WO2022032151A1 - Treatment of sensorineural deafness - Google Patents

Treatment of sensorineural deafness Download PDF

Info

Publication number
WO2022032151A1
WO2022032151A1 PCT/US2021/045031 US2021045031W WO2022032151A1 WO 2022032151 A1 WO2022032151 A1 WO 2022032151A1 US 2021045031 W US2021045031 W US 2021045031W WO 2022032151 A1 WO2022032151 A1 WO 2022032151A1
Authority
WO
WIPO (PCT)
Prior art keywords
minar2
gene
mutation
expression
agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/045031
Other languages
French (fr)
Inventor
Mustafa TEKIN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Miami
Original Assignee
University of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Miami filed Critical University of Miami
Publication of WO2022032151A1 publication Critical patent/WO2022032151A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/16Otologicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the present disclosure relates to methods of characterizing and treating sensorineural deafness.
  • Hearing loss is one of the most common sensory deficits, affecting 1 in 500 newborns globally (Mehl and Thomson 2002). Genetic factors are implicated in majority of cases, with more than 80% of the inherited form exhibiting autosomal recessive transmission (Morton and Nance 2006). No additional findings are present in over 70% of the cases, which are then classified as non-syndromic hearing loss (Morton and Nance 2006).
  • the disclosure provides a method of treating sensorineural deafness in a mammalian subject (e.g., human) in need thereof.
  • the method comprises administering to a subject having a mutation in a Membrane Integral NOTCH2 Associated Receptor gene (MINAR2) a composition that comprises a polynucleotide that encodes a MINAR2 peptide, a MINAR2 peptide, a small molecule that increases expression of MINAR2, an agent that blocks expression of a mutant MINAR2 gene, an agent that corrects the mutation in the MINAR2 gene.
  • Administration of a combination of any of the foregoing is also contemplated.
  • the method comprises detecting the presence of a mutation in the MINAR2 gene in a sample from a subject.
  • the MINAR2 mutation is a DNA variant classified as pathogenic or likely pathogenic according to American College of Medical Genetics and Genomics (ACMG) guidelines.
  • ACMG American College of Medical Genetics and Genomics
  • the disclosure also contemplates a method comprising diagnosing the subject with sensorineural deafness when the presence of a mutation in the MINAR2 gene is detected.
  • each feature or embodiment, or combination, described herein is a non-limiting, illustrative example of any of the aspects of the disclosure and, as such, is meant to be combinable with any other feature or embodiment, or combination, described herein.
  • each of these types of embodiments is a non-limiting example of a feature that is intended to be combined with any other feature, or combination of features, described herein without having to list every possible combination.
  • Such features or combinations of features apply to any of the aspects of the invention.
  • Figures 1A-1D Families and the MINAR2 variants.
  • Fig. 1A Pedigrees and segregation of the M1NAR2 variant in families. Filled symbols denote affected individuals and double lines indicate first cousin consanguinity.
  • Fig. IB Electropherograms showing the identified variant. The wild type traces are from an unrelated individual. Hom: Homozygous mutant, Het: Heterozygous mutant.
  • Fig. 1C A diagram outlining the positions of the variants p.Argl38ValfsTerlO and p.Trp48Ter in the intracellular region of the MINAR2 protein and the mapping to in exons 1-3 of the MINAR2 gene.
  • Fig. 1A Pedigrees and segregation of the M1NAR2 variant in families. Filled symbols denote affected individuals and double lines indicate first cousin consanguinity.
  • Fig. IB Electropherograms showing the identified variant. The wild type traces are from an un
  • Figure 2 Table of parameters used for detecting homozygous runs (Enlis software).
  • Figure 3 Table of homozygous runs >2 MB in the affected siblings.
  • Figure 4 Table of primers used for the Sanger DNA sequencing.
  • Figures 5A-5C Families, MINAR2 variants, and the effects of the c.393G>T variant on splicing.
  • Fig. 5 A Pedigrees and segregation of the MINAR2 variant in families. Filled symbols denote affected individuals and double lines indicate first cousin consanguinity. Electropherograms show the identified variant. The wild type traces are from an unrelated individual. Hom: Homozygous mutant.
  • Fig. 5B Locations of the identified variants.
  • Fig. 5C Exon trap assay for variant c.393G>T. MINAR2 exon 2 was inserted into a vector consisting of 5’ and 3’ exons. PCR products show larger and smaller bands in c.393G>T compared to wildtype. Sanger sequencing confirmed insertion of 85 bp at the donor site of exon 2 and skipping of exon 2.
  • FIG. 6A Top four representative images show angiogenic potential of non-transfected (NT) human umbilical vascular endothelial cells (HUVEC) compared to cells transfected with M1NAR2 wild type (WT) plasmid construct, M1NAR2 plasmid construct bearing p.Trp48* and p.Argl38Valfs*10 variants, respectively.
  • NT non-transfected
  • WT wild type
  • FIG. 6E Right graph shows analysis of total length of angiogenic vessels formed after incubation of 12 hrs on Matrigel coated wells; images were analyzed with imageJ angioanalyzer and results are expressed as Mean+SEM.
  • Fig. 6B Left: Western blot images of effect of MINAR2 (WT) transient overexpression on NOTCH2 and VEGFA protein levels in HUVEC cells; Right: statistical analysis of GAPDH normalized relative protein expressions of NOTCH2 and VEGFA. Results are expressed as mean+SEM and significant differences are shown as (*p ⁇ 0.05) when compared to control.
  • Fig. 6C Left: western blot images of effect of SiRNA induced MINAR2 silencing on NOTCH2 protein levels in PC12; Right: Beta- Actin normalized relative protein expression of NOTCH2.
  • Results are expressed as Mean+SEM and significant differences are shown as (**p ⁇ 0.01) when compared to control or (##p ⁇ 0.01) when compared to groups other than control.
  • Fig. 6D Left: western blot images of effect of M1NAR2 wild type (WT), MINAR2 p.Trp48* and MINAR2 p.Argl38Valfs*10 variants transient overexpression on phosphorylation of Extracellular signal-regulated protein kinases 1 and 2 (Erkl/2); Right: statistical analysis of GAPDH-normalized relative protein expressions of pErkl/2 and Erkl/2.
  • Fig. 6E Left: Immunoblot analysis of S6 Ribosomal Protein and its phosphorylation at Ser235/236; Akt and its phosphorylation at Ser 473 in PC12 cells transfected with either scrambled negative control siRNA or MINAR2 siRNA. Transfected cells were serum starved and treated with 50 ng/ml of NGF for 0 to 12 hours. Cell lysates were harvested after 48 hrs of SiRNA incubation and at 0,1,3 and 12 hours of NGF treatment.
  • Figure 8 Table providing WGS homozygous runs >1 MB in three affected siblings of Family 1 and 2.
  • Figure 9 Table of audiological phenotype in affected individuals.
  • Figure 10 Table of characteristics of the identified MINAR2 variants.
  • Figure 11 qRT-PCR analysis of effect of scrambled and three predicted MINAR2 SiRNA sequences namely A, B, and C at concentrations of lOnM and 80nM on MINAR2 mRNA expression in PC 12 cells after 48 hrs of transfection respectively. The results are expressed as Fold change in mRNA levels+SEM.
  • Figure 12 Relative expression pattern of Minar2 (previously known as A730017C20Rik) in mouse inner ear (data from Elkon et. al., 2015) by using gene Expression Analysis Resource (gEAR; umgear.org/).
  • Figure 13 Table of ten longest homozygous runs in the proband of Family 2 individual 11:1 via WGS.
  • the disclosure provides a method of characterizing and treating deafness.
  • Genome sequencing GS was performed on a subset of these families and revealed loss of function variants in M1NAR2.
  • Variants in MINAR2, a frameshift 8bp deletion (p.Argl38ValfsTerl0) and a nonsense variant (p.Trp48Ter) were identified in two unrelated Turkish families co-segregating with autosomal recessive sensorineural hearing loss.
  • a third variant also was identified, p.Lysl31Asn, in two additional families.
  • MINAR2 (previously known as uncharacterized protein KIAA1024L and mouse gene A730017C20Rik ⁇ ) shares some identity with MINAR1, which has been found to be involved in controlling neurite formation during neuronal differentiation through DEP Domain Containing MTOR Interacting Protein (DEPTOR) and angiogenesis through modulation of Notch2.
  • Notch pathway is a highly conserved intercellular signaling cascade that is activated by the interaction of transmembrane ligands (Delta and Jagged) with Notch receptors, which are usually expressed on the surface of neighboring cells.
  • Notch Ligand to receptor induces cleavage of the Notch receptors intracellular domain (NICD) and ensuing nuclear translocation of the NICD, where it binds to multiple DNA-binding proteins (Andersson et al. 2011; Chillakuri et al. 2013; Lu and Lux 1996).
  • Notch signaling plays a very delicate role in angiogenesis.
  • Notch activation is generally repressed to allow proliferation of endothelial cells in response to VEGF stimulation, and its expression is later upregulated when endothelial cells stop proliferating and the vessels begin to stabilize (Henderson et al. 2001; Taylor et al. 2002).
  • Disruption or interference with the Notch pathway in mice resulted in the development of vascular tumors and lethal hemorrhage (Liu et al. 2011) and its activity in cell culture inhibited the angiogenic functions of endothelial cells such as capillary tube formation, migration, and proliferation (Itoh et al. 2004; Leong et al. 2002; Noseda et al. 2004; Williams et al. 2011).
  • MINAR2 encodes major intrinsically disordered NOTCH2-binding receptor 1-like (also known as Membrane integral NOTCH2-associated receptor 2 or MINAR2) (UniProtKB/Swiss-Prot Reference sequence: P59773; SEQ ID NO: 2).
  • the disclosure provides a method of characterizing sensorineural deafness in a subject.
  • the method comprises detecting a mutation in M1NAR2 in the subject, as described further herein.
  • the disclosure also provides methods of treating sensorineural deafness.
  • the method comprises administering to a subject having a mutation in the M1NAR2 gene a composition that comprises one or more of the following: a polynucleotide that encodes a MINAR2 peptide, a MINAR2 peptide, a small molecule that increases expression of MINAR2, an agent that blocks expression of a mutant MINAR2 gene, and an agent that corrects the mutation in the MINAR2 gene.
  • the method comprises administering a combination of the foregoing agents, in a single composition or in separate compositions (optionally administered at different time points).
  • the method comprises detecting the presence of a mutation in the MINAR2 gene in a sample from the subject.
  • the MINAR2 mutation is preferably a DNA variant classified as pathogenic or likely pathogenic according to American College of Medical Genetics and Genomics (ACMG) guidelines.
  • ACMG American College of Medical Genetics and Genomics
  • a method is provided which comprises diagnosing the subject with sensorineural deafness when the presence of the mutation in the MINAR2 gene is detected.
  • the method comprises detecting the MINAR2 gene mutations p.Argl38ValfsTerlO, p.Trp48Ter, or any protein truncating mutation and/or mutation that leads to a “loss of function” or a hypomorphic function of the protein.
  • the method comprises detecting the MINAR2 gene mutation p.Lysl31Asn.
  • mutations in the MINAR2 gene may be detected using next-generation sequencing such as a gene panel, whole exome sequencing (WES), whole-genome sequencing (WGS), Sanger sequencing, and related DNA sequencing methods, polymerase chain reaction (PCR), real-time PCR (RT- PCR), microarray or Multiplex Ligation-dependent Probe Amplification (MLPA) assays for sequence and copy number variants, DNA restriction enzyme digestion and gel electrophoresis, and other DNA mutation detection methods known in the art.
  • mutant MINAR2 may be detected via next-generation sequencing or PCR amplification of M1NAR2 mRNA or western blotting of MINAR2 protein.
  • the MINAR2 mutation is detected by examining proteins using western blotting (immunoblot), High-performance liquid chromatography (HPLC), Liquid chromatography-mass spectrometry (LC/MS), antibody dependent methods such as enzyme- linked immunosorbent assay (ELISA), protein immunoprecipitation, protein immunostaining, protein chip methods or other protein detection methods suitable for mutation detection.
  • western blotting immunoblot
  • HPLC High-performance liquid chromatography
  • LC/MS Liquid chromatography-mass spectrometry
  • ELISA enzyme- linked immunosorbent assay
  • protein immunoprecipitation protein immunostaining
  • protein chip methods or other protein detection methods suitable for mutation detection.
  • the sample may be any biological sample taken from the subject, including, but not limited to, any tissue, cell, or fluid (e.g., blood) which can be analyzed for a trait of interest, such as the presence or amount of a nucleic acid (e.g., M1NAR2 mRNA) or a protein (e.g., MINAR2 protein).
  • a nucleic acid e.g., M1NAR2 mRNA
  • a protein e.g., MINAR2 protein
  • the biological sample is a plasma, saliva, urine, or skin sample.
  • a “subject” as referred to herein, can be any mammal, such as a human.
  • the subject is an infant, a child, an adolescent or an adult.
  • the subject is a human aged 5 years or younger.
  • the subject is 13 years or younger, 18 years or younger, 30 years or younger, or over 30 years old.
  • the subject exhibits hearing loss from the inability to hear sounds ranging from 20 decibels (dB) to 1000 dB, or >1000 dB.
  • the subjects hearing loss is an inability to hear sounds at 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or >1000 dB.
  • the subjects hearing loss may be absent at the time of performing the methods described herein.
  • subjects may have other organ dysfunctions.
  • MINAR2 peptide is administered to the subject.
  • the therapy supplements MINAR2 peptide levels where endogenous, functional MINAR2 levels are inadequate or absent.
  • An exemplary MINAR2 peptide is provided in SEQ ID NO: 2.
  • the disclosure contemplates use of a peptide that comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 2.
  • the peptide may comprise at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 2.
  • the method comprises administering to the subject a polynucleotide (e.g., a polynucleotide that encodes the MINAR2 peptide/protein (i.e. , the MINAR2 peptide described herein), an agent that blocks expression of a mutant M1NAR2 gene, and/or an agent that corrects the mutation in MINAR2 gene).
  • Polynucleotides are typically delivered to a host cell via an expression vector, which includes the regulatory sequences necessary for delivery and expression.
  • the constructs described herein include a promoter (e.g., cytomegalovirus (CMV) promoter), a protein coding region (optionally with noncoding (e.g.
  • Expression vectors may be viral-based (e.g., retrovirus-, adenovirus-, or adeno- associated virus-based) or non-viral vectors (e.g., plasmids). Non- vector based methods (e.g., using naked DNA, DNA complexes, etc.) also may be employed.
  • the vector is a viral vector, such as a lentiviral vector or baculoviral vector, and in various preferred embodiments the vector is an adeno-associated viral vector (AAV).
  • AAV adeno-associated viral vector
  • the expression vector may be based on any AAV serotype, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV- 9, AAV-10, AAV-11, AAV-12, or AAV-13.
  • Polynucleotides also may be delivered via liposomes, nanoparticles, exosomes, microvesicles, hydrodynamic -based gene delivery, or via a “gene-gun.”
  • the agent is a polynucleotide that encodes a MINAR2 peptide.
  • the amino acid sequence of the MINAR2 peptide is provided as SEQ ID NO: 2.
  • the polynucleotide used in the method optionally encodes the amino acid sequence of SEQ ID NO: 2 or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 2 (which retains the function of MINAR2).
  • the polynucleotide comprises SEQ ID NO: 1 or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the polynucleotide sequence of SEQ ID NO: 1 (and which encodes MINAR2).
  • the agent is a small molecule therapeutic (i.e., drug) that increases expression of MINAR2.
  • administration of the small molecule increases MINAR2 protein levels.
  • “increasing” expression of MINAR2 does not require 100% increase of expression of MINAR2 protein levels in a subject; any level of increased expression of MINAR2 may be beneficial to a subject.
  • administration of the small molecule increases the expression of MINAR2 protein by about 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or 100%.
  • an agent which blocks the expression of a mutant M1NAR2 gene is administered, optionally in combination with a polynucleotide that encodes functional MINAR2 or MINAR2, itself.
  • An agent that blocks expression of a mutant MINAR2 gene refers to an agent that interferes with expression of a mutant MINAR2 gene so that mutant MINAR2 gene expression and/or mutant MINAR2 protein levels are reduced compared to basal/ wild-type levels. It will be appreciated that “blocking” expression of a mutant MINAR2 gene does not require 100% abolition of expression and MINAR2 production; any level of reduced expression of aberrant MINAR2 may be beneficial to a subject.
  • agents include, but are not limited to, antisense oligonucleotides (ASO), short hairpin RNA (shRNA), small interfering RNA (siRNA), or micro RNA (miRNA).
  • ASO antisense oligonucleotide
  • shRNA short hairpin RNA
  • siRNA small interfering RNA
  • miRNA micro RNA
  • the agent is an antisense oligonucleotide (ASO) used to knock-down (i.e., reduce) the expression of aberrant (i.e. mutant) MINAR2.
  • ASO antisense oligonucleotide
  • the MINAR2 antisense oligonucleotide reduces the expression of MINAR2 protein by 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80 90 or 100%.
  • An ASO is a single-stranded deoxyribonucleotide, which is complementary to an mRNA target sequence.
  • the MINAR2 antisense oligonucleotide targets an exonic or intronic sequence of the MINAR2 gene.
  • an agent that corrects the mutation in the M1NAR2 gene is employed.
  • the agent may comprise components employed in genome-editing techniques, such as designer zinc fingers nucleases (ZFNs), transcription activator-like effectors nucleases (TALENs), or CRISPR-Cas (clustered regularly interspaced short palindromic repeats- CRISPR associated) systems.
  • ZFNs designer zinc fingers nucleases
  • TALENs transcription activator-like effectors nucleases
  • CRISPR-Cas clustered regularly interspaced short palindromic repeats- CRISPR associated
  • the agents are used to modify the sequence of the MINAR2 coding region or a regulatory element and/or non-coding region associated with the MINAR2 gene.
  • genome editing may be used to replace part or all of the M1NAR2 gene sequence or alter MINAR2 protein expression levels.
  • An exemplary agent for use in the method of the disclosure is, DNA encoding Cas9 molecules and/or guide RNA (gRNA) molecules.
  • Cas9 and gRNA can be present in a single expression vector or separate expression vectors.
  • Adenoviral delivery of the CRISPR/Cas9 system is described in Holkers et al., Nature Methods (2014), 11(10): 1051-1057, which is incorporated by reference in its entirety.
  • treating refers to reducing or ameliorating sensorineural deafness and/or associated disorders and/or symptoms associated therewith. These terms include reducing the severity of the disorder or any symptoms associated therewith. It is appreciated that, although not precluded, “treating” or “treatment” of a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated; any increase in sensitivity to sound or change in a similar sensory perception is contemplated. A change in the ability of a subject to detect sound is readily accomplished through administration of simple hearing tests, such as a tone test commonly administered by an audiologist. In most mammals, a reaction to different frequencies indicates a change in sensory perception. In humans, comprehension of language also is appropriate.
  • a change in perception is indicated by the ability to distinguish different types of acoustic stimuli, such as differentiating language from background noise, and by understanding speech. Speech threshold and discrimination tests are useful for such evaluations.
  • a baseline value is recorded prior to treatment using any appropriate sensory test.
  • a subject is reevaluated at an appropriate time period following the method (e.g., 1 day, 3 days, 5 days, 7 days, 14 days, 21 days, 28 days, 2 months, 3 months or more), the results of which are compared to baseline results to determine a change.
  • a dose of an active agent (e.g., a polynucleotide that encodes a MINAR2 peptide; a MINAR2 peptide; a small molecule that increases expression of MINAR2; an agent that blocks the expression of a mutant M1NAR2 gene; an agent that corrects a mutation in MINAR2 gene) will depend on factors such as route of administration (e.g., local vs. systemic), patient characteristics (e.g., gender, weight, health, side effects), the nature and extent of the sensorineural deafness or associated disorder, and the particular active agent or combination of active agents selected for administration.
  • route of administration e.g., local vs. systemic
  • patient characteristics e.g., gender, weight, health, side effects
  • the nature and extent of the sensorineural deafness or associated disorder e.g., the particular active agent or combination of active agents selected for administration.
  • Suitable methods of administering a physiologically-acceptable composition such as a pharmaceutical composition comprising an agent described herein, are well known in the art.
  • more than one route can be used to administer one or more of the agents disclosed herein.
  • a particular route can provide a more immediate and more effective reaction than another route.
  • composition orally through injection or infusion by intravenous, intraotic, intraperitoneal, intracerebral (intra-parenchymal), intracerebroventricular, intramuscular, intra-ocular, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, urethral, vaginal, or rectal means; by controlled, delayed, sustained or otherwise modified release systems; by implantation devices; using nanoparticles; or as a conjugate.
  • the agent described herein is administered to the inner ear.
  • the most direct routes of administration entail surgical procedures which allow access to the interior of the structures of the inner ear.
  • Inoculation via cochleostomy allows administration of the agent directly to the regions of the inner ear associated with hearing.
  • Cochleostomy involves drilling a hole through the cochlear wall, e.g., in the otic capsule below the stapedial artery as described in Kawamoto et al., Molecular Therapy, 4(6), 575-585 (2001), and release of a pharmaceutical composition.
  • Administration to the endolymphatic compartment is particularly useful for administering an agent to the areas of the inner ear responsible for hearing.
  • the agent can be administered to the semicircular canals via canalostomy.
  • Canalostomy provides for exposure to the vestibular system and the cochlea, whereas cochleostomy does not provide as efficient transduction in the vestibular space.
  • the risk of damage to cochlear function is reduced using canalostomy in as much as direct injection into the cochlear space can result in mechanical damage to hair cells (Kawamoto et al., supra).
  • Administration procedures also can be performed under fluid (e.g., artificial perilymph), which can comprise factors to alleviate side effects of treatment or the administration procedure, such as apoptosis inhibitors or anti-inflammatories.
  • Another direct route of administration to the inner ear is through the round window, either by injection or topical application to the round window.
  • Administration via the round window is especially preferred for delivering agents to the perilymphatic space.
  • the agent can be present in or on a device that allows controlled or sustained release, such as a sponge, meshwork, mechanical reservoir or pump, or mechanical implant.
  • a biocompatible sponge or gelfoam soaked in a pharmaceutical composition is placed adjacent to the round window, through which the agent permeates to reach the cochlea.
  • Mini- osmotic pumps provide sustained release of an agent over extended periods of time (e.g., five to seven days), allowing small volumes of composition to be administered, which can prevent mechanical damage to endogenous sensory cells.
  • a polynucleotide can be introduced ex vivo into cells previously removed from a given subject.
  • Such transduced autologous or homologous host cells can be progenitor cells that are reintroduced into the inner ear of the subject to express, e.g., functional MINAR2.
  • progenitor cells that are reintroduced into the inner ear of the subject to express, e.g., functional MINAR2.
  • the agent is preferably administered as soon as possible after it has been determined that the subject is at risk for hearing loss (e.g., because of family history or detection of mutant MINAR2 prior to clinical manifestation of hearing impairment) or has demonstrated hearing loss.
  • the two or more active agents described herein may be administered as part of a therapeutic regimen. Alternatively or in addition, one or more of the active agents may be administered with other therapeutics as part of a therapeutic regimen.
  • the active agent(s) may be administered as a monotherapy or as a combination therapy with other treatments administered simultaneously or metronomically.
  • the term "simultaneous” or “simultaneously” refers to administration of two agents within six hours or less (e.g., within three hours or within one hour each other). In this regard, multiple active (or therapeutic) agents may be administered the same composition or in separate compositions provided within a short period of time (e.g., within 30 minutes).
  • micronomically means the administration of different agents at different times and at a frequency relative to repeat administration. Active agents need not be administered at the same time or by the same route; preferably, in various embodiments, there is an overlap in the time period during which different active agents are exerting their therapeutic effect.
  • This Example describes a study of subjects with sensorineural hearing loss.
  • Subjects The diagnosis of sensorineural hearing loss was established via standard audiometry in a sound-proof room according to the current clinical standards. Clinical evaluation included a thorough physical examination and otoscopy in all cases. DNA was extracted from peripheral blood leukocytes of probands according to the standard procedures.
  • BGISEQ-500 and Illumina X Ten instruments in Family 1 individual 11:1 and 11:2, respectively (FigurelA).
  • Whole-genome sequencing also was performed in Family 1 individual 11:3 and Family 2 individual 11:1 ( Figure 7) Reads were mapped to human genome reference (NCBI build37/hg 19 version) with Burrows Wheeler Aligner (BWA).
  • Genome Analysis Toolkit GTK was used for the variant calling. Copy number variants (CNVs) were called using the CNVnator.
  • Enlis Genome Research software www.enlis.com/) was used to identify runs of homozygosity from genome sequencing data ( Figure 7).
  • gnomAD Breast Cancer
  • NCBI dbSNP
  • an internal exome/genome database that includes > 4,000 exomes from different ethnicities 100 genomes.
  • Minor allele thresholds of 0.005 for recessive and 0.001 for dominant variants were used.
  • missense variants a combination of criteria from the following databases were used: damaging for Sorting Intolerant From Tolerant (SIFT), Polyphen2, disease-causing for MutationTaster and > 0.7 for REVEL score.
  • SIFT Sorting Intolerant From Tolerant
  • ACMG American College of Medical Genetics
  • ClinGen hearing loss expert panel guidelines were used for variant interpretation. Sanger sequencing was used to evaluate co-segregation of the variant with hearing loss.
  • Enlis Genome Research software was used to identify homozygous regions from GS data ( Figure 2). After excluding variants in all previously recognized deafness genes, the focus became variants that mapped to shared runs of homozygosity, > 1 MB regions, in siblings (11:1 and 11:2) of family 1 ( Figure 3). Later variant filtering in shared autozygous regions in siblings, was applied.
  • Proband in family 1 was a 17-year-old female with bilateral progressive sensorineural hearing loss. She was diagnosed with hearing loss during infancy, which progressed to profound deafness after age 10. Otoacoustic emissions were negative. High resolution temporal bone CT was normal. At age 12 she received unilateral cochlear implant improving her oral communication.
  • a homozygous NM_001257308.2:c.412_419delCGGTTTTG (p.Argl38ValfsTerl0) variant was identified in two siblings in family 1 by using genome sequencing.
  • the cohort screening revealed a homozygous NM_001257308.2:c.l44G>A (p.Trp48Ter) variant in a simplex family (family 2) in MINAR2. Both variants were present on the intracellular domain of Minar2 corresponding to the regions of exon 3 and 1 respectively ( Figure 1). Single locus two- point LOD score was 3.6.
  • Example 2 describes further study of subjects with sensorineural hearing loss. Individuals in the first two families were included in Example 1. This Example reports on variants in MINAR2, membrane integral NOTCH2 associated receptor 2, in four families underlying autosomal recessive non-syndromic deafness. M1NAR2 is a recently annotated gene. Functional aspects of MINAR2 and consequences of MINAR2 dysfunction in humans remain largely uncharacterized. Three loss-of-function M1NAR2 variants, p.Trp48*. p.Argl38Valfs*10, and p.Lysl31Asn, were identified as described herein in 13 individuals with congenital or prelingual-onset severe to profound sensorineural hearing loss.
  • Minar2 is expressed in the mouse inner ear, with the protein localizing mainly in the hair cells, spiral ganglia, the spiral limbus, and the stria vascularis.
  • the results described below show that MINAR2 suppresses angiogenesis, as well as NOTCH2, MAPK, and mTOR pathways.
  • the data suggest that MINAR2 is essential for hearing in humans and its disruption leads to sensorineural hearing loss.
  • Subjects The diagnosis of sensorineural HL was established via auditory brainstem response or standard audiometry in a sound-proof room according to the current clinical standards. Clinical evaluation included reviews of past medical history with an emphasis on environmental causes of HL and syndromic deafness and a thorough physical examination including an eye exam and otoscopy in all cases. DNA was extracted from peripheral blood leukocytes of participants according to the standard procedures.
  • Exome sequencing was performed on a HiSeq 2000 platform (Illumina), in individuals IV:3 and IV:5 in Family 3 and IV: 1 in Family 4 ( Figure 7).
  • Illumina Infinium Global Screening Array (GSA) v2 (Illumina) kit used for genotyping in 16 members of Family 3 and three members of Family 4 to map the shared homozygous regions in affected individuals.
  • Site directed mutagenesis MINAR2 (OHu01804, NM_001257308.2) cDNA cloned in pcDNA3.1+/C-(K)DYK was procured from Genscript Biotech (NJ, USA). Site directed mutagenic changes to incorporate c.412_419delCGGTTTTG, and C.144G>A were done using Quick Change Uightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, USA).
  • plasmid was subjected to PCR amplification as per standard kit guidelines using mutagenic primers 5'-agtgtacatgtctcccaaccaggtcattaggattttcc-3' (SEQ ID NO: 14), 5'- ggaaaatcctaatgacctggttgggagacatgtacact-3' (SEQ ID NO: 15), and 5'- gaglagacaaggtlltglcaglgltgtgcagcagg-3' (SEQ ID NO: 16), 5'- cctgctgcacaacactgacaaaaccttgtctactc-3' (SEQ ID NO: 17) for c.412_419delCGGTTTTG and c,144G>A variants, respectively.
  • lOpl of the product was subject to Dpnl digestion for 5min at 37°C and transformed into chemically competent DH5a cells (NEB, USA) by heat shock at 42 °C for 30sec. Resulting transformants were grown in SOC media for Bit at 37 °C and selected overnight on LB agar plates containing lOOpg/ml Ampicillin. Following day, single colonies were selected and further grown in LB broth containing lOOpg/ml Ampicillin for 12 hours. Plasmid isolation and purification was done using plasmid miniprep kit (Qiagen, Germany). Sanger sequencing for confirmation of variant incorporation was done Genewiz, USA; by using cytomegalovirus virus forward primer (5’-CGCAAATGGGCGGTAGGCGTG- 3’; SEQ ID NO: 18).
  • Minigene assay for MINAR2 c.393G>T and transfections in HEK293 The preparation of minigene was carried out using the pETOl vector (Mobitec, GmbH). This Exontrap system is based on a shuttle vector (pETOl), which already contains 5’ and 3’ exon separated by a 600 bp intron sequence, including a multiple cloning site (MCS).
  • pETOl shuttle vector
  • MCS multiple cloning site
  • a total of 528bp regions including exon2 and flanking introns was amplified using primers 5'- CCGCTCGAGAGAGAACCCTAGAATCCTTTT-3' (SEQ ID NO: 19) and 5'- TCCCCGAGAGAAAAGCCAG-3' (SEQ ID NO: 20), which contain overhangs for Xhol and SacII restriction sites. After amplification, bands were excised, digested, and ligated with T4 DNA ligase into pETOl. After ligation, the resulting recombinant pETOl was transformed and selected on ampicillin plates lOOg/ml.
  • RT-PCR was then performed with 5 , GATGGATCCGCTTCCTGCCCC-3, , (SEQ ID NO: 23) and 5 'CTCCCGCCACCTCAGTGCC- 3' (SEQ ID NO: 24), and the resulting product was analyzed using agarose (1.5%) gel electrophoresis.
  • HUVEC cells were cultured in gelatin coated flasks using EndoGRO endothelial cell growth kit (SCME002, Sigma- Aldrich). For transient transfections with plasmid constructs 3xl0 5 cells were plated with gelatin coated 6 wells plates. After 12 hours of initial plating HUVEC cells were transiently transfected with 2ug of MINAR2 wildtype or MINAR2 mutant constructs (c.412_419delCGGTTTTG and C.144G>A) using Jetprime transfection reagent.
  • SCME002 EndoGRO endothelial cell growth kit
  • PC 12 cells were grown in poly-D-lysine coated T-75 tissue culture flasks at 37°C in 5% CO2 using RPMI-1640 supplemented with 5% horse serum, 5% fetal bovine serum and IX penicillin and streptomycin. Cells were fed 3 times in a week and were passaged at 8O%-85% confluency.
  • Protein estimation of samples was done using commercially available BCA kit (Pierce, Thermo Scientific). Equal concentration of protein was reduced and loaded on 4-20% Tris-Glycine gradient gel and protein separation was done as per the method of Laemmli et al. (Laemmli 1970). Following separation protein was transferred onto 0.22 micron using Turbo-trans Blot system (Biorad, USA). The resulting PVDF membrane were blocked in 5% BSA for 1.5hr and incubated overnight at 4°C in primary antibodies diluted (1:1000) in TBST (TBS+Tween 0.5%). Blots were washed with TBST and incubated in HRP conjugated Anti-Rabbit Goat secondary antibody (1:3000) for 1.5hr at room temperature.
  • Minar2 mRNA expression in Mice To check the expression of Minar2 in different tissues, lung, liver, kidney, brain and cochlea were dissected from P30 wildtype mice. In addition, the cochlear expression of Minar2 was assessed in E18.5 and P0 samples. Total RNA was isolated with TRIzol Reagent (Invitrogen) according to manufacturer’s instructions. Prior to reverse transcription, RNA samples were treated with rDNAse I (DNA-free kit, Applied Biosystems). cDNA was synthetized using qScript XLT cDNA SuperMix (Quanta Biosciences).
  • the primers used to amplify a 117 bp fragment of the Minar2 transcript were: forward 5'- TGGACCATTGAGGAGTATGACA-3' (SEQ ID NO: 30) and reverse 5'- GTCGAAGCCAGGAGTGTACG-3’ (SEQ ID NO: 31).
  • a 171 bp fragment was amplified with 5’-ACCCAGAAGACTGTGGATGG-3’ (SEQ ID NO: 32) forward primer and 5’-CACATTGGGGGTAGGAACAC-3’ (SEQ ID NO: 33) reverse primer.
  • DPOAE Distortion Product OtoAcoustic Emission
  • EP Endocochlear Potential recording in Mice: EP was measured in urethane- anaesthetised mice (O.lml/lOg bodyweight of a 20%w/v solution) aged P30-32 using 150mM KCl-filled glass pipette microelectrodes, as described previously (Ingham et al. 2016; Steel and Barkway 1989). EP was recorded as the potential difference (mV) between the tip of a glass microelectrode inserted into scala media via a fenestration in the cochlea basal turn lateral wall and a reference Ag-AgCl pellet electrode inserted under the skin of the dorsal surface of the neck.
  • mV potential difference
  • the primary antibodies used were rabbit anti-Myosin Vila (diluted 1:200; 25-6790, Proteus), mouse IgG2 anti-glutamate receptor 2 (GluR2) (diluted 1:2000; MAB397, Emd Millipore), and mouse IgGl anti-C-terminal-binding protein 2 (CtBP2) (diluted 1:200; 612044, BD Transduction Laboratories). Samples were incubated with the secondary antibodies for two cycles of Ih at 37°C.
  • the secondary antibodies used were Alexa Fluor 647- conjugated chicken anti-rabbit (1:200; #A21443, Thermo Fisher Scientific), Alexa Fluor 488- conjugated goat anti-mouse (IgG2a) (diluted 1:1000; #A21131, Thermo Fisher Scientific) and Alexa Fluor 568-conjugated goat anti-mouse (IgGl) (1:1000; #A21124, Thermo Fisher Scientific).
  • Specimens were mounted using ProLong Gold Antifade Mountant with DAPI (P36931, Life Technologies) and stored at 4°C. Samples were imaged with a Zeiss LSM 700 inverted confocal microscope interfaced with ZEN 2011 software (vl4.0.17.201).
  • a mouse anti- Myo7a (MY07A 138-1, DSHB), a chicken anti-NF (AB5539, Millipore), a mouse anti-Tujl (MMS-435P), and a chicken anti-Beta Galactosidase (ab9361) were utilized as a primary antibody.
  • Specimens were washed with PBS, and then incubated with anti-mouse Alexa Fluor 568 and 488, and anti-chicken 647 were applied.
  • DAPI (Calbiochem) were used to counterstain a nuclear DNA.
  • Specimens were washed with PBS and mounted in fluorescence mounting medium (Dako). Images were taken using a Zeiss LSM 710 fluorescence microscope.
  • mice were culled by decapitation (Pl) or by cervical dislocation (Pl 4 and P30). The skull was cut in two halves and the brain was removed to facilitate the penetration of the fixative. Samples were washed with cold PBS, fixed overnight in 4% PFA at 4°C and then washed twice with cold PBS.
  • X-gal staining Whole mount cochlea were incubated overnight at 37°C in X-gal staining solution (0.02% NP40, 0.01% Sodium Deoxycholate, 2mM MgCh, 5mM K3Fe(CN)6, 5mM K4Fe(CN)e, 0.5 mg/ml X-gal), washed twice with PBS 1-X and mounted in mounting medium (Dako).
  • Non-syndromic sensorineural hearing loss is diagnosed in affected individuals: A summary of the auditory phenotype of 13 affected individuals is shown in Figure 9. Ages ranged from 3 to 80 years old at the last examination. Each affected individual was diagnosed with HL either at birth or during infancy.
  • Families 1 and 2 were of Turkish ancestry, recruited in Turkey. Parents of Family 1 stated that in 11:1 and 11:2, HL was milder in younger ages and progressed to profound degree around age 10. Otoacoustic emissions were absent in these individuals. These siblings received unilateral cochlear implants at ages 12 and 10, respectively, which improved their oral communication. Individual 11:3 in Family 1 was diagnosed with profound sensorineural HL after failing the newborn hearing screening test. Otoacoustic emissions were absent at diagnosis. He received a unilateral cochlear implant at age 1 and communicates orally.
  • Families 3 and 4 were of Indian ancestry, recruited in India. While there is no known consanguinity in any of marriages in these two pedigrees, they are all from the same small town belonging to the same Malawi caste (Mali). All the affected individuals in Family 3 were born deaf and used signs, simple words, or sounds to be able to communicate. Severity of HL appeared to have remained the same in all the affected individuals from the beginning of life. Individuals IV: 1 and IV:2 in Family 4 were diagnosed with profound sensorineural HL at the age of about 3 years via auditory brainstem response studies. Their mode of communication at that age was predominantly non-verbal.
  • a high-resolution temporal bone CT scan was normal in at least one affected member of each family. None of the affected individuals had additional clinical findings for a syndromic form of deafness. Their neurodevelopmental skills were on target except for speech delay. None of the affected individuals showed impaired balance on tandem walking and Romberg test. They did not have bradykinesia, tremor, or rigidity on neurological examination.
  • MINAR2 variants co-segregate with autosomal recessive deafness: Homozygosity mapping via genome sequencing revealed a shared 9.4 Mb region, chr5: 123,576,980- 132,980,451 (hgl9), in three affected children of Family 1.
  • Family 3 from SNP arrays the longest autozygous region in all 7 affected individuals is flanked by markers rs 13174854 and rs377767449, which is 2.96 Mb chr5:128, 738, 407-131, 705 ,915 (hgl9).
  • Family 4 two affected children share a 5.76 Mb autozygous region chr5: 126,978,108- 132,742,450 (hgl9) flanked by markers rsl 1241936 and rsl 1242152.
  • MINAR2 c.393G>T leads to aberrant splicing:
  • the c.393G>T variant substitutes the last nucleotide of exon 2 and is predicted to abolish a splice donor site.
  • Exon trapping experiments show that this variant leads to insertion of 85 intronic nucleotides into exon 2, which alters the amino acid composition of the rest of the protein ( Figure 5C).
  • the same variant also leads to skipping of exon 2 entirely ( Figure 5C).
  • MINAR2 is named based on its structural similarity to MINAR1, which is shown to be involved in NOTCH2 signaling (Ho et al. 2018).
  • MINAR2 is predicated to have a cytoplasmic domain, a single transmembrane domain with a few amino acids at the extracellular domain.
  • MINAR2 encodes a significantly smaller protein (190 vs 917 amino acids) (Ho et al. 2018).
  • NOTCH2 abundance in cells is correlated with M1NAR2 expression.
  • MINAR2 is involved in MAP kinase and mTOR pathways: The study tested the effect of MINAR2 on the MAPK pathway by transiently overexpressing wildtype M1NAR2 on PC 12 cells and detecting levels of ERK1/2 and pERKl/2, a crucial kinase of the MAPK signaling pathway. These studies show that overexpression of wildtype MINAR2 reduces the abundance of pERKl/2. On the other hand, overexpression of the two MINAR2 deafness variants in Families 1 and 2 does not show this effect, again supporting their loss-of-function properties (Figure 6D).
  • Minar2 is expressed in the mouse cochlea: The presence of Minar2 transcript in different mouse tissues was assessed, including the inner ear, and specifically the cochlea. Total RNA was isolated from wildtype at E18.5, P0, and P30. RT-PCR with a forward primer located in exon 2 and a reverse primer in exon 3 of the Minar2 gene (NM_173759) produced a unique band of 17 Ibp corresponding to the wildtype mRNA in all analyzed tissues, with the exception of the liver. Minar2 is highly expressed in the inner ear, and specifically in the cochlea, at E18.5, P0, and P30 (data not shown).
  • the Notch pathway is a highly conserved intercellular signaling cascade that is activated by the interaction of transmembrane ligands (Delta and Jagged) with Notch receptors, which are usually expressed on the surface of neighboring cells. Binding of the Notch Ligand to receptor induces cleavage of the Notch receptors intracellular domain (NICD) and ensuing nuclear translocation of the NICD, where it binds to multiple DNA-binding proteins.
  • Notch activation is generally repressed to allow proliferation of endothelial cells in response to VEGF stimulation, and its expression is later upregulated when endothelial cells stop proliferating and the vessels begin to stabilize (Henderson et al.
  • MINAR2 is structurally similar to MINAR1, which has been reported to be involved in controlling neurite formation during neuronal differentiation through DEP Domain Containing MTOR Interacting Protein (DEPTOR).
  • DEPTOR DEP Domain Containing MTOR Interacting Protein
  • Figure 6E MINAR2 downrcgulatcs mTOR signaling
  • Minar2 mRNA expression in mouse inner ear at postnatal day 0 and showing a gradual decline up to day 30. Many fold increase in the early days of life and depleting over time suggests that Minar2 play a role in the development of the inner ear.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure relates to a method of treating sensorineural deafness. A method of characterizing hearing loss in a human subject also is provided.

Description

TREATMENT OF SENSORINEURAL DEAFNESS
GRANT FUNDING DISCLOSURE
[0001] This invention was made with government support under grant number DC009645 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.
CROSS REFERENCE TO RELATED APPLICATION AND INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] This application claims priority to U.S. Provisional Patent Application No. 63/062,922, filed August 7, 2020, which is hereby incorporated by reference in its entirety.
[0003] Incorporated by reference in its entirety is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: 55776PC_Seqlisting.txt; Size: 20,678bytes; Created: August 6, 2021.
FIELD OF THE INVENTION
[0004] The present disclosure relates to methods of characterizing and treating sensorineural deafness.
BACKGROUND
[0005] Hearing loss is one of the most common sensory deficits, affecting 1 in 500 newborns globally (Mehl and Thomson 2002). Genetic factors are implicated in majority of cases, with more than 80% of the inherited form exhibiting autosomal recessive transmission (Morton and Nance 2006). No additional findings are present in over 70% of the cases, which are then classified as non-syndromic hearing loss (Morton and Nance 2006).
[0006] High genetic heterogeneity has made identification of gene and gene variants challenging, development in next-generation sequencing technologies has provided speed and accessibility required for analyzing a wide array of genes, to precisely locate the genomic cause of a disease. Identification and functional characterization of deafness-associated genes represent the most efficient way to enhance knowledge in the field of sensory physiology and hearing loss (Atik et al. 2015; Vona et al. 2015). SUMMARY
[0007] The disclosure provides a method of treating sensorineural deafness in a mammalian subject (e.g., human) in need thereof. The method comprises administering to a subject having a mutation in a Membrane Integral NOTCH2 Associated Receptor gene (MINAR2) a composition that comprises a polynucleotide that encodes a MINAR2 peptide, a MINAR2 peptide, a small molecule that increases expression of MINAR2, an agent that blocks expression of a mutant MINAR2 gene, an agent that corrects the mutation in the MINAR2 gene. Administration of a combination of any of the foregoing is also contemplated. In various aspects, the method comprises detecting the presence of a mutation in the MINAR2 gene in a sample from a subject. In various embodiments, the MINAR2 mutation is a DNA variant classified as pathogenic or likely pathogenic according to American College of Medical Genetics and Genomics (ACMG) guidelines. The disclosure also contemplates a method comprising diagnosing the subject with sensorineural deafness when the presence of a mutation in the MINAR2 gene is detected.
[0008] It should be understood that, while various embodiments in the specification are presented using "comprising" language, under various circumstances, a related embodiment may also be described using "consisting of" or "consisting essentially of" language. The disclosure contemplates embodiments described as "comprising" a feature to include embodiments which "consist of" or "consist essentially of" the feature. The term "a" or "an" refers to one or more. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. The term "or" should be understood to encompass items in the alternative or together, unless context unambiguously requires otherwise.
[0009] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. Only such limitations which are described herein as critical to the invention should be viewed as such; variations of the invention lacking limitations which have not been described herein as critical are intended as aspects of the invention.
[0010] It is understood that each feature or embodiment, or combination, described herein is a non-limiting, illustrative example of any of the aspects of the disclosure and, as such, is meant to be combinable with any other feature or embodiment, or combination, described herein. For example, where features are described with language such as “one embodiment,” “some embodiments,” “various embodiments,” “related embodiments,” each of these types of embodiments is a non-limiting example of a feature that is intended to be combined with any other feature, or combination of features, described herein without having to list every possible combination. Such features or combinations of features apply to any of the aspects of the invention.
[0011] The headings herein are for the convenience of the reader and not intended to be limiting. Additional aspects, embodiments, and variations of the invention will be apparent from the Detailed Description and/or drawings and/or claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figures 1A-1D: Families and the MINAR2 variants. Fig. 1A: Pedigrees and segregation of the M1NAR2 variant in families. Filled symbols denote affected individuals and double lines indicate first cousin consanguinity. Fig. IB: Electropherograms showing the identified variant. The wild type traces are from an unrelated individual. Hom: Homozygous mutant, Het: Heterozygous mutant. Fig. 1C: A diagram outlining the positions of the variants p.Argl38ValfsTerlO and p.Trp48Ter in the intracellular region of the MINAR2 protein and the mapping to in exons 1-3 of the MINAR2 gene. Fig. ID: Alignment of the amino acid sequences for human MINAR1 and MINAR2. Alignments derived from Clustal Omega. MINAR1 positions = 273; MINAR2 positions = 190. 56 identical positions, 20.217% identity, and 81 similar positions according to UniProt Align software.
[0013] Figure 2 : Table of parameters used for detecting homozygous runs (Enlis software).
[0014] Figure 3 : Table of homozygous runs >2 MB in the affected siblings.
[0015] Figure 4 : Table of primers used for the Sanger DNA sequencing.
[0016] Figures 5A-5C: Families, MINAR2 variants, and the effects of the c.393G>T variant on splicing. Fig. 5 A: Pedigrees and segregation of the MINAR2 variant in families. Filled symbols denote affected individuals and double lines indicate first cousin consanguinity. Electropherograms show the identified variant. The wild type traces are from an unrelated individual. Hom: Homozygous mutant. Fig. 5B: Locations of the identified variants. Fig. 5C: Exon trap assay for variant c.393G>T. MINAR2 exon 2 was inserted into a vector consisting of 5’ and 3’ exons. PCR products show larger and smaller bands in c.393G>T compared to wildtype. Sanger sequencing confirmed insertion of 85 bp at the donor site of exon 2 and skipping of exon 2.
[0017] Figures 6A-6E: Effects of MIN R2 overexpression and silencing on angiogenesis and multiple pathways. Fig. 6A: Top four representative images show angiogenic potential of non-transfected (NT) human umbilical vascular endothelial cells (HUVEC) compared to cells transfected with M1NAR2 wild type (WT) plasmid construct, M1NAR2 plasmid construct bearing p.Trp48* and p.Argl38Valfs*10 variants, respectively. Right graph shows analysis of total length of angiogenic vessels formed after incubation of 12 hrs on Matrigel coated wells; images were analyzed with imageJ angioanalyzer and results are expressed as Mean+SEM. Significant differences were shown as (***p<0.001) when compared to control and as (##p <0.01) when compared to MINAR2(WT). Fig. 6B: Left: Western blot images of effect of MINAR2 (WT) transient overexpression on NOTCH2 and VEGFA protein levels in HUVEC cells; Right: statistical analysis of GAPDH normalized relative protein expressions of NOTCH2 and VEGFA. Results are expressed as mean+SEM and significant differences are shown as (*p<0.05) when compared to control. Fig. 6C: Left: western blot images of effect of SiRNA induced MINAR2 silencing on NOTCH2 protein levels in PC12; Right: Beta- Actin normalized relative protein expression of NOTCH2. Results are expressed as Mean+SEM and significant differences are shown as (**p<0.01) when compared to control or (##p <0.01) when compared to groups other than control. Fig. 6D: Left: western blot images of effect of M1NAR2 wild type (WT), MINAR2 p.Trp48* and MINAR2 p.Argl38Valfs*10 variants transient overexpression on phosphorylation of Extracellular signal-regulated protein kinases 1 and 2 (Erkl/2); Right: statistical analysis of GAPDH-normalized relative protein expressions of pErkl/2 and Erkl/2. Results are expressed as mean+SEM and significant differences are shown as (***p<0.001) when compared to control and as (###p <0.001 ) when compared to MINAR2(WT). Fig. 6E: Left: Immunoblot analysis of S6 Ribosomal Protein and its phosphorylation at Ser235/236; Akt and its phosphorylation at Ser 473 in PC12 cells transfected with either scrambled negative control siRNA or MINAR2 siRNA. Transfected cells were serum starved and treated with 50 ng/ml of NGF for 0 to 12 hours. Cell lysates were harvested after 48 hrs of SiRNA incubation and at 0,1,3 and 12 hours of NGF treatment. In addition, cells were treated with 100 nM of rapamycin (Rap) for 30 min after 12 hours of NGF treatment. GAPDH was used as a loading control. Right: Quantitative analysis of p-S6 levels in PC 12 cells transfected with scrambled and MINAR2 SiRNA respectively at 0,1,3 and 12 hours of NGF treatment. The p-S6/S6 ratios are calculated from three biological repeats. Results are expressed as mean+SEM and significant difference between scrambled SiRNA and MINAR2 SiRNA are shown as (*p<0.05) when compared for any time point.
[0018] Figure 7 : Table of next generation sequencing statistics
[0019] Figure 8: Table providing WGS homozygous runs >1 MB in three affected siblings of Family 1 and 2.
[0020] Figure 9 : Table of audiological phenotype in affected individuals.
[0021] Figure 10: Table of characteristics of the identified MINAR2 variants.
[0022] Figure 11: qRT-PCR analysis of effect of scrambled and three predicted MINAR2 SiRNA sequences namely A, B, and C at concentrations of lOnM and 80nM on MINAR2 mRNA expression in PC 12 cells after 48 hrs of transfection respectively. The results are expressed as Fold change in mRNA levels+SEM.
[0023] Figure 12: Relative expression pattern of Minar2 (previously known as A730017C20Rik) in mouse inner ear (data from Elkon et. al., 2015) by using gene Expression Analysis Resource (gEAR; umgear.org/).
[0024] Figure 13: Table of ten longest homozygous runs in the proband of Family 2 individual 11:1 via WGS.
DETAILED DESCRIPTION
[0025] The disclosure provides a method of characterizing and treating deafness. To better map the landscape of autosomal recessive sensorineural hearing loss, samples from families with parental consanguinity were collected. Genome sequencing (GS) was performed on a subset of these families and revealed loss of function variants in M1NAR2. Variants in MINAR2, a frameshift 8bp deletion (p.Argl38ValfsTerl0) and a nonsense variant (p.Trp48Ter) were identified in two unrelated Turkish families co-segregating with autosomal recessive sensorineural hearing loss. A third variant also was identified, p.Lysl31Asn, in two additional families. [0026] MINAR2 (previously known as uncharacterized protein KIAA1024L and mouse gene A730017C20Rik~) shares some identity with MINAR1, which has been found to be involved in controlling neurite formation during neuronal differentiation through DEP Domain Containing MTOR Interacting Protein (DEPTOR) and angiogenesis through modulation of Notch2. Notch pathway is a highly conserved intercellular signaling cascade that is activated by the interaction of transmembrane ligands (Delta and Jagged) with Notch receptors, which are usually expressed on the surface of neighboring cells. Binding of Notch Ligand to receptor induces cleavage of the Notch receptors intracellular domain (NICD) and ensuing nuclear translocation of the NICD, where it binds to multiple DNA-binding proteins (Andersson et al. 2011; Chillakuri et al. 2013; Lu and Lux 1996).
[0027] Notch signaling plays a very delicate role in angiogenesis. In the initial stages of angiogenesis, Notch activation is generally repressed to allow proliferation of endothelial cells in response to VEGF stimulation, and its expression is later upregulated when endothelial cells stop proliferating and the vessels begin to stabilize (Henderson et al. 2001; Taylor et al. 2002). Disruption or interference with the Notch pathway in mice resulted in the development of vascular tumors and lethal hemorrhage (Liu et al. 2011) and its activity in cell culture inhibited the angiogenic functions of endothelial cells such as capillary tube formation, migration, and proliferation (Itoh et al. 2004; Leong et al. 2002; Noseda et al. 2004; Williams et al. 2011).
[0028] Disclosed herein is the identification of mutations in the MINAR2 gene (wild-type sequence found in NCBI Reference Sequence: NM_001257308.2; SEQ ID NO: 1). MINAR2 encodes major intrinsically disordered NOTCH2-binding receptor 1-like (also known as Membrane integral NOTCH2-associated receptor 2 or MINAR2) (UniProtKB/Swiss-Prot Reference sequence: P59773; SEQ ID NO: 2).
[0029] In one aspect, the disclosure provides a method of characterizing sensorineural deafness in a subject. The method comprises detecting a mutation in M1NAR2 in the subject, as described further herein.
[0030] The disclosure also provides methods of treating sensorineural deafness. The method comprises administering to a subject having a mutation in the M1NAR2 gene a composition that comprises one or more of the following: a polynucleotide that encodes a MINAR2 peptide, a MINAR2 peptide, a small molecule that increases expression of MINAR2, an agent that blocks expression of a mutant MINAR2 gene, and an agent that corrects the mutation in the MINAR2 gene. In various embodiments, the method comprises administering a combination of the foregoing agents, in a single composition or in separate compositions (optionally administered at different time points). In various aspects, the method comprises detecting the presence of a mutation in the MINAR2 gene in a sample from the subject. In various embodiments, the MINAR2 mutation is preferably a DNA variant classified as pathogenic or likely pathogenic according to American College of Medical Genetics and Genomics (ACMG) guidelines. In various aspects of the disclosure, a method is provided which comprises diagnosing the subject with sensorineural deafness when the presence of the mutation in the MINAR2 gene is detected.
[0031] In various embodiments, the method comprises detecting the MINAR2 gene mutations p.Argl38ValfsTerlO, p.Trp48Ter, or any protein truncating mutation and/or mutation that leads to a “loss of function” or a hypomorphic function of the protein. In various aspects, the method comprises detecting the MINAR2 gene mutation p.Lysl31Asn. In related embodiments, mutations in the MINAR2 gene may be detected using next-generation sequencing such as a gene panel, whole exome sequencing (WES), whole-genome sequencing (WGS), Sanger sequencing, and related DNA sequencing methods, polymerase chain reaction (PCR), real-time PCR (RT- PCR), microarray or Multiplex Ligation-dependent Probe Amplification (MLPA) assays for sequence and copy number variants, DNA restriction enzyme digestion and gel electrophoresis, and other DNA mutation detection methods known in the art. Also mutant MINAR2 may be detected via next-generation sequencing or PCR amplification of M1NAR2 mRNA or western blotting of MINAR2 protein.
[0032] In various aspects, the MINAR2 mutation is detected by examining proteins using western blotting (immunoblot), High-performance liquid chromatography (HPLC), Liquid chromatography-mass spectrometry (LC/MS), antibody dependent methods such as enzyme- linked immunosorbent assay (ELISA), protein immunoprecipitation, protein immunostaining, protein chip methods or other protein detection methods suitable for mutation detection.
[0033] The sample may be any biological sample taken from the subject, including, but not limited to, any tissue, cell, or fluid (e.g., blood) which can be analyzed for a trait of interest, such as the presence or amount of a nucleic acid (e.g., M1NAR2 mRNA) or a protein (e.g., MINAR2 protein). In various embodiments, the biological sample is a plasma, saliva, urine, or skin sample.
[0034] A “subject” as referred to herein, can be any mammal, such as a human. In various embodiments, the subject is an infant, a child, an adolescent or an adult. In various embodiments, the subject is a human aged 5 years or younger. In other aspects, the subject is 13 years or younger, 18 years or younger, 30 years or younger, or over 30 years old. In various embodiments, the subject exhibits hearing loss from the inability to hear sounds ranging from 20 decibels (dB) to 1000 dB, or >1000 dB. In related aspects, the subjects hearing loss is an inability to hear sounds at 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or >1000 dB. In various aspects, the subjects hearing loss may be absent at the time of performing the methods described herein. In various embodiments, subjects may have other organ dysfunctions.
[0035] In some embodiments, MINAR2 peptide is administered to the subject. As such, the therapy supplements MINAR2 peptide levels where endogenous, functional MINAR2 levels are inadequate or absent. An exemplary MINAR2 peptide is provided in SEQ ID NO: 2. The disclosure contemplates use of a peptide that comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 2. For example, the peptide may comprise at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 2.
[0036] In various embodiments, the method comprises administering to the subject a polynucleotide (e.g., a polynucleotide that encodes the MINAR2 peptide/protein (i.e. , the MINAR2 peptide described herein), an agent that blocks expression of a mutant M1NAR2 gene, and/or an agent that corrects the mutation in MINAR2 gene). Polynucleotides are typically delivered to a host cell via an expression vector, which includes the regulatory sequences necessary for delivery and expression. In some aspects, the constructs described herein include a promoter (e.g., cytomegalovirus (CMV) promoter), a protein coding region (optionally with noncoding (e.g. 3’-UTR) regions that facilitate expression), transcription termination sequences, and/or regulator element sequences. In various aspects, tissue specific or regulatable expression may be desired. In this regard, for example, the Cre-loxP system may be utilized to express a polynucleotide of interest (e.g., MINAR2 gene). [0037] Expression vectors may be viral-based (e.g., retrovirus-, adenovirus-, or adeno- associated virus-based) or non-viral vectors (e.g., plasmids). Non- vector based methods (e.g., using naked DNA, DNA complexes, etc.) also may be employed. Optionally, the vector is a viral vector, such as a lentiviral vector or baculoviral vector, and in various preferred embodiments the vector is an adeno-associated viral vector (AAV). The expression vector may be based on any AAV serotype, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV- 9, AAV-10, AAV-11, AAV-12, or AAV-13. Polynucleotides also may be delivered via liposomes, nanoparticles, exosomes, microvesicles, hydrodynamic -based gene delivery, or via a “gene-gun.”
[0038] In various embodiments, the agent is a polynucleotide that encodes a MINAR2 peptide. The amino acid sequence of the MINAR2 peptide is provided as SEQ ID NO: 2. The polynucleotide used in the method optionally encodes the amino acid sequence of SEQ ID NO: 2 or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 2 (which retains the function of MINAR2). Optionally, the polynucleotide comprises SEQ ID NO: 1 or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the polynucleotide sequence of SEQ ID NO: 1 (and which encodes MINAR2).
[0039] In various embodiments, the agent is a small molecule therapeutic (i.e., drug) that increases expression of MINAR2. As such, administration of the small molecule increases MINAR2 protein levels. It will be appreciated that “increasing” expression of MINAR2 does not require 100% increase of expression of MINAR2 protein levels in a subject; any level of increased expression of MINAR2 may be beneficial to a subject. In related embodiments, administration of the small molecule increases the expression of MINAR2 protein by about 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or 100%.
[0040] In various embodiments, an agent which blocks the expression of a mutant M1NAR2 gene is administered, optionally in combination with a polynucleotide that encodes functional MINAR2 or MINAR2, itself. An agent that blocks expression of a mutant MINAR2 gene refers to an agent that interferes with expression of a mutant MINAR2 gene so that mutant MINAR2 gene expression and/or mutant MINAR2 protein levels are reduced compared to basal/ wild-type levels. It will be appreciated that “blocking” expression of a mutant MINAR2 gene does not require 100% abolition of expression and MINAR2 production; any level of reduced expression of aberrant MINAR2 may be beneficial to a subject. Exemplary agents include, but are not limited to, antisense oligonucleotides (ASO), short hairpin RNA (shRNA), small interfering RNA (siRNA), or micro RNA (miRNA). In related aspects, the agent is an antisense oligonucleotide (ASO) used to knock-down (i.e., reduce) the expression of aberrant (i.e. mutant) MINAR2. It will be appreciated that “blocking” expression of the MINAR2 gene does not require 100% abolition of expression of MINAR2 protein; any level of reduced expression of MINAR2 may be beneficial to a subject. For example, in various aspects, the MINAR2 antisense oligonucleotide reduces the expression of MINAR2 protein by 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80 90 or 100%. An ASO is a single-stranded deoxyribonucleotide, which is complementary to an mRNA target sequence. In various aspects, the MINAR2 antisense oligonucleotide targets an exonic or intronic sequence of the MINAR2 gene.
[0041] In some embodiments, an agent that corrects the mutation in the M1NAR2 gene is employed. In this regard, the agent may comprise components employed in genome-editing techniques, such as designer zinc fingers nucleases (ZFNs), transcription activator-like effectors nucleases (TALENs), or CRISPR-Cas (clustered regularly interspaced short palindromic repeats- CRISPR associated) systems. In some embodiments, the agents are used to modify the sequence of the MINAR2 coding region or a regulatory element and/or non-coding region associated with the MINAR2 gene. In various aspects, genome editing may be used to replace part or all of the M1NAR2 gene sequence or alter MINAR2 protein expression levels. An exemplary agent for use in the method of the disclosure is, DNA encoding Cas9 molecules and/or guide RNA (gRNA) molecules. Cas9 and gRNA can be present in a single expression vector or separate expression vectors. Adenoviral delivery of the CRISPR/Cas9 system is described in Holkers et al., Nature Methods (2014), 11(10): 1051-1057, which is incorporated by reference in its entirety.
[0042] The terms “treating” or “treatment” refer to reducing or ameliorating sensorineural deafness and/or associated disorders and/or symptoms associated therewith. These terms include reducing the severity of the disorder or any symptoms associated therewith. It is appreciated that, although not precluded, “treating” or “treatment” of a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated; any increase in sensitivity to sound or change in a similar sensory perception is contemplated. A change in the ability of a subject to detect sound is readily accomplished through administration of simple hearing tests, such as a tone test commonly administered by an audiologist. In most mammals, a reaction to different frequencies indicates a change in sensory perception. In humans, comprehension of language also is appropriate. A change in perception is indicated by the ability to distinguish different types of acoustic stimuli, such as differentiating language from background noise, and by understanding speech. Speech threshold and discrimination tests are useful for such evaluations. To detect a change in sensory perception (e.g., hearing), a baseline value is recorded prior to treatment using any appropriate sensory test. A subject is reevaluated at an appropriate time period following the method (e.g., 1 day, 3 days, 5 days, 7 days, 14 days, 21 days, 28 days, 2 months, 3 months or more), the results of which are compared to baseline results to determine a change.
[0043] A dose of an active agent (e.g., a polynucleotide that encodes a MINAR2 peptide; a MINAR2 peptide; a small molecule that increases expression of MINAR2; an agent that blocks the expression of a mutant M1NAR2 gene; an agent that corrects a mutation in MINAR2 gene) will depend on factors such as route of administration (e.g., local vs. systemic), patient characteristics (e.g., gender, weight, health, side effects), the nature and extent of the sensorineural deafness or associated disorder, and the particular active agent or combination of active agents selected for administration.
[0044] Suitable methods of administering a physiologically-acceptable composition, such as a pharmaceutical composition comprising an agent described herein, are well known in the art. In various aspects, more than one route can be used to administer one or more of the agents disclosed herein. A particular route can provide a more immediate and more effective reaction than another route. For example, in certain circumstances, it will be desirable to deliver the composition orally; through injection or infusion by intravenous, intraotic, intraperitoneal, intracerebral (intra-parenchymal), intracerebroventricular, intramuscular, intra-ocular, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, urethral, vaginal, or rectal means; by controlled, delayed, sustained or otherwise modified release systems; by implantation devices; using nanoparticles; or as a conjugate.
[0045] In various aspects, the agent described herein is administered to the inner ear. The most direct routes of administration entail surgical procedures which allow access to the interior of the structures of the inner ear. Inoculation via cochleostomy allows administration of the agent directly to the regions of the inner ear associated with hearing. Cochleostomy involves drilling a hole through the cochlear wall, e.g., in the otic capsule below the stapedial artery as described in Kawamoto et al., Molecular Therapy, 4(6), 575-585 (2001), and release of a pharmaceutical composition. Administration to the endolymphatic compartment is particularly useful for administering an agent to the areas of the inner ear responsible for hearing. Alternatively, the agent can be administered to the semicircular canals via canalostomy. Canalostomy provides for exposure to the vestibular system and the cochlea, whereas cochleostomy does not provide as efficient transduction in the vestibular space. The risk of damage to cochlear function is reduced using canalostomy in as much as direct injection into the cochlear space can result in mechanical damage to hair cells (Kawamoto et al., supra). Administration procedures also can be performed under fluid (e.g., artificial perilymph), which can comprise factors to alleviate side effects of treatment or the administration procedure, such as apoptosis inhibitors or anti-inflammatories.
[0046] Another direct route of administration to the inner ear is through the round window, either by injection or topical application to the round window. Administration via the round window is especially preferred for delivering agents to the perilymphatic space.
[0047] The agent can be present in or on a device that allows controlled or sustained release, such as a sponge, meshwork, mechanical reservoir or pump, or mechanical implant. For example, a biocompatible sponge or gelfoam soaked in a pharmaceutical composition is placed adjacent to the round window, through which the agent permeates to reach the cochlea. Mini- osmotic pumps provide sustained release of an agent over extended periods of time (e.g., five to seven days), allowing small volumes of composition to be administered, which can prevent mechanical damage to endogenous sensory cells.
[0048] A polynucleotide can be introduced ex vivo into cells previously removed from a given subject. Such transduced autologous or homologous host cells can be progenitor cells that are reintroduced into the inner ear of the subject to express, e.g., functional MINAR2. One of ordinary skill in the art will understand that such cells need not be isolated from the patient, but can instead be isolated from another individual and implanted into the patient.
[0049] The agent is preferably administered as soon as possible after it has been determined that the subject is at risk for hearing loss (e.g., because of family history or detection of mutant MINAR2 prior to clinical manifestation of hearing impairment) or has demonstrated hearing loss.
[0050] It is contemplated the two or more active agents described herein may be administered as part of a therapeutic regimen. Alternatively or in addition, one or more of the active agents may be administered with other therapeutics as part of a therapeutic regimen. The active agent(s) may be administered as a monotherapy or as a combination therapy with other treatments administered simultaneously or metronomically. The term "simultaneous" or "simultaneously" refers to administration of two agents within six hours or less (e.g., within three hours or within one hour each other). In this regard, multiple active (or therapeutic) agents may be administered the same composition or in separate compositions provided within a short period of time (e.g., within 30 minutes). The term "metronomically" means the administration of different agents at different times and at a frequency relative to repeat administration. Active agents need not be administered at the same time or by the same route; preferably, in various embodiments, there is an overlap in the time period during which different active agents are exerting their therapeutic effect.
[0051] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.
EXAMPLES
Example 1
[0052] This Example describes a study of subjects with sensorineural hearing loss.
[0053] Subjects: The diagnosis of sensorineural hearing loss was established via standard audiometry in a sound-proof room according to the current clinical standards. Clinical evaluation included a thorough physical examination and otoscopy in all cases. DNA was extracted from peripheral blood leukocytes of probands according to the standard procedures.
[0054] Sequencing and Bioinformatics Analysis: Genome sequencing was performed via
BGISEQ-500 and Illumina X Ten instruments in Family 1 individual 11:1 and 11:2, respectively (FigurelA). Whole-genome sequencing also was performed in Family 1 individual 11:3 and Family 2 individual 11:1 (Figure 7) Reads were mapped to human genome reference (NCBI build37/hg 19 version) with Burrows Wheeler Aligner (BWA). Genome Analysis Toolkit (GATK) was used for the variant calling. Copy number variants (CNVs) were called using the CNVnator. Enlis Genome Research software (www.enlis.com/) was used to identify runs of homozygosity from genome sequencing data (Figure 7).
[0055] For the population allele frequency, gnomAD (Broad Institute) and dbSNP (NCBI) databases, as well as an internal exome/genome database that includes > 4,000 exomes from different ethnicities 100 genomes, were used. Minor allele thresholds of 0.005 for recessive and 0.001 for dominant variants were used. For the missense variants, a combination of criteria from the following databases were used: damaging for Sorting Intolerant From Tolerant (SIFT), Polyphen2, disease-causing for MutationTaster and > 0.7 for REVEL score. American College of Medical Genetics (ACMG) and ClinGen hearing loss expert panel guidelines were used for variant interpretation. Sanger sequencing was used to evaluate co-segregation of the variant with hearing loss. Enlis Genome Research software was used to identify homozygous regions from GS data (Figure 2). After excluding variants in all previously recognized deafness genes, the focus became variants that mapped to shared runs of homozygosity, > 1 MB regions, in siblings (11:1 and 11:2) of family 1 (Figure 3). Later variant filtering in shared autozygous regions in siblings, was applied.
[0056] Screening cohort by genotyping: Following identification of a M1NAR2 variant in a family, 685 probands with autosomal recessive deafness were screened. These probands either had additional affected family members and/or parental consanguinity. Thus, probands were sought which had MINAR2 within a homozygous run determined by rs6885164, rs25810, rs9327540, and rs6888996. Genotypes were determined by using TaqMan assays (Applied Biosystems). For each TaqMan reaction, 20 ng DNA was mixed with TaqMan Universal PCR Master Mix (2x, Applied Biosystems) and SNP Genotyping Assay (20x, Applied Biosystems). PCR conditions were 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. Plates were read on the 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Foster City, CA). Finally, data were analyzed by using the SDS v2.4 software (Applied Biosystems). All three coding exons and exon-intron boundaries of MINAR2 were further screened via Sanger sequencing in those individuals who were homozygous for selected SNPs (Figure 4). [0057] Statistics: Single locus two-point LOD scores were calculated using Superlink Online SNP 1.1 with a disease allele frequency of 0.001 under fully penetrant autosomal recessive model assuming autozygosity.
Non-syndromic sensorineural hearing loss in affected individuals
[0058] Proband in family 1 (11:1) was a 17-year-old female with bilateral progressive sensorineural hearing loss. She was diagnosed with hearing loss during infancy, which progressed to profound deafness after age 10. Otoacoustic emissions were negative. High resolution temporal bone CT was normal. At age 12 she received unilateral cochlear implant improving her oral communication.
[0059] Individual 11:2 was a 15-year-old male with progressive sensorineural hearing loss leading to profound deafness, which was treated with unilateral cochlear implant at age 10. Otoacoustic emissions were negative. Temporal bone CT did not show inner ear malformations.
[0060] Individual 11:3 was a 3-year-old male who was diagnosed with sensorineural hearing loss during newborn screening. He was diagnosed with bilateral profound hearing loss and received a unilateral cochlear implant at age 1. Otoacoustic emissions were negative.
[0061] Individual II: 1 in family 2 was a 42-year-old female with bilateral profound sensorineural hearing loss, which was either congenital or prelingual-onset.
[0062] None of the affected individuals had additional clinical findings for a known form of syndromic deafness. Their neurodevelopmental skills were on target except for speech development.
Genome sequencing reveals a frameshift variant in MINAR2
[0063] On average, read depth was 47.32x and 36.19x; lx coverage of the genome was 99.2% and 99.6%, 4x coverage of the genome was 98.88% and 99.6% for family 1 individual 11:1 and 11:2.
[0064] A homozygous NM_001257308.2:c.412_419delCGGTTTTG (p.Argl38ValfsTerl0) variant was identified in two siblings in family 1 by using genome sequencing. The cohort screening revealed a homozygous NM_001257308.2:c.l44G>A (p.Trp48Ter) variant in a simplex family (family 2) in MINAR2. Both variants were present on the intracellular domain of Minar2 corresponding to the regions of exon 3 and 1 respectively (Figure 1). Single locus two- point LOD score was 3.6.
Example 2
[0065] This Example describes further study of subjects with sensorineural hearing loss. Individuals in the first two families were included in Example 1. This Example reports on variants in MINAR2, membrane integral NOTCH2 associated receptor 2, in four families underlying autosomal recessive non-syndromic deafness. M1NAR2 is a recently annotated gene. Functional aspects of MINAR2 and consequences of MINAR2 dysfunction in humans remain largely uncharacterized. Three loss-of-function M1NAR2 variants, p.Trp48*. p.Argl38Valfs*10, and p.Lysl31Asn, were identified as described herein in 13 individuals with congenital or prelingual-onset severe to profound sensorineural hearing loss. The Examples provided herein show that Minar2 is expressed in the mouse inner ear, with the protein localizing mainly in the hair cells, spiral ganglia, the spiral limbus, and the stria vascularis. Via in vitro studies, the results described below show that MINAR2 suppresses angiogenesis, as well as NOTCH2, MAPK, and mTOR pathways. The data suggest that MINAR2 is essential for hearing in humans and its disruption leads to sensorineural hearing loss.
Materials and Methods
[0066] Subjects: The diagnosis of sensorineural HL was established via auditory brainstem response or standard audiometry in a sound-proof room according to the current clinical standards. Clinical evaluation included reviews of past medical history with an emphasis on environmental causes of HL and syndromic deafness and a thorough physical examination including an eye exam and otoscopy in all cases. DNA was extracted from peripheral blood leukocytes of participants according to the standard procedures.
[0067] DNA Sequencing and Bioinformatics Analysis: Whole-genome sequencing was performed in Family 1 individuals II: 1, 11:2, 11:3 and Family 2 11:1 (Figure 7; Figure 5A). Reads were mapped to human genome reference (NCBI build37/hg 19 version) with Burrows Wheeler Aligner (BWA). Genome Analysis Toolkit (GATK) was used for variant calling (DePristo et al. 2011; Li and Durbin 2010; McKenna et al. 2010). Copy number variants (CNVs) were called using CNVnator (Abyzov et al. 2011). Enlis Genome Research software (www.enlis.com/) was used to identify runs of homozygosity from genome sequencing data (Figure 7). [0068] Exome sequencing was performed on a HiSeq 2000 platform (Illumina), in individuals IV:3 and IV:5 in Family 3 and IV: 1 in Family 4 (Figure 7). In addition, Illumina Infinium Global Screening Array (GSA) v2 (Illumina) kit used for genotyping in 16 members of Family 3 and three members of Family 4 to map the shared homozygous regions in affected individuals.
[0069] Using the NSHE-specific American College of Medical Genetics (ACMG) guidelines, minor allele frequency (MAF) thresholds of 0.005 for recessive and for recessive and 0.001 for dominant variants were used. Population allele frequencies were obtained from gnomAD (gnomad.broadinstitute.org/) and dbSNP (www.ncbi.nlm.nih.gov/projects/SNP/) databases, as well as from our internal exome/genome database that includes > 7,000 samples from different ethnicities. ACMG and ClinGen HU expert panel guidelines were used for variant interpretation (Oza et al. 2018; Richards et al. 2015).
[0070] Whole-genome and exome sequencing data in affected individuals were first analyzed for variants (SNVs, indels, and CNVs) in recognized HU genes retrieved from (hereditaryhearingloss.org/), Online Mendelian Inheritance in Man (omim.org/), University of Miami Molecular Genetics Uaboratory HU gene panel, and a virtual gene panel for HU (v2.176) from PanelApp (www.genomicsengland.co.uk). This analysis did not reveal a plausible variant under any inheritance model. After excluding variants in previously recognized deafness genes, we focused on variants that mapped to shared runs of homozygosity > 1 MB regions, in affected members of each family (Figures 2 and 8).
[0071] Sanger sequencing was used to evaluate co- segregation of candidate variants with HU.
[0072] Site directed mutagenesis: MINAR2 (OHu01804, NM_001257308.2) cDNA cloned in pcDNA3.1+/C-(K)DYK was procured from Genscript Biotech (NJ, USA). Site directed mutagenic changes to incorporate c.412_419delCGGTTTTG, and C.144G>A were done using Quick Change Uightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, USA). Briefly, 40 ng plasmid was subjected to PCR amplification as per standard kit guidelines using mutagenic primers 5'-agtgtacatgtctcccaaccaggtcattaggattttcc-3' (SEQ ID NO: 14), 5'- ggaaaatcctaatgacctggttgggagacatgtacact-3' (SEQ ID NO: 15), and 5'- gaglagacaaggtlltglcaglgltgtgcagcagg-3' (SEQ ID NO: 16), 5'- cctgctgcacaacactgacaaaaccttgtctactc-3' (SEQ ID NO: 17) for c.412_419delCGGTTTTG and c,144G>A variants, respectively. Following PCR, lOpl of the product was subject to Dpnl digestion for 5min at 37°C and transformed into chemically competent DH5a cells (NEB, USA) by heat shock at 42 °C for 30sec. Resulting transformants were grown in SOC media for Ihr at 37 °C and selected overnight on LB agar plates containing lOOpg/ml Ampicillin. Following day, single colonies were selected and further grown in LB broth containing lOOpg/ml Ampicillin for 12 hours. Plasmid isolation and purification was done using plasmid miniprep kit (Qiagen, Germany). Sanger sequencing for confirmation of variant incorporation was done Genewiz, USA; by using cytomegalovirus virus forward primer (5’-CGCAAATGGGCGGTAGGCGTG- 3’; SEQ ID NO: 18).
[0073] Minigene assay for MINAR2 c.393G>T and transfections in HEK293: The preparation of minigene was carried out using the pETOl vector (Mobitec, GmbH). This Exontrap system is based on a shuttle vector (pETOl), which already contains 5’ and 3’ exon separated by a 600 bp intron sequence, including a multiple cloning site (MCS). To include MINAR2 C.393G > T, a total of 528bp regions including exon2 and flanking introns was amplified using primers 5'- CCGCTCGAGAGAGAACCCTAGAATCCTTTT-3' (SEQ ID NO: 19) and 5'- TCCCCGAGAGAAAAGCCAG-3' (SEQ ID NO: 20), which contain overhangs for Xhol and SacII restriction sites. After amplification, bands were excised, digested, and ligated with T4 DNA ligase into pETOl. After ligation, the resulting recombinant pETOl was transformed and selected on ampicillin plates lOOg/ml.
[0074] Positive colonies were identified, and isolated-recombinant vectors were confirmed using Sanger sequencing primer 5'-GCGAAGTGGAGGAtCCACAAG-3 (SEQ ID NO: 21). Furthermore, HEK-293 cells were transfected with 2pg of empty vector pETOl, pETOl containing control fragment, and Mutant MINAR2 c.393G>T fragments. RNA isolation was done 48 hours after the initial transfection, and reverse transcription was done using SuperScript™ IV First-Strand Synthesis System (ThermoFisher, US) and cDNA primer 5’- GATCCACGATGC-3' (SEQ ID NO: 22) specific to pETOl. RT-PCR was then performed with 5 ,GATGGATCCGCTTCCTGCCCC-3,, (SEQ ID NO: 23) and 5 'CTCCCGCCACCTCAGTGCC- 3' (SEQ ID NO: 24), and the resulting product was analyzed using agarose (1.5%) gel electrophoresis.
[0075] In vitro angiogenesis assay ofHUVEC cells: HUVEC cells were cultured in gelatin coated flasks using EndoGRO endothelial cell growth kit (SCME002, Sigma- Aldrich). For transient transfections with plasmid constructs 3xl05 cells were plated with gelatin coated 6 wells plates. After 12 hours of initial plating HUVEC cells were transiently transfected with 2ug of MINAR2 wildtype or MINAR2 mutant constructs (c.412_419delCGGTTTTG and C.144G>A) using Jetprime transfection reagent.
[0076] For comparative analysis of angiogenic potential of transiently transfected HUVEC cells with MINAR2 constructs, 7xl03 cells were plated on matrigel coated 6 well plates as per user instructions of In Vitro Angiogenesis Assay Kit (ECM625, Millipore Sigma). Plates were incubated at 37°C in humidified CO2 incubator for 12hrs. Images were acquired at 200pm with Leica DMIL inverted microscope, and analysis of the total length of angiogenic vessels was performed with Angiogenesis Analyzer for ImageJ, as described by (Carpentier et al. 2020).
[0077] Cell culture and SiRNA induced silencing in PCI 2 cells: PC 12 cells were grown in poly-D-lysine coated T-75 tissue culture flasks at 37°C in 5% CO2 using RPMI-1640 supplemented with 5% horse serum, 5% fetal bovine serum and IX penicillin and streptomycin. Cells were fed 3 times in a week and were passaged at 8O%-85% confluency. After 3 passages 2.7xl05 cells were plated per well on poly-D-lysine coated 6 well plates and allowed to attach for 6-8 hrs, cells were then washed using IX Dulbecco’s PBS and incubated with antibiotics free fresh growth media containing 80nM MINAR2 siRNA (GUCAUGCUGGUGGAUUGAUAGAAAC; SEQ ID NO: 25) complexed with 7.5ul/well of RNAiMAX transfection reagent for 24hrs. After 48hrs of transfection cells were subjected to serum starvation in RPMI containing 1% horse serum, 50ng/ml NGF (2.5S, Gibco Thermo Scientific) and IX antibiotics.
[0078] To check the efficacy of MINAR2 siRNA in silencing MINAR2 mRNA levels, cells were harvested in buffer RLT after 48hrs of initial transfection and mRNA isolation was done as per user instructions of RNeasy Micro kit (Qiagen, Germany). cDNA was synthetized using qScript XLT cDNA SuperMix (Quanta Biosciences). The qRT-PCR reaction and cycle durations were set up as per user instructions of PowerUp SYBR Green Master mix using primer 5’- ATGCTGCCCTTTAGAC-3’ (SEQ ID NO: 26); 5’GACAGACCCAGACTGGAATAAC-3’ (SEQ ID NO: 27) for MINAR2 and 5’-ACTCCCATTCTTCCACCTTTG-3’ (SEQ ID NO: 28); 5’-CCCTGTTGCTGTAGCCATATT-3’ (SEQ ID NO: 29) for GAPDH. Efficiency of silencing is shown in Figure 11. [0079] Western blotting: Cells were harvested in RIPA buffer containing IX protease and phosphatase inhibitor (Halt, Thermo Scientific). Protein estimation of samples was done using commercially available BCA kit (Pierce, Thermo Scientific). Equal concentration of protein was reduced and loaded on 4-20% Tris-Glycine gradient gel and protein separation was done as per the method of Laemmli et al. (Laemmli 1970). Following separation protein was transferred onto 0.22 micron using Turbo-trans Blot system (Biorad, USA). The resulting PVDF membrane were blocked in 5% BSA for 1.5hr and incubated overnight at 4°C in primary antibodies diluted (1:1000) in TBST (TBS+Tween 0.5%). Blots were washed with TBST and incubated in HRP conjugated Anti-Rabbit Goat secondary antibody (1:3000) for 1.5hr at room temperature. On termination of antibody reactions, blots were washed three times with TBST and developed and visualized using west pico supersignal ECL substrate (Pierce, Thermo, USA) and FluorChemE (ProteinSimple, USA) respectively.
[0080] Minar2 mRNA expression in Mice: To check the expression of Minar2 in different tissues, lung, liver, kidney, brain and cochlea were dissected from P30 wildtype mice. In addition, the cochlear expression of Minar2 was assessed in E18.5 and P0 samples. Total RNA was isolated with TRIzol Reagent (Invitrogen) according to manufacturer’s instructions. Prior to reverse transcription, RNA samples were treated with rDNAse I (DNA-free kit, Applied Biosystems). cDNA was synthetized using qScript XLT cDNA SuperMix (Quanta Biosciences). The primers used to amplify a 117 bp fragment of the Minar2 transcript were: forward 5'- TGGACCATTGAGGAGTATGACA-3' (SEQ ID NO: 30) and reverse 5'- GTCGAAGCCAGGAGTGTACG-3’ (SEQ ID NO: 31). For Gapdh, a 171 bp fragment was amplified with 5’-ACCCAGAAGACTGTGGATGG-3’ (SEQ ID NO: 32) forward primer and 5’-CACATTGGGGGTAGGAACAC-3’ (SEQ ID NO: 33) reverse primer.
[0081] Distortion Product OtoAcoustic Emission (DPOAE) measurements in Mice: Following ABR measurements DPOAEs were measured. The microphone probe tip of an Etymotic ER10B+ low noise system was positioned next to the opening of the left ear canal. Using Tucker Davis Technologies BioSigRZ software and MFI loudspeakers, f2 tones were presented at 6, 12, 18, 24 and 30 kHz at increasing level -10 to 75 dB SPL in 5 dB steps, whilst fl tones were presented at lOdB above the f2 (0 to 85 dB SPL), at a frequency ratio of 1 : 1.2 for fl : f2 tones. For each f2 frequency the DPOAE threshold was determined at the lowest f2 stimulus level (dB SPL) where the 2fl-f2 DPOAE rose in amplitude above two standard deviations from the mean noise floor.
[0082] Endocochlear Potential (EP) recording in Mice: EP was measured in urethane- anaesthetised mice (O.lml/lOg bodyweight of a 20%w/v solution) aged P30-32 using 150mM KCl-filled glass pipette microelectrodes, as described previously (Ingham et al. 2016; Steel and Barkway 1989). EP was recorded as the potential difference (mV) between the tip of a glass microelectrode inserted into scala media via a fenestration in the cochlea basal turn lateral wall and a reference Ag-AgCl pellet electrode inserted under the skin of the dorsal surface of the neck.
[0083] Wholemount dissection, immunohistochemistry, and confocal imaging of synapses: Cochleae of postnatal day (P)14 and P30-32 mice were fixed in 4% paraformaldehyde (PFA) in PBS for 2h and decalcified with 0.1M ethylenediaminetetraacetic acid (EDTA) overnight at room temperature (RT). After dissection of the organ of Corti, samples were permeabilised with 5% Tween in PBS for 30 min and blocked in 0.5% Triton X-100 and 10% Normal Horse Serum (NHS) in PBS for 2h. Then, the tissues were incubated overnight with the primary antibodies diluted in 8% NHS at RT. The primary antibodies used were rabbit anti-Myosin Vila (diluted 1:200; 25-6790, Proteus), mouse IgG2 anti-glutamate receptor 2 (GluR2) (diluted 1:2000; MAB397, Emd Millipore), and mouse IgGl anti-C-terminal-binding protein 2 (CtBP2) (diluted 1:200; 612044, BD Transduction Laboratories). Samples were incubated with the secondary antibodies for two cycles of Ih at 37°C. The secondary antibodies used were Alexa Fluor 647- conjugated chicken anti-rabbit (1:200; #A21443, Thermo Fisher Scientific), Alexa Fluor 488- conjugated goat anti-mouse (IgG2a) (diluted 1:1000; #A21131, Thermo Fisher Scientific) and Alexa Fluor 568-conjugated goat anti-mouse (IgGl) (1:1000; #A21124, Thermo Fisher Scientific). Specimens were mounted using ProLong Gold Antifade Mountant with DAPI (P36931, Life Technologies) and stored at 4°C. Samples were imaged with a Zeiss LSM 700 inverted confocal microscope interfaced with ZEN 2011 software (vl4.0.17.201). All the images were captured with the plan- Apochromat 63x/1.40 oil DIC objective and 2.0 optical zoom. Confocal z-stacks were obtained with a z-step size of 0.25 pm, ensuring that all the synaptic puncta were imaged. Images were acquired at the 12 kHz and 24 kHz best-frequency regions and the ImageJ measure line plug-in (Eaton Peabody Laboratories) was used to map cochlear length to cochlear best frequencies. Brightness and contrast levels were adjusted for whole images using Fiji. Synaptic puncta counts were performed manually using the cell-counter plugin in Fiji software. All the images containing puncta were merged in a z-stack and the z-axis maximum intensity projection was used for quantification of synapses, defined by colocalization of CtBP2- and GluR2-labelled puncta. The total number of ribbon synapses was divided by the number of Myo7a- labelled IHCs present in the image to determine the number of ribbon synapses per IHC. In the cases where an IHC was not completely visible in the image, the synapses corresponding to that cell were not counted. After counting of synapses, whole images were subjected to the smoothing function of Fiji for presentation. Two non-overlapping images were acquired at each best-frequency region, counting between 10 to 14 IHCs at each frequency. A one-way ANOVA with multiple comparisons was used to compare the different experimental groups.
[0084] Immunofluorescence: Tympanic bullae containing the cochleae were dissected from P0 mice under the microscope and locally perfused with 4% PFA through the round and oval windows. Samples were kept in 4% PFA at 4 °C overnight and rinsed in IX PBS. Cochlea whole mounts were permeabilized with 0.5% Triton X-100 and blocked in 5% BSA for 1 hour at room temperature, followed by overnight incubation at 4°C with primary antibodies. A mouse anti- Myo7a (MY07A 138-1, DSHB), a chicken anti-NF (AB5539, Millipore), a mouse anti-Tujl (MMS-435P), and a chicken anti-Beta Galactosidase (ab9361) were utilized as a primary antibody. Specimens were washed with PBS, and then incubated with anti-mouse Alexa Fluor 568 and 488, and anti-chicken 647 were applied. DAPI (Calbiochem) were used to counterstain a nuclear DNA. Specimens were washed with PBS and mounted in fluorescence mounting medium (Dako). Images were taken using a Zeiss LSM 710 fluorescence microscope.
[0085] To perform additional experiments, mice were culled by decapitation (Pl) or by cervical dislocation (Pl 4 and P30). The skull was cut in two halves and the brain was removed to facilitate the penetration of the fixative. Samples were washed with cold PBS, fixed overnight in 4% PFA at 4°C and then washed twice with cold PBS.
[0086] X-gal staining: Whole mount cochlea were incubated overnight at 37°C in X-gal staining solution (0.02% NP40, 0.01% Sodium Deoxycholate, 2mM MgCh, 5mM K3Fe(CN)6, 5mM K4Fe(CN)e, 0.5 mg/ml X-gal), washed twice with PBS 1-X and mounted in mounting medium (Dako).
Results [0087] Non-syndromic sensorineural hearing loss is diagnosed in affected individuals: A summary of the auditory phenotype of 13 affected individuals is shown in Figure 9. Ages ranged from 3 to 80 years old at the last examination. Each affected individual was diagnosed with HL either at birth or during infancy.
[0088] Families 1 and 2 were of Turkish ancestry, recruited in Turkey. Parents of Family 1 stated that in 11:1 and 11:2, HL was milder in younger ages and progressed to profound degree around age 10. Otoacoustic emissions were absent in these individuals. These siblings received unilateral cochlear implants at ages 12 and 10, respectively, which improved their oral communication. Individual 11:3 in Family 1 was diagnosed with profound sensorineural HL after failing the newborn hearing screening test. Otoacoustic emissions were absent at diagnosis. He received a unilateral cochlear implant at age 1 and communicates orally.
[0089] Families 3 and 4 were of Indian ancestry, recruited in India. While there is no known consanguinity in any of marriages in these two pedigrees, they are all from the same small town belonging to the same Hindu caste (Mali). All the affected individuals in Family 3 were born deaf and used signs, simple words, or sounds to be able to communicate. Severity of HL appeared to have remained the same in all the affected individuals from the beginning of life. Individuals IV: 1 and IV:2 in Family 4 were diagnosed with profound sensorineural HL at the age of about 3 years via auditory brainstem response studies. Their mode of communication at that age was predominantly non-verbal.
[0090] A high-resolution temporal bone CT scan was normal in at least one affected member of each family. None of the affected individuals had additional clinical findings for a syndromic form of deafness. Their neurodevelopmental skills were on target except for speech delay. None of the affected individuals showed impaired balance on tandem walking and Romberg test. They did not have bradykinesia, tremor, or rigidity on neurological examination.
[0091] MINAR2 variants co-segregate with autosomal recessive deafness: Homozygosity mapping via genome sequencing revealed a shared 9.4 Mb region, chr5: 123,576,980- 132,980,451 (hgl9), in three affected children of Family 1. In Family 3, from SNP arrays the longest autozygous region in all 7 affected individuals is flanked by markers rs 13174854 and rs377767449, which is 2.96 Mb chr5:128, 738, 407-131, 705 ,915 (hgl9). In Family 4, two affected children share a 5.76 Mb autozygous region chr5: 126,978,108- 132,742,450 (hgl9) flanked by markers rsl 1241936 and rsl 1242152.
[0092] Within the autozygous segments, genome sequencing revealed the MINAR2 NM_001257308.2:c.412_419delCGGTTTTG (p.Argl38Valfs*10) variant in the three affected members of Family 1 and the NM_001257308.2:c.l44G>A (p.Trp48*) variant in the proband of Family 2. Exome sequencing revealed MINAR2 NM_001257308.2:c.393G>T (p.Lysl31Asn) variant in 3 affected members of Families 3 and 4. These variants are absent in gnomAD and internal databases and are predicted to disrupt protein function (Figure 10).
[0093] Sanger sequencing confirmed the variants and showed that each variant co-segregates with ARNSHL in 4 families (Figure 5).
[0094] Overexpression ofMINAR suppresses angiogenesis and MINAR2 variants abolish this effect: As MINAR1 has been shown to inhibit angiogenesis (Ho et al. 2018), the study investigated whether MINAR2 shows the same effect on angiogenesis in HUVEC. These studies revealed that overexpression of MINAR2 suppresses angiogenesis (Figure 6A). MINAR2 variant detected in Families 1 and 2 was then overexpressed in HUVEC and angiogenesis was compared with the effects of wildtype MINAR2. MINAR2 variants rescued angiogenesis, suggesting that they are loss-of-function variants (Figure 6A).
[0095] MINAR2 c.393G>T (p.Lys!31Asn) leads to aberrant splicing: The c.393G>T variant substitutes the last nucleotide of exon 2 and is predicted to abolish a splice donor site. Exon trapping experiments show that this variant leads to insertion of 85 intronic nucleotides into exon 2, which alters the amino acid composition of the rest of the protein (Figure 5C). The same variant also leads to skipping of exon 2 entirely (Figure 5C).
[0096] Expression levels o/MINAR2 are inversely correlated with intracellular NOTCH2 abundance: MINAR2 is named based on its structural similarity to MINAR1, which is shown to be involved in NOTCH2 signaling (Ho et al. 2018). MINAR2 is predicated to have a cytoplasmic domain, a single transmembrane domain with a few amino acids at the extracellular domain. However, MINAR2 encodes a significantly smaller protein (190 vs 917 amino acids) (Ho et al. 2018). The study explored if NOTCH2 abundance in cells is correlated with M1NAR2 expression. Furthermore, the study explored the effect of MINAR2 expression on VEGF. The data show that overexpression of wildtype MINAR2 is associated with reduced NOTCH2 and VEGFA (a prominent VEGF protein in vascular endothelial cells) abundance (Figure 6B). Silencing of MINAR2 in PC 12 cells, which endogenously express MINAR2, shows an increase in NOTCH2 and confirms the suppressor effect of MINAR2 on NOTCH2 abundance (Figure 6C). These results suggest that the suppressor effects of MINAR2 on angiogenesis is via NOTCH2 and VEGF signaling pathways.
[0097] MINAR2 is involved in MAP kinase and mTOR pathways: The study tested the effect of MINAR2 on the MAPK pathway by transiently overexpressing wildtype M1NAR2 on PC 12 cells and detecting levels of ERK1/2 and pERKl/2, a crucial kinase of the MAPK signaling pathway. These studies show that overexpression of wildtype MINAR2 reduces the abundance of pERKl/2. On the other hand, overexpression of the two MINAR2 deafness variants in Families 1 and 2 does not show this effect, again supporting their loss-of-function properties (Figure 6D).
[0098] When MINAR2 was silenced in PC12 cells, an increase was observed in a functional protein in mTORCl activity, P-S6, at 12 hours (Figure 6E). However, there was no difference in pAKT, a component of mT0RC2 activity (Figure 6E).
[0099] Minar2 is expressed in the mouse cochlea: The presence of Minar2 transcript in different mouse tissues was assessed, including the inner ear, and specifically the cochlea. Total RNA was isolated from wildtype at E18.5, P0, and P30. RT-PCR with a forward primer located in exon 2 and a reverse primer in exon 3 of the Minar2 gene (NM_173759) produced a unique band of 17 Ibp corresponding to the wildtype mRNA in all analyzed tissues, with the exception of the liver. Minar2 is highly expressed in the inner ear, and specifically in the cochlea, at E18.5, P0, and P30 (data not shown).
Discussion
[00100] This study presented three loss-of-function variants in MINAR2 in four unrelated families co- segregating with non-syndromic sensorineural HL. Hearing loss started at birth or in early childhood in all affected individuals, and in the majority of cases it was already severe or profound at the time of diagnosis. A progressive HL reaching to profound degree during childhood was noted in some affected individuals. In addition to ABRs showing sensorineural HL, otoacoustic emissions were absent in three children tested, suggesting dysfunction of both inner hair cell/neurons and outer hair cells. [00101] The studies described herein show that MINAR2 suppresses NOTCH2 signaling, VEGF, and angiogenesis. The Notch pathway is a highly conserved intercellular signaling cascade that is activated by the interaction of transmembrane ligands (Delta and Jagged) with Notch receptors, which are usually expressed on the surface of neighboring cells. Binding of the Notch Ligand to receptor induces cleavage of the Notch receptors intracellular domain (NICD) and ensuing nuclear translocation of the NICD, where it binds to multiple DNA-binding proteins. In the initial stages of angiogenesis, Notch activation is generally repressed to allow proliferation of endothelial cells in response to VEGF stimulation, and its expression is later upregulated when endothelial cells stop proliferating and the vessels begin to stabilize (Henderson et al.
2001; Taylor et al. 2002). Disruption or interference with the Notch pathway in mice resulted in the development of vascular tumors and lethal hemorrhage (Liu et al. 2011) and its activity in cell culture inhibited the angiogenic functions of endothelial cells such as capillary tube formation, migration, and proliferation (Itoh et al. 2004; Leong et al. 2002; Noseda et al. 2004; Williams et al. 2011).
[00102] MINAR2 is structurally similar to MINAR1, which has been reported to be involved in controlling neurite formation during neuronal differentiation through DEP Domain Containing MTOR Interacting Protein (DEPTOR). In this study, we show that similar to MINAR1, MINAR2 downrcgulatcs mTOR signaling (Figure 6E), which may contribute to the abnormal hair cell innervation observed in the Minar2 mutant mice. On the other hand, we found persistent Minar2 mRNA expression in mouse inner ear at postnatal day 0 and showing a gradual decline up to day 30. Many fold increase in the early days of life and depleting over time suggests that Minar2 play a role in the development of the inner ear.
References
[00103] Abyzov et al., (2011) CNVnator: an approach to discover, genotype, and characterize typical and atypical CNVs from family and population genome sequencing. Genome Res 21: 974-84. doi: 10.1101/gr.114876.110
[00104] Alford et al., ACMG Working Group on Update of Genetics Evaluation Guidelines for the Etiologic Diagnosis of Congenital Hearing Loss, Professional P, Guidelines C (2014) American College of Medical Genetics and Genomics guideline for the clinical evaluation and etiologic diagnosis of hearing loss. Genet Med 16: 347-55. doi: 10.1038/gim.2014.2 [00105] Andersson et al., (2011) Notch signaling: simplicity in design, versatility in function. Development 138: 3593-612. doi: 10.1242/dev.063610
[00106] Atik et al., (2015) Whole-exome sequencing and its impact in hereditary hearing loss. Genet Res (Camb) 97: e4. doi: 10.1017/S001667231500004X
[00107] Bademci et al., (2015) Comprehensive analysis via exome sequencing uncovers genetic etiology in autosomal recessive nonsyndromic deafness in a large multiethnic cohort. Genet Med. doi: 10.1038/gim.2015.89
[00108] Blakeley et al., (2016) Efficacy and Biomarker Study of Bevacizumab for Hearing
Loss Resulting From Neurofibromatosis Type 2-Associated Vestibular Schwannomas. J Clin Oncol 34: 1669-75. doi: 10.1200/JC0.2015.64.3817
[00109] Carpentier et al., (2020) Angiogenesis Analyzer for hnageJ - A comparative morphometric analysis of "Endothelial Tube Formation Assay" and "Fibrin Bead Assay". Sci
Rep 10: 11568. doi: 10.1038/s41598-020-67289-8
[00110] Chillakuri et al., (2013) Structural analysis uncovers lipid-binding properties of Notch ligands. Cell Rep 5: 861-7. doi: 10.1016/j.celrep.2013.10.029
[00111] DePristo et al., (2011) A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 43: 491-8. doi: 10.1038/ng.806
[00112] Doll et al., (2020) Genetic Spectrum of Syndromic and Non-Syndromic Hearing Loss in Pakistani Families. Genes (Basel) 11. doi: 10.3390/genesl 1111329
[00113] Elkon et al., (2015) RFX transcription factors are essential for hearing in mice. Nat Commun 6: 8549. doi: 10.1038/ncomms9549
[00114] Henderson et al., (2001) The basic helix-loop-helix transcription factor HESR1 regulates endothelial cell tube formation. J Biol Chem 276: 6169-76. doi: 10.1074/jbc.M008506200
[00115] Ho et al., (2020) Loss of MINAR2 impairs motor function and causes Parkinson's disease-like symptoms in mice. Brain Commun 2: fcaa047. doi: 10.1093/braincomms/fcaa047
[00116] Ho et al., (2018) MIN ARI is a Notch2 -binding protein that inhibits angiogenesis and breast cancer growth. J Mol Cell Biol 10: 195-204. doi: 10.1093/jmcb/mjy002 [00117] Ingham et al., (2019) Mouse screen reveals multiple new genes underlying mouse and human hearing loss. PLoS Biol 17: e3000194. doi: 10.1371/joumal.pbio.3000194
[00118] Ingham et al., (2016) S1PR2 variants associated with auditory function in humans and endocochlear potential decline in mouse. Sci Rep 6: 28964. doi: 10.1038/srep28964
[00119] Ingham et al., (2011) Using the Auditory Brainstem Response (ABR) to Determine Sensitivity of Hearing in Mutant Mice. Curr Protoc Mouse Biol 1: 279-87. doi:
10.1002/9780470942390.mol 10059
[00120] Ingham et al., (2019) Mouse screen reveals multiple new genes underlying mouse and human hearing loss. PLoS Biol 17: e3000194. doi: 10.1371/journal.pbio.3000194
[00121] Itoh F, Itoh S, Goumans MJ, Valdimarsdottir G, Iso T, Dotto GP, Hamamori Y, Kedes L, Kato M, ten Dijke Pt P (2004) Synergy and antagonism between Notch and BMP receptor signaling pathways in endothelial cells. EMBO J 23: 541-51. doi:
10.1038/sj.emboj.7600065
[00122] Jelani et al., (2019) A mutation in the major autophagy gene, WIPI2, associated with global developmental abnormalities. Brain 142: 1242-1254. doi: 10.1093/brain/awz075
[00123] Korver et al., (2017) Congenital hearing loss. Nat Rev Dis Primers 3: 16094. doi: 10.1038/nrdp.2016.94
[00124] Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-5. doi: 10.1038/227680a0
[00125] Lanford et al., (1999) Notch signalling pathway mediates hair cell development in mammalian cochlea. Nat Genet 21: 289-92. doi: 10.1038/6804
[00126] Eeong et al., (2002) Activated Notch4 inhibits angiogenesis: role of beta 1-integrin activation. Mol Cell Biol 22: 2830-41. doi: 10.1128/mcb.22.8.2830-2841.2002
[00127] Ei H, Durbin R (2010) Fast and accurate long-read alignment with Burrows- Wheeler transform. Bioinformatics 26: 589-95. doi: 10.1093/bioinformatics/btp698
[00128] Liu et al., (2011) Notchl loss of heterozygosity causes vascular tumors and lethal hemorrhage in mice. J Clin Invest 121: 800-8. doi: 10.1172/JCI43114 [00129] Lu FM, Lux SE (1996) Constitutively active human Notchl binds to the transcription factor CBF1 and stimulates transcription through a promoter containing a CBF1 -responsive element. Proc Natl Acad Sci U S A 93: 5663-7. doi: 10.1073/pnas.93.11.5663
[00130] McKenna et al., (2010) The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20: 1297-303. doi: 10.1101/gr.107524.110
[00131] Mehl AL, Thomson V (2002) The Colorado newborn hearing screening project, 1992-1999: on the threshold of effective population-based universal newborn hearing screening. Pediatrics 109: E7.
[00132] Morton CC, Nance WE (2006) Newborn hearing screening-a silent revolution. N Engl J Med 354: 2151-64. doi: 10.1056/NEJMra050700
[00133] Noseda et al., (2004) Notch activation induces endothelial cell cycle arrest and participates in contact inhibition: role of p21Cip 1 repression. Mol Cell Biol 24: 8813-22. doi: 10.1128/MCB.24.20.8813-8822.2004
[00134] Orvis et al., (2021) gEAR: Gene Expression Analysis Resource portal for community- driven, multi-omic data exploration. Nat Methods, doi: 10.1038/s41592-021-01200-9
[00135] Oza A et al., ClinGen Hearing Loss Clinical Domain Working G (2018) Expert specification of the ACMG/AMP variant interpretation guidelines for genetic hearing loss. Hum Mutat 39: 1593-1613. doi: 10.1002/humu.23630
[00136] Pan et al., (2010) Notch signaling is required for the generation of hair cells and supporting cells in the mammalian inner ear. Proc Natl Acad Sci U S A 107: 15798-803. doi: 10.1073/pnas.1003089107
[00137] Plotkin et al., (2009) Hearing improvement after bevacizumab in patients with neurofibromatosis type 2. N Engl J Med 361: 358-67. doi: 10.1056/NEJMoa0902579
[00138] Richards et al., Committee ALQA (2015) Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 17: 405-24. doi: 10.1038/gim.2015.30 [00139] Ryder et al., (2014) Rapid conversion of EUCOMM/KOMP-CSD alleles in mouse embryos using a cell-permeable Cre recombinase. Transgenic Res 23: 177-85. doi: 10.1007/sl 1248-013-9764-x
[00140] Siekmann et al., (2008) Modulation of VEGF signalling output by the Notch pathway. Bioessays 30: 303-13. doi: 10.1002/bies.20736
[00141] Skarnes et al., (2011) A conditional knockout resource for the genome- wide study of mouse gene function. Nature 474: 337-42. doi: 10.1038/naturel0163
[00142] Sloan-Heggen et al., (2015) Characterising the spectrum of autosomal recessive hereditary hearing loss in Iran. J Med Genet 52: 823-9. doi: 10.1136/jmedgenet-2015- 103389
[00143] Steel KP, Barkway C (1989) Another role for melanocytes: their importance for normal stria vascularis development in the mammalian inner ear. Development 107: 453-63.
[00144] Silberstein et al., (2013) A system for exact and approximate genetic linkage analysis of SNP data in large pedigrees. Bioinformatics 29: 197-205. doi: 10.1093/bioinformatics/bts658
[00145] Taylor et al., (2002) Notch activation during endothelial cell network formation in vitro targets the basic HLH transcription factor HESR-1 and downregulates VEGFR-2/KDR expression. Microvasc Res 64: 372-83. doi: 10.1006/mvre.2002.2443
[00146] Vaudry et al., (2002) Signaling pathways for PC 12 cell differentiation: making the right connections. Science 296: 1648-9. doi: 10.1126/science.1071552
[00147] Vona et al., (2015) Non-syndromic hearing loss gene identification: A brief history and glimpse into the future. Mol Cell Probes 29: 260-70. doi: 10.1016/j.mcp.2015.03.008
[00148] White et al., (2013) Genome-wide generation and systematic phenotyping of knockout mice reveals new roles for many genes. Cell 154: 452-64. doi:
10.1016/j.cell.2013.06.022
[00149] Williams et al., (2011) Asymmetric cell divisions promote Notch-dependent epidermal differentiation. Nature 470: 353-8. doi: 10.1038/nature09793
[00150] Yan et al., (2016) Spectrum of DNA variants for non-syndromic deafness in a large cohort from multiple continents. Hum Genet 135: 953-61. doi: 10.1007/s00439-016- 1697-z [00151] Zhang et al., (2018) UBTOR/KIAA1024 regulates neurite outgrowth and neoplasia through mTOR signaling. PLoS Genet 14: el007583. doi: 10.1371/journal.pgen.1007583

Claims

What is claimed:
1. A method of treating sensorineural deafness in a human subject in need thereof, the method comprising: administering to the subject having a mutation in a Membrane Integral NOTCH2 Associated Receptor gene (MINAR2) a composition that comprises a polynucleotide that encodes a MINAR2 peptide; a MINAR2 peptide; a small molecule that increases expression of MINAR2; an agent that blocks the expression of a mutant MINAR2 gene; an agent that corrects a mutation in MINAR2 gene, or a combination of any of the foregoing.
2. The method of claim 1, wherein the mutation in the MINAR2 gene is p.Argl38ValfsTerlO.
3. The method of claim 1, wherein the mutation in the MINAR2 gene is p.Trp48Ter.
4. The method of claim 1, wherein the agent is a polynucleotide encoding the MINAR2 peptide.
5. The method of claim 1, wherein the agent is a MINAR2 peptide.
6. The method of claim 1, wherein the agent that blocks the expression of a mutant MINAR2 gene is an M1NAR2 antisense oligonucleotide or CRISPR Cas9 protein and one or more guide RNA molecules, TALEN or zinc finger nuclease (ZFN).
7. The method of claim 1, wherein the agent that corrects the mutation in MINAR2 gene is a CRISPR Cas9 protein and one or more guide RNA molecules, TALEN or zinc finger nuclease (ZFN).
8. The method of any one of claims 1-7, wherein the method comprises, prior to the administration step, detecting the presence of a mutation in the MINAR2 gene in a sample from the subject.
32
9. The method of claim 8, wherein the mutation in the MINAR2 gene is p.Argl38ValfsTerlO.
10. The method of claim 8, wherein the mutation in the MINAR2 gene is p.Trp48Ter.
11. A method of characterizing hearing loss in a human subject, the method comprising detecting a mutation in the M1NAR2 gene in a sample from the subject.
12. The method of claim 11, wherein the mutation in the MINAR2 gene is p.Argl38ValfsTerlO.
13. The method of claim 11, wherein the mutation in the MINAR2 gene is p.Trp48Ter.
33
PCT/US2021/045031 2020-08-07 2021-08-06 Treatment of sensorineural deafness Ceased WO2022032151A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063062922P 2020-08-07 2020-08-07
US63/062,922 2020-08-07

Publications (1)

Publication Number Publication Date
WO2022032151A1 true WO2022032151A1 (en) 2022-02-10

Family

ID=80118503

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/045031 Ceased WO2022032151A1 (en) 2020-08-07 2021-08-06 Treatment of sensorineural deafness

Country Status (1)

Country Link
WO (1) WO2022032151A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170326254A1 (en) * 2014-10-10 2017-11-16 Massachusetts Eye And Ear Infirmary Efficient delivery of therapeutic molecules in vitro and in vivo
US20180258424A1 (en) * 2015-11-11 2018-09-13 Coda Biotherapeutics, Inc. Crispr compositions and methods of using the same for gene therapy
US20180369414A1 (en) * 2015-12-11 2018-12-27 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells
WO2019078684A2 (en) * 2017-10-19 2019-04-25 서울대학교병원 Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof
WO2020237088A1 (en) * 2019-05-21 2020-11-26 University Of Miami Treatment of sensorineural deafness

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170326254A1 (en) * 2014-10-10 2017-11-16 Massachusetts Eye And Ear Infirmary Efficient delivery of therapeutic molecules in vitro and in vivo
US20180258424A1 (en) * 2015-11-11 2018-09-13 Coda Biotherapeutics, Inc. Crispr compositions and methods of using the same for gene therapy
US20180369414A1 (en) * 2015-12-11 2018-12-27 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells
WO2019078684A2 (en) * 2017-10-19 2019-04-25 서울대학교병원 Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof
WO2020237088A1 (en) * 2019-05-21 2020-11-26 University Of Miami Treatment of sensorineural deafness

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DOHERTY ET AL.: "GPSM2 Mutations Cause the Brain Malformations and Hearing Loss in Chudley-McCullough Syndrome", THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 90, no. 6, 8 June 2012 (2012-06-08), pages 1088 - 1093, XP028522221, DOI: 10.1016/j.ajhg.2012.04.008 *
INGHAM NEIL J, PEARSON SELINA A, VANCOLLIEID VALERIE E, ROOKID VICTORIA, LEWISID MORAG A, CHEN JING, BUNIELLOID ANNALISA, MARTELLE: "Mouse screen reveals multiple new genes underlying mouse and human hearing loss", PLOS BIOLOGY, 1 April 2019 (2019-04-01), XP055906439, Retrieved from the Internet <URL:https://journals.plos.org/plosbiology/article/file?id=10.1371/journal.pbio.3000194&type=printable> [retrieved on 20220329] *

Similar Documents

Publication Publication Date Title
García-Huerta et al. Insulin-like growth factor 2 (IGF2) protects against Huntington’s disease through the extracellular disposal of protein aggregates
Mazur et al. Combined inhibition of BET family proteins and histone deacetylases as a potential epigenetics-based therapy for pancreatic ductal adenocarcinoma
Kawashima et al. Transmembrane channel-like (TMC) genes are required for auditory and vestibular mechanosensation
Zhu et al. Loss of ARHGEF6 causes hair cell stereocilia deficits and hearing loss in mice
Valdés-Sánchez et al. Retinal pigment epithelium degeneration caused by aggregation of PRPF31 and the role of HSP70 family of proteins
Collin et al. Disruption of murine Adamtsl4 results in zonular fiber detachment from the lens and in retinal pigment epithelium dedifferentiation
US9107942B2 (en) Methods of diagnosing and treating fibrosis
US20120252877A1 (en) Methods and compositions for treatment of tuberous sclerosis complex
TW202130654A (en) Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
US20130309246A1 (en) Jagged1 as a marker and therapeutic target for breast cancer bone metastasis
JP2018518530A (en) Methods and compositions for treating disorders associated with aging
Hinze et al. Incorrect dosage of IQSEC2, a known intellectual disability and epilepsy gene, disrupts dendritic spine morphogenesis
Abdelhamed et al. The ciliary Frizzled-like receptor Tmem67 regulates canonical Wnt/β-catenin signalling in the developing cerebellum via Hoxb5
WO2016022776A2 (en) Increasing atoh1 life to drive sensorineural hair cell differentiantion
US12083168B2 (en) Treatment and detection of inherited neuropathies and associated disorders
Zhang et al. TMEM25 modulates neuronal excitability and NMDA receptor subunit NR2B degradation
Zhu et al. Cingulin regulates hair cell cuticular plate morphology and is required for hearing in human and mouse
Sekar et al. Impairing Gasdermin D-mediated pyroptosis is protective against retinal degeneration
US20220111002A1 (en) Treatment of sensorineural deafness
Mou et al. Identification of vimentin as a novel target of HSF4 in lens development and cataract by proteomic analysis
Nacher-Soler et al. Development and in vivo validation of small interfering RNAs targeting NOX3 to prevent sensorineural hearing loss
WO2022032151A1 (en) Treatment of sensorineural deafness
Koyama et al. Rewired Neuroactive Ligand-Receptor Signaling Confers Adaptive Resistance to BCL-2 Inhibition in AML
Chen Probing the function of Ca2+-binding C2 domains of otoferlin, a synaptic protein of sensory hair cells
D'Atri Defining the genetic and molecular basis of inherited eye diseases present in Pakistan

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21854114

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21854114

Country of ref document: EP

Kind code of ref document: A1