treated with 0.45 µm-filtered collagenase type I 2 mg/mL (gibco) at 37 °C. Digested for 30 min in an incubator. Then, the digested solution was put into a 70 μm strainer, and the filtered solution was centrifuged at 3000 × g for 5 minutes.
상기 인간 진피섬유아세포 및 인간 경막외 AD-MSC(Adipose-Derived Mesenchymal Stem Cell)를 10 % exosome-depleted FBS (gibco), 1 % 페니실린/스트렙토마이신 (gibco), 10ug/mL의 재조합 인간 FGF-basic (Peprotech), 10ug/mL의 재조합 인간 PDGF-BB (Peprotech) 및 25ug/mL 플라스모신(plasmocin)(InvivoGen)이 보충된 로우 글루코스-DMEM (gibco)에서 유지하였다. 모든 세포를 37 °C 및 5 % CO2 인큐베이터 조건에서 배양하였다.The human dermal fibroblasts and human epidural AD-MSC (Adipose-Derived Mesenchymal Stem Cell) were mixed with 10% exosome-depleted FBS (gibco), 1% penicillin/streptomycin (gibco), and recombinant human FGF-basic at 10ug/mL. (Peprotech), 10 ug/mL recombinant human PDGF-BB (Peprotech) and 25 ug/mL plasmocin (InvivoGen) supplemented with low glucose-DMEM (gibco). All cells were cultured at 37 °C and 5% CO 2 incubator conditions.
실시예 1-2. 인간 진피섬유아세포 및 인간 경막외 AD-MSC 엑소좀의 분리Example 1-2. Isolation of human dermal fibroblasts and human epidural AD-MSC exosomes
175 T-플라스크에서 성장한 AD-MSC의 배양 배지를 48 시간 배양 후 수집하였다. 엑소좀을 세포 배양배지에서 정제하고 300 x g에서 10 분 동안 원심 분리하여 세포를 제거하였다. 그 다음 상등액을 2500 x g에서 25 분 동안 다시 원심 분리하여 세포 파편 및 세포 사멸체를 제거하였다. 그 후, 90Ti 로터 (Beckman Coulter)를 사용하여 상등액을 100,000 x g에서 120 분 동안 초원심 분리하였다. 상등액을 버리고 펠릿을 0.22 μm 필터된 PBS 200 μL에 넣고 재현탁시켰다. 엑소좀 단백질 농도를 Pierce ™ BCA 분석 키트 (Thermo Fisher science 23225)로 측정하였다.The culture medium of AD-MSCs grown in 175 T-flasks was collected after 48 hours of incubation. The exosomes were purified in cell culture medium and cells were removed by centrifugation at 300 x g for 10 min. The supernatant was then centrifuged again at 2500 x g for 25 min to remove cell debris and apoptosis. Then, the supernatant was ultracentrifuged at 100,000 x g for 120 min using a 90Ti rotor (Beckman Coulter). Discard the supernatant and resuspend the pellet in 200 µL of 0.22 µm filtered PBS. Exosome protein concentration was measured with a Pierce ™ BCA assay kit (Thermo Fisher science 23225).
실시예 1-3. 유세포 분석Examples 1-3. flow cytometry
flow cytometry Galios(Beckman Coulter)를 사용하여 유세포 분석을 수행하였다. 발현 줄기세포 마커를 결정하기 위해 CD105 (Bio-Rad, MCA1557), CD90 (BioLegend, 555596), CD73 (BioLegend, 344004), CD45 (BioLegend, 555482), CD34 (BioLegend, 343504) 및 CD14 (Bio-Rad, MCA1568)와 같은 항체로 세포를 염색하였다. 항체는 FITC 또는 PE 형광 염료와 접합되었다.Flow cytometry was performed using flow cytometry Galios (Beckman Coulter). CD105 (Bio-Rad, MCA1557), CD90 (BioLegend, 555596), CD73 (BioLegend, 344004), CD45 (BioLegend, 555482), CD34 (BioLegend, 343504) and CD14 (Bio-Rad) to determine expressed stem cell markers. , MCA1568) and stained the cells with the same antibody. Antibodies were conjugated with FITC or PE fluorescent dyes.
엑소좀 분석을 위해 분리된 엑소좀 200μL를 10μL의 알데히드 / 설페이트-라텍스 비드 4 % w/v (ThermoFishcer Scientific)와 함께 실온에서 15 분 동안 배양하였다. 그 다음 1 mL 부피의 PBS(0.1 % BSA로 보충)를 엑소좀 / 비드 혼합물에 추가하였다. 샘플를 밤새 회전시켜 배양하였다. 비드-커플링된 엑소좀을 2000 × g 에서 10 분 동안 원심 분리하여 펠릿화하고 500 μL의 PBS로 세척하였다.For exosome analysis, 200 μL of isolated exosomes were incubated with 10 μL of aldehyde/sulfate-latex beads 4% w/v (ThermoFishcer Scientific) at room temperature for 15 minutes. A 1 mL volume of PBS (supplemented with 0.1% BSA) was then added to the exosome/bead mixture. Samples were spun overnight and incubated. Bead-coupled exosomes were pelleted by centrifugation at 2000 × g for 10 min and washed with 500 μL of PBS.
펠릿을 4 °C에서 1 시간 동안 항체 CD9 (NOVUS, NBP1-28364), CD81 (NOVUS, NBP1-44859)을 포함하는 PBS 50μL로 재현탁시켰으며 모든 항체를 FITC 형광 염료와 접합하였다. 500 μL의 PBS를 사용하여 샘플을 세척하고 10 분 동안 2000 x g 원심 분리하였다. 그 다음, 펠릿을 150 μL의 PBS로 재현탁시켰다. 직경 4 μm 비드로 처리된 엑소좀을 게이팅 및 분석하였다.The pellet was resuspended in 50 μL of PBS containing antibodies CD9 (NOVUS, NBP1-28364), CD81 (NOVUS, NBP1-44859) for 1 h at 4 °C and all antibodies were conjugated with FITC fluorescent dye. Samples were washed with 500 µL of PBS and centrifuged at 2000 x g for 10 min. The pellet was then resuspended in 150 μL of PBS. Exosomes treated with 4 μm diameter beads were gated and analyzed.
실시예 1-4. 투과 전자 현미경(TEM)Examples 1-4. Transmission electron microscopy (TEM)
인간 진피섬유아세포 및 인간 경막외 AD-MSC로부터 새로 분리된 엑소좀을 차가운 증류수에 재현탁시켰다. 엑소좀 현탁액을 폼바 카본 코팅 그리드(Ted Pella Inc.)에 로딩하고 2 % 파라포름알데히드(paraformaldehyde)에 10 분 동안 고정한 다음 용액을 제거하고 샘플을 건조시켰다. 그리드를 bioTEM으로 관찰하였다(히타치 HT7700).Freshly isolated exosomes from human dermal fibroblasts and human epidural AD-MSC were resuspended in cold distilled water. The exosome suspension was loaded onto a Pomba carbon coating grid (Ted Pella Inc.) and fixed in 2% paraformaldehyde for 10 minutes, then the solution was removed and the sample was dried. The grid was observed by bioTEM (Hitachi HT7700).
실시예 1-5. 나노 입자 추적 분석 (NTA).Examples 1-5. Nanoparticle Tracking Analysis (NTA).
NTA 분석은 제조업체의 권고에 따라 PMX120 (Particle Metrix) 기기로 수행되었다.NTA analysis was performed with a PMX120 (Particle Metrix) instrument according to the manufacturer's recommendations.
실시예 1-6. 사이토카인 분석Example 1-6. Cytokine analysis
Quantibody® 사이토카인 어레이키트 (RayBiotech, QAH-CYT-1)를 이용하여 인간 진피섬유아세포 및 인간 경막외 AD-MSC 엑소좀 용액에서 사이토카인을 정량화하였다. 엑소좀 단백질을 각 어레이에 대해 300 μg / mL로 희석하고 총 샘플 부피의 100 μL를 로드하고 제조업체의 프로토콜에 따라 수행하였다. 신호는 Innopsys Innoscan의 Cy3 파장 (532nm)이 장착된 레이저 스캐너로 측정되었다. 데이터 분석은 Mapix 버전 7.2.0으로 정량화되었다.Cytokines were quantified in human dermal fibroblasts and human epidural AD-MSC exosome solutions using the Quantibody® Cytokine Array Kit (RayBiotech, QAH-CYT-1). Exosomal proteins were diluted to 300 µg/mL for each array and 100 µL of the total sample volume was loaded and performed according to the manufacturer's protocol. Signals were measured with a laser scanner equipped with a Cy3 wavelength (532 nm) from Innopsys Innoscan. Data analysis was quantified with Mapix version 7.2.0.
실시예 1-7. THP-1 세포에 대한 LPS 및 EV 처리Example 1-7. LPS and EV Treatment for THP-1 Cells
인간 THP-1 세포를 24 시간 동안 100 nM PMA (Sigma-Aldrich, Saint Louis, MO, USA)에서 대식세포로 분화하였다. LPS 처리전에 THP-1 세포의 PMA를 세척하였다. 인간 진피섬유아세포 유래 EV와 인간 경막외지방 MSC 유래 EV (50 ㎍/mL)를 1 ㎍/mL LPS (Sigma-Aldrich)와 동시에 첨가하였다. 대조군으로 THP-1 유래 대식세포를 LPS 및 EV 없이 또는 50 ㎍/mL의 2개 세포 유래 EV와 함께 배양하였다.Human THP-1 cells were differentiated into macrophages in 100 nM PMA (Sigma-Aldrich, Saint Louis, MO, USA) for 24 h. PMA of THP-1 cells was washed before LPS treatment. EVs derived from human dermal fibroblasts and EVs derived from human epidural fat MSCs (50 μg/mL) were added simultaneously with 1 μg/mL LPS (Sigma-Aldrich). As a control, THP-1 derived macrophages were cultured without LPS and EV or with 50 μg/mL of two cell-derived EVs.
실시예 1-8. 통계 분석Examples 1-8. statistical analysis
통계 분석은 GraphPad Prism 소프트웨어를 사용하여 처리되었다. 모든 측정 데이터는 평균 ± 표준편차로 표시되었으며 unpaired t-test를 사용하였다. p 값 <0.05는 유의미한 것으로 간주되었으며 도면의 설명에 기재되었다.Statistical analysis was processed using GraphPad Prism software. All measured data were expressed as mean ± standard deviation, and unpaired t-test was used. A p value <0.05 was considered significant and is described in the description of the figures.
<실시예 2: 인간 경막외 AD-MSC의 특성 확인><Example 2: Characterization of human epidural AD-MSC>
줄기세포와 섬유 아세포를 비교하기 위해 두 가지 세포 유형을 배양하였다. 인간 경막외 AD-MSC는 인간 경막외지방조직에서 분리되었으며, 분리된 인간 경막외 AD-MSC는 전형적인 중간엽 줄기세포 특성을 가졌다. 세포는 플라스틱 배양 플레이트에 부착되었으며, 세포 모양은 진피 섬유 아세포와 같이 길고 얇은 방추 모양이었다(도 1a 참조). 또한, 유세포 분석을 통해 인간 경막외 AD-MSC는 CD73, CD90 및 CD105의 경우 양성 세포 표면 마커 발현을 나타내고, CD14, CD34 및 CD45의 경우 음성 세포 표면 마커 발현을 나타냄을 확인하였다(도 1b 참조). 줄기세포의 증식 및 엑소좀의 분리를 위해 세포를 12회 계대배양하였다. 이러한 결과는 분리된 인간 경막외 AD-MSC가 중간엽 줄기 세포의 전형적인 특징을 가짐을 의미한다.Two cell types were cultured to compare stem cells and fibroblasts. Human epidural AD-MSCs were isolated from human epidural adipose tissue, and the isolated human epidural AD-MSCs had typical mesenchymal stem cell characteristics. Cells were attached to plastic culture plates, and the cell shape was long and thin, spindle-shaped, like that of dermal fibroblasts (see Fig. 1a). In addition, flow cytometry analysis confirmed that human epidural AD-MSCs showed positive cell surface marker expression for CD73, CD90 and CD105, and negative cell surface marker expression for CD14, CD34 and CD45 (see Fig. 1b). . Cells were subcultured 12 times for the proliferation of stem cells and isolation of exosomes. These results suggest that isolated human epidural AD-MSCs have typical characteristics of mesenchymal stem cells.
<실시예 3: 인간 진피섬유아세포 및 인간 경막외 AD-MSC 엑소좀 특성화><Example 3: Characterization of human dermal fibroblasts and human epidural AD-MSC exosomes>
일반 FBS의 혈청 알부민과 엑소좀은 분리된 엑소좀의 순도에 영향을 미치기 때문에 소 혈청 유래 엑소좀이 제거된 FBS를 포함한 세포배양배지를 사용하였다. TEM으로 정제된 엑소좀을 확인하기 위해, 특정 단백질에 대한 FACS 및 크기 분포 및 입자 수에 대한 NTA(Nanoparticles tracking analysis) 분석을 수행하였다. TEM 이미징 결과에 따르면, 분리된 엑소좀은 엑소좀의 고전적 형태를 나타냈으며 엑소좀의 크기는 직경 100 - 200 nm이고 구형임을 확인하였다.Since serum albumin and exosomes of normal FBS affect the purity of the isolated exosomes, a cell culture medium containing FBS from which bovine serum-derived exosomes have been removed was used. In order to confirm the exosomes purified by TEM, FACS and NTA (Nanoparticles tracking analysis) analysis of the size distribution and number of particles for a specific protein was performed. According to the TEM imaging results, the isolated exosomes exhibited a classical form of exosomes, and it was confirmed that the size of the exosomes was 100-200 nm in diameter and spherical.
또한 엑소좀 막은 지질 이중층으로 구성되어 TEM으로 어둡고 두꺼운 엑소좀 막을 관찰하였다(도 2a 참조). 다포체(multivesicular body, MVB)로 만든 엑소좀에는 테트라스파닌, 융합 단백질 및 MVB 생물 발생 마커와 같은 여러 바이오 마커가 있다. 특히 CD9, CD63 및 CD81과 같은 테트라 스파닌이 엑소좀 막에서 발현되었다. 이에 유세포 분석을 사용하여 테트라스파닌 CD63과 CD81을 검출하였다.In addition, the exosome membrane was composed of a lipid bilayer, and dark and thick exosome membranes were observed by TEM (see Fig. 2a). Exosomes made from multivesicular bodies (MVBs) have several biomarkers such as tetraspanins, fusion proteins, and MVB biogenesis markers. In particular, tetraspanins such as CD9, CD63 and CD81 were expressed in the exosome membrane. Thus, tetraspanins CD63 and CD81 were detected using flow cytometry.
유세포분석은 일반적으로 세포에 대해 수행되지만 엑소좀은 일반 세포보다 매우 작기 때문에 약 4 μm 직경 크기의 알데히드 / 라텍스 비드를 사용하여 유세포 분석을 수행하였다. 상기 비드 결합 엑소좀은 유세포 분석기에 의해 분석되었으며, 진피섬유아세포 및 인간 경막외 AD-MSC 유래 엑소좀은 각각 약 60 %와 90 %의 CD63, CD81의 발현을 나타내었다(도 2b 참조).Although flow cytometry is usually performed on cells, exosomes are much smaller than normal cells, so flow cytometry was performed using aldehyde/latex beads with a diameter of about 4 μm. The bead-bound exosomes were analyzed by flow cytometry, and dermal fibroblasts and human epidural AD-MSC-derived exosomes exhibited about 60% and 90% of CD63 and CD81 expression, respectively (see FIG. 2b ).
NTA 데이터는 엑소좀 크기 분포 및 농도를 나타낸다. 분리된 인간 진피섬유아세포 유래 엑소좀의 99.7 %는 평균 크기가 144.4 nm이고 농도는 1.06 x 1010 입자/mL였다. 분리된 인간 경막외 AD-MSC 유래 엑소좀의 99.1 %는 직경이 142.8 nm이고 농도는 1.27 x 1010 입자/mL였다(도 2c 참조).NTA data represent exosome size distribution and concentration. 99.7% of isolated human dermal fibroblast-derived exosomes had an average size of 144.4 nm and a concentration of 1.06 x 10 10 particles/mL. 99.1% of isolated human epidural AD-MSC-derived exosomes had a diameter of 142.8 nm and a concentration of 1.27 x 10 10 particles/mL (see Fig. 2c).
<실시예 4: 인간 경막외 AD-MSC 유래 엑소좀의 면역 억제 효과 확인><Example 4: Confirmation of immunosuppressive effect of exosomes derived from human epidural AD-MSC>
인간 진피섬유아세포 유래 엑소좀과 인간 경막외 AD-MSC 유래 엑소좀 간의 사이토카인 및 케모카인 수준을 비교하였다. 염증인자 수준의 정확한 측정을 비교하기 위해 사이토카인 어레이 매뉴얼에 따라 300 μg / mL의 단백질 농도로 조정하였다. GM-CSF, MIP-1 알파, MMP-9, IL-5, GRO 및 VEGF와 같은 전 염증 인자는 인간 경막외 AD-MSC 유래 엑소좀에서 낮은 발현 수준임을 확인하였다. 반면, 항염증인자인 IL-4, 및 IL-13은 인간 경막외 AD-MSC 유래 엑소좀에서 증가되었고 특히 IL-13 발현이 현저하게 증가되어 있음을 확인하였다(도 3). 상기 결과는 MSC 유래 엑소좀은 면역 방어에 중요한 역할을 한다는 것을 의미한다.Cytokine and chemokine levels were compared between human dermal fibroblast-derived exosomes and human epidural AD-MSC-derived exosomes. To compare accurate measurements of inflammatory factor levels, the protein concentration was adjusted to 300 μg/mL according to the cytokine array manual. Pro-inflammatory factors such as GM-CSF, MIP-1 alpha, MMP-9, IL-5, GRO and VEGF were confirmed to have low expression levels in human epidural AD-MSC-derived exosomes. On the other hand, it was confirmed that the anti-inflammatory factors IL-4 and IL-13 were increased in exosomes derived from human epidural AD-MSC, and in particular, IL-13 expression was significantly increased (FIG. 3). These results suggest that MSC-derived exosomes play an important role in immune defense.
더욱이, 본 발명에 따른 엑소좀은 파골 또는 골흡수에 영향을 미칠 수 있는 인자들을 최소한으로 발현하면서 항염증과 관련된 사이토카인의 분비가 높은 것임을 확인하였다. Moreover, it was confirmed that the exosome according to the present invention has a high secretion of anti-inflammatory-related cytokines while minimally expressing factors that can affect osteoclast or bone resorption.
<실시예 5: 인간 경막외지방 MSC 유래 EV의 항염증 효과 확인><Example 5: Confirmation of anti-inflammatory effect of EV derived from human epidural fat MSC>
경막외지방 MSC 유래 EV가 항염증 효과를 유발하는지 확인하기 위해 THP-1 인간 단핵구 백혈병 세포주를 사용하였다. PMA 없이 배양된 THP-1 세포를 충분한 증식시키고, PMA를 배양 플레이트에서 성장한 THP-1 세포에 첨가하였다. PMA로 처리된 THP-1 세포는 증식을 멈추고 배양 접시의 바닥에 부착된 다음 대식세포와 유사한 세포로 분화되었다 (도 4a).The THP-1 human monocytic leukemia cell line was used to determine if epidural adipose MSC-derived EVs induce anti-inflammatory effects. THP-1 cells cultured without PMA were sufficiently proliferated, and PMA was added to THP-1 cells grown in culture plates. THP-1 cells treated with PMA stopped proliferating, adhered to the bottom of the culture dish, and then differentiated into macrophage-like cells (Fig. 4a).
Lipopolysaccharides(LPS)는 그람 음성 박테리아의 외막을 구성하며 CD14 / TLR4와 상호 작용하고 세포 내 신호를 활성화하는 가장 특성화된 병원체 관련 분자 패턴 중 하나로 간주된다. THP-1 유래 대식세포를 LPS로 처리하면 염증 인자와 PGE2 및 PGF2α와 같은 아라키돈산 생성물이 방출되었다.Lipopolysaccharides (LPS) constitute the outer membrane of Gram-negative bacteria and are considered one of the most characterized pathogen-associated molecular patterns to interact with CD14/TLR4 and activate intracellular signaling. Treatment of THP-1-derived macrophages with LPS released inflammatory factors and arachidonic acid products such as PGE2 and PGF2α.
LPS 유발 염증 및 사이토카인 발현 변화를 감지하기 위해 LPS 자극을 시도하였다. EV-에서 LPS로 자극된 THP-1 유래 대식세포는 또한 대식세포에 대한 EV의 항염증 효과를 확인하기 위해 처리되었다 (도 4a). LPS 자극 후, 컨디셔닝된 배지의 TNF-α, IL-6 및 IL-10을 사이토카인 어레이 및 ELISA로 정량화하였다(도 4b). LPS는 THP-1 유래 대식세포에서 TNF-α (973.6 ± 0.69 pg / mL)를 유의하게 유도하였다. 반대로 LPS를 처리하지 않은 군과 EV를 처리한 군은 TNF-α 생산면에서 차이가 없었다. LPS와 함께 처리된 진피섬유아세포 및 경막외지방 MSC 유래 EV는 각각 68.55 ± 49.92 pg / mL 및 53.64 ± 33.20 pg / mL의 값으로, TNF-α 생성이 크게 감소한 것으로 나타났다.LPS stimulation was attempted to detect LPS-induced inflammation and changes in cytokine expression. THP-1-derived macrophages stimulated with LPS in EV- were also treated to confirm the anti-inflammatory effect of EVs on macrophages (Fig. 4a). After LPS stimulation, TNF-α, IL-6 and IL-10 in the conditioned medium were quantified by cytokine array and ELISA (Fig. 4b). LPS significantly induced TNF-α (973.6 ± 0.69 pg/mL) in THP-1-derived macrophages. Conversely, there was no difference in TNF-α production between the group not treated with LPS and the group treated with EV. Dermal fibroblasts and epidural adipose MSC-derived EVs treated with LPS were 68.55 ± 49.92 pg / mL and 53.64 ± 33.20 pg / mL, respectively, indicating a significant decrease in TNF-α production.
LPS를 처리하지 않은 군에서는 사이토카인 IL-6가 생성되지 않았다. 그러나 IL-6 생산은 LPS 처리 그룹에서 증가하였다(1489.39 ± 121.92 pg / mL). 더욱이, LPS 처리된 진피섬유아세포 유래 EV는 IL-6 생산 수준을 증가시켰다 (1321.79 ± 203.60 pg / mL). 그러나 LPS와 경막외지방 MSC 유래 EV를 동시에 처리했을 때 IL-6 생산이 크게 차단되었다 (167.78 ± 7.69 pg / mL).In the group not treated with LPS, the cytokine IL-6 was not produced. However, IL-6 production was increased in the LPS-treated group (1489.39 ± 121.92 pg/mL). Moreover, LPS-treated dermal fibroblast-derived EVs increased IL-6 production levels (1321.79 ± 203.60 pg/mL). However, simultaneous treatment of LPS and epidural MSC-derived EVs significantly blocked IL-6 production (167.78 ± 7.69 pg/mL).
LPS와 경막외지방 MSC 유래 EV를 동시에 처리했을 때 IL-10 생산은 406.96 ± 67.94 pg / mL 값으로 확인되었다. 이는 LPS (77.49 ± 15.80 pg / mL) 만 처리한 경우와 LPS 및 진피섬유아세포 EV (133.23 ± 15.80 pg / mL)를 처리한 경우에 비해 증가된 값이다.When LPS and epidural MSC-derived EV were treated simultaneously, IL-10 production was confirmed as 406.96 ± 67.94 pg/mL. This is an increased value compared to the case where only LPS (77.49 ± 15.80 pg / mL) and LPS and dermal fibroblast EV (133.23 ± 15.80 pg / mL) were treated.
상기 결과는 EV가 THP-1 유래 대식세포에서 TNF-α 생산을 감소시켰음을 입증한다. 또한, 진피섬유아세포 유래 EV와 달리 경막외지방 MSC 유래 EV는 전 염증 인자 IL-6 생성이 감소한 것으로 나타났다. 또한, 알려진 항염증 인자인 IL-10의 생산은 경막외지방 MSC 유래 EV에서 증가했다. 즉, 경막외지방 MSC 유래 EV의 처리는 진피섬유아세포 유래 EV에 비해 THP-1 대식세포에서 LPS 유발 염증을 억제한다.These results demonstrate that EVs reduced TNF-α production in THP-1 derived macrophages. In addition, unlike dermal fibroblast-derived EVs, epidural MSC-derived EVs showed decreased production of the pro-inflammatory factor IL-6. In addition, the production of IL-10, a known anti-inflammatory factor, was increased in epidural MSC-derived EVs. That is, the treatment of epidural MSC-derived EVs suppressed LPS-induced inflammation in THP-1 macrophages compared to dermal fibroblast-derived EVs.
상기 결과들을 통해서, 본 발명에 따른 엑소좀이 염증 반응 억제에 우수한 효과가 있음을 확인하였다. Through the above results, it was confirmed that the exosome according to the present invention has an excellent effect in inhibiting the inflammatory reaction.
<실시예 6 인간 경막외 AD-MSC 유래 엑소좀의 파골세포 분화에 대한 억제 확인><Example 6 Confirmation of inhibition of osteoclast differentiation of exosomes derived from human epidural AD-MSC>
실시 예 6-1: 경막외 AD-MSC 유래 엑소좀의 파골세포 분화에 대한 억제 평가 (TRAP staining) Example 6-1: Evaluation of inhibition of osteoclast differentiation of epidural AD-MSC-derived exosomes (TRAP staining)
마우스 대식세포를 12well plate에 2x105/well의 밀도로 24h 배양하였으며 FBS, 1% PS, M-CSF가 첨가된 배지로 교체해준 후 엑소좀 (1, 10, 100*108 particles/ml)을 2시간 동안 처리해 주었다. 이후 RANKL을 처리하여 24시간 동안 반응시켰다. 위와 같은 방법으로 4일간 분화시켰다. 대식세포에 RANKL을 처리하면 RANK에 결합하며 TRAP 양성 세포로 분화하게 된다. 이후 파골세포의 세포 화학적 표지효소인 Tartrate resistance acid phosphatase (TRAP)에 발색성 기질을 첨가하여 핵을 염색을 하였고 핵이 3개 이상으로 다핵화된 세포를 관찰하고 이미지화 및 정량화 하였다. Mouse macrophages were cultured in a 12 well plate at a density of 2x10 5 /well for 24 h, and exosomes (1, 10, 100*10 8 particles/ml) were cultured in a medium supplemented with FBS, 1% PS, and M-CSF. treated for 2 hours. Then, RANKL was treated and reacted for 24 hours. It was differentiated for 4 days in the same way as above. When macrophages are treated with RANKL, they bind to RANK and differentiate into TRAP-positive cells. After that, the nucleus was stained by adding a chromogenic substrate to Tartrate resistance acid phosphatase (TRAP), a cytochemical marker enzyme of osteoclasts. Cells with three or more nuclei were observed, imaged and quantified.
도 5 및 도 6에서 확인할 수 있듯이, 상기 대식세포에 RANKL을 처리했을 때 파골세포로의 분화가 증가하였고, 엑소좀을 처리한 경우 엑소좀 입자 농도 의존적으로 파골세포의 수가 현저히 감소하였음을 확인하였다. 이로부터 인간 경막외 AD-MSC 유래 엑소좀의 파골세포로의 분화를 억제시킴을 확인할 수 있었다.As can be seen in FIGS. 5 and 6 , when the macrophages were treated with RANKL, differentiation into osteoclasts increased, and when the exosomes were treated, it was confirmed that the number of osteoclasts was significantly reduced in a concentration-dependent manner with the exosome particles. . From this, it was confirmed that the differentiation of human epidural AD-MSC-derived exosomes into osteoclasts was inhibited.
실시 예 6-2: 인간 경막외 AD-MSC 유래 엑소좀의 파골세포 분화에 대한 유전자 발현 억제 평가 (Real-time PCR)Example 6-2: Evaluation of gene expression inhibition for osteoclast differentiation of exosomes derived from human epidural AD-MSC (Real-time PCR)
마우스 대식세포에 RANKL을 처리했을 때 파골세포 분화에 관련하는 유전자인 TRAP, Cathepsin K, DC-STAMP, NFATc1 에 대한 유전자 발현을 real-time PCR을 통해 확인하였다. 마우스 대식세포를 12well plate에 2x105/well의 밀도로 10% FBS, 1% PS 및 M-CSF가 첨가된 배지에 24 시간 배양 후, 같은 조성의 배지로 교체해준 후 엑소좀 (100*108 particles/ml)을 2 시간 동안 처리해주었다. 이후 RANKL을 처리하여 24 시간 동안 반응시켰다. 위와 같은 방법으로 4일간 분화시킨 후 TRIzol (Thermo Fisher)용액을 이용하여 세포내 RNA를 분리하고 RNA 정량값을 토대로 RT premix를 이용하여 cDNA를 합성하였다. 합성된 cDNA는 primer를 이용하여 real-time PCR을 통해 증폭시켰다. 사용된 primer는 mouse TRAP, Cathesin K, DC-STAMP, NFATc1 (표1)이고 control 유전자인 beta-actin과 비교하여 상대적 양을 비교하였다.When mouse macrophages were treated with RANKL, gene expression for TRAP, Cathepsin K, DC-STAMP, and NFATc1, which are genes related to osteoclast differentiation, was confirmed through real-time PCR. Mouse macrophages were cultured for 24 hours in a medium supplemented with 10% FBS, 1% PS and M-CSF at a density of 2x10 5 /well in a 12 well plate, then replaced with a medium of the same composition and exosomes (100*10 8 particles/ml) was treated for 2 hours. Then, RANKL was treated and reacted for 24 hours. After differentiation for 4 days in the same way as above, intracellular RNA was isolated using TRIzol (Thermo Fisher) solution, and cDNA was synthesized using RT premix based on the RNA quantification value. The synthesized cDNA was amplified through real-time PCR using primers. The primers used were mouse TRAP, Cathesin K, DC-STAMP, and NFATc1 (Table 1), and the relative amounts were compared with the control gene beta-actin.
서열번호SEQ ID NO: 명칭designation 서열 (5‘-3’)sequence (5'-3')
22 TRAP 정방향 프라이머TRAP Forward Primer CTGGAGTGCACGATGCCAGCGACACTGGAGTGCACGATGCCAGCGACA
33 TRAP 역방향 프라이머TRAP reverse primer TCCGTGCTCGGCGATGGACCAGATCCGTGCTCGGCGATGGACCAGA
44 DC-STAMP 정방향 프라이머DC-STAMP Forward Primer CCAAGGAGTCGTCCATGATTCCAAGGAGTCGTCCATGATT
55 DC-STAMP 역방향 프라이머DC-STAMP Reverse Primer GGCTGCTTTGATCGTTTCTCGGCTGCTTTGATCGTTTCTC
66 Cathepsin K 정방향 프라이머Cathepsin K Forward Primer GGCCAACTCAAGAAGAAAACGGCCAACTCAAGAAGAAAAC
77 Cathepsin K 역방향 프라이머Cathepsin K Reverse Primer GTGCTTGCTTCCCTTCTGGGTGCTTGCTTTCCCTTCTGG
88 NFATc1 정방향 프라이머NFATc1 forward primer CTCGAAAGACAGTGGAGCATCTCGAAAGACAGTGGAGCAT
99 NFATc1 역방향 프라이머NFATc1 reverse primer CGGCTGCCTTCCGTCTCATAGCGGCTGCCTTCCGTCTCATAG
1010 beta-actin 정방향 프라이머beta-actin forward primer AGGCCCAGAGCAAGAGAGAGGCCCAGAGCAAGAGAG
1111 beta-actin 역방향 프라이머beta-actin reverse primer TCAACATGATCTGGGTCATCTCAACATGATCTGGGTCATC
대식세포에 RANKL을 처리하면 RANK에 결합하여 TRAP 양성인 다핵화된 파골세포로 분화된다. 또한 파골세포로 분화하는데 중요한 전사 인자인 NFATc1를 활성화 시키고 파골세포 분화기전(osteoclastogenesis)에 관여하는 TRAP, Cathepsine K, DC-STAMP의 발현을 증가시킨다.When macrophages are treated with RANKL, they bind to RANK and differentiate into TRAP-positive multinucleated osteoclasts. It also activates NFATc1, a transcription factor important for differentiation into osteoclasts, and increases the expression of TRAP, Cathepsine K, and DC-STAMP, which are involved in osteoclastogenesis.
도 7 및 표 2 에서 확인할 수 있듯이, 대식세포에 RANKL을 처리했을 때 파골세포의 분화가 증가하였으며 엑소좀 처리에 의해서 파골세포의 수가 현저히 감소된 것을 확인했다. 이것으로 보아 인간 피하지방 조직 유래 줄기세포로부터 분리된 엑소좀은 파골세포로의 분화를 억제시킴을 확인할 수 있었다. 7 and Table 2, when macrophages were treated with RANKL, osteoclast differentiation was increased, and it was confirmed that the number of osteoclasts was significantly reduced by exosome treatment. From this, it was confirmed that exosomes isolated from human subcutaneous adipose tissue-derived stem cells inhibited differentiation into osteoclasts.
엑소좀exosomes -- -- ++
RANKLRANKL -- ++ ++
TRAPTRAP 1One 1156.81156.8 103.8103.8
DC-STAMPDC-STAMP 1One 22.0722.07 1.31.3
Cathepsin KCathepsin K 1One 2573.82573.8 179.1179.1
NFATc1NFATc1 1One 3.23.2 0.90.9
실시 예 6-3: 인간 경막외 AD-MSC 유래 엑소좀의 파골세포 분화에 대한 F-actin ring formation 형성 조절 평가 (F-actin ring staining)Example 6-3: Evaluation of the regulation of F-actin ring formation formation for osteoclast differentiation of exosomes derived from human epidural AD-MSC (F-actin ring staining)
마우스 대식세포를 12well plate에 2x105/well의 밀도로 10% FBS, 1% PS 및 M-CSF가 첨가된 배지에 24h 배양 후, 같은 조성의 배지로 교체해준 후 엑소좀 (100*108 particles/ml)을 2시간 동안 처리해주었다. 이후 RANKL을 처리하여 24 시간 동안 반응시켰다. 대식세포에 RANKL을 처리하면 파골세포 분화과정에서 형태학적 특징인 F-actin ring을 형성한다. 이후 alexa phalloidin으로 cytoskeletal의 marker인 f-actin과 핵 (DAPI)을 염색하였고 형광 이미지화 하였다. Mouse macrophages were cultured for 24 h in a medium supplemented with 10% FBS, 1% PS and M-CSF at a density of 2x10 5 /well in a 12 well plate, and then replaced with a medium of the same composition and exosomes (100*10 8 particles) /ml) was treated for 2 hours. Then, RANKL was treated and reacted for 24 hours. When macrophages are treated with RANKL, an F-actin ring, a morphological characteristic, is formed in the osteoclast differentiation process. Then, f-actin, a cytoskeletal marker, and nucleus (DAPI) were stained with alexa phalloidin, and fluorescence imaging was performed.
도 8에서 확인할 수 있듯이, 대식세포에 RANKL을 처리했을 때 파골세포 분화와 함께 f-actin ring 형성이 증가하였으며, 엑소좀 처리에 의해서 파골세포 분화가 억제됨에 따라 f-actin ring 형성이 감소되었다. 이것으로 보아 인간 경막외 AD-MSC 유래 엑소좀이 파골세포 분화를 억제시킴을 확인할 수 있었다. As can be seen in Figure 8, when macrophages were treated with RANKL, f-actin ring formation was increased along with osteoclast differentiation, and f-actin ring formation was decreased as osteoclast differentiation was suppressed by exosome treatment. From this, it was confirmed that human epidural AD-MSC-derived exosomes inhibit osteoclast differentiation.
<실시예 7: 엑소좀 내 miRNA 발현 변화 확인><Example 7: Confirmation of miRNA expression change in exosomes>
인간 경막외 AD-MSC 유래 엑소좀의 특성을 분석하기 위하여 miRNA 발현 패턴을 확인하였다. 구체적으로, 차세대 시퀀싱 (NGS)을 수행하였으며, 피부섬유아세포 유래 엑소좀과 대비하여 그 결과를 확인하고 이와 함께 이들의 비율을 표시하였다. To analyze the characteristics of human epidural AD-MSC-derived exosomes, miRNA expression patterns were identified. Specifically, next-generation sequencing (NGS) was performed, and the results were confirmed in comparison with exosomes derived from skin fibroblasts, and their ratios were also indicated.
상기 결과를 표 3에 나타내었다. The results are shown in Table 3.
발현값 순서Expression value order miRNA 종류miRNA types 발현값expression value 비율ratio
경막외 지방 중간엽 줄기세포 유래 엑소좀Epidural adipose mesenchymal stem cell-derived exosomes 피부섬유아세포유래 엑소좀Skin fibroblast-derived exosome 경막외 지방 중간엽 줄기세포 유래 엑소좀 / 피부섬유아세포 유래 엑소좀Epidural adipose mesenchymal stem cell-derived exosome / dermal fibroblast-derived exosome
1One hsa-miR-122-5phsa-miR-122-5p 14377421437742 40634063 354354
22 hsa-miR-3591-3phsa-miR-3591-3p 9304193041 440440 211211
33 hsa-let-7b-5phsa-let-7b-5p 3097530975 17371737 1818
44 hsa-miR-10b-5phsa-miR-10b-5p 2778627786 200200 139139
55 hsa-miR-151a-3phsa-miR-151a-3p 1407014070 561561 2525
66 hsa-miR-27a-3phsa-miR-27a-3p 1137711377 489489 2323
77 hsa-miR-181a-5phsa-miR-181a-5p 74607460 6060 124124
88 hsa-miR-514a-5phsa-miR-514a-5p 66906690 5555 122122
99 hsa-miR-412-5phsa-miR-412-5p 46114611 101101 4646
1010 hsa-miR-99b-5phsa-miR-99b-5p 36653665 204204 1818
표 3에서 확인할 수 있는 바와 같이, NGS를 통해서 확인한 결과, 경막외 지방 줄기세포 엑소좀에서 miRNA가 많이 발현하는 상위 10개는 위 언급된 서열과 같다. As can be seen in Table 3, as a result of confirmation through NGS, the top 10 highly expressed miRNAs in the epidural adipose stem cell exosomes are the same as the above-mentioned sequences.
이 상위 10개 miRNAs 중 hsa-miR-122-5P가 가장 높게 발현되었다. 이러한, hsa-miR-122-5P는 파골 세포의 분화와 관련성이 높은데, 골질환을 가지는 환자들에서는 이의 발현이 상당이 낮은 것으로 알려져 있다. 이에 본 발명에 따른 엑소좀은 위 miRNA를 다량 함유함으로써 파골세포의 분화 억제에 우수한 효과를 나타내는 것을 확인하였다. Among these top 10 miRNAs, hsa-miR-122-5P was expressed the most. Such hsa-miR-122-5P is highly correlated with osteoclast differentiation, and its expression is known to be significantly low in patients with bone disease. Accordingly, it was confirmed that the exosome according to the present invention exhibits an excellent effect in inhibiting the differentiation of osteoclasts by containing a large amount of the above miRNA.
<실시예 8 DAVID 분석을 통한 miR-122-5p 타겟 유전자 확인 ><Example 8 Identification of miR-122-5p target gene through DAVID analysis>
파골 세포의 발현 변화에 영향을 미칠 수 있는 분자 메커니즘을 추가로 탐색하기 위해 데이터베이스 DAVID Bioinformatics Resources 6.8를 사용하여 추정되는 miR-122-5p 표적 서열을 예측하였다. To further explore the molecular mechanisms that might affect the expression changes in osteoclasts, the putative miR-122-5p target sequence was predicted using the database DAVID Bioinformatics Resources 6.8.
그 결과, PPARG coactivator1 beta (PPARGC1B) 및 Transcription factor bindingto IGHM enhancer 3(TFE3)를 억제하는 것이 위 표적 서열 예측 결과를 통해 확인되었다. 이러한 PPARG coactivator1 beta (PPARGC1B) 및 Transcription factor bindingto IGHM enhancer 3(TFE3)는 파골 세포 분화를 양성 조절하는 유전자로 알려져 있는바, 이의 억제를 통해 우수한 골질환 치료 효과를 확인할 수 있었다. As a result, inhibition of PPARG coactivator1 beta (PPARGC1B) and transcription factor bindingto IGHM enhancer 3 (TFE3) was confirmed through the above target sequence prediction results. These PPARG coactivator1 beta (PPARGC1B) and transcription factor bindingto IGHM enhancer 3 (TFE3) are known to be genes positively regulating osteoclast differentiation, and through their inhibition, excellent bone disease treatment effects were confirmed.
<실시예 9 골질환 모델에서의 엑소좀 처리에 따른 골질환 치료 효과 확인><Example 9 Confirmation of Bone Disease Treatment Effect according to Exosome Treatment in Bone Disease Model>
마우스 C57BL/6 암컷을 사용하여 22±2℃ 및 상대습도 50±10%, 12시간 명암 주기로 설정된 환경에서 플라스틱 케이지에 사육하였다. 마우스의 난소절제 이전에 동일 환경에서 약 1주 정도 사육 조건에 적응시켰다. C57BL/6 female mice were bred in plastic cages in an environment set at 22±2° C. and 50±10% relative humidity, and a 12-hour light-dark cycle. Mice were acclimatized to breeding conditions for about 1 week in the same environment before ovariectomy.
졸레틸(zoletil)과 럼펀(lumpun)을 근육 주사하여 마취한 후 난소 수술부위를 제모하고 소독하였다. 1cm 가량의 피부를 절개하고 다른 장기에 손상이 가해지지 않도록 주의하여 자궁을 따라 난소를 확인하여 봉합용 실로 난소를 결찰한 뒤 양측의 난소를 모두 절제하였다. 난소 절제 후 각 장기를 복강 내로 재위치 시킨 뒤 봉합용 실로 봉합한다. 10일 이후에 8주 동안 치료물질로 본 발명에 따른 엑소좀을 투여하였다.After anesthesia by intramuscular injection of zoletil and lumpun, the surgical site of the ovary was removed and disinfected. After making an incision of about 1 cm in the skin, the ovaries were checked along the uterus, taking care not to injure other organs, and the ovaries were ligated with a suture thread, and then both ovaries were excised. After ovarian resection, each organ is repositioned into the abdominal cavity and sutured with a suture thread. After 10 days, the exosome according to the present invention was administered as a therapeutic material for 8 weeks.
실험군은 아래와 같이 설정하였다.The experimental group was set up as follows.
① 난소 비절제 대조군(sham), 10마리, PBS(대조군) 투여① Non-ovarian control group (sham), 10 animals, PBS (control group) administration
② 난소 비절제 대조군(sham), 10마리, 엑소좀 고농도 투여② Non-ovarian control group (sham), 10 animals, high concentration of exosomes
③ 난소 절제 실험군(OVX), 10마리, PBS(대조군) 투여③ Ovariectomy test group (OVX), 10 animals, PBS (control group) administration
④ 난소 절제 실험군(OVX), 10마리, 엑소좀 저농도 투여④ Ovariectomy experimental group (OVX), 10 animals, low concentration of exosomes
⑤ 난소 절제 실험군(OVX), 10마리, 엑소좀 중농도 투여⑤ Ovarian excision experimental group (OVX), 10 mice, medium concentration of exosomes
⑥ 난소 절제 실험군(OVX), 10마리, 엑소좀 고농도 투여⑥ Ovariectomy experimental group (OVX), 10 animals, high concentration of exosomes
상기 결과들을 통해 본 발명에 따른 경막외 지방 중간엽 줄기세포 유래 엑소좀이 우수한 파골 세포 억제 효과 및 골 흡수 억제 효과가 있음을 확인하였다. 또한, 추가적으로 우수한 염증 억제를 함께 가짐으로써 골질환, 염증성 질환(특히 골염증성질환)에 있어서 dual effect를 가질 수 있음을 또한 확인하였다. Through the above results, it was confirmed that the epidural adipose mesenchymal stem cell-derived exosomes according to the present invention have excellent osteoclast inhibitory effects and bone resorption inhibitory effects. In addition, it was also confirmed that it can have a dual effect in bone diseases and inflammatory diseases (especially osteo-inflammatory diseases) by having additionally excellent inflammation inhibition.
이러한 결과를 바탕으로 본 발명에 따른 엑소좀이 골 질환 및/또는 염증성 질환의 치료제로 이용될 수 있음을 확인하였다. Based on these results, it was confirmed that the exosome according to the present invention can be used as a therapeutic agent for bone diseases and/or inflammatory diseases.

Claims (20)

  1. 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating bone disease, comprising an epidural adipose mesenchymal stem cell-derived exosome.
  2. 제1항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 hsa-miR-122-5p를 포함하는 것인 골 질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the epidural adipose mesenchymal stem cell-derived exosome contains hsa-miR-122-5p.
  3. 제1항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 IL-4, IL-13 또는 이들 모두를 포함하는 것인, 골 질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the epidural adipose mesenchymal stem cell-derived exosome contains IL-4, IL-13, or both.
  4. 제1항에 있어서, 골 질환은 치주염, 치조골 결손, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트병(paget's disease), 류마티스 관절염(rheumatoid arthritis), 무혈성괴사, 삽입물주위 골용해증 (Periprosthetic osteolysis), 대사성 골질환 및 골경화증으로 이루어진 군으로부터 선택되는 어느 하나 이상의 질환인 골 질환 예방 또는 치료용 약학 조성물.According to claim 1, wherein the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteotitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis ), avascular necrosis, periprosthetic osteolysis, metabolic bone disease, and a pharmaceutical composition for the prevention or treatment of any one or more diseases selected from the group consisting of osteosclerosis.
  5. 제1항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 10nm 내지 300 nm의 직경을 가지는 것인, 골 질환 예방 또는 치료용 약학 조성물. The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the epidural adipose mesenchymal stem cell-derived exosome has a diameter of 10 nm to 300 nm.
  6. 제1항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 파골 세포의 분화를 억제하는 것인, 골 질환 예방 또는 치료용 약학 조성물. The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the epidural adipose mesenchymal stem cell-derived exosome inhibits the differentiation of osteoclasts.
  7. 제1항에 있어서, 조성물은 엑소좀을 1 X 107~ 1 X 1012/ml의 입자 수로 포함하는 것인, 골 질환 예방 또는 치료용 약학 조성물. The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the composition contains exosomes in an amount of 1 X 10 7 to 1 X 10 12 /ml of particles.
  8. 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 염증성 질환 예방 또는 치료용 약학 조성물로서, As a pharmaceutical composition for preventing or treating an inflammatory disease comprising an epidural adipose mesenchymal stem cell-derived exosome,
    상기 염증성 질환은 골관절염, 골연골염, 변형성 골염, 낭성 섬유성 골염, 치골염, 치밀화 골염 및 골수염으로 이루어진 군으로부터 선택되는 어느 하나인, 약학 조성물. The inflammatory disease is any one selected from the group consisting of osteoarthritis, osteochondritis, osteomyelitis, cystic fibrous osteotitis, gingivitis, densified osteomyelitis and osteomyelitis, a pharmaceutical composition.
  9. 제8항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 hsa-miR-122-5p를 포함하는 것인 염증성 질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating an inflammatory disease according to claim 8, wherein the epidural adipose mesenchymal stem cell-derived exosome comprises hsa-miR-122-5p.
  10. 제8항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 IL-4, IL-13 또는 이들 모두를 포함하는 것인, 염증성 질환 예방 또는 치료용 약학 조성물.The pharmaceutical composition for preventing or treating inflammatory diseases according to claim 8, wherein the epidural adipose mesenchymal stem cell-derived exosomes include IL-4, IL-13, or both.
  11. 경막외 지방 중간엽 줄기세포 유래 엑소좀을 이를 필요로 하는 대상체에 투여하는 단계를 포함하는 골 질환의 치료 방법.A method of treating a bone disease comprising administering an epidural adipose mesenchymal stem cell-derived exosome to a subject in need thereof.
  12. 제11항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 hsa-miR-122-5p를 포함하는 것인 골 질환의 치료 방법.The method of claim 11, wherein the epidural adipose mesenchymal stem cell-derived exosome comprises hsa-miR-122-5p.
  13. 제11항에 있어서, 골 질환은 치주염, 치조골 결손, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트병(paget's disease), 류마티스 관절염(rheumatoid arthritis), 무혈성괴사, 삽입물주위 골용해증 (Periprosthetic osteolysis), 대사성 골질환 및 골경화증으로 이루어진 군으로부터 선택되는 어느 하나 이상의 질환인 골 질환의 치료 방법.12. The method of claim 11, wherein the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteotitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis ), avascular necrosis, periprosthetic osteolysis, metabolic bone disease, and a method of treating bone disease, which is any one or more diseases selected from the group consisting of osteosclerosis.
  14. 골 질환의 치료를 위한 약제의 제조에서 경막외 지방 중간엽 줄기세포 유래 엑소좀의 용도. Use of epidural adipose mesenchymal stem cell-derived exosomes in the manufacture of a medicament for the treatment of bone diseases.
  15. 제14항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 hsa-miR-122-5p를 포함하는 것인 용도. The use according to claim 14, wherein the epidural adipose mesenchymal stem cell-derived exosome comprises hsa-miR-122-5p.
  16. 제14항에 있어서, 골 질환은 치주염, 치조골 결손, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트병(paget's disease), 류마티스 관절염(rheumatoid arthritis), 무혈성괴사, 삽입물주위 골용해증 (Periprosthetic osteolysis), 대사성 골질환 및 골경화증으로 이루어진 군으로부터 선택되는 어느 하나 이상의 질환인 용도. 15. The method of claim 14, wherein the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis ), avascular necrosis, periprosthetic osteolysis, metabolic bone disease, and any one or more diseases selected from the group consisting of osteosclerosis.
  17. 골 질환의 치료에 사용하기 위한 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 조성물.A composition comprising an epidural adipose mesenchymal stem cell-derived exosome for use in the treatment of a bone disease.
  18. 제17항에 있어서, 경막외 지방 중간엽 줄기세포 유래 엑소좀은 hsa-miR-122-5p를 포함하는 것인 조성물. The composition according to claim 17, wherein the epidural adipose mesenchymal stem cell-derived exosome comprises hsa-miR-122-5p.
  19. 제17항에 있어서, 골 질환은 치주염, 치조골 결손, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트병(paget's disease), 류마티스 관절염(rheumatoid arthritis), 무혈성괴사, 삽입물주위 골용해증 (Periprosthetic osteolysis), 대사성 골질환 및 골경화증으로 이루어진 군으로부터 선택되는 어느 하나 이상의 질환인 조성물. The method of claim 17, wherein the bone disease is periodontitis, alveolar bone defect, osteoporosis, osteomalacia, rickets, osteopenia, fibrous osteotitis, aplastic bone disease, osteogenesis imperfecta, bone atrophy, Paget's disease, rheumatoid arthritis ), avascular necrosis, periprosthetic osteolysis (Periprosthetic osteolysis), any one or more diseases selected from the group consisting of metabolic bone disease and osteosclerosis composition.
  20. 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 예방 또는 개선용 식품 조성물.A food composition for preventing or improving bone disease comprising an epidural adipose mesenchymal stem cell-derived exosome.
PCT/KR2021/012182 2020-09-09 2021-09-08 Composition for treating bone diseases comprising epidural adipose mesenchymal stem cell-derived exosome WO2022055238A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0115478 2020-09-09
KR20200115478 2020-09-09
KR10-2021-0053062 2021-04-23
KR1020210053062A KR20220033403A (en) 2020-09-09 2021-04-23 Composition for treating inflammatory diseases comprising exosomes derived from human epidural adipose tissue derived stem cell

Publications (1)

Publication Number Publication Date
WO2022055238A1 true WO2022055238A1 (en) 2022-03-17

Family

ID=80631982

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/012182 WO2022055238A1 (en) 2020-09-09 2021-09-08 Composition for treating bone diseases comprising epidural adipose mesenchymal stem cell-derived exosome

Country Status (2)

Country Link
KR (1) KR20220033444A (en)
WO (1) WO2022055238A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013169202A1 (en) * 2012-05-10 2013-11-14 Biomatcell Ab Osteogenic differentiation of mesenchymal stem cells
KR20190011213A (en) * 2017-07-24 2019-02-01 한양대학교 에리카산학협력단 Composition for preventing or treating osteoporosis comprising stem cell-derived exosomes
KR20200088408A (en) * 2017-11-16 2020-07-22 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 Method for producing exosome derived from MSC

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013169202A1 (en) * 2012-05-10 2013-11-14 Biomatcell Ab Osteogenic differentiation of mesenchymal stem cells
KR20190011213A (en) * 2017-07-24 2019-02-01 한양대학교 에리카산학협력단 Composition for preventing or treating osteoporosis comprising stem cell-derived exosomes
KR20200088408A (en) * 2017-11-16 2020-07-22 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 Method for producing exosome derived from MSC

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HUANG JIANG-HU; FU CHUN-HUI; XU YANG; YIN XIAO-MING; CAO YONG; LIN FEI-YUE: "Extracellular Vesicles Derived from Epidural Fat-Mesenchymal Stem Cells Attenuate NLRP3 Inflammasome Activation and Improve Functional Recovery After Spinal Cord Injury", NEUROCHEMICAL RESEARCH, SPRINGER US, NEW YORK, vol. 45, no. 4, 17 January 2020 (2020-01-17), New York, pages 760 - 771, XP037067821, ISSN: 0364-3190, DOI: 10.1007/s11064-019-02950-x *
LEE GUN WOO, SEO MIN-SOO, KANG KYUNG-KU, OH SE-KYUNG: "Epidural Fat-Derived Mesenchymal Stem Cell: First Report of Epidural Fat-Derived Mesenchymal Stem Cell", ASIAN SPINE JOURNAL, vol. 13, no. 3, 30 June 2019 (2019-06-30), pages 361 - 367, XP055909800, ISSN: 1976-1902, DOI: 10.31616/asj.2018.0215 *

Also Published As

Publication number Publication date
KR20220033444A (en) 2022-03-16

Similar Documents

Publication Publication Date Title
WO2019135644A1 (en) Composition for improving, preventing or treating skin diseases comprising induced pluripotent stem cell-derived mesenchymal stem cell and exosome derived therefrom
KR101705412B1 (en) Composition for preventing or treating immune disease comprising mesenchymal stem cell treated stat3 inhibitor
US11040072B2 (en) Composition for inducing beige adipocyte differentiation containing exosome derived from stem cells
WO2018004143A1 (en) Angiogenesis-promoting composition containing adult stem cell-derived exosome-mimetic nanovesicle
WO2014181954A1 (en) Culture medium composition for improving regenerative capacity of stem cells, and stem cell culturing method using same
WO2017179840A1 (en) Composition for treating chronic pulmonary disease, comprising exosome derived from thrombin-treated stem cell
WO2019117633A1 (en) Cosmetic composition and pharmaceutical composition for alleviating atopic dermatitis, hair loss, and wounds or reducing skin wrinkles
WO2021210872A1 (en) Composition for preventing or treating diabetic skin disease, comprising exosome derived from thrombin-treated stem cell
WO2019004792A9 (en) Preparation method for and use of human-derived cardiac stem cell microspheroid
WO2019198995A1 (en) Exosome-based conversion method for immune cells
KR102184428B1 (en) Method for preparing exosomes from mesenchymal stem cells and culture solution and culture solution produced from the same
WO2019031729A2 (en) Use of composition comprising stem cell-derived exosome as effective ingredient in alleviating non-alcoholic simple steatosis or non-alcoholic steatohepatitis
WO2014185620A1 (en) Stem cell composition for venous administration
WO2022055238A1 (en) Composition for treating bone diseases comprising epidural adipose mesenchymal stem cell-derived exosome
WO2020222483A1 (en) Pharmaceutical composition for treating sepsis or systemic inflammatory response syndrome, comprising isolated mitochondria as active ingredient
WO2023200258A1 (en) Extracellular vesicles isolated from mesenchymal stem cells derived from chemically-induced pluripotent stem cells, and use thereof
KR20160109019A (en) Composition for Prevention or Treatment of Atopic Dermatitis via Intravenous Injection Comprising Adipose-derived Stem Cell
US8394629B2 (en) Use of vinca alkaloids and salts thereof
WO2023027317A1 (en) Composition for treating muscle loss-related diseases comprising exosomes derived from tonsil mesenchymal stem cells
WO2022108165A1 (en) Method for producing exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cells, and use thereof
WO2010077093A2 (en) Composition for promoting hair growth or preventing hair loss comprising erythropoietin
WO2015194710A1 (en) Composition comprising mesenchymal stem cells treated with stat3 inhibitor as active ingredient for preventing or treating immune diseases
WO2019235789A1 (en) Composition, comprising tonsil-derived mesenchymal stem cell-controlling medium, for prevention or treatment of graft-versus-host disease
WO2018088821A1 (en) Composition for promoting stem cell activity, comprising histone deacetylase inhibitor and priming factor as active ingredients
WO2013125899A1 (en) Composition for preventing or treating immune diseases or inflammatory diseases, containing stem cells as active ingredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21867104

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 10/07/2023)

122 Ep: pct application non-entry in european phase

Ref document number: 21867104

Country of ref document: EP

Kind code of ref document: A1