WO2022044054A1 - Système d'exécution d'une détection rapide d'agents pathogènes - Google Patents

Système d'exécution d'une détection rapide d'agents pathogènes Download PDF

Info

Publication number
WO2022044054A1
WO2022044054A1 PCT/IN2021/050840 IN2021050840W WO2022044054A1 WO 2022044054 A1 WO2022044054 A1 WO 2022044054A1 IN 2021050840 W IN2021050840 W IN 2021050840W WO 2022044054 A1 WO2022044054 A1 WO 2022044054A1
Authority
WO
WIPO (PCT)
Prior art keywords
microchip
sample solution
head assembly
rotor
micropump
Prior art date
Application number
PCT/IN2021/050840
Other languages
English (en)
Inventor
Sandeep Kumar JHA
Syed KASIM D.
Harpreet Singh
Shweta Panwar
Kingshuk PANDA
Naveen Kumar Yadav
Sourav Dutta
Kirti LNU
Tarun Singh
Rishi Raj
Original Assignee
Indian Institute Of Technology Delhi
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indian Institute Of Technology Delhi filed Critical Indian Institute Of Technology Delhi
Priority to EP21860791.9A priority Critical patent/EP4204807A4/fr
Publication of WO2022044054A1 publication Critical patent/WO2022044054A1/fr

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/502715—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip characterised by interfacing components, e.g. fluidic, electrical, optical or mechanical interfaces
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L9/00—Supporting devices; Holding devices
    • B01L9/52—Supports specially adapted for flat sample carriers, e.g. for plates, slides, chips
    • B01L9/527—Supports specially adapted for flat sample carriers, e.g. for plates, slides, chips for microfluidic devices, e.g. used for lab-on-a-chip
    • F—MECHANICAL ENGINEERING; LIGHTING; HEATING; WEAPONS; BLASTING
    • F04—POSITIVE - DISPLACEMENT MACHINES FOR LIQUIDS; PUMPS FOR LIQUIDS OR ELASTIC FLUIDS
    • F04B—POSITIVE-DISPLACEMENT MACHINES FOR LIQUIDS; PUMPS
    • F04B19/00—Machines or pumps having pertinent characteristics not provided for in, or of interest apart from, groups F04B1/00 - F04B17/00
    • F04B19/006—Micropumps
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/04—Exchange or ejection of cartridges, containers or reservoirs
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/06—Fluid handling related problems
    • B01L2200/0684—Venting, avoiding backpressure, avoid gas bubbles
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/14—Process control and prevention of errors
    • B01L2200/143—Quality control, feedback systems
    • B01L2200/147—Employing temperature sensors
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/02—Identification, exchange or storage of information
    • B01L2300/025—Displaying results or values with integrated means
    • B01L2300/027—Digital display, e.g. LCD, LED
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/06—Auxiliary integrated devices, integrated components
    • B01L2300/0627—Sensor or part of a sensor is integrated
    • B01L2300/0645—Electrodes
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/06—Auxiliary integrated devices, integrated components
    • B01L2300/0627—Sensor or part of a sensor is integrated
    • B01L2300/0663—Whole sensors
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/18—Means for temperature control
    • B01L2300/1805—Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks
    • B01L2300/1827—Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks using resistive heater
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00—Moving or stopping fluids
    • B01L2400/04—Moving fluids with specific forces or mechanical means
    • B01L2400/0475—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure
    • B01L2400/0487—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure fluid pressure, pneumatics
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00—Moving or stopping fluids
    • B01L2400/06—Valves, specific forms thereof
    • B01L2400/0677—Valves, specific forms thereof phase change valves; Meltable, freezing, dissolvable plugs; Destructible barriers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • the present disclosure generally relates to the field of diagnostics. Particularly, but not exclusively, the present disclosure relates to detection of infections caused by any micro-organism. Further embodiments of the present disclosure describe a system and method for detecting micro-organism such as bacteria, virus, fungi, etc.
  • Antibody or Aptamer based detection technique can catch a few pathogens including bacteria, fungi or sometimes viruses, but their sensitivity remains unsatisfactory without sample preconcentration e.g., in case of lateral flow immunoassay. More sensitive techniques such as surface plasmon resonance is very expensive and instrument exhaustive technique and very difficult to scale up in a pandemic situation like COVID19 outbreak.
  • PCR Polymerase Chain Reaction
  • RT-PCR Reverse Transcription PCR
  • qPCR Quantitative PCR
  • LAMP Loop-Mediated Amplification
  • RT-LAMP RNA reverse Transcription PCR
  • qPCR Quantitative PCR
  • LAMP devices measure turbidity in reaction mix and hence always prone to false positive results due to primer complementarity and mixing of human genomic DNA from sample.
  • PCR reaction is not standalone but would require gel electrophoresis as well and hence is cumbersome and labour extensive procedure.
  • RT-PCR machines are quite expensive and also need sample extraction, pre-treatment and often lead to result in no less than 4-6 hours per sample.
  • One of the conventional techniques includes Microdroplet-manipulation systems and methods for automated execution of molecular biological protocols.
  • Other conventional technique is based on use of RT-LAMP in micro-PCR tubes.
  • RT-LAMP in micro-PCR tubes.
  • such techniques are complex, require human intervention, and analysis of multiple samples using multiple wells.
  • the present disclosure relates to a system for carrying out rapid detection of pathogens.
  • the system comprises an enclosure, a head assembly, a micropump and a microchip.
  • the enclosure has a front cover, a back cover, a bottom cover, and a side cover.
  • the head assembly is coupled with the front cover of the enclosure.
  • the head assembly comprises an opening.
  • the microchip is placed within the opening of the head assembly.
  • the micropump is disposed at the microchip.
  • the micropump is affixed at a predesignated space of over the microchip.
  • the at least one portion of the front cover and the head assembly are movable to place the microchip at the head assembly.
  • the head assembly along with the front cover moves up when a button is pressed ‘up’ .
  • the system is initiated.
  • at least one of a microcontrollers and a control circuit is activated with said pressed button.
  • the microchip is placed behind the front cover, inside the enclosure.
  • the head assembly comprises a hole to accommodate a trapezoidal lead screw, wherein the trapezoidal lead screw is connected to a motor that actuates the head assembly to move at least the front cover of the enclosure.
  • the at least one portion of the front cover is a lower portion of the enclosure.
  • the front cover of the enclosure has an upper portion that includes a display holder to accommodate a display unit.
  • the enclosure comprises a back cover that includes an air exit window to dissipate heat of the system.
  • a rechargeable battery placed at a bottom cover of the enclosure.
  • the present disclosure relates to a micropump of the system for carrying out rapid detection of pathogens.
  • the micropump comprises a chassis, a rotor rotatably, a rotor adapter and a motor shaft adapter.
  • the chassis has a tubular region defined between a closed bottom end and an opened top end. The tubular region is encapsulated by a side wall. At least two grooves are formed at the side wall to accommodate a tube containing sample solution in the chassis.
  • the chassis has a stepped portion. The stepped portion is formed at an internal face of the chassis to facilitate the tube containing sample solution.
  • the rotor rotatably is configured in the tubular region of the chassis.
  • the rotor assembly comprises a plurality of protruded surfaces and protrusions.
  • the plurality of protruded surfaces and protrusions is formed at one surface of the rotor projecting towards the opened top end of the chassis.
  • the rotor comprises a plurality of connectors.
  • the plurality of connectors is formed at the plurality of protruded surfaces of the rotor.
  • the rotor has a cavity. The cavity is formed at periphery of the rotor to facilitate the tube containing sample solution.
  • the rotor adapter is configured to actuate the rotor.
  • the rotor adapter comprises a plurality of holes and a cutout.
  • the plurality of holes is formed at a first face of the rotor adapter to secure the plurality of the connectors of the rotor assembly.
  • the cutout is formed at a second face of the rotor adapter.
  • the motor shaft adapter comprises a protrusion.
  • the protrusion is to be incorporated in the cutout of the rotor adapter in order to actuate the rotor.
  • the micropump has a cap configured at the opened top end of the chassis.
  • the micropump has at least one tube clamp configured at outside surface of the chassis to clamp the tube containing sample solution.
  • the motor shaft adapter is coupled with an electric motor.
  • the rotor is actuated by a microcontroller.
  • the present disclosure relates to a microchip of the system for carrying out rapid detection of pathogens.
  • the microchip comprises a microchannel, a cell lysis zone and at least three microheaters.
  • the microchannel is adapted to flow a sample solution.
  • the cell lysis zone is configured to breakdown the sample solution in the microchannel.
  • the at least three microheaters are configured to heat the sample solution.
  • the at least three microheaters are positioned at some distance from one another.
  • the at least three microheaters are pre-set with different temperature value, defining at least three temperature zones.
  • the microchannel is being passed through at least three temperature zones in order to heat the sample solution at least three different temperatures.
  • the microchip has a plurality of microvalves configured to automate the flow of sample solution within the microchannel.
  • the microchip has at least one wax reservoir configured to collect molten wax. In an embodiment, at least one bubble breaker reservoir configured to break the bubble present in the sample solution.
  • the microchip has an air exit hole configured to release the ambient air from the microchannel when sample solution is taken in.
  • the microchip has a micropump configured to pump the sample solution in the microchannel.
  • the at least three microheaters are controlled at three different temperature values by a microcontroller.
  • At least one nichrome flat heater wire is configured to heat the sample solution.
  • the present invention relates to a method of operating a system for carrying out rapid detection of pathogens.
  • the method comprised the steps of actuating, at least one motor configured to move a head assembly in at least one of up or down direction, wherein the movement of the head assembly enable insertion of a microchip.
  • the method also includes actuating, at least one micropump motor configured to pump a sample solution in a microchannel of the microchip.
  • the method includes activating, an interdigitated electrode (IDE) to perform cell lysis of the sample solution in the microchannel and initiating, at least three microheaters of the microchip, configured to heat the sample solution, detecting, by at least one detector, presence of pathogens from the sample solution treated using the at least three microheaters, and displaying the detection of the presence of pathogen in the sample solution.
  • IDE interdigitated electrode
  • Figure 1 illustrates an isometric view of an enclosure of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 1A illustrates a perspective view of a front cover of the enclosure of Figure 1, in accordance with the present disclosure.
  • Figure IB illustrates front and back view of a front cover of the enclosure of Figure 1, in accordance with the present disclosure.
  • Figure 1C illustrates a perspective view of a back cover of the enclosure of Figure 1, in accordance with the present disclosure.
  • Figure ID illustrates a perspective view of side covers of the enclosure of Figure 1, in accordance with the present disclosure.
  • Figure IE illustrates a perspective view of a bottom cover of the enclosure of Figure 1, in accordance with the present disclosure.
  • Figure 2 illustrates a perspective view of a power unit of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figures 3A and 3B illustrate a perspective view of a head assembly of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figures 4A, 4B and 4C illustrate a perspective view of a micropump of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 5 illustrates a perspective view of a rotor adapter of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 6 illustrates a perspective view of a motor adapter of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 7 illustrates a perspective view of a sample collector of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • FIG. 8 illustrates a block diagram of a control unit of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 9 illustrates a flowchart of an exemplary method of operating a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • Figures 10 and 11 illustrate a perspective view of a microchip of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • Figure 12 illustrates a sensor response graph of PCR of Lambda phage DNA on the ‘direct chip’ version of microchip in the system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • Figure 13 illustrates a sensor response graph of PCR amplification of Lambda phage DNA on the ‘wax chip’ version of microchip in the system for carrying out rapid detection of pathogens in accordance with another embodiment of the present disclosure.
  • Figure 14 illustrates a graph of a calibration curve of different concentration of COVID19 positive control RNA (i.e., 10 1 to 10 6 copies/pL), RT-PCR on microchip ‘wax chip’ version of a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • COVID19 positive control RNA i.e., 10 1 to 10 6 copies/pL
  • RT-PCR on microchip ‘wax chip’ version of a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • Figure 15 illustrates a graph of a FFT (Fast Fourier Transform) based smoothened RT-qPCR curve on microchip ‘direct chip’ version and calculation of Ct value of a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • FFT Fast Fourier Transform
  • Figure 16 illustrates a graph of a FFT (Fast Fourier Transform) based smoothened RT-qPCR curve on microchip ‘wax chip’ version and calculation of Ct value of a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • FFT Fast Fourier Transform
  • FIGS 17 and 18 illustrate a perspective view of a microchip (1700) with one or more heaters made using conductive ink, placement of micropump (400 and 500) and sample inlet (700) for carrying out rapid detection of pathogens, in accordance with an embodiment of the present disclosure.
  • Figure 19 illustrate a perspective view of a microchip (1700) including one or more nichrome flat heater wires of a system for carrying out rapid detection of pathogens, in accordance with an embodiment of the present disclosure.
  • Figure 1 illustrates an enclosure (100) of the system for carrying out rapid detection of pathogens.
  • the enclosure (100) is configured to assemble various electronic and mechanical components such as electric motor, head assembly, electrical switches, display unit, plurality of sensors, PCBs, power sockets, guide rods and rechargeable battery system etc.
  • the enclosure (100) may have different shapes. In an exemplary embodiment, the enclosure (100) has rectangular shape.
  • the enclosure (100) may be divided into two sections as an upper section and a lower section.
  • the upper section is a configured to secure microcontroller, display unit, and their related accessories, while the lower section is configured to accommodate head assembly (300), micropump, microchip and power unit. Both the sections (upper and lower) are divided through a plate extended from the front side towards the back side.
  • the enclosure (100) comprises a front cover (101), side covers (left and right) (102), a back cover (103), a bottom cover (104) and a top cover (105). Each cover of the enclosure (100) has multiple holes to attach with one another by means of screw mechanism.
  • FIGs 1A and IB illustrate front side and back side of the front cover (101) of the enclosure (100).
  • the front cover (101) has an upper portion and a lower portion.
  • the upper portion includes a display holder (101 A).
  • the display holder (101 A) is configured to accommodate a display unit (not shown).
  • the display unit may have a LED display and their related cables.
  • the display unit is configured to indicate heater temperatures, color sensor illumination values and plot response curve graph corresponding color sensor illumination values with respect to time and display Ct value of detected DNA or RNA.
  • the lower portion of the front cover comprises has a front door (10 IB).
  • the front door (10 IB) is movable, upon actuation of an actuator by a user.
  • the movement of the front door (101B) ensures opening of the enclosure to place the microchip inside the enclosure (100).
  • the front door (101B) may have ‘up’ and ‘down’ movement for selectively opening the enclosure (100).
  • the front cover (101) has at least two holes (101C) configured to connect shaft coupling screws.
  • the front cover (101) has a slot (101D) configured to incorporate a pump motor and color sensor wires inside the enclosure (100).
  • At least one hole (10 IE) is formed at the front cover for incorporating IR sensor wire cables and pogo pin heater power cables. There are multiple screw points provided on the front cover
  • FIG. 1C illustrates the back cover (103) of the enclosure (100).
  • the back cover (103) has an air exit window (103 A).
  • the air exit window (103 A) is configured to dissipate heat from the components present inside the enclosure (100).
  • the air exit window (103 A) may have multiple openings to throw heated air of the enclosure (100) towards the environment.
  • the air exit window (103 A) may have different pattern that may be placed at different portions on the back cover (103).
  • the air exist window (103 A) is positioned at the center of the back cover (103).
  • Figure ID illustrates the side covers (102) of the enclosure (100).
  • the side covers are identical to Figure ID.
  • the slots (102) have slots for up-down buttons, a ON-OFF power switch, a power socket, a USB connector, and a SD card.
  • the slots are divided into both (left and right) side covers (102).
  • the slots for up-down buttons (102A), a ON-OFF power switch (102B) and a power socket (102C) are formed in left side cover (102), while the slots for a USB connector (102E) and a SD card (102D) are formed on the right-side cover (102).
  • the up-down buttons (102 A) are configured to move the front door (10 IB) of the front cover (101) in order to place the microchip inside the enclosure (100).
  • the ON-OFF power switch (102B) is configured to turn ‘ON’ and ‘OFF’ the power of the system.
  • the power socket (102C) is configured to provide AC supply to switched-mode power supply (SMPS) in order to charge a power unit (200).
  • the slot for SD card (102D) is provided to incorporate a SD memory card.
  • the slot for USB connector (102E) is provided to connect the USB cable with the microcontroller in order to upload and download program/data.
  • Figure IE illustrates the bottom cover (104) of the enclosure (100).
  • the bottom cover (104) has holes for mounting motor shafts, a trapezoidal screw, and PCBs.
  • the bottom cover (104) defines an area for mounting the power unit (200).
  • the four holes (104C) formed at bottom left corner of the bottom cover are provided to mount a casing (201) of the power unit (200), the two holes (104B) formed at middle portion of the bottom cover provided for mounting motor assembly, the one hole (104 A) formed between the two holes (104B), is provided for the trapezoidal lead screw, the four holes at middle corner are provided to attach the SMPS-PCB board.
  • Figure IF illustrates the top cover (105) of the enclosure (100).
  • the top cover (105) of the enclosure (100) has one or more holes to attach with the front cover (101), side covers (102) and the back cover (103) by means of screw mechanism.
  • FIG 2 illustrates the power unit (200) of the system for carrying out rapid detection of pathogens.
  • the power unit (200) comprises a battery.
  • the battery is housed by the cage (201) of the power unit (200).
  • the cage (201) may be situated at the area (104C) defined by the bottom cover (104) of the enclosure (100), as shown in Figure IE.
  • the battery is configured to provide electric power to electrical units such as electric motors, display unit and PCBs etc.
  • the battery is rechargeable type.
  • the cage (201) of the power unit (200) may have a plurality of air outlets (202) to dissipate heat of the battery.
  • Figures 3A and 3B illustrate a head assembly (300) of the system for carrying out rapid detection of pathogens.
  • the head assembly (300) is coupled with the front cover (101) of the enclosure (100).
  • the head assembly (300) is movable, upon actuation of the actuator by the user.
  • the head assembly (300) has an edge (301A) that is fixedly coupled to the front door (101B) of the front cover (101) of the enclosure (100).
  • the head assembly (300) moves in ‘up’ and ‘down’ direction along with the front door (10 IB) of the front cover (101) so that the microchip (1000) can be placed at the head assembly (300) inside the enclosure (100).
  • the head assembly (300) comprises a hole (301E) to accommodate a trapezoidal lead screw to move the head assembly in ‘up’ and ‘down’ direction, upon actuation of the actuator.
  • the actuator may up-down buttons to which the user operates for opening and closing the front door (10 IB) of the front cover (101) so as to place the microchip (1000) at the head assembly (300) inside the enclosure (100).
  • the head assembly (300) comprises a pump motor disposed at the top and a pair of flange linear ball bearing bushing placed at the bottom side. The head assembly along with the front cover moves up when a button is pressed ‘up’. After pressing the button, the machine is started. The microcontroller and circuit boot up with said pressed button.
  • the microchip on whose body the micropump is fixed with a glue and a predesignated place, is placed behind the front cover, inside the enclosure.
  • the head assembly (300) is to be derived by the pump motor so that the head assembly (300) can move in ‘up’ and ‘down’ direction.
  • the actuator may be up-down buttons.
  • the system for carrying out rapid detection of pathogens comprises a plurality of pogo pins.
  • the plurality of pogo pins may be installed at the main PCB.
  • the main PCB may be positioned at the bottom cover (104) of the enclosure (100) such that the plurality of pogo pins project towards the bottom side of the head assembly (300).
  • the head assembly (300) defines an area at the bottom side to accommodate the microchip (1000) so that it is being pressed by the plurality of pogo pins, when the head assembly (300) moves in ‘down’ direction.
  • the head assembly (300) comprises an opening (301C) that is configured to accommodate a microchip (1000) therein, as shown in Figure 3 A.
  • FIGS 4A, 4B and 4C illustrate a micropump (400) of the system for carrying out rapid detection of pathogens.
  • the micropump (400) is disposed at the microchip (1000).
  • the micropump (400) is located behind the front cover (101B1), inside the enclosure.
  • the micropump (400) sits on top surface of the microchip (1000), glued over a predesignated place.
  • a cutout (502) of the rotor adapter (500) protrudes up from it, which is captured by an end (602) of the motor shaft adapter (600).
  • the motor shaft adapter (600) is attached permanently to the motor shaft within an opening (301B) of the head assembly (300), when the head assembly (300) comes down.
  • the micropump (400) comprises a chassis (401), a rotor (405), and a cap (409).
  • the chassis (401) has a tubular region (402).
  • the tubular region (402) is defined between a closed bottom end (402B) and an opened top end (402 A).
  • the tubular region (402) is encapsulated by a side wall.
  • the chassis has at least two grooves, which are formed at the side wall (402C).
  • the at least two grooves (410) are configured to accommodate a tube containing sample solution in the chassis (401).
  • the tube enters from one groove (410) and exits from other grooves (410).
  • the chassis (401) has a stepped portion (403).
  • the stepped portion (403) is formed at an internal face of the side wall (402C) of the chassis (401).
  • the stepped portion (403) is extended between the at least two grooves (410) so that a portion of the tube containing solution, present in the tubular region (402), can be secured on the stepped portion (403) of the chassis (401).
  • the chassis (401) has at least one tube clamp (404).
  • the at least one tube clamp (404) is configured at outside surface of the chassis (401). In an exemplar embodiment, there are two tube clamps (404) configured for holding the tube containing solution, as shown in Figure 4A.
  • the rotor (405) is rotatably configured in the tubular region (402) of the chassis (401).
  • the rotor (405) has a first surface (406) and a second surface (407).
  • the first surface (406) projects towards the opened top end (402A) of the chassis (401), whereas the second surface (407) lies towards the closed bottom end (402B) of the chassis (401).
  • the rotor (405) has a plurality of protrusions (406A), a plurality of protruded surfaces (406B) and a plurality of connectors (406C).
  • the plurality of protruded surfaces (406B) and the plurality of protrusions (406A) are formed at the first surface (406).
  • the plurality of protruded surfaces (406B) and the plurality of protrusions (406A) project towards the opened top end (402A) of the chassis (401).
  • the plurality of connectors (406C) is formed at the plurality of protruded surfaces (406B) of the rotor (405).
  • the plurality of connectors (406C) projects towards the opened top end (402A) of the chassis (401).
  • the plurality of protruded surfaces (406B) has irregular shape, whereas the plurality of protrusions (406A) and the plurality of connectors (406C) have cylindrical shape.
  • plurality of protruded surfaces (406B), the plurality of protrusions (406A) and the plurality of connectors (406C) may have different shapes.
  • the rotor (405) has a cavity (408).
  • the cavity (408) is formed at periphery of the rotor (405). Particularly, the cavity (408) is formed at the plurality of projection surfaces (406B) such that the cavity (408) facilitates the tube containing sample solution, as shown in Figure 4B.
  • the cap (409) is configured at the opened top end (402A) of the chassis (401).
  • the cap (409) has a hole (409 A) at centre so that the rotor (405) can be derived by means of a pump motor, as shown in Figure 4C.
  • Figure 5 illustrates a rotor actuator (500) of the system for carrying out rapid detection of pathogens.
  • the rotor adapter (500) may have cylindrical shape.
  • (500) has a first surface and a second surface.
  • the first surface has a plurality of holes
  • the plurality of holes (501) of the rotor adapter (500) is formed to secure the plurality of the connectors (406C) so as to actuate the rotor (405), upon receiving power from the pump motor.
  • FIG. 6 illustrates a motor shaft adapter (600) of the system for carrying out rapid detection of pathogens.
  • the motor shaft adapter (600) has two ends (601, 602) in which one end (601) of the motor shaft adapter (600) comprises a protrusion (601) and another end (602) of the motor shaft adapter (600) coupled with pump motor.
  • the protrusion (601) of the motor shaft adapter (600) is configured to be incorporated in the cutout (502) of the rotor adapter (500) so that the rotor adapter (500) can be actuated by the pump motor in order to actuate the rotor (405).
  • the pump motor is electronically coupled and controlled the microcontroller, in order to actuate the rotor (405).
  • FIG. 7 illustrates a sample inlet well (700) of the system for carrying out rapid detection of pathogens.
  • the sample inlet well (700) is disposed at a microchip (1000). Particularly, the sample inlet well (700) is provided at a sample inlet head (reservoir) (1001), as shown in Figures 10 and 11.
  • the sample inlet well (700) is configured to collect the sample solution.
  • the sample inlet well (700) has a top end (701) and a bottom end (702).
  • the top end (701) is provided to receive the sample solution, whereas the bottom end (702) is provided to release the sample solution.
  • the top end (701) of the sample inlet well (700) may have V shape.
  • the V shape of the sample inlet well (700) is configured to eliminate air bubble formation in the sample solution.
  • FIG. 8 illustrates a block diagram of a control unit 800 of the system for carrying out rapid detection of pathogens, in accordance with the present disclosure.
  • the Control unit 800 include a power supply 802.
  • the power supply 802 may be a switchmode power supply (SMPS) configured to receive 230 volts power from AC main supply.
  • the power supply 802 may be configured to convert high voltage AC power to lower voltage DC power.
  • the power 802 may include a regulator to convert the electric power from one form to another based on required characteristics.
  • the power supply 802 may be configured to supply power to the one or more components of the control unit 800.
  • SMPS switchmode power supply
  • the low voltage DC power supply from the power supply 802 may be supplied to a battery 804.
  • the battery may be of 24V power.
  • the power supplied from the power supply 802 may be used by the battery 804 to charge cells of the battery 804.
  • the battery 804 may be connected to a power ON switch 806.
  • the power ON switch 806 may either automatic or manually and configured to switch ON and OFF the power supply to the control unit 800.
  • the Control unit 800 may further include three power supply units 8O8a-8O8c. Each of said unit may include suitable voltage regulator and/or converter configured to supply a desired voltage to connected components.
  • the voltage supply unit 808a may be configured to supply + 18V DC power to a second Metal Oxide Semiconductor Field Effect Transistor (MOSFET) driver 822.
  • the voltage supply unit 808b may be configured to supply +5 V DC power to a microcontroller 810 of the control unit 800.
  • the voltage supply unit 808c may be configured to supply +8V DC power to a first MOSFET driver 812.
  • the first MOSFET driver 812 may be operatively coupled with the microcontroller 810 and heaters T4, T5 814.
  • the MOSFET driver 812 may be configured to receive power supply from the supply unit 808c and a control single from the microcontroller 810 to drive the heaters 814.
  • the microcontroller 810 may be communicably coupled to a color sensor 816.
  • the color sensor 816 may be configured to detect one or more color from the sample flowing through the microchip at various stage of the desired process.
  • the color sensor 816 may be attached with a light emitting diode of suitable wavelength to illuminate the detection zone on microchip (1011) and a 520nm wavelength narrow pass wavelength filter and configured to monitor a dye’s fluorescence enhancement signal.
  • the color sensor 816 may be attached to any suitable wavelength filter configured to monitor suitable color dyes, as desired for the operation of the system.
  • the microcontroller 810 may also be operatively attached to a memory unit 818.
  • the memory unit 818 may be configured to store instructions to be executed by the microcontroller 810 to perform the desired functionality. In other embodiments, the memory unit 818 may be configured to store various parameters received from one or more sensors.
  • the memory unit 818 may include any suitable storage media such as, but not limited to, memory card, pen drive and so forth.
  • the control unit 800 may also include a front door open switch 820 configured to operate front door (10 IB) of the enclosure (100) in open and close condition.
  • the front door open switch 820 may be a manual switch pressed by the user or an automated switch configured to ON and OFF based on a command received from the microcontroller 810.
  • the microcontroller 810 may also be configured to be operatively coupled with second MOSFET driver 822 to operate heater Tl, T2, T3 824.
  • the microcontroller 810 may be configured to operate heater 824 at three different constant temperatures via the second MOSFET driver 822.
  • the microcontroller 810 may be operatively coupled to a motor driver 828 configured to operate one or more pump motor 830,
  • the microcontroller 810 may also be operatively coupled with another motor driver 834 configured to operate a z-axis motor 836.
  • the Z-axis motor 836 may be configured to move the head assembly in z- axis.
  • the microcontroller 810 may be further coupled with an IR sensor 832, configured to detect temperature of the sample at one or more stages of the process.
  • the IR sensor 832 may be configured to detect the temperature of the sample with no direct contact, thus provide greater flexibility and reliability.
  • the microcontroller 810 may also be coupled with a buzzer 838 configured to send one or more indication to a user.
  • the microcontroller 810 may also be configured with a display unit 826.
  • the display unit 826 may include any suitable display device such as a Light Emitting Diode (LED) screen, Liquid Crystal Display (LCD) display screen and so forth.
  • the display unit 826 may be configured to display results of the process of the system 100.
  • the display unit 826 may be a touch screen display which may also be configured to receive one or more user inputs. The results of the test conducted on the sample may be displayed to the user via the display unit 826.
  • the display unit 826 may be configured to display amplification level graph with respect to time along with Ct value and copies/pL concentration of input sample.
  • Figure 9 illustrates a flowchart of an exemplary method 900 of operating a system for carrying out rapid detection of pathogens in accordance with an embodiment of the present disclosure.
  • At block 902 at least one motor configured to move a head assembly in at least one of up or down direction is actuated. The movement of the head assembly enables insertion of a microchip.
  • At block 904 at least one micropump motor configured to pump a sample solution in a microchannel of the microchip is actuated.
  • an interdigitated electrode (IDE) coupled with the microcontroller, is activated to break down the sample solution in the microchannel.
  • FIG. 10 and 11 illustrate the microchip (1000) of the system for carrying out rapid detection of pathogens.
  • the microchip is made from two layers i.e., a first layer and a second layer of PMMA (Polymethyl methacrylate).
  • the microchip (1000) comprises a microchannel (1002), a cell lysis zone (1003) including IDE and a plurality of microheaters (1008).
  • the microchannels are formed on the first layer of the microchip.
  • the microheaters and IDE are disposed on the second layer of the microchip and are bonded to the first layer of the microchip.
  • a side of the first layer of microchip including microchannels faces downward.
  • the microchannel (1002) is adapted to flow a sample solution.
  • the cell lysis zone (1003) is configured to break down the sample solution in the microchannel (1003).
  • the interdigitated electrode (IDE) beneath the cell lysis zone is screen printed using conductive carbon paste and that DC voltage is applied to carry out cell lysis.
  • IDE electrode may be fabricated on the second layer using conductive ink formulation.
  • the IDE may be used to maintain a potential +30V DC for cell lysis of the sample solution.
  • the Alkaline Glycol Lysis method may be used to perform cell lysis on the sample solution.
  • the plurality of microheaters (1008) is configured to heat the sample solution.
  • a nichrome flat heater wire may be used to heat the sample solution.
  • the plurality of microheaters (1008) is positioned at some distance from one another.
  • the plurality of microheaters (1008) pre-set with different temperature value, defining a plurality of temperature zones. Each temperature zone is configured to treat the sample solution at specific temperature value.
  • the microchannel (1002) is being passed through the plurality of temperature zones in order to heat the sample solution at different temperature value.
  • the heaters may be manufactured using conductive ink.
  • the microchip (1000) is designed and constructed into two different versions, which are: ‘direct chip’ and ‘wax chip’. In ‘direct chip’, the microchip comprises one microchannel (1002) and three microheaters (1008).
  • the three microheaters (1008) are beneath the three different temperature zones, which are: denaturation at temperature value 92°-95°C, annealing at temperature value 45°- 65°C and extension at temperature value 60°-72° C.
  • the experiments have been performed with these temperature values. It was used for initial testing and confirmation of chip architecture, and qPCR and RT-qPCR involving dsDNA and ssRNA. For this, the sample has been added onto the microchannel (1002) through micropump (400) or manual pumping.
  • the microchip comprises one sample inlet head (reservoir) (1001), two closing microvalves (1004) and one opening microvalve (1004) to automate sample input, mixing and PCR process, and two additional microheaters (1010) for microvalve operation.
  • the microchannel width may vary with the variation in size of the microchip (1000).
  • the microchip (1000) comprises a plurality of microvalves (1004), a wax reservoir (1006), a bubble breaker reservoir (1007) and an air exit hole (1005).
  • the plurality of microvalves (1004) is configured to automate the sample solution.
  • the wax reservoir (1006) is configured to collect molten wax.
  • the bubble breaker reservoir (1007) is configured to break the bubble present in the sample solution.
  • the air exit hole (1005) is configured to release the air from the sample solution.
  • the micropump (400) is configured to pump the sample solution in the microchannel (1002).
  • the microheaters (1008, 1010) are controlled on at least three different temperature values by the microcontroller.
  • the system may work on other samples such as, but not limited to, gargled saliva, blood sample of a user.
  • the system and the method explained above may also perform calculation of CT value or DNA/RNA.
  • One such method involves slope of response curve and second method include linear fit between a block of data while moving along X axis.
  • the concentration of initial DNA / RNA concentration in terms of copy number / pL can also be reported on screen based on calibration curve.
  • Tables 1 and 2 illustrate qPCR data with lambda phage viral genome (purified commercial dsDNA), in which PCR conditions are shown in terms of a Forward Primer and a Reverse Primer.
  • the Forward Primer is 5’ GCAAGTATCGTTTCCACCGT 3’ and the Reverse Primer is 5’ TTATAAGTCTAATGAAGACAAATCCC 3’.
  • Figure 12 illustrates the result of PCR of Lambda DNA on the microchip ‘direct chip’ version.
  • the result of conducting PCR amplification (qPCR) on the microchip ‘direct chip’ version is positive and there are clear differences between no DNA vs 10 3 and 10 6 copy no. of lambda phage DNA on the microchip, i.e. especially up to 900 data points corresponding to ⁇ 45 cycles of PCR.
  • Figure 13 illustrates the result of qPCR data with lambda phage DNA on the microchip ‘wax chip’ version.
  • the conditions, as applied for PCR of Lambda DNA on the microchip ‘direct chip’ version, are applied for amplification and qPCR with lambda phage DNA on microchip ‘wax chip’ version, which clearly shows no amplification in blank and clear amplification in sensor signal between 500-1200 data points corresponding to ⁇ 45 cycles of reaction with 10 6 copies /pl DNA. These two confirmed the efficacy of the system for qPCR and it is helpful in diagnosing DNA containing pathogens.
  • Figure 14 illustrates the reverse transcriptase reaction on the microchip ‘wax chip’ version started as soon as sample is drawn in and the microvalves are opened and closed at designated positions, so as to create a sealed environment for master mix and sample to circulate continuously inside the channel cycle after cycle.
  • the PCR amplification step is started after 24.16 min on these chips.
  • the concentration of applied RNA sample initially is calibrated, and the slope of curve is used.
  • the device operation, method of analysis is proven to be success with this calibration curve and the same equation is fed in the microcontroller for calculation of values of RNA copy no. in unknown samples.
  • the first peak is observed at 77 min as time is calculated perpendicular to start of linear amplification curve.
  • the PCR amplification cycle is started at 40 min. after following 30 min. of reverse transcriptase cDNA formation step and 10 min. of denaturation of reverse transcriptase. Therefore, the starting time for PCR amplification detection was 37 min (77 min - 40 min).
  • the Ct or Cq value is 28.5 for this RNA.
  • the calculated value is very closed to desired result and hence proven the efficacy of this system and method for rapid detection of SARS COV2.
  • Figure 16 illustrates a FFT (Fast Fourier Transform) based smoothened RT-qPCR curve on microchip ‘wax chip’ version and calculation of Ct value.
  • the cell lysis or viral coat lysis is possible on the microchip to extract genetic material, bacteria Escherichia coli DH5a cells grown in Luria broth under optimal shaking conditions to mid log phase and harvested by centrifugation, washed with PBS buffer thrice to remove any adhered DNA and suspended 5xl0 8 c.f.u. in 100 pl solution containing IX TE buffer and 0.1% Tween-20 solution.
  • FFT Fast Fourier Transform
  • the voltage-based method can be used on microchip, an alternate method is also sought which can be applied on viscous mucous containing sample such as saliva.
  • FIGS 17 and 18 illustrate a microchip (1700) including one or more heaters fabricated using conductive ink, positioning of micropump (400 & 500) and sample collector (700). Since the other components present in the microchip (1800) are similar to the microchip (1000), the description of said components has been omitted for the sake of brevity.
  • Figures 19 illustrate a microchip (1900) including one or more nichrome flat heater wires.
  • the one or more nichrome flat heater wires are configured to heat the sample solution.
  • the nichrome flat heater wire is an alternative of the microheaters (1008), used in the microchip (1000). Since the other components present in the microchip (1800) are similar to the microchip (1000), the description of said components has been omitted for the sake of brevity.
  • the functions described may be implemented in hardware, software, firmware, or any combination thereof. If implemented in software, the functions may be stored on or transmitted over, as one or more instructions or code, a computer-readable medium and executed by a hardware-based processing unit.
  • Computer-readable media or memory may include computer-readable storage media, which corresponds to a tangible medium such as data storage media, or communication media including any medium that facilitates transfer of a computer program from one place to another, e.g., according to a communication protocol.
  • computer- readable media generally may correspond to (1) tangible computer-readable storage media which is non-transitory or (2) a communication medium such as a signal or carrier wave.
  • Data storage media may be any available media that can be accessed by one or more computers or one or more processors to retrieve instructions, code and/or data structures for implementation of the techniques described in this disclosure.
  • a computer program product may include a computer- readable medium.
  • Such computer-readable storage media or memory can comprise RAM, ROM, EEPROM, CD-ROM or other optical disk storage, magnetic disk storage, or other magnetic storage devices, flash memory, or any other medium that can be used to store desired program code in the form of instructions or data structures and that can be accessed by a computer. Also, any connection is properly termed a computer-readable medium.
  • coaxial cable, fiber optic cable, twisted pair, digital subscriber line (DSL), or wireless technologies such as infrared, radio, and microwave are included in the definition of medium.
  • DSL digital subscriber line
  • computer-readable storage media and data storage media do not include connections, carrier waves, signals, or other transient media, but are instead directed to non-transient, tangible storage media.
  • Disk and disc includes compact disc (CD), laser disc, optical disc, digital versatile disc (DVD), floppy disk and Blu-ray disc, where disks usually reproduce data magnetically, while discs reproduce data optically with lasers. Combinations of the above should also be included within the scope of computer-readable media.
  • processors such as one or more digital signal processors (DSPs), general purpose microprocessors, application specific integrated circuits (ASICs), field programmable logic arrays (FPGAs), or other equivalent integrated or discrete logic circuitry.
  • DSPs digital signal processors
  • ASICs application specific integrated circuits
  • FPGAs field programmable logic arrays
  • processors may refer to any of the foregoing structure or any other structure suitable for implementation of the techniques described herein.
  • the functionality described herein may be provided within dedicated hardware and/or software modules configured for encoding and decoding, or incorporated in a combined codec. Also, the techniques could be fully implemented in one or more circuits or logic elements.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Clinical Laboratory Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dispersion Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Mechanical Engineering (AREA)
  • Hematology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

La présente divulgation concerne un système d'exécution d'une détection rapide d'agents pathogènes Le système comprend une enceinte, un ensemble tête, une micropompe et une micropuce. L'enceinte comprend un couvercle avant, un couvercle arrière, un couvercle inférieur et un couvercle latéral. L'ensemble tête est accouplé au couvercle avant de l'enceinte. L'ensemble tête comprend une ouverture. La micropuce peut être placée dans l'ouverture de l'ensemble tête. La micropompe est disposée au niveau de la micropuce. La ou les parties du couvercle avant et de l'ensemble tête est (sont) mobile(s) pour permettre le placement de la micropuce au niveau de l'ensemble tête. La micropuce comprend un puits d'entrée d'échantillon destiné à recevoir une solution d'échantillon, un microcanal destiné à faire circuler la solution d'échantillon, une zone de lyse de cellules conçue pour décomposer la solution d'échantillon dans le microcanal, ainsi qu'au moins trois micro-réchauffeurs conçus pour chauffer la solution d'échantillon à trois températures différentes.
PCT/IN2021/050840 2020-08-31 2021-08-31 Système d'exécution d'une détection rapide d'agents pathogènes WO2022044054A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP21860791.9A EP4204807A4 (fr) 2020-08-31 2021-08-31 Système d'exécution d'une détection rapide d'agents pathogènes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN202011037535 2020-08-31
IN202011037535 2020-08-31

Publications (1)

Publication Number Publication Date
WO2022044054A1 true WO2022044054A1 (fr) 2022-03-03

Family

ID=80352792

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IN2021/050840 WO2022044054A1 (fr) 2020-08-31 2021-08-31 Système d'exécution d'une détection rapide d'agents pathogènes

Country Status (2)

Country Link
EP (1) EP4204807A4 (fr)
WO (1) WO2022044054A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142692A2 (fr) * 2005-11-14 2007-12-13 The Government Of The Usa, As Represented By The Secretary Of The Navy Système automatisé échantillon à microréseau
US8298763B2 (en) * 2007-03-02 2012-10-30 Lawrence Livermore National Security, Llc Automated high-throughput flow-through real-time diagnostic system

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101465701B1 (ko) * 2008-01-22 2014-11-28 삼성전자 주식회사 핵산 증폭 장치
AU2018255430B2 (en) * 2017-04-21 2022-12-08 Mesa Biotech, Inc. Fluidic test cassette
EP3676009A4 (fr) * 2017-09-01 2021-06-16 Miroculus Inc. Dispositifs microfluidiques numériques et leurs procédés d'utilisation
EP3706906A4 (fr) * 2017-11-10 2021-11-03 Visca, LLC Dispositif d'évaluation rapide pour l'exposition à un rayonnement
CN110387313B (zh) * 2019-08-07 2022-09-02 哈尔滨工业大学 一种基于气泡混合的磁泳微流控芯片

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142692A2 (fr) * 2005-11-14 2007-12-13 The Government Of The Usa, As Represented By The Secretary Of The Navy Système automatisé échantillon à microréseau
US8298763B2 (en) * 2007-03-02 2012-10-30 Lawrence Livermore National Security, Llc Automated high-throughput flow-through real-time diagnostic system

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4204807A4 *

Also Published As

Publication number Publication date
EP4204807A1 (fr) 2023-07-05
EP4204807A4 (fr) 2024-08-07

Similar Documents

Publication Publication Date Title
JP2016101166A (ja) ユニバーサルサンプル調製システムおよび統合解析システムの使用方法
JP4240332B2 (ja) ポリメラーゼ連鎖反応ｄｎａ増幅および検出方法
US9284520B2 (en) Instruments for biological sample preparation devices
TWI230257B (en) Integrated analytical biochip and manufacturing method thereof
EP3360976B1 (fr) Appareil à convection thermique pour une réaction en chaîne de la polymérase
US9518291B2 (en) Devices and methods for biological sample-to-answer and analysis
US9090890B2 (en) Devices and methods for biological sample preparation
CN111902212A (zh) Lamp检测装置
US8405006B2 (en) Small footprint heater
WO2022044054A1 (fr) Système d'exécution d'une détection rapide d'agents pathogènes
CN111148573A (zh) 用于快速样品处理和分析的装置和方法
WO2014071257A1 (fr) Dispositifs et procédés de préparation d'échantillons biologiques
WO2016004155A1 (fr) Dispositifs et procédés permettant de surveiller et de quantifier l'amplification d'acide nucléique
TWI656211B (zh) 一種熱對流式聚合酶鏈式反應裝置
WO2003092893A1 (fr) Dispositif integre servant a effectuer une recherche genetique et equipement d'examen et de lecture correspondant
US20120040856A1 (en) Method for detecting the presence of liquids in a microfluidic device, detecting apparatus and corresponding microfluidic device
US10307755B1 (en) Apparatuses and methods for sample-specific self-configuration
EP4180128A1 (fr) Dispositif miniature d'amplification isotherme d'acides nucléiques
EP1631387B1 (fr) Dispositif concu pour des reactions en chaine de la polymerase
US20120164649A1 (en) System, devices and methods for monitoring and detection of chemical reactions
Uddin et al. Optimization of the Amplicons Detection System of Loop-Mediated Isothermal Amplification on Microfluidic Compact Disk
CN214694197U (zh) 一种核酸提取扩增检测一体机
RU216488U1 (ru) Станция для одноразового картриджа для изотермической амплификации
KR102401332B1 (ko) 채널에 에어 포켓이 있는 pcr 칩
US20220099621A1 (en) Nucleic acid detection kit and nucleic acid detection device

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21860791

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021860791

Country of ref document: EP

Effective date: 20230331