WO2022035033A1 - Primer set for detecting severe fever with thrombocytopenia syndrome virus, and diagnostic kit using same - Google Patents

Abstract

The present invention relates to: a composition for detecting a severe fever with thrombocytopenia syndrome (hereinafter referred to as SFTS) virus; a diagnostic kit; and a method for providing information for SFTS diagnosis, and comprises a first primer set of SEQ ID NOs: 7 and 8 and a second primer set of SEQ ID NOs: 9 and 10, and thus can detect, with high sensitivity, an SFTS virus in a specimen.

Description

Primer set for detection of severe fever with thrombocytopenia syndrome virus and diagnostic kit using the same

The present invention has been made under project number HG18C0028 with the support of the Ministry of Health and Welfare, the Ministry of Science and ICT, the Ministry of Agriculture, Food and Rural Affairs, the Ministry of Trade, Industry and Energy, the Ministry of Public Administration and Security, the Ministry of Environment and the Ministry of Food and Drug Safety, and the research management institution of the above project is (re) Infectious disease research and development project group of ministries related to quarantine, the research project name is “Infectious disease research and development project of ministries related to quarantine”, the research project name is “Development and standardization of effective diagnostic methods for pathogens in vectors (mites, mosquitoes) through international joint research”, the lead institution Chonnam National University Industry-Academic Collaboration Group, the research period is 2018.08.06 ~ 2020.12.31.

This patent application claims priority to Korean Patent Application No. 10-2020-0102539 filed with the Korean Intellectual Property Office on August 14, 2020, the disclosure of which is incorporated herein by reference.

The present invention relates to a primer set for detecting Severe Fever with Thrombocytopenia Syndrome virus transmitted by ticks and a diagnostic kit using the same.

Severe Fever with Thrombocytopenia Syndrome (hereinafter, SFTS) is a disease transmitted to humans by ticks infected with SFTS virus as a carrier of the disease. SFTS was identified in China in the 2000s, and the pathogen Huaiyangshan banyangvirus was discovered in 2011.

The symptoms of SFTS are characterized by thrombocytopenia and high fever, and additionally, gastrointestinal failure, leukopenia, and multiple organ failure. It has been confirmed that SFTS has a fatality rate of up to 30% in patients with weakened immunity, such as young children and the elderly. In addition, according to a recently published study, it has been reported that secondary infection occurs when closely exposed to SFTS-infected body fluids or blood even without direct contact with ticks. Therefore, SFTS is a disease requiring attention to infection and prevention.

Ticks that cause SFTS include dog tick, mite tick, and Japanese tick, which are known to expand their habitats mainly through wild animals. In particular, the aforementioned ticks inhabit all of Korea, China and Japan, and cause many infections and deaths every year.

Methods for diagnosing such SFTS include culture method, enzyme-linked immunosorbent assay (ELISA), and indirect fluorescent antibody assay (　IFA). In Korea, only the Korea Centers for Disease Control and Prevention, which is the central institution for national public health management, utilizes it because it requires specialized manpower and special equipment to perform it.

Conventional Reverse Transcription Polymerase Chain Reaction (hereinafter referred to as Conventional RT-PCR), Nested Reverse Transcription Polymerase Chain Reaction, and Nested Reverse Transcription Polymerase Chain Reaction are molecular diagnostics. ; Hereinafter, Nested RT-PCR) and Onestep Realtime Reverse Transcription Polymerase Chain Reaction (hereinafter, Onestep Realtime RT-PCR) are preferred. Currently, in Korea, Conventional RT-PCR, Nested RT-PCR, and Onestep Realtime RT-PCR have been developed for rapid diagnosis of SFTS and are being used in diagnostic tests.

However, both RT-PCR and real-time RT-PCR have low reliability and sensitivity in complex and small samples such as ticks, and thus have a high false-negative rate. If the amplification product to be subjected to PCR is not clean, other substances as well as the amplification product to be tested due to non-specific binding may be amplified. Secondary PCR is performed by preparing a specific primer again inside it. At this time, the primer used on the outside for the first PCR is called an outer primer, and the primer prepared on the inside for the second PCR is called a nested primer. By performing the PCR twice in this way, more accurate PCR results can be obtained. For this reason, the Centers for Disease Control and Prevention (CDC) used a nested PCR method in which primary RT-PCR was performed with an outer primer and the PCR amplification product of a low concentration amplified through this was amplified again with nested primers.

This method has the advantage of effectively detecting the SFTS virus in ticks and contributing to public health based on it, but the sensitivity is low because all PCR amplification products are electrophoresed and the results are judged based on the band intensity. It is low, and the analysis procedure is cumbersome, and the time required is also long.

In order to improve the efficiency and sensitivity of the conventional primer set for diagnosing severe fever with Thrombocytopenia Syndrome (SFTS), the present inventors built a SFTS genome database with recent mutations, and based on this, In comparison, intensive research efforts were made on a composition, kit, and method of providing information for diagnosis, including a primer set for detecting SFTS virus that has high amplification efficiency and can be used immediately at the quarantine site. As a result, a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; And a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10; By identifying a composition for detecting SFTS virus comprising the same, a diagnostic kit comprising the same, and a method of providing information for SFTS diagnosis, the present invention invention was completed.

Accordingly, it is an object of the present invention to provide a composition for detecting SFTS virus comprising a primer set for detecting SFTS virus.

Another object of the present invention is to provide a kit for diagnosing SFTS virus including a primer set for detecting SFTS virus.

Another object of the present invention is to provide a method for providing information for SFTS diagnosis.

The present invention relates to a primer set for detecting Severe Fever with Thrombocytopenia Syndrome (SFTS) virus and a diagnostic kit using the same, and more particularly, the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8 A first primer set consisting of; And to provide a method for providing information for diagnosing a composition, diagnostic kit, and SFTS infection comprising a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10.

Hereinafter, the present invention will be described in more detail.

An example of the present invention is a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; and

a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

It relates to a composition for detecting a severe fever with platelet syndrome virus comprising a.

In the present invention, the primer used for gene amplification is a nucleic acid sequence having a short free 3-terminal hydroxyl group, which can form a base pair with a complementary template and refers to a short nucleic acid that functions as a starting point for template strand copying. . The primer is capable of initiating DNA synthesis in the presence of a reagent for the polymerization reaction (ie, DNA polymerase or reverse transcriptase) and the four different nucleoside triphosphates in an appropriate buffer solution and temperature.

In the present invention, primers are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers may incorporate additional features that do not change the basic properties of the primer to serve as the starting point of DNA synthesis.

In addition, the primer can be chemically synthesized using a phosphoramidite solid support method, or other well-known methods. The sequence of the primers may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, “encapsulation”, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phospho poroamidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

In the present invention, the primer comprises one or more additional covalently linked residues, for example, a protein (eg, a nuclease, a toxin, an antibody, a signal peptide, poly-L-lysine, etc.), an insertion agent (eg, acridine). , psoralen, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. The primer may also be modified with a label capable of directly or indirectly providing a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, biotin, and the like.

In the present invention, the first or second primer set is a group consisting of S segment (S segment, S segment), M segment (Medium segment, M segment) and L segment (Large segment, L segment) of severe fever with thrombocytopenia syndrome virus It may be complementary binding to one or more segments selected from, for example, binding to M segment, but is not limited thereto.

Another example of the present invention is a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; and

a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

It relates to a kit for diagnosing severe fever with thrombocytopenia syndrome, comprising a composition for detecting a virus for severe fever with thrombocytopenia comprising a.

Another embodiment of the present invention relates to a method of providing information for diagnosing severe fever with thrombocytopenia, comprising the steps of:

A first amplification step of performing RT-PCR (Reverse Transcription Polymerase Chain Reaction) amplification using the RNA isolated from the subject as a template;

a second amplification step of sequentially amplifying the Nested-Realtime PCR (Nested Realtime Polymerase Chain Reaction) using the PCR amplification product amplified in the first amplification step as a template; and

A confirmation step of confirming the PCR amplification product amplified in the second amplification step.

In the present invention, the first amplification step may be performed using a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, but is not limited thereto.

In the present invention, the second amplification step may be performed using a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10, but is not limited thereto.

In the present invention, the subject may be one or more selected from the group consisting of humans, wild animals, livestock and companion animals, but is not limited thereto.

In the present invention, the RNA isolated from the subject may be isolated from the sample obtained from the subject. The sample may be one or more selected from the group consisting of tissue, blood, serum, saliva, urine, semen, and body fluid, but is not limited thereto.

As used herein, the term “reverse transcription-PCR (RT-PCR)” refers to, for example, reverse transcription of a target nucleic acid and amplification by PCR.

As used herein, the term "PCR amplification product" refers to an amplification product generated after performing the first or second PCR.

As used herein, the term "Nested PCR" refers to a method for reducing the amplification of non-specific binding in which a primer is attached to a nucleotide sequence other than a target as a modification of PCR. Conventional PCR requires a primer complementary to the end of the target DNA sequence, and PCR amplification products are amplified according to the cycle. A common problem is that the primer is attached to an inaccurate nucleotide sequence site rather than a target template nucleotide region to create an unwanted strand. This problem appears as the PCR cycle increases. In nested PCR, two sets of primers are used in two consecutive PCRs to enhance specific DNA amplification.

The first PCR amplification product may include non-specific target amplification. The first PCR amplification product is used as a template for the second PCR. The second PCR uses nested primers attached to the (nested) base sequence located in the first PCR amplification product or increases specificity by 'hemi, semi-nesting' method. Since the second PCR is complementary to the specific nucleotide sequence of the first PCR amplification product, non-specific amplification products are not amplified.

This reduces the number of first PCR amplification and minimizes the production of non-specific amplification products that increase as the cycle increases, so more PCR cycles can be run. Nested PCR is useful for PCR with very rare templates or high background. Nested PCR is more successful in amplifying long DNA than general PCR, but requires more specific target sequence knowledge.

As used herein, the term "real-time PCR" refers to the application of a fluorescent material to the PCR technique, and the degree of emission of the fluorescent material is measured in real time along with the amplification of the target gene present in the sample during the reaction. It means a method that can quickly and accurately analyze the presence or absence of amplification of a target gene and its aspect by detecting and quantitatively analyzing it. Such real-time PCR is divided into a method using SYBR Green and a method using a double-labeled probe.

As used herein, the term "SYBR green technique" binds to the amplified DNA in the real-time PCR amplification process to generate a fluorescence signal. A way to measure production. In addition, the real-time PCR technique using a dual labeled probe is a method using a double-labeled probe labeled with a fluorescent material at the 5' end and a quencher at the 3' end. It can be checked whether the double-labeled probe is annealed with the PCR amplification product of the target gene through the fluorescence signal by the labeled probe, and real-time PCR known in the art such as the Tackman probe method of the target gene is applicable. .

In the present invention, the confirmation step is a melting curve temperature of 80 to 90 ℃, 80 to 89 ℃, 80 to 88 ℃, 80 to 87 ℃, 80 to 86 ℃, 81 to 90 ℃, 81 to 89 ℃, 81 to 88 ℃ , 81 to 87 °C, 81 to 86 °C, 82 to 90 °C, 82 to 89 °C, 82 to 88 °C, 82 to 87 °C, 82 to 86 °C, 83 to 90 °C, 83 to 89 °C, 83 to 88 °C , 83 to 87 °C, 83 to 86 °C, 84 to 90 °C, 84 to 89 °C, 84 to 88 °C, 84 to 87 °C, 84 to 86 °C, 85 to 90 °C, 85 to 89 °C, 85 to 88 °C , 85 to 87 ℃, 85 to 86 ℃, 86 to 90 ℃, 86 to 89 ℃, 86 to 88 ℃, for example, in the case of 86 to 87 ℃, it may be to determine whether severe fever with platelet syndrome infection as positive , but is not limited thereto.

In the present invention, the confirmation step may be performed by at least one selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement, but is not limited thereto.

In the present invention, SYBR green is bound to the amplified DNA, and when SYBR green bound to the amplified DNA generates a fluorescence signal, the fluorescence signal is detected to determine the presence of the target gene and the amplification product therefrom. The final amplification product is measured with Nested-Realtime PCR, a method for measuring the production of That is, it does not require an additional electrophoresis process.

In the present invention, when the amplified amplification product is blast-analyzed and compared with the sequence of the SFTS virus itself, if the total score is 700 to 1000, it can be determined to have an effective value.

In the present invention, when the amplified amplification product is blast-analyzed and compared with the sequence of the SFTS virus itself, if the identity score is 95 to 100%, it can be determined to have an effective value.

The present invention relates to a composition for detecting Severe Fever with Thrombocytopenia Syndrome (SFTS) virus, a kit for diagnosis, and a method for providing information for diagnosing SFTS. By establishing a database, the diagnosis efficiency can be increased compared to the existing method by using a composition for detecting severe fever with thrombocytopenia syndrome virus, a diagnostic kit, and a method that provides information for SFTS diagnosis, and can be used immediately at the quarantine site.

Figure 1a is a photograph showing the state of collecting mites ( Ixodidae spp. ) using a flag according to a manufacturing example of the present invention.

1b is a photograph showing mites collected on a flag according to a manufacturing example of the present invention.

1c is a photograph showing a tube containing mites collected as a sample according to one preparation example of the present invention.

Figure 2a is a graph showing the distribution of genome data for each segment of a severe fever with thrombocytopenia syndrome (Severe Fever with Thrombocytopenia Syndrome, hereinafter, SFTS) virus according to a preparation example of the present invention.

Figure 2b is a graph showing the distribution of genomic data for each country (Korea, China and Japan) of the SFTS virus according to one preparation of the present invention.

3 is a schematic diagram illustrating a database construction and utilization method based on RNA sequence data according to a preparation example of the present invention.

4 is a diagram showing alignment of the M segment (Medium segment, M segment) of the SFTS virus according to a manufacturing example of the present invention.

5 is a schematic diagram showing a process for detecting SFTS virus by conventional RT-PCR and nested PCR detection methods of a comparative example of the present invention.

6 is an electrophoresis photograph showing the detection result of the SFTS virus amplification product after performing RT-PCR and nested PCR by extracting RNA from a sample isolated from ticks according to a comparative example of the present invention.

Figure 7a is a graph showing the result of performing nested-realtime PCR of the PCR amplification product in Example 1-2 of the present invention as a melting curve.

Figure 7b is an electrophoresis picture showing the results of comparison with the negative control and the amplification of the SFTS virus and positive control through Nested-Realtime PCR in Example 1-2 of the present invention.

Figure 8a is a schematic diagram showing the process for detecting the SFTS virus by RT-PCR and nested-realtime PCR detection method of Example 2 of the present invention.

Figure 8b is a schematic diagram including the electrophoresis step after the process for detecting the SFTS virus by RT-PCR and nested-realtime PCR detection method of Example 2 of the present invention.

Figure 9a is a graph showing the melting curve analysis results after performing nested-realtime PCR in Example 2-2 of the present invention.

Figure 9b is an electrophoresis picture showing the detection result of the SFTS virus amplification product after performing nested-realtime PCR in Example 2-2 of the present invention.

10A is an electrophoresis photograph showing the result of amplification (560 bp) of SFTS B type RNA diluted by concentration of Example 3 of the present invention by RT-PCR.

10b is an electrophoresis photograph showing the nested PCR amplification product result (245 bp) of SFTS B type RNA diluted by concentration of Example 3 of the present invention.

10c is an electrophoresis photograph showing the result (565 bp) of the RT-PCR amplification product of SFTS B type RNA diluted by concentration of Example 3 of the present invention.

10d is an electrophoresis photograph showing the result of nested PCR amplification (496 bp) of SFTS B type RNA diluted by concentration of Example 3 of the present invention.

11 is a systematic diagram of an SFTS virus isolate analyzed using sequencing data according to Example 4 of the present invention.

12A is a graph showing the result of comparing the sequence length of the PCR amplification product with Comparative Example 1 after sequencing the amplification product according to Example 2 of the present invention in the Sanger method.

12b is a graph showing the overall score compared to Comparative Example 1 by comparing the amplification product according to Example 2 of the present invention with the sequence of the SFTS virus itself after blast analysis.

12c is a graph showing the identity index compared to Comparative Example 1 by comparing the amplification product according to Example 2) of the present invention with the sequence of the SFTS virus itself after blast analysis.

a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; And a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10; to a composition for detecting Severe Fever with Thrombocytopenia Syndrome (SFTS) virus, including a.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Preparation Example 1. Severe fever thrombocytopenia syndrome virus sequence database construction for primer design

1-1. Securing Severe Fever Thrombocytopenia Syndrome Virus Samples for Database Construction

Severe Fever with Thrombocytopenia Syndrome (hereinafter referred to as SFTS) In order to secure a tick ( Ixodidae spp .) suspected of being infected with the SFTS virus, the Severe Fever with Thrombocytopenia Syndrome (SFTS) virus sample, Sabuk-myeon, Chuncheon-si, Gangwon-do Ticks were collected using flags in (FIG. 1a). It is useful to use a flag to collect mites, as they exist mainly in thick bushes, but when an attachment target such as a person or an animal passes through the bush, they attach to the host and move.

Ticks buried in flags (FIG. 1b) were collected and samples suspected of infection with severe fever with thrombocytopenia syndrome were secured in a tube (FIG. 1c).

1-2. Construction of database for each segment of severe fever with thrombocytopenia syndrome virus

A database (data base; hereinafter, DB) for each segment of the SFTS virus was constructed. The SRA file was downloaded from NCBI genbank and changed to Fasta format using the NCNI-SRA toolkit. Then, sequence assembly was performed with an IDBA assembler. In order to remove the redundant sequence from the assembled sequence, the redundant sequence was removed using the CD-HIT program. After that, the database was built with the NCBI Blastdb make command using the generated file. The created database used a sequence server program to run a local blast server. The specifications of the computer that performed this analysis are CPU, AMD Ryzen Threadripper 2950X 1ea, Memory: 96GB, Storage1: Samsund SSD 970 EVO 1TB, Storage2: WD NAS 4TB HDD.

A total of 1,159 sequences were obtained, classified by virus genome data, and indicated by segment and country (Korea, China, and Japan) (Figs. 2a and 2b). The data constructed in this way was used to analyze the virus sequence.

1-3. Securing background sequences other than severe fever with thrombocytopenia syndrome virus for database construction

To design a background sequence database other than the SFTS virus present in ticks ( Ixodidae spp .), NCBI-SRA was conducted with ticks, H. Longicornis and H. Longicornis. flava ) of the total RNA sequence (RNA sequence) data was obtained.

SFTS virus can be transmitted not only by small tick, but also by dog tick (H. of 95 to 98%, and the currently published genomic DNA data relates to the small tick and the dog tick, so RNA sequence data of two species were included.

Based on the RNA sequence data obtained from Genbank, De novo sequence assemblers designed a de novo contig using IDBA software, and the database construction and utilization method is shown in Figure 3 same as

All of the S, M, and L segments were confirmed to be relatively conservative, but in the present invention, similar amplification sites were set so that they could be compared with the diagnostic method for partial detection of M segments used by the Korea Centers for Disease Control and Prevention and the Institute for Health and Environment. Severe fever thrombocytopenia syndrome virus M segment alignment (alignment) was visualized using UGENE after alignment using MAFFT, and the sequence is shown in Table 1 (SEQ ID NO: 1) and FIG. 4 . In addition, a positive control sequence was prepared in order to confirm whether the PCR reaction proceeded normally in the PCR detection and diagnosis process (Table 1 SEQ ID NO: 2). The positive control sequence was designed to generate a PCR amplification product having a smaller size than the actual positive result so that it could be distinguished from the actual positive sample.

SEQ ID NO:	segment	Sequence Listing (5'---> 3')
One	M		RGCWAAYATCCCAAGCCCWACAGAYTGGCTRAATGCCYTGTTTGGCAATGGGCTGAGYAGGTGGRTYCTKGGGGTRATRGGGGTYCTRCTKGGGGGRTTRGCYCTCTTYTTCWTRATYATGTYTTTGYTYAARYTGGGRACAAAACARRTRTTTCGATCRAGGACRAAGCTGGCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
2	positive control	GCTGTGATGAGATGGTCCATGCTGATTCCAAGCTTGTTTCATGCAGGCAAGGCATGCGCAACTTGTGAAGTGTCTACTATCCTTAAACGCATATCTCATGAAGGAATGTGTCACAACTGGATCTGATGTTGCCCGGGCCGAGTTAGTGTTGAGCTCGAGTGGGAACTTAGCTTGTATGAGTAGTGATTTGGATCGAGTGCCATGATCGATCGATCGACATGAGAGTGGGATGCTTGTATGAGTAGTGATTTGGATAAGAGTTGTAGGCTCAG

A similar amplification site was set for comparison with the diagnostic method for detecting a part of the M segment (565 bp) being used by the Korea Centers for Disease Control and Prevention and the Institute for Health and Environment. As a result of the analysis, it was confirmed that the M segment was relatively conservative.

Preparation Example 2. Design of Primer

Severe Fever with Thrombocytopenia Syndrome virus genome sequence DB constructed in Preparation Example 1-2 and the background host genome database constructed in Preparation Example 1-3 A primer was designed and shown in Table 2.

order number	division	designation	Sequence List (5`- -> 3`)	bp
3	existing method first PCR forward primer	SFTS-MF3	GATGAGATGGTCCATGCTGATTCT	1708-1731
4	existing method first PCR reverse primer	SFTS-MR2	CTCATGGGGTGGAATGTCCTCAC	2245-2267
5	existing method Second PCR Forward Primer	SFTS-2nd-F	TAAACTTGTGTCGTGCAG	1731-1750
6	existing method second PCR reverse primer	SFTS-2nd-R	CCCAGCGACATCTCCTTACA	1956-1975
7	first PCR forward primer	SFTS-1FW	GCTGYGATGAGATGGTCCATGC	1703-1724
8	first PCR reverse primer	SFTS-1RV	CTCATGGGGTGGAATGTCCTCAC	2245-2267
9	Second PCR Forward Primer	SFTS-2FW-v2	ATGAAGGAATGYITCACAACTGG	1765-1787
10	second PCR reverse primer	SFTS-2Rev-v2	GTGGAATGTCCTCACITCICC	2239-2259

Comparative Example 1. SFTS virus detection through conventional RT-PCR and nested RT-PCR of nucleic acids extracted from ticks suspected of having severe fever with thrombocytopenia syndrome (SFTS)

As shown in FIG. 5 in order to detect Severe Fever with Thrombocytopenia Syndrome (SFTS) virus, the RNA of ticks obtained in Preparation Example 1 is extracted and then reverse transcription polymerization is the first conventional detection method. Detection was performed by sequentially performing the Reverse Transcription Polymerase Chain Reaction (hereinafter, RT-PCR) and secondly, the Nested Polymerase Chain Reaction (hereinafter, Nested PCR).

1-1. First RT-PCR detection test

RT-PCR was performed in which reverse transcription and PCR amplification were sequentially performed using the RNA extracted from the ticks obtained in Preparation Example 1 and the primer set designed in Preparation Example 2. Specific experimental conditions are shown in Tables 3 and 4.

Element	usage
2x PCR master mix	10 ul
Primer mix: Existing first PCR forward primer: SFTS-MF3 (10 pmol/ul) Existing first PCR reverse primer: SFTS-MR2 (10 pmol/ul)	1 ul
RNA	5 ul
Molecular biology grade water	4 ul

step	temperature	hour	number of repetitions
RT reaction	50 ℃	30 min	1 cycle
hot start	95 ℃	15 min	1 cycle
Denatures	95 ℃	20 sec	35 cycle
Annealing	62 ℃	40 sec
Extension	72 ℃	30 sec
final extension	72 ℃	5 min	1 cycle
Store	4 ℃	forever	-

Through the first RT-PCR, a 560 bp primary amplification product (Product) was obtained.

1-2. Second Nested PCR Amplification Test

The second step, nested PCR, was performed with the PCR amplification product generated through the first RT-PCR. Specific experimental conditions are shown in Tables 5 and 6.

Element	usage
2x qPCR master mix (with intercalating dye)	10 ul
Primer mix: Existing second PCR forward primer: SFTS-2nd-F (10 pmol/ul) Existing second PCR reverse primer: SFTS-2nd-R (10 pmol/ul)	1 ul
first PCR product	1 ul
Molecular biology grade water	8 ul

step	temperature	hour	number of repetitions
hot start	94 ℃	5 min	1 cycle
Denatures	94 ℃	20 sec	26 cycle
Annealing	59 ℃	20 sec
Extension	72 ℃	20 sec
final extension	72 ℃	5 min	1 cycle
Store	4 ℃	forever	-

After the second step, nested PCR, was electrophoresed in an agarose gel 2.0% Mupid electrophoresis apparatus at 130 v for 20 minutes to confirm a secondary amplification product of 245 bp (FIG. 6).

As shown in FIG. 6 , when the SFTS virus is detected by the method of Comparative Example 1 in which RT-PCR and nested PCR are sequentially performed, a 245 bp segment is amplified, so in the QC step during the Sanger sequencing process. A significant amount of data may be lost. In addition, there are disadvantages in that the procedure is complicated and the overall PCR running time is long in that electrophoresis must be additionally performed.

Example 1. Amplification of Severe Fever Thrombocytopenia Syndrome (SFTS) Virus and Positive Control and Comparison with Negative Control by RT-PCR and Nested-Realtime PCR Detection Method

Preparation Example 2 In order to confirm the melting peak temperature and the size of the PCR amplification product of the primers designed with SEQ ID NOs: 5 to 8 in Table 2, the first reverse transcription polymerase chain reaction method (Reverse Transcription Polymerase Chain Reaction; hereafter, RT- PCR) and the second nested realtime polymerase chain reaction (Nested Realtime Polymerase Chain Reaction; hereinafter, Nested-Realtime PCR) were sequentially performed.

1-1. First RT-PCR amplification test

Severe Fever with Thrombocytopenia Syndrome (hereinafter, SFTS) virus culture medium, artificially synthesized positive control sequence (Table 1, SEQ ID NO: 2) and the primer set designed in Preparation Example 2 Reverse transcription (reverse transcription) and RT-PCR in which PCR is performed sequentially was performed. Specific experimental conditions are shown in Tables 7 and 8.

Element	usage
2x PCR master mix	10 ul
Primer mix: First PCR forward primer: SFTS-1FW (10pmole/ul) First PCR reverse primer: SFTS-1RV (10 pmol/ul)	1 ul
RNA	5 ul
Molecular biology grade water	4 ul

step	temperature	hour	number of repetitions
RT reaction	50 ℃	10 min	1 cycle
hot start	95 ℃	5 min	1 cycle
Denatures	95 ℃	20 sec	30 cycle
Annealing	62 ℃	20 sec
Extension	72 ℃	30 sec

1-2. Melting curve and electrophoresis analysis result after the second nested-realtime PCR

The second step, Nested-Realtime PCR, was performed with the PCR amplification product generated through the first RT-PCR. Specific experimental conditions were performed according to Tables 9 and 10, and the amount of PCR product amplification was quickly confirmed in real time by using SYBR green as a fluorescent label.

Since the log value of the initial amount of the template has a linear relationship with the threshold cycle, the log value of the initial amount and the corresponding threshold cycle are used using nucleic acids with known initial amounts. Thus, a standard calibration curve can be obtained, and by using this standard calibration curve, the initial amount for an unknown sample can be accurately calculated.

The results of detecting SFTS in this way are shown in FIGS. 7A and 7B .

Element	usage
2x qPCR master mix (with intercalating dye)	10 ul
Primer mix: Second PCR forward primer: SFTS-2Fw-v2 (10pmole/ul) Second PCR reverse primer: SFTS-2Rev-v2 (10pmole/ul)	1 ul
first PCR product	1 ul
Molecular biology grade water	8 ul

step	temperature	hour	number of repetitions
hot start	95 ℃	3 min	1 cycle
Denatures	95 ℃	15 sec	25 cycle
Annealing	62 ℃	20 sec
Extension	72 ℃	20 sec
Melting peak	75~95℃	0.5 ℃ step 30 sec hold	Step and Hold
Store	16 ℃	Forever	-

As shown in Fig. 7a, in the case of the actual positive sample, the melting curve temperature was in the range of 86 to 87 ° C, and in the case of the positive control replaced with a synthetic gene, it was in the range of 83 to 84 ° C. The melting curve was observed in the negative control group. It didn't happen.

After analyzing the results of nested-realtime PCR, electrophoresis was additionally performed to compare the size of the final amplified product of PCR through the method of Example 1. Electrophoresis was performed on an agarose gel 2.0% Agaro-Power System electrophoresis device at 140 V for 30 minutes (FIG. 7b).

As shown in FIG. 7b , the actual positive sample was expressed as 530 bp, and the positive control replaced with the synthetic gene was expressed as 184 bp, and no PCR amplification product was observed in the negative control.

Through this, when the melting curve temperature is 86 to 87° C. and a 530 bp PCR amplification product is observed on the electrophoresis, it can be determined that the SFTS virus is present.

Example 2. SFTS virus detection by RT-PCR and nested-realtime PCR of nucleic acids extracted from ticks suspected of having severe fever with thrombocytopenia syndrome (SFTS)

As shown in FIG. 8a to detect Severe Fever with Thrombocytopenia Syndrome (SFTS) virus, after extracting the RNA of ticks obtained in Preparation Example 1, the first reverse transcription polymerase chain reaction method (Reverse Transcription Polymerase Chain Reaction; hereinafter, RT-PCR) and the second nested realtime polymerase chain reaction (Nested Realtime Polymerase Chain Reaction; hereinafter, Nested-Realtime PCR) were sequentially performed. However, in order to visually confirm the size of the final product in the present invention, electrophoresis was additionally performed (FIG. 8b). The size of the final amplification product can be measured by gel, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement, and phosphorescence measurement. In the actual test method of the present invention, as shown in FIG. 8a, SYBR green is bound to the amplified DNA, and when SYBR green bound to the amplified DNA generates a fluorescence signal, the fluorescence signal is detected to detect the presence of the target gene. The final amplification product is measured by Nested-Realtime PCR, which is a method of measuring whether or not the amplification product is produced therefrom, and the detection and diagnosis is carried out, and the specific product can be determined through melting curve analysis. That is, it does not require an additional electrophoresis process.

2-1. First RT-PCR detection test

RT-PCR in which reverse transcription and PCR were performed sequentially was performed using the RNA extracted from the ticks obtained in Preparation Example 1 and the primer set designed in Preparation Example 2. Specific samples and experimental conditions are shown in Tables 7 to 8 of Example 1-1. The generated PCR product was used as a template for secondary PCR immediately in a PCR station without electrophoresis in order to prevent contamination of the laboratory environment.

2-2. Second Nested-Realtime PCR Detection Test

The second step (Nested-Realtime PCR) was performed with the PCR amplification product generated through the first RT-PCR. Specific experimental conditions are shown in Tables 9 to 10 of Example 1-2. Accordingly, an experiment was performed and the results were shown ( FIGS. 9A and 9B ).

As shown in FIG. 9A , as a result of nested-realtime PCR melting curve analysis, a positive suspicious result was confirmed around 86° C. in 25 samples out of a total of 32 samples, and no melting curve was observed in 7 samples.

After the nested real-time polymerase chain reaction value analysis, electrophoresis was further performed to compare the size of the final amplification product of PCR through the method of Example 2 (see FIG. 8b ). Electrophoresis was performed on an agarose gel 2.0% Agaro-Power ^TM System electrophoresis device at 140 V for 30 minutes (FIG. 9b).

As shown in FIG. 9B, a final amplification product of 495 bp was obtained, and the number of sequences to be compared and analyzed is large because there is less data loss than when the SFTS virus is detected by the method of Comparative Example 1 It was confirmed that the reliability was high. In addition, it was confirmed that when the SFTS virus was detected by the method of Example 1 compared to the method of Comparative Example 1, the detection time of the final amplification product could be shortened by about one hour or more.

Example 3. Sensitivity comparison of the method of detecting severe fever with thrombocytopenia syndrome (SFTS) using RT-PCR and nested RT-PCR of Comparative Example 1 and RT-PCR and Nested-Realtime PCR of Example 2

In order to confirm the detection sensitivity of the RT-PCR and nested RT-PCR of Comparative Example 1, SFTS B type RNA distributed from the Centers for Disease Control and Prevention Center was diluted twice for each concentration with 2 ^-1 to 2 ^-10 , followed by RT -PCR sensitivity was confirmed. To confirm the PCR amplification product, electrophoresis was performed on an agarose gel 2.0% Agaro-Power ^TM System electrophoresis device at 140 v for 30 minutes, and as a result, an amplification product of 560 bp was obtained (FIG. 10a).

In addition, secondary PCR was performed with the nested PCR of Comparative Example 1 using the PCR amplification product confirmed in FIG. 10a as a template, and finally, PCR amplification of 245 bp from SFTS B type RNA from 2 ^-1 to 2 ^-5 The product was identified (Fig. 10b). However, no PCR amplification products were identified in subsequent dilutions.

In order to confirm the sensitivity of the SFTS detection method using RT-PCR and nested-realtime PCR of Example 2, SFTS B type RNA distributed from the Centers for Disease Control and Prevention's Mediation Analysis Division was diluted twice by concentration with 2 ^-1 to 2 ^-10 . After that, RT-PCR was performed to confirm sensitivity.

Agarose gel 2.0% A was electrophoresed in an Agaro-Power™ System electrophoresis device at 140 V for 30 minutes, and an amplification product of 565 bp was obtained (FIG. 10c).

Secondary PCR was performed by the nested-realtime PCR method of Example 2 using the PCR amplification product identified in FIG. 10c as a template, and as a result, in all RNA samples diluted with 2 ^-1 to 2 ^-10 , PCR amplification products were identified (Fig. 10d).

Through this, the conventional SFTS virus detection method using RT-PCR and nested PCR (Comparative Example 1) could detect only ^2-5 dilutions of SFTS B type RNA, but the SFTS virus detection method using RT-PCR and nested-realtime PCR ( Example 2) was confirmed to be detectable even after dilution to 2 ^-10 .

Example 4. Sequencing and lineage analysis using samples amplified by RT-PCR and Nested-Realtime PCR

Table 11 shows the sequencing results of 33 PCR amplification products actually obtained from the 40 PCR test samples of Example 2 amplified by RT-PCR and nested-realtime PCR. In addition, the secured sequence blast (Blast) results are shown in Table 12.

order number	sample number	Sequence Listing (5'---> 3')
8	One	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
9	2	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGATTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCACTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGATATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
10	4	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
11	5	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
12	6	GAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTGAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACCGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCAAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGCATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
13	7	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
14	8	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
15	9	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
16	10	GAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
17	11	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
18	12	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
19	13	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
20	14	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCAAGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAGATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
21	15	AGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCAGGGAGTCCGGACTCAAAATGTCTCAAAATCAAAGTTAAGAGGATTAACCTGAAATGCAAGAAGTCATCATCATATTTCGTTCCTGATGCTCGGTCCAGATGTACATCTGTGAGGAGATGCCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTTTCTGATGATTGGGCAGGTAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCTGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCCTCATGCATCTTCTGGAGGAAATGGGTGGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCATCAGCAGTCATAGAGCTAACAATGCCCTCAGGCGACGTGAGGACATTCCA
22	16	GAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCGTATTTTGTTCCTGATGCTCGATCCAGGTGTATATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGCGCTCAGATGGATGTGGAGGAGCAGCCCGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
23	17	GAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAGAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTCCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
24	18	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGTGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
25	19	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
26	21	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGGCTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
27	22	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
28	23	CGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTAAGAACATTCCAC
29	24	GAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGAACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAAAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCA
30	25	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
31	28	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
32	30	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTAGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAGTGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGTGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGGTGCCCTCGGGCGACGTGAGGACATTCCAC
33	31	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCATCCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
34	32	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
35	33	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
36	36	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGGATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
37	39	ACATGAAGGAATGCGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTTAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGTAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC
38	40	ACATGAAGGAATGTGTCACAACTGGGAGGGCGCTCCTTCCTGCGGTGAACCCAGGACAAGAGGCATGTCTGCACTTCACGGCACCTGGGAGCCCGGACTCAAAATGTCTCAAAATCAAGGTTAAGAGGATCAACCTAAAATGTAAGAAGTCATCATCATATTTTGTTCCTGATGCTCGATCCAGGTGTACATCTGTGAGGAGATGTCGCTGGGCAGGAGACTGTCAGTCTGGGTGCCCCTCTCATTTCACGTCCAACTCCTTCTCTGATGATTGGGCAGGAAAAATGGACAGGGCTGGTCTAGGATTCAGTGGGTGCTCAGATGGATGTGGAGGAGCAGCCTGCGGCTGCTTCAATGCGGCCCCTTCATGCATCTTTTGGAGGAAATGGGCAGAGAATCCACATGGGATCATCTGGAAAGTATCTCCATGTGCTGCATGGGTCCCTTCAGCAGTCATAGAGCTAACGATGCCCTCGGGCGACGTGAGGACATTCCAC

sample number	Target acc.ver	% identity	sort length	Inconsistency	gap open	q. start	q. end	s. start	s. end	E- value	bit score
One	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
2	KU507548.1	98.592	497	7	0	One	497	1763	2259	0	880
4	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
5	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
6	KU507548.1	98.361	488	8	0	One	488	1771	2258	0	857
7	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
8	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
9	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
10	KU507548.1	99.385	488	3	0	One	488	1771	2258	0	885
11	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
12	KU507548.1	99.194	496	4	0	One	496	1763	2258	0	894
13	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
14	KU507548.1	98.592	497	7	0	One	497	1763	2259	0	880
15	LC516197.1	99.184	490	4	0	One	490	1712	2201	0	883
16	KU507548.1	98.361	488	8	0	One	488	1771	2258	0	857
17	KU507548.1	98.77	488	6	0	One	488	1771	2258	0	869
18	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
19	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
21	KU507548.1	98.793	497	6	0	One	497	1763	2259	0	885
22	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
23	KU507548.1	99.358	467	3	0	One	467	1793	2259	0	846
24	KU507548.1	98.77	488	6	0	One	488	1771	2258	0	869
25	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
28	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
30	KU507548.1	98.189	497	9	0	One	497	1763	2259	0	869
31	KU507548.1	98.793	497	6	0	One	497	1763	2259	0	885
32	KU507548.1	99.195	497	4	0	One	497	1763	2259	0	896
33	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
36	KU507548.1	98.793	497	6	0	One	497	1763	2259	0	885
39	KU507548.1	98.994	497	5	0	One	497	1763	2259	0	891
40	KU507548.1	98.793	497	6	0	One	497	1763	2259	0	885

The KU507548.1 gene in Table 12 is the complete sequence of KADGH segment M isolated from severe fever with thrombocytopenia syndrome virus.

In addition, the LC516197.1 gene of Table 12 is a Severe Fever with Thrombocytopenia Syndrome (SFTS) virus JNU-1 gene for a multivalent protein glycoprotein membrane among partial coding sequences (cds).

From the sequencing data obtained as shown in Tables 11 and 12, samples 1, 2, 4, 6, 7, and 8 were selected and subjected to phylogenetic analysis (FIG. 11).

11, when the severe fever thrombocytopenia syndrome virus detection method using nested-realtime PCR (Example 2) is performed, the PCR product cannot be analyzed by the general Taqman probe method with a short length. It was confirmed that phylogenetic analysis was also possible. In addition, it could be confirmed that phylogenetically, it was well separated into each genotype in the mites.

Sanger-style sequencing of the PCR amplification product of the detection method by RT-PCR and nested PCR (Comparative Example 1) and the PCR amplification product of the detection method by RT-PCR and nested real-time PCR (Example 2) It was confirmed that the sequence length of the method (Example 2) for detection by RT-PCR and Nested Real-time PCR (Example 2) was relatively long compared to the conventional method for detection by RT-PCR and nested PCR (Comparative Example 1). (Fig. 12a).

In addition, the amplification amplified by the detection method by RT-PCR and nested real-time PCR (this method; Example 2) compared to the conventional detection method by RT-PCR and nested PCR (existing method; Comparative Example 1) When the product was analyzed by blast and compared with the sequence of the SFTS virus itself, the method for detection by RT-PCR and nested real-time PCR (this method; Example 2) is BLAST (basic local alignment search tool) analysis. As a result of setting match/mismatch scoring to +1 and -2, respectively, and linearly performing gap costs, the present method (execution of Comparative Example 1) compared to the basic method (Comparative Example 1). It was confirmed that the overall score (Fig. 12b) and identity index (Fig. 12c) of the amplified product amplified in Example 2) were high. In addition, the E-value (Table 12) was 0, and it was confirmed that the probability of accidentally matching a sequence other than SFTS was 0%.

Therefore, the existing detection method for determining whether tick infection is present in Korea has low sensitivity of the nested PCR primer and difficulty in sequence analysis, but through the present invention, sensitivity problem and SFTS patient-infection through sequence analysis It is judged that it can help to more clearly understand the correlation between SFTS of ticks in the estimated area.

The present invention relates to a primer set for detecting Severe Fever with Thrombocytopenia Syndrome virus transmitted by ticks and a diagnostic kit using the same.

Claims (8)

1. a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; and

   a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

   A composition for detecting Severe Fever with Thrombocytopenia Syndrome (SFTS) virus comprising a.
2. According to claim 1, wherein the first or the second primer set S segment (small segment, S segment), M segment (Medium segment, M segment) and L segment (Large segment, L segment) of the severe fever with thrombocytopenia syndrome virus A composition for detecting severe fever with thrombocytopenia syndrome that is complementary to one or more segments selected from the group consisting of.
3. a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8; and

   a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

   A kit for diagnosing severe fever with thrombocytopenia syndrome, including a composition for detecting the Severe Fever with Thrombocytopenia Syndrome, SFTS virus.
4. A method of providing information for diagnosing Severe Fever with Thrombocytopenia Syndrome (SFTS) comprising the steps of:

   A first amplification step of performing RT-PCR (Reverse Transcription Polymerase Chain Reaction) amplification using the RNA isolated from the subject as a template;

   a second amplification step of sequentially amplifying Nested-Realtime PCR (Nested Realtime Polymerase Chain Reaction) using the PCR amplification product amplified in the first amplification step as a template; and

   A confirmation step of confirming the PCR amplification product amplified in the second amplification step.
5. The method of claim 4, wherein the first amplification step is performed using a first primer set consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8. .
6. The method of claim 4, wherein the second amplification step is performed using a second primer set consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10. .
7. [Claim 5] The method of claim 4, wherein in the confirming step, when the melting curve temperature is 80 to 90 ° C., it is determined whether the severe fever thrombocytopenia syndrome infection is positive.
8. The method of claim 4, wherein the confirming step is performed by at least one selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement and phosphorescence measurement. How to provide information for diagnosis.

Images