WO2022022624A1 - Method for producing cardiomyocytes by means of reprogramming - Google Patents

Abstract

Provided is a method for producing cardiomyocytes by means of reprogramming, in which method a small molecule combination of a Tyk2 inhibitor and/or a TGFβ inhibitor, and optional cardiomyocyte-induced transcription factors come into contact with differentiated cells such as fibroblasts.

Description

Method for generating cardiomyocytes by reprogramming technical field

The present invention relates to the field of biomedicine, especially the field of regenerative medicine. In particular, the present invention relates to a method of reprogramming cardiomyocytes from differentiated cells such as fibroblasts using Tyk2 inhibitors and/or TGF[beta] inhibitors, and optionally cardiomyocyte-inducing transcription factors.

Background of the Invention

23 million people worldwide suffer from heart failure, usually caused by myocardial cell damage or myocardial cell dysfunction. A common cause of cardiomyocyte loss is ischemic heart disease leading to myocardial infarction, where damage is permanent and progressive due to the limited capacity of the heart to regenerate. Despite advances in medical treatment, there are currently no strategies to restore muscle mass other than orthotopic heart transplantation, which is limited by the number of cells from which it can be derived and long-term efficacy. The cell therapies used in human trials so far have demonstrated that the transplanted cells do not become cardiomyocytes in large numbers and do not persist in the heart. Transplantation of pluripotent stem cell-derived cardiomyocytes is being tested and may be valuable if issues such as cell survival, maturation and electrophysiological integration are effectively addressed. The use of cell-type-specific transcription factors (TFs) to reprogram cells in situ to cell types lost in disease is a promising alternative to cell therapy for effective tissue regeneration. In the heart, a large number of non-cardiomyocytes, mainly cardiac fibroblasts, can be converted into induced cardiomyocyte-like cells by transcription factors.

In rodents, infusion of 3 cardiac-specific TFs: GATA4, MEF2C, and TBX5 (GMT) directly after coronary artery ligation resulted in the conversion of non-cardiomyocytes to cardiomyocyte-like cells electrically coupled to existing cardiomyocytes, This improves heart function and reduces scar size. However, the efficiency is still limited, especially in vitro, and most cells are not fully reprogrammed. The signals present in vivo that lead to improved quality of reprogramming are unknown, but it is suggested that changes in culture conditions or signaling pathways can enhance cardiac reprogramming in vitro (and possibly in vivo).

Since the successful introduction of the first generation of cardiomyocyte reprogramming, there have been many reports on enhancing the efficiency of cardiac reprogramming. Both the quality and efficiency of cardiomyocyte-like cells generated in vitro can be improved by altering the metrology of the three GMT genes, identifying additional genes based on GMT, or by manipulating signaling pathways. In most cases, the increased efficiency was found primarily in mouse embryonic fibroblasts; in contrast, cardiac fibroblasts and adult skin-initiated reprogramming had limited effects. Although the recent siRNA-mediated knockdown of bmi1 and the strategy of combining SB431542 with XAV939 have improved the efficiency of cardiac fibroblast reprogramming in vitro, it remains to be determined whether there is a mechanism that further enhances reprogramming in mice in vivo or affects human cardiac fibroblasts. Methods of Fibrocyte Reprogramming.

Therefore, there remains a need in the art for new reprogramming methods that can efficiently generate functional cardiomyocytes by reprogramming in vivo or in vitro to treat cardiac diseases such as heart failure.

Brief Description of Drawings

Figure 1. Identification of small molecules that promote cardiomyocyte reprogramming. A. Small molecule screening strategy to promote cardiomyocyte reprogramming; B. Fluorescence image of Myh6-mCherry positive cells. C. Myh6-mCherry positive cell count. The results showed that two small molecules, SB431542 and Baricitinib (2C), synergistically promoted the transdifferentiation of fibroblasts into induced cardiomyocytes like cells (iCMs).

Figure 2. Shows the optimum concentration and duration of action for 2C.

Figure 3. Shows the comparison of 2C with SB431542+XAV939 in promoting iCM efficiency.

Figure 4. Shows that GMT+2C significantly improves reprogramming efficiency and quality.

Figure 5. Shows that MT+2C is able to induce cells with mature morphology, expression of typical cardiomyocyte-specific genes, spontaneous calcium transients, and action potentials similar to ventricular cardiomyocytes.

Figure 6. Shows that Gata4 can be effectively replaced by co-action of 2C.

Figure 7. Shows RNA-seq data showing that 2C can significantly up-regulate cardiomyocyte-related genes and down-regulate fibroblast-related genes on the basis of GMT or MT.

Figure 8. Principal component analysis showing the 782 genes with the most differences in RNA-seq results. The addition of 2C made the cardiomyocytes induced by GMT or MT to obtain an overall cellular state closer to that of adult cardiomyocytes.

Figure 9. GO analysis of genes showing significant up- and down-regulation of GMT+2C compared to GMT.

Figure 10. Shows that SB431542 can be replaced by small molecules of the same signaling pathway.

Figure 11. Shows that Dexamethasone or Nabumetone cannot achieve the effect of replacing Baricitinib.

Figure 12. Shows that Baricitinib structural analogs have the effect of promoting cardiomyocyte reprogramming.

Figure 13. Shows that 2C can significantly increase the efficiency of reprogramming of human fibroblasts to cardiomyocytes on the basis of 5 transcription factors.

Figure 14.2C One transcription factor can be subtracted from the five reported to induce hiCM.

Figure 15. Schematic representation of in vivo reprogramming using Postn to trace cardiac myofibroblasts emerging after myocardial infarction.

Figure 16. Shows that 2C significantly improves the efficiency of in situ reprogramming in vivo, both in the myocardial infarct marginal zone and infarct zone in the mouse myocardial infarction model.

Figure 17. Shows the results of Masson's trichrome staining in a mouse myocardial infarction model, showing that 2C significantly reduces the area of cardiac fibrosis (muscle fibers in red and collagen in blue).

Figure 18. Shows that in a mouse myocardial infarction model, only 2C treatment resulted in a significant reprogramming phenomenon compared to the EGFP control group, and achieved a reprogramming efficiency comparable to the MGT only group.

Figure 19. Shows the results of Masson's trichrome staining in a mouse myocardial infarction model, showing that 2C treatment alone can significantly reduce the fibrotic area.

Figure 20. Shows that the combination of Ruxolitinib and SB43152 has superior myocardial reprogramming effect in vivo.

Figure 21. Schematic diagram testing the effect of knockdown of Tyk2 on cardiomyocyte reprogramming. A: The experimental design diagram, taking neonatal mouse fibroblasts as starting cells, in the case of infection with transcription factor MT combination and shRNA, reprogramming into cardiomyocytes only under the condition of reprogramming medium (added C1). B: Reprogramming specific experimental steps. C: The knockdown effect of Tyk2.

Figure 22. Shows the induction of large numbers of cells positive for the cardiac specific markers cTnl and a-actinin from fibroblasts by knockdown of Tyk2 in the case of MT+SB.

Figure 23. Shows qPCR detection of reprogrammed cells expression levels of cardiac specific markers.

Figure 24. Shows that knockdown of Tyk2 by CRISPR can promote cardiomyocyte reprogramming induced by transcription factor MT and small molecule compound C1.

Figure 25. Shows that the Tyk2 small molecule inhibitors BMS-986165 and/or PF-06826647 can induce a large number of cells positive for the cardiac specific markers cTnI and a-actinin from fibroblasts.

Figure 26. Shows that the Tyk2 small molecule inhibitors BMS-986165 and/or PF-06826647 can induce beating cardiomyocytes from fibroblasts.

Figure 27. Shows that the Tyk2 inhibitor Ruxolitinib and the TGF[beta] inhibitor TEW-7197 increase the efficiency of cardiac in situ reprogramming.

Figure 28. Shows that the Tyk2 inhibitor Ruxolitinib and the TGF[beta] inhibitor TEW-7197 improve cardiac fibrosis after MI.

Figure 29. Shows that SB431542 and Baricitinib (2C) in combination with MYOCD resulted in improved hiCM induction efficiency.

Figure 30. Shows that in the presence of MT + Baricitinib, knockdown of Alk5, the receptor for TGF[beta], induces a large number of cells positive for the cardiac specific markers cTnI and a-actinin from fibroblasts.

Figure 31. Shows that 2C significantly improves cardiac function in vivo.

detailed description

The present inventors performed small molecule screening on mouse cardiac fibroblasts and revealed a new method that can enhance cardiomyocyte reprogramming. The method significantly improves the in vivo and in vitro direct reprogramming efficiency of cardiomyocytes mediated by the transcription factor combination GMT through the combination of Tyk2 inhibitor and/or TGFβ inhibitor. The present application demonstrates that by combining these two types of small molecules, the efficiency of GMT-induced cardiomyocyte reprogramming can be increased by 100-fold. This combination of small molecules can accelerate the process of reprogramming and improve the quality of the obtained cardiomyocytes, especially by shortening the beating time of cardiomyocytes and increasing the proportion of beating cells. This combination of small molecules can also reduce the number of exogenous transcription factors required for reprogramming without reducing the efficiency and quality of reprogramming. Experiments on human cells also demonstrated that this combination of small molecules can increase the efficiency of transcription factor-mediated reprogramming by 20-fold and can reduce the number of transcription factors required for reprogramming from five to four. These findings demonstrate the great potential of gene therapy and drug combination therapy for cardiac regeneration in vivo.

In one aspect, the invention provides a method of reprogramming an initiating cell into a cardiomyocyte, the method comprising contacting the initiating cell with at least one Tyk2 inhibitor and/or at least one TGF[beta] inhibitor.

As used herein, "Tyk2" inhibitors refer to substances that inhibit the Tyk2 signaling pathway, such as inhibitory antibodies, small molecule compounds, etc., including but not limited to Baricitinib, Ruxolitinib, S-Ruxolitinib, Tofacitinib, Oclacitinib maleate, Itacitinib, Peficitinib, Gandotinib, FM-381, Filgotinib, PF-06826647, BMS-986165, or their structural analogs. In some specific embodiments, the Tyk2 inhibitor is Baricitinib. In some specific embodiments, the Tyk2 inhibitor is Ruxolitinib. In some specific embodiments, the Tyk2 inhibitor is PF-06826647. In some specific embodiments, the Tyk2 inhibitor is BMS-986165.

It is worth noting that the small molecule compounds mentioned herein all encompass their pharmaceutically acceptable salts. For example, Ruxolitinib includes Ruxolitinib phosphate, while Tofacitinib also includes Tofacitinib citrate. The chemical structures of some of the Tyk2 inhibitors exemplified herein can be found in Figure 12.

As used herein, "TGFβ inhibitor" refers to a substance that inhibits the TGFβ signaling pathway, such as inhibitory antibodies, small molecule compounds, etc., including but not limited to SB43152, TEW-7197, RepSox, GW788388, SD-208, LY364947, Y -27632, LDN-193189, LY2109761 and Galunisertib, or their structural analogs. In some specific embodiments, the TGFβ inhibitor is SB43152. In some specific embodiments, the TGFβ inhibitor is TEW-7197.

In some embodiments, the method comprises contacting the initiating cell with a Tyk2 inhibitor and a TGF[beta] inhibitor.

In some embodiments, the at least one Tyk2 inhibitor includes 1, 2, 3 or more Tyk2 inhibitors. In some embodiments, the at least one TGFβ inhibitor includes 1, 2, 3 or more Tyk2 inhibitors.

In some specific embodiments, the method comprises contacting the starting cell with Baricitinib and SB43152.

In some specific embodiments, the method comprises contacting the starting cell with Ruxolitinib and TEW-7197. In some specific embodiments, the method comprises contacting the starting cell with Ruxolitinib and SB43152. In some specific embodiments, the method comprises contacting the starting cell with PF-06826647 and SB43152. In some specific embodiments, the method comprises contacting the starting cell with BMS-986165 and SB43152. In some specific embodiments, the method comprises contacting the starting cell with PF-06826647, BMS-986165 and SB43152.

In some embodiments, the starting cell is a differentiated cell. In some embodiments, the starting cells are non-cardiomyocytes. The starting cells may be cells of mesodermal origin such as heart cells, cells of ectodermal origin such as neural cells, or cells of endoderm origin such as colon cells. In some embodiments, the starting cells are neuronal cells, skeletal muscle cells, hepatocytes, fibroblasts, osteoblasts, chondrocytes, adipocytes, endothelial cells, stromal cells, smooth muscle cells, cardiomyocytes, Nerve cells, hematopoietic cells, pancreatic islet cells, or almost any cell in the body. In some embodiments, the starting cells are skin fibroblasts. In some embodiments, the starting cells are cardiac fibroblasts.

In some embodiments, the starting cells are isolated cells (ex vivo cells).

In the present invention, the starting cells can be derived from mammals or non-mammals. In some embodiments of the invention, the starting cell is derived from a human. In some embodiments of the invention, the starting cell is derived from a non-human mammal. In some embodiments of the invention, the starting cell is derived from a murine such as a mouse or rat or a non-human primate.

In some embodiments, the reprogrammed cardiomyocytes are functional cardiomyocytes. The functional cardiomyocytes, for example, have one or more of the following characteristics: α-actinin positive, cTnT positive, with well-aligned sarcomere structure, beating, expressing ventricular cardiomyocyte markers such as Myl2v, spontaneous Calcium transients, action potentials similar to ventricular cardiomyocytes, etc.

In the present invention, "contacting the starting cells with a Tyk2 inhibitor and/or a TGFβ inhibitor" can be achieved by, for example, culturing the starting cells in a medium containing a Tyk2 inhibitor and/or a TGFβ inhibitor.

In some embodiments, the concentration of the Tyk2 inhibitor, eg, Baricitinib, is from about 0.1 μM to about 50 μM, eg, about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 5 μM, about 7.5 μM , about 10 μM, about 15 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM. In some preferred embodiments, the concentration of a Tyk2 inhibitor, such as Baricitinib, is about 2 [mu]M. In some preferred embodiments, the concentration of a Tyk2 inhibitor such as PF-06826647 or BMS-986165 is about 5 [mu]M.

In some embodiments, the concentration of the TGFβ inhibitor, eg, SB43152, is from about 0.1 μM to about 50 μM, eg, about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 5 μM, about 7.5 μM , about 10 μM, about 15 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM. Preferably, the concentration of the TGF[beta] inhibitor such as SB43152 is about 2 [mu]M.

In some embodiments, the methods described herein "contact the initiating cell with a Tyk2 inhibitor and/or a TGFβ inhibitor" for about 1 day to about 21 days or more, eg, about 3 days to about 21 days or more Prolonged, about 6 days to about 21 days or more, about 9 days to about 21 days or more, about 12 days to about 21 days or more, about 15 days to about 21 days or more , or from about 18 days to about 21 days or more.

In some embodiments, the method further comprises providing at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA to the initiating cell.

As used herein, a "cardiomyocyte-inducing transcription factor" refers to a transcription factor that, upon introduction into the initiating cell, is capable of causing reprogramming of the initiating cell into a cardiomyocyte under appropriate conditions. Numerous transcription factors are known in the art that can be used to generate cardiomyocytes by reprogramming, including but not limited to: MEF2C, TBX5, GATA4, MESP1, MYOCD, HAND2, SRF, ESRRG, ZFPM2, Nkx2.5, VEGF, Baf60c, and any combination of them.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor includes at least MEF2C.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor further comprises TBX5. For example, the at least one cardiomyocyte-inducing transcription factor includes or consists of MEF2C and TBX5.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor further comprises GATA4. For example, the at least one cardiomyocyte-inducing transcription factor includes or consists of MEF2C, TBX5, and GATA4.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor further comprises MYOCD. For example, the at least one cardiomyocyte-inducing transcription factor includes or consists of MEF2C, TBX5, GATA4, and MYOCD.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor further comprises MESP1. For example, the at least one cardiomyocyte-inducing transcription factor includes or consists of MEF2C, TBX5, GATA4, MYOCD, and MESP1.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor comprises or consists of MEF2C, GATA4, MYOCD, and MESP1.

In some embodiments, the at least one cardiomyocyte-inducing transcription factor is MYOCD.

As used herein, a "cardiomyocyte-inducing microRNA" refers to a microRNA that, upon introduction into the initiating cell, is capable of causing reprogramming of the initiating cell into a cardiomyocyte under suitable conditions. A variety of microRNAs are known in the art that can be used to generate cardiomyocytes by reprogramming, including but not limited to: miR1, miR133, miR208, and miR499, and any combination thereof. In some embodiments, the at least one cardiomyocyte-inducing microRNA comprises or consists of miR1, miR133. In some embodiments, the at least one cardiomyocyte-inducing microRNA comprises or consists of miR1, miR133, miR208, and miR499.

The at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA can be provided to, ie, introduced into, the initiating cell by any method known in the art.

For example, an expression vector comprising a nucleotide sequence encoding the transcription factor and/or microRNA can be introduced into the starting cell. Methods for introducing expression vectors into cells are known in the art, including, but not limited to, DEAE-dextran method, calcium phosphate method, cationic liposome method, cationic polymer, Biolistic particle delivery method (bombardment method with biolistic particles) , microinjection, electroporation, and virus-mediated methods. Wherein, preferably, the expression vector is a viral expression vector, which can realize the introduction of the nucleotide sequence encoding the transcription factor and/or microRNA by viral transfection. The viral vector is preferably a lentiviral vector, a retroviral vector, an adenoviral vector and the like. Methods for constructing viral vectors, such as lentiviral vectors, comprising desired nucleotide sequences are known in the art.

In some embodiments of the methods of the present invention, the step of "providing the initiating cell with at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA" may The step of "contacting the agent and/or the TGFβ inhibitor" is performed before or after or simultaneously, preferably before. For example, the step of "providing at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA to the initiating cell" may be performed in the step of "combining the initiating cell with at least one Tyk2 inhibitor and/or at least one 1 day before the TGFβ inhibitor exposure step.

In one aspect, the present invention provides the use of a Tyk2 inhibitor and/or a TGFβ inhibitor as described above in the manufacture of a reagent or kit for preparing cardiomyocytes from starting cells. Said Tyk2 inhibitor and TGF[beta] inhibitor are as defined above.

In one aspect, the present invention provides a cardiomyocyte prepared by the method of the present invention.

In one aspect, the present invention provides a pharmaceutical composition comprising cardiomyocytes prepared by the method of the present invention and a pharmaceutically acceptable carrier.

In one aspect, the present invention also provides cardiomyocytes prepared by the method of the present invention or a pharmaceutical composition of the present invention comprising the cardiomyocytes prepared by the method of the present invention and a pharmaceutically acceptable carrier in the manufacture of a method for treating cardiac diseases. Use in medicine. The heart disease is particularly a myocardial disease, including but not limited to heart failure, myocardial infarction and the like.

In one aspect, the present invention also provides a method of treating cardiac disease in a subject, the method comprising administering to the subject cardiomyocytes prepared by the method of the present invention or a myocardium of the present invention comprising the myocardium prepared by the method of the present invention A pharmaceutical composition of cells and a pharmaceutically acceptable carrier.

As used herein, a "subject" can be a mammal or a non-mammal. The subject can be a human, or a non-human mammal such as a mouse or rat or a non-human primate.

In addition, the inventors have surprisingly found that in vivo treatment of post-MI mice with GMT, TGFβ inhibitors such as SB43152 and Tyk2 inhibitors such as Baricitinib can significantly improve the efficiency of in situ reprogramming in vivo and effectively reduce the scar area. Even more surprisingly, in MI mice treated with small-molecule TGFβ inhibitors such as SB431542 and Tyk2 inhibitors such as Baricitinib alone, in situ reprogramming was also observed to be comparable to transcription factor (GMT) alone. In vivo reprogramming efficiency.

Accordingly, in one aspect, the present invention also provides a method of treating cardiac disease in a subject, the method comprising administering to the subject at least one inhibitor of Tyk2 and/or at least one inhibitor of TGF[beta]. The heart disease is particularly a myocardial disease, including but not limited to heart failure, myocardial infarction and the like. Said Tyk2 inhibitor and TGF[beta] inhibitor are as defined above.

In some embodiments, the method further comprises administering to the subject at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA. The "at least one cardiomyocyte-inducing transcription factor" and "at least one cardiomyocyte-inducing microRNA" are as defined above. In some embodiments, said "administering at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA" comprises administering an expression vector comprising a nucleotide sequence encoding said transcription factor and/or microRNA, For example viral vectors, preferably lentiviral vectors.

In some embodiments, the administration is systemic. In some embodiments, the administration is topical, eg, intracardiac.

In one aspect, the present invention provides a pharmaceutical composition comprising at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor as defined herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition further comprises at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA as defined herein, or a nucleus encoding said transcription factor and/or microRNA Expression vectors for nucleotide sequences, such as viral vectors, preferably lentiviral vectors.

In one aspect, the present invention provides the use of at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor as defined in the present invention in the manufacture of a medicament for the treatment of cardiac disease. The heart disease is particularly a myocardial disease, including but not limited to heart failure, myocardial infarction and the like.

In one aspect, the present invention provides at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor as defined herein, and at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA as defined herein , or the use of an expression vector comprising a nucleotide sequence encoding the transcription factor and/or microRNA in the preparation of a medicament for treating heart disease. The expression vector is for example a viral vector, preferably a lentiviral vector. The heart disease is particularly a myocardial disease, including but not limited to heart failure, myocardial infarction and the like.

In one aspect, the present invention provides a reprogramming medium comprising at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor as defined herein. In some embodiments, the reprogramming medium is used in the methods of the invention.

In one aspect, the present invention provides a kit for reprogramming starting cells into cardiomyocytes, the kit comprising at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor as defined herein, and /or comprising the reprogramming medium of the present invention. In some embodiments, the kit further comprises at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA as defined herein, or nucleotides encoding said transcription factors and/or microRNAs sequence expression vector. The expression vector is for example a viral vector, preferably a lentiviral vector.

In some embodiments of various aspects of the invention, the at least one Tyk2 inhibitor is Baricitinib and the at least one TGFβ inhibitor is SB43152. In some embodiments of various aspects of the invention, the at least one Tyk2 inhibitor is Ruxolitinib and the at least one TGFβ inhibitor is TEW-7197. In some embodiments of various aspects of the invention, the at least one Tyk2 inhibitor is Ruxolitinib and the at least one TGFβ inhibitor is SB43152. In some embodiments of various aspects of the invention, the at least one inhibitor of Tyk2 is PF-06826647 and the at least one inhibitor of TGF[beta] is SB43152. In some embodiments of various aspects of the invention, the at least one inhibitor of Tyk2 is BMS-986165 and the at least one inhibitor of TGFβ is SB43152. In some embodiments of various aspects of the invention, the at least one inhibitor of Tyk2 is BMS-986165 and PF-06826647, and the at least one inhibitor of TGF[beta] is SB43152.

Example

In order to facilitate the understanding of the present invention, the present invention will be more fully described below with reference to the relevant specific embodiments and accompanying drawings. Preferred embodiments of the invention are shown in the accompanying drawings. However, the present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that a thorough and complete understanding of the present disclosure is provided.

Materials and methods

Lentivirus preparation and infection

The lentiviral vector used in this experiment was prepared by using pLL transformed from lentiviral vector PLenti-Lox3.7 (pLL3.7) and FU-tet-o-hOct4 to express the envelope protein vesicular stomatitis virus G protein. Plasmid pVSVg, the expression protein plasmid pRSV rev to aid in exocytosis for capsid assembly, and the polyprotein expression gene Gag with envelope and matrix, the protease, reverse transcriptase, and integrase polyprotein expression gene Pol, and the Rev response The plasmid pMDLg/pRRE of the element RRE was co-transfected into the human embryonic kidney epithelial cell line HEK293T for packaging.

Modeling of myocardial infarction in mice and in situ gene overexpression by lentivirus in myocardial infarction area

1. Anesthesia method: use isoflurane to induce anesthesia by continuous inhalation. The induction concentration was 5% and the maintenance concentration was 1%.

2. Tracheal intubation: Before intubation, depilatory cream was used to depilate the surgical site of the mouse. The depilation area is under the armpit of her left upper limb, with an area of about 4 square centimeters. The mouse was suspended from the slanted cardboard using a thin wire to hang the mouse's upper incisors. Use a gooseneck lamp to illuminate the throat of the mouse. At this point, the tongue of the mouse was gently pulled out, and its trachea was visible. Use an indwelling needle for tracheal intubation. After successful intubation, the mouse was removed from the cardboard, fixed on the operating table with medical tape, and the ventilator was connected while maintaining anesthesia. When maintaining anesthesia, the tidal volume was set to 200 μL/min.

3. Take the virus out of the -80°C refrigerator in advance and put it on ice to thaw. After thawing, use a pipette to mix the viral liquid gently. If using FU-tet-o vector lentivirus, you need to take the same volume of FUdeltaGW-rtTA for pre-mixing (for example, mix 50 μL of FU-tet-o-EGFP and 50 μL of FUdeltaGW-rtTA). The concentrated virus was drawn into a microsyringe (using a 27g needle) in advance and kept on ice for use.

4. Surgical method Mice were placed in the right lateral decubitus position. About 2 mm from the left armpit of the mouse, the skin was vertically incised, and a purse-string knot was placed at the wound after incision. The skin and muscles of the mice were bluntly separated, and the pectoralis major muscle was further bluntly separated to expose the left 4th to 5th intercostal space, and enter the chest here. The left ventricle can be observed by gently placing the thoracotomy device and slowly dilating the wound. Because the mouse phrenic nerve is very thin, do not deliberately dissociate the entire pericardium. The left anterior descending coronary artery can be observed under a stereomicroscope by gently tearing a small amount of the pericardium below the junction of the main pulmonary artery and the left atrial appendage. Use a slip wire to ligate the proximal end. After ligation, a change in color of the anterior wall of the ventricle can be observed, and the anterior wall of the left ventricle becomes pale immediately with transient ventricular arrhythmias. At this point, injection of concentrated virus can be performed.

5. Immediately after ligation of the left anterior descending coronary artery, concentrated virus injection was performed at the edge of the ischemic white area. 2-3 needles were injected, and the total volume of concentrated virus was 60 μL. Upon injection, significant bleaching of the myocardium at the injection site was observed. If there is bleeding in the myocardium, use medical absorbent cotton to gently press until the bleeding stops.

6. Tighten the purse knot to suture to close the chest. Close the isoflurane anesthesia canister. A 10ml syringe was inserted between the mouse thorax and muscle. Slowly squeeze the mouse thoracic cavity to expel the gas into the mouse thoracic cavity and muscle space. Aspiration is performed at this time to draw out the gas, thereby avoiding the complications of pneumothorax in mice.

7. Put the mice on a 42°C incubator, and the mice will wake up after a few minutes.

8. If the lentivirus of the FU-tet-o vector is used, the mice need to replace their drinking water with a solution containing 1mg/mL Doxycycline hyclate and 2mg/ml sucrose on the second day after surgery to induce continuous expression of the target fragment.

Heart tube, aspirate the supernatant, you can see a white precipitate at the bottom of the cannula. Use pre-cooled PBS to resuspend at the ratio of toxic medium: PBS=525:1. The resuspended concentrated virus was divided into 50 μL/tube, frozen in a -80°C refrigerator, and taken as needed.

Small molecule drug delivery in mice

The small molecule SB431542 and Baricitinib were co-dissolved in DMSO to prepare a stock solution. The concentration of both small molecules was 100 mg/ml, and they were stored in a -80 degree refrigerator. Before drug injection, the small molecule stock solution is dissolved in the dosing solvent and prepared as-is. 2C was administered at a dose of 5 mg/kg/d by intraperitoneal injection. Solvent formula: 5% Tween-80, 30% PEG300, 65% deionized water.

Frozen sections and immunofluorescence staining

1. The mice were sacrificed by necking, and the heart was taken out; the heart was incised in the coronal plane along the ligation point, and the myocardial infarction area at the apex of the heart was taken. Squeeze out as much blood as possible from the heart in PBS. The hearts were placed in 4% paraformaldehyde at 4°C for 3.5 hours; rinsed with PBS; the hearts were then placed in 30% sucrose and dehydrated at 4°C overnight.

2. O.C.T. Embed the tissue and place it in liquid nitrogen for freezing.

3. The temperature of the slicing box and the temperature of the cutter head are both set to -22°C, the embedding block is trimmed first, and then the frozen section is performed, and the thickness of the slice is 10 μm. Sections were fixed with acetone at 4°C for 5 minutes, and sections were dried at room temperature to prevent dissection.

4. For fragile antigens, immerse the sections in citrate buffer at 37°C for 20min. TBS-Tween20 washes three times for 10 minutes each.

5. 0.3% Triton-100 TBS-Tween20 solution at 37°C for 10min × 3 times (prepare 30% storage solution first: Triton x-100 28.2ml+TBS-Tween20 72.8ml, put it in a 37-degree water bath for 2-3 hours , make it fully dissolved, and then dilute before use); rinse with TBS-Tween20 for 5min×3 times.

6. 10% NDS, 2% BSA dissolved in 0.3% Triton-100 TBS-Tween20 solution, blocked for 30min.

7. Shake off the blocking solution, add the primary antibody (diluted in 10% NDS, 2% BSA according to the ratio recommended in the instructions), and place at 4°C overnight.

8. Wash three times with TBS-Tween20 for 5 minutes each.

9. Add secondary antibody (1:1000 diluted in 2% BSA in TBS solution), and place at room temperature for 1 hour in the dark.

10. Wash three times with TBS-Tween20 for 5 minutes each.

11. Mount the slides with anti-quenching mounting medium containing DAPI stain, observe under a laser confocal microscope or store in the dark.

12. Laser confocal microscope image acquisition.

13. ImageJ software (NIH) assisted analysis.

Masson stain

Sections are routinely dewaxed to water. Stain with prepared Weigert iron hematoxylin staining solution for 5min-10min. Differentiated with acidic ethanol differentiation solution for 5-15s, washed with water. Masson blue solution returned to blue for 3-5min, washed with water. Wash with distilled water for 1 min. Ponceau Fuchsin staining solution for 5-10min. In the above operation process, the weak acid working solution is configured according to the ratio of distilled water:weak acid solution=2:1, and the weak acid working solution is washed for 1min. Phosphomolybdic acid solution wash 1-2min. Wash with the prepared weak acid working solution for 1min. Dye directly into aniline blue staining solution for 1-2min. Wash with the prepared weak acid working solution for 1min. Rapid dehydration in 95% ethanol. Dehydrate with absolute ethanol 3 times for 5-10 s each time. Xylene was transparent 3 times, 1-2min each time. Neutral gum mount.

Ultrasound analysis of mouse heart

Anesthesia method: Anesthesia was induced by continuous inhalation of isoflurane. The induction concentration was 5% and the maintenance concentration was 1%. Depilate the mouse chest. Image acquisition was performed using a Vevo 2100 (VisualSonics) small animal ultrasound system.

Reprogramming-induced cardiomyocyte method:

NSF (neonatal mouse skin fibroblast) was isolated from 1-day-old mouse skin and digested with collagenase. P0 cryopreservation, recovery P1 induction. nCF (neonatal mouse cardiac fibroblast) was isolated from 1-day-old mouse hearts, digested with collagenase, and plated on 10 cm petri dishes. CD90.2 MACS, residual cardiomyocytes were removed, and sorted CF was used for induction.

Human fibroblasts, from ATCC, ~P8-10 were used for induction.

Reprogramming step: d-2, plated cells. d-1, infected with virus. d0, remove virus-containing medium and replace with reprogramming medium. Beating cell counts and immunofluorescence assays were performed at approximately 3 weeks.

MEF separation

MEF medium: High glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% GlutaMAX, 1% non-essential amino acids (NEAA) and 1% Pen Strep.

Mouse embryonic fibroblasts (MEFs) were isolated from ICR mouse embryos. Briefly, after removal of the head, limbs and guts, E13.5 embryos were minced with scissors and dissociated in trypsin-EDTA for 10 min at 37°C. After addition of MEF medium and centrifugation, MEF cells were collected and cultured.

NSF separation

NSF medium: High glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% GlutaMAX, 1% non-essential amino acids (NEAA) and 1% penicillin-streptomycin.

Neonatal mouse skin fibroblasts (NSF, neonatal mouse skin fibroblast) were isolated from 1-day-old ICR mice. Briefly, after mice were sacrificed, the skin was peeled, placed in PBS containing 0.25% Trypsin, and digested overnight at 4°C. The next day, the digested skin tissue was removed and the epidermis was carefully removed. The dermal tissue was cut into pieces, placed in collagenase type I + DNase I (dissolved in MEF medium) for digestion for ~30 minutes, centrifuged to remove hair follicle cells, and skin fibroblasts were collected.

nCF separation

nCF medium: IMDM supplemented with 20% fetal bovine serum (FBS) and 1% penicillin-streptomycin.

Neonatal mouse cardiac fibroblasts (nCF, neonatal mouse cardiac fibroblast) were isolated from 1-day-old ICR mice. Briefly, after mice were sacrificed, hearts were removed, minced and placed in collagenase type II + DNase I (dissolved in nCF medium) containing 1 mg/ml. Every 5 minutes of digestion, the supernatant of the digestion solution was collected, and the cells obtained by the digestion were collected by centrifugation until the tissue block was completely digested, and the cultured nCF was collected.

nCF Magnetic Separation

MACS buffer: 500ml PBS, add 2.5g BSA, 2ml EDTA (0.5M), filter with 0.22μm filter, store at 4°C.

nCF was digested with Trypsin-EDTA, cells were collected, resuspended in MACS buffer, added with Thy1.2 magnetic beads, and incubated at 4°C for 30 minutes. The incubated cells were rinsed with MACS buffer, resuspended in MACS buffer, and passed over an equilibrated LS column. After 3-4 washes, the cells bound to the magnetic beads were collected, counted, and used.

lentiviral packaging

293T medium: high glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), stored at 4°C.

2xHBS: 500 ml HEPES buffer (50 mM) + 280 mM NaCl + 10 mM KCl + 1.5 mM Na ₂ HPO ₄ + 12 mM Glucose, adjusted to pH 7.05, filtered through a 0.22 μm filter, and stored at -20°C.

2.5M CaCl ₂ : CaCl ₂ was dissolved in ddH ₂ O, CaCl ₂ was 2.5M, filtered through a 0.22 μm filter, and stored in a -20°C refrigerator.

D-1, spread 293T on a 10cm petri dish. D0, when the cell confluence is ~70%, replace with fresh medium. Simultaneously premix the target plasmid (15μg) and the three packaging plasmids pMDLg/pRRE, pRSV/Rev and pVSV-G (5μg each) + 50μl 2.5M CaCl ₂ , add ddH ₂ O to make up to 500μl, and after mixing, Slowly add dropwise to 500 μl of 2x HBS, shake to mix well, add dropwise to a petri dish, and shake gently. 12 hours after transfection, the medium was replaced with fresh medium, and 48 hours after transfection, the medium containing virus was collected, filtered through a 0.45 μm filter, aliquoted, and stored in a -80°C refrigerator.

Generation of iCMs from fibroblasts

iCM Reprogramming Medium: DMEM/M199 (4:1) supplemented with 10% KnockOut Serum Replacement (KSR), 10% FBS, 1% GlutaMAX, 1% MEM NEAA, 1% Pen Strep, 2 μg/ml Dox and small molecules Mixture 2C (2 μM SB431542, 2 μM Baricitinib).

D-2, the 24-well plate was first coated with 0.1% gelatin, placed in a 37°C cell incubator for 30 minutes, the gelatin was aspirated, and the 24-well plate was seeded with 80,000 cells per well. D-1, cells were replaced with MEF medium containing 6ng/μl polybrene and infected with FU-tet-o-Gata4, FU-tet-o-Mef2c, FU-tet-o-Tbx5, FUdeltaGW-rtTA, each virus per well Add 200 µl of unconcentrated virus. D0, cells were replaced with iCM reprogramming medium, and the medium was changed every 3-4 days.

Reagent supplier and product number

	Reagent name	supplier		article number
1	DMEM, high glucose	HyClone	SH30022.01
2	MEDIUM 199	Gibco	11150-059
3	KnockOut Serum Replacement(KSR)	Thermo Fisher		A3181502
4	Fetal Bovine Serum (FBS)	VISTECH	SE100-011
5	GlutaMAX	Gibco	35050–061
6	MEM NEAA	Gibco	11140-050
7	Pen Strep	Gibco	15140-122
8	Doxycycline hyclate	Sigma-Aldrich		D9891
9	SB431542	selleck		S1067
10	baricitinib	selleck	S2851
11	IMDM	Gibco	12440-053
12	Collagenase I	Gibco	17018029
13	Collagenase II	Gibco	17101015
14	Polybrene	Sigma-Aldrich		H9268
15	CaCl 2	Sigma-Aldrich	C7902
16	HEPES	Sigma-Aldrich	H4034
17	NaCl	Sigma-Aldrich	BP358-212
18	KCl	Sigma-Aldrich	P5405
19	Na2HPO4	Sigma-Aldrich		S5136
20	Glucose	Sigma-Aldrich	G7021
twenty one	Gelatin	Sigma-Aldrich	G9391
twenty two	PBS	Corning	21-040-CVR
twenty three	trypsin	Gibco	15090-046
twenty four	Trypsin-EDTA	Gibco	25200-056

25	0.22μm filter	Millipore	SLGP033RB
26	0.45μm filter	Millipore	SLHP033RB
27	24-well plates	Corning	353047
28	10cm Tissue culture dishes	Corning	353003

Example 1. SB431542 and Baricitinib promote GMT-mediated reprogramming in mice to induce cardiomyocytes

Screening was performed on Myh6-mCherry neonatal mouse dermal fibroblasts, while transfecting three genes, GMT (Gata4, Mef2c, and Tbx5), a small molecule library was screened by observing the ratio and brightness of reporter genes. The effect of small molecules on reprogramming was quantified, as shown in Figure 1A. Specifically, on D-2 (day -2), Myh6-mCherry neonatal mouse skin fibroblasts (NSF) were plated; on D-1 (day -1), the infection expressed Gata4, respectively , Mef2c, Tbx5 (GMT) three lentiviruses; on D0 (day 0), the medium was replaced with a reprogramming medium supplemented with small molecules, and the medium was changed every 3-4 days. Three weeks after induction, the number of Myh6-mCherry positive cells was observed and counted to screen small molecules that can promote the induction of cardiomyocyte-like cells (iCM).

Through screening, it was found that two small molecules, SB431542 (also referred to as C1 herein) and Baricitinib (also referred to as C2 herein), could improve the efficiency of reprogramming-induced cardiomyocytes, respectively, and these two small molecules had a synergistic effect (the combination of which was called 2C ). See Figure 1B and Figure 1C.

Then further study the optimal concentration and optimal time of action of 2C. Specifically, for the optimal concentration of action, Myh6-mCherry neonatal mouse dermal fibroblasts were plated at D-2; three lentiviruses expressing Gata4, Mef2c, Tbx5 (GMT) were infected at D-1; at D-0 Change to a reprogramming medium containing a combination of small molecules at different concentrations, and change the medium every 3-4 days. On the basis of Baricitinib at 2 μM, SB431542 with different concentration gradients was added in turn, and the optimal concentration of SB431542 was determined by staining with cTnT, a marker of cardiomyocytes. Then, on the basis of 2μM SB431542, different concentrations of Baricitinib were added in turn, and the optimal concentration of Baricitinib was determined by cTnT staining. As shown in Figure 2A, the optimal concentration of SB431542 was 2 μM, and the optimal concentration of Baricitinib was also 2 μM.

For the optimal duration of action, wild-type mouse cardiac fibroblasts (nCF) were plated on D-2, and residual cardiomyocytes were removed with CD90.2 MACS; D-1 was infected to express Gata4, Mef2c, Tbx5 ( GMT) three lentiviruses; at D0, change to reprogramming medium: Basal medium and 2C medium (i.e. Basal medium + 2 μM SB431542 + 2 μM Baricitinib), and change the medium every 3 days. The number of beating iCM cells and the number of cells stained positive for α-actinin were counted on D21. The results are shown in Fig. 2B, the optimal time for the combination of the two small molecules is the whole process of adding D0-D21.

It has been previously reported that the small molecule combination SB431542+XAV939 (Circulation, 2017) can promote reprogramming-induced cardiomyocytes. Therefore, the inventors further compared the efficiency of 2C and SB431542+XAV939. Specifically, Myh6-mCherry neonatal mouse dermal fibroblasts were plated at D-2; three lentiviruses expressing Gata4, Mef2c, and Tbx5 (GMT) were infected at D-1; replaced by D-0 containing different small molecules Combined reprogramming medium, changed every 3-4 days; immunofluorescence staining at D21: cTnI, cTnT, α-actinin. The reprogramming media used were: Basal medium, Basal medium+2μM SB431542(C1), Basal medium+2μM Baricitinib (C2), Basal medium+2μM SB431542+2μM Baricitinib(2C), Basal medium+2.6μM SB431542+ 5μM XAV939(SB+XAV), Basal medium+2μM SB431542+2μM Baricitinib+5μM XAV939(2C+XAV). The results are shown in Fig. 3, 2C promoted iCM with significantly higher efficiency than SB431542+XAV939.

In addition, the inventors found that 2C not only improved the efficiency of reprogramming induced cardiomyocytes, but also significantly improved the quality of induced reprogramming. Specifically, Myh6-mCherry neonatal mouse dermal fibroblasts were plated at D-2; three lentiviruses expressing Gata4, Mef2c, Tbx5 (GMT) were infected at D-1; Programming medium was changed every 3-4 days; cardiac marker expression or cardiomyocyte phenotype was measured at 3 or 4 weeks. The results are shown in Figure 4. Figure 4A and B show that the cardiomyocyte-like cells were efficiently induced by GMT+2C, the cTnT positive cells reached 70.1% (4 weeks), the α-actinin positive cells reached 82.6% (4 weeks), and all had neatly arranged sarcomeres structure. Figure 4C shows that on skin cells, the vast majority of cardiomyocyte-like cells obtained by GMT+2C induction (4 weeks) are able to express the marker of ventricular cardiomyocytes, Myl2v (Myosin light chain 2), demonstrating that the induced iCMs Cardiomyocytes of the ventricular subtype. Figure 4D shows that GMT+2C (3 weeks) highly efficiently promotes the beating of iCMs, proving that the induced cardiomyocytes are functionally mature iCMs.

Example 2. Combination of 2C and MT to achieve mouse reprogramming to induce cardiomyocytes

The inventors have surprisingly found that 2C can subtract Gata4 among the three transcription factors of GMT without reducing the reprogramming efficiency and quality. Specifically, at D-2, cells were plated, neonatal mouse cardiac fibroblasts (nCF), and residual cardiomyocytes were removed with CD90.2 MACS; at D-1, there were three treatments: no infection Virus (Null), infected with virus expressing Gata4+Mef2c+Tbx5(GMT), or infected with virus expressing Mef2c+Tbx5(MT); change to reprogramming medium at D0: Basal medium and 2C medium (Basal medium+2μM SB431542 +2 μM Baricitinib), medium was changed every 3 days; marker expression, myocardial-related gene expression, beating cell count, cellular calcium transients, cellular action potential, etc. were checked at the indicated times. The results are shown in Figure 5.

Figure 5A shows that 2C can subtract Gata4 from the three genes of GMT by cTnT staining at week 3. Figure 5B shows that the cells obtained by MT+2C induction (4 weeks) have neatly arranged sarcomere structures. Figure 5C shows that 2C promotes the expression of cardiomyocyte genes (cardiomyocyte structural genes, cardiomyocyte function-related genes, cardiomyocyte endogenous transcription factors). Figure 5D shows MT+2C induction (3 weeks) to obtain functional cardiomyocytes capable of beating. Figure 5E shows that MT+2C induced (4 weeks) functional cardiomyocytes have spontaneous calcium transients. Figure 5F shows that MT+2C induced (6 weeks) functional cardiomyocytes have similar action potentials to mature ventricular cardiomyocytes.

In addition, the inventors further found that subtracting GATA4 from the three GMT genes requires 2C to work together. Specifically, at D-2, plated cells, neonatal mouse cardiac fibroblasts (nCF), were used to remove residual cardiomyocytes with CD90.2 MACS; at D-1, infection expressed Mef2c+Tbx5 (MT ) virus; change to reprogramming medium at D0, and change the medium every 3 days; check cTnT-positive cells and beating cells after 3 weeks. The reprogramming medium was Basal medium, Basal medium+2μM SB431542(C1), Basal medium+2μM Baricitinib(C2), Basal medium+2μM SB431542+2μM Baricitinib(2C), Basal medium+2.6μM SB431542+5μM XAV939(SB +XAV), Basal medium+2μM SB431542+2μM Baricitinib+5μM XAV939(2C+XAV). The results are shown in Figure 6. On the basis of only transduction of MT, only the addition of 2C can induce beating cells.

Example 3, 2C promotes the mechanism of reprogramming induced cardiomyocytes

The inventors further investigated the expression profiles of cardiomyocytes induced by reprogramming using MT+2C and GMT+2C by RNA-seq. Specifically, at D-2, cells were plated, neonatal mouse cardiac fibroblasts (nCF), and residual cardiomyocytes were removed with CD90.2 MACS; at D-1, there were three treatments: no infection Virus (Null), infected with virus expressing Gata4+Mef2c+Tbx5 (GMT), or infected with virus expressing Mef2c+Tbx5 (MT); change to reprogramming medium at D0, and change the medium every 3 days; harvest cells after 6 weeks , extract total RNA for RNA-seq. The media used were: Basal medium, Basal medium+2μM SB431542(SB), Basal medium+2μM SB431542+2μM Baricitinib(2C), Basal medium+2.6μM SB431542+5μM XAV939(SBXAV). Neonatal CMs are 1-day-old mouse cardiomyocytes, and Adult CMs are 8-week-old adult mouse ventricular cardiomyocytes.

As shown in Figure 7, the RNA-seq data showed that MT+2C and GMT+2C could be clearly distinguished from other combinations and had a more similar expression profile to that of adult cardiomyocytes; MT+2C and GMT+2C were similar to other combinations. It can better inhibit the expression of fibroblast-related genes while inducing the expression of myocardial-specific genes.

Based on RNA-seq data, principal component analysis of the 782 genes that differed most between adult cardiomyocytes and mouse cardiac fibroblasts showed that MT+2C and GMT+2C were closer to adult cardiomyocytes than other published reprogramming methods, such as shown in Figure 8.

In addition, in order to further study the role of 2C, GO analysis was performed on genes that were significantly up-regulated and down-regulated compared with GMT+2C and GMT. As shown in Figure 9, 2C significantly up-regulated genes related to myocardial development and muscle beating, and significantly down-regulated genes related to cardiac muscle development and muscle beating. Genes related to cell activation and adhesion.

Alternatives to Example 4, 2C

This example aims to investigate whether SB431542 or Baricitinib can be replaced by small molecules of the same signaling pathway.

Specifically, on D-2 (day -2), Myh6-mCherry neonatal mouse skin fibroblasts (NSF) were plated; on D-1 (day -1), the infection expressed Gata4, Mef2c, Tbx5 ( GMT); on D0 (day 0), change to reprogramming medium supplemented with small molecules every 3-4 days; count beating cells on D18. In addition, at D-2, plated cells, WT mouse cardiac fibroblasts (nCF), were removed with CD90.2 MACS to remove residual cardiomyocytes; at D-1, infected with a virus expressing Mef2c+Tbx5(MT); replaced at D0 To supplement the small molecule reprogramming medium, the medium was changed every 3 days; cTnT positive cells were counted after four weeks. 2C was used as a positive control.

SB431542 is an inhibitor of the TGFβ signaling pathway. This example analyzes whether other small molecules of this signaling pathway can be combined with Baricitinib, including RepSox, GW788388, SD-208, LY364947, Y-27632, LDN-193189, LY2109761 and Galunisertib. Baricitinib is an inhibitor of the Jak pathway. This example analyzes whether other small molecules of this signaling pathway can be combined with SB431542, including Filgotinib, WP1066, Gandotinib, Ruxolitinib and AZD1480. The results are shown in Figure 10. Whether it is based on beating or the number of cTnT positive cells, SB431542 can be effectively replaced by small molecules with the same signaling pathway. Baricitinib's small molecules with the same signaling pathway are only replaced by its structural analog Ruxolitinib. . It can be seen that the TGFβ signaling pathway is very important for reprogramming into cardiomyocytes; but at the same time, Baricitinib cannot be replaced by most other compounds with the same target of Jak-Stat.

In addition, some anti-inflammatory small molecules have been reported to improve the efficiency of reprogramming induction of cardiomyocytes, such as dexamethasone or nabumetone. However, as shown in Figure 11, on the basis of transduction of MT, these anti-inflammatory small molecules combined with SB431542 induced WT mouse cardiac fibroblasts (nCF) for three weeks, respectively, which could not replace the effect of Baricitinib.

As mentioned above, only its structural analog Ruxolitinib has a surrogate effect on the small molecule of the Jak signaling pathway. The inventors further investigated whether other Baricitinib structural analogs can effectively replace Baricitinib. As shown in Figure 12, on the basis of transduction of MT, the structural analogs of Baricitinib and SB431542 were combined to induce WT mouse cardiac fibroblasts (nCF) for three weeks, which could replace the effect of Baricitinib.

Example 5, 2C promotes reprogramming and induces human cardiomyocytes

The inventors further investigated the role of 2C in the transdifferentiation of human fibroblasts to human induced cardiomyocyte like cells (hiCM) based on five transcription factors (GATA4, MEF2C, TBX5, MESP1, MYOCD). .

Specifically, cells were plated at D-2, human cardiac fibroblasts; at D-1, lentiviruses expressing GATA4, MEF2C, TBX5, MESP1, MYOCD(5F) were infected; at D0, the reprogramming medium was replaced: basal/ 2C medium, the medium was changed every 3 days; the number of cTnT positive cells, phenotype detection and myocardial-related gene expression detection were counted at 3 weeks. Alternatively, plated cells at D-2, BJ human epidermal fibroblasts; infected with lentivirus expressing GATA4, MEF2C, TBX5, MESP1, MYOCD(5F) at D-1; changed to reprogramming medium at D0: basal/2C medium, with medium changes every 3 days; check for spontaneous calcium transients at 3 weeks.

The results are shown in Figure 13. Figure 13A shows that 2C is very efficient in promoting transdifferentiation of human fibroblasts to human cardiomyocyte-like cells. Figure 13B shows that the induced hiCMs have good sarcomere structure. Figure 13C shows that 2C significantly increased the expression of myocardial related genes. Figure 13D shows induction of hiCMs with spontaneous calcium transients.

Five transcription factors (GATA4, MEF2C, TBX5, MESP1, MYOCD) have been reported to be necessary for the induction of hiCM. The inventors have surprisingly found that 2C can reduce the number of transcription factors required for reprogramming of human cells without reducing reprogramming efficiency.

Specifically, cells were plated at D-2, BJ human epidermal fibroblasts; lentiviruses expressing 4 of GATA4, MEF2C, TBX5, MESP1 and MYOCD (4F) were infected at D-1; replaced by reprogramming at D0 Medium: basal/2C medium, changed every 3 days; check the number of α-actinin positive cells at 3 weeks.

The results are shown in Figure 14. In the presence of 2C, TBX5 or MESP1 is not required, especially MESP1. The efficiency of the combination of 2C with GATA4, MEF2C, TBX5, and MYOCD is even higher than that of 2C+5F.

Example 6. 2C induces cardiomyocytes in vivo by in situ reprogramming

In order to verify the effect of 2C in in situ reprogramming in vivo, a mature lentiviral overexpression system was used to in situ overexpress transcription factors such as Gata4, Mef2c, and Tbx5 in the myocardial infarction area of mice, and small molecule compounds were used to improve the efficiency of transdifferentiation. and myocardial infarction treatment. In order to better evaluate the efficiency of cell fate transition, a transgenic mouse model hybridized with Postn-MerCreMer and Rosa-loxp-stop-loxp-tdTomato was used to trace myofibroblasts in the myocardial infarction area, and immunofluorescence was performed on tissue sections with confocal laser. Microscopic counting and myocardial infarction cell separation were used to calculate the proportion of cardiomyocytes in red fluorescent cells (formerly cardiac myofibroblasts), thereby judging the transdifferentiation efficiency of myofibroblasts to myocardium. The therapeutic effect of cardiac repair was comprehensively evaluated by means of echocardiography, ECG monitoring, nuclear magnetic resonance and animal behavioral testing. In situ reprogramming in vivo is shown in Figure 15.

As shown in Figure 16, in vivo lineage tracing experiments showed that GMT+2C had better in situ reprogramming efficiency than GMT. Compared with GMT, GMT+2C had significantly improved reprogramming effects in both the marginal and infarct regions of myocardial infarction. In addition, by Masson staining, it was found that in the myocardial infarction mouse model, the GMT+2C treatment group had a significantly reduced fibrotic scar area compared with GMT, as shown in FIG. 17 .

However, what is even more surprising is that in the absence of any transgene, a certain amount of in situ reprogramming can be observed in the pure 2C-treated group, and its reprogramming efficiency has reached a level comparable to that of the GMT-treated group. , as shown in Figure 18. In addition, Masson staining showed (Figure 19) that the pure 2C treatment group could significantly reduce the fibrotic scar area compared to the solvent treatment group. Such results suggest that 2C has the potential to be used alone in the treatment of myocardial infarction.

Figure 20 shows that the combination of Ruxolitinib and SB43152 has a superior effect.

Example 7. Inhibition of Tyk2 signaling pathway promotes reprogramming and induces human cardiomyocytes

1. Knockdown of Tyk2 by shRNA affects cardiomyocyte reprogramming

As mentioned above, the combination (2C) of the small molecules Baricitinib (C2) and SB43152 (C1) can significantly improve the cardiomyocyte reprogramming efficiency mediated by the transcription factor combination GMT (Gata4, Mef2c and Tbx5), and this small molecule combination can also On the premise of not reducing the efficiency and quality of reprogramming, reducing the number of exogenous transcription factors required for reprogramming, that is, in the presence of this small molecule combination, the combination of transcription factors MT (Mef2c and Tbx5) can be used to achieve high-efficiency cardiomyocytes reprogram. However, as shown above, the small molecules of the Jak signaling pathway do not, for the most part, replace the role of baricitinib in myocardial reprogramming. Therefore, Baricitinib may act through other signaling pathways.

The inventors have now surprisingly found that knocking down the expression of Tyk2 in cells can replace the effect of Baricitinib (C2). The experimental design of this example is shown in FIG. 21 . Briefly, by designing shRNAs targeting the Tyk2 gene (shTyk2#1, shTyk2#2, shTyk2#3, shTyk2#4, shTyk2#5), they were introduced into neonatal mouse fibroblasts together with the transcription factor combination MT, and then in Induction was performed in reprogramming medium containing C1 to test the efficiency of reprogramming into cardiomyocyte-like cells. Figure 21C shows that all five shRNAs can knock down the expression of Tyk2.

Immunofluorescence detection of cardiac-specific markers cTnI and a-actinin showed that three shRNAs, shTyk2#1, shTyk2#2, and shTyk2#3, combined with transcription factors MT and C1, respectively, could achieve myocardial similar to the small molecule combination 2C. Cell reprogramming efficiency. shNT is a non-targeting control. The results are shown in FIG. 22 . In addition, qPCR also confirmed that the expression of cardiac-specific markers was significantly increased in the presence of MT+C1 and knockdown of Tyk2 (Figure 23).

The sequences of Tyk2-specific shRNAs capable of knocking down Tyk2 and increasing myocardial reprogramming efficiency are as follows:

shTyk2#1:

CCCATCTTCATTAGCTGGGAACTCGAGTTCCCAGCTAATGAAGATGGGG(SEQ ID NO:1);

shTyk2#2:

CCCTTCATCAAGCTAAGTGATCTCGAGATCACTTAGCTTGATGAAGGG(SEQ ID NO:2);

shTyk2#3:

CCACTTTAAGAATGAGAGCTTCTCGAGAAGCTCTCATTCTTAAAGTGG (SEQ ID NO: 3).

It can be seen that specific knockdown of Tyk2 can promote cardiomyocyte reprogramming.

2. Knockout of Tyk2 by gene editing affects cardiomyocyte reprogramming

In order to further confirm the role of specific inhibition of Tyk2 in cardiomyocyte reprogramming, the inventors further designed five different sgRNAs targeting the Tyk2 gene, knocked out the Tyk2 gene in neonatal mouse fibroblasts using CRISPR technology, and separately Cardiomyocyte reprogramming efficiency was tested in the presence of transcription factors MT as well as C1. sgNTs are controls that do not target Tyk2.

The experimental results are shown in Figure 24. Immunofluorescence detection of cardiac-specific markers cTnI and a-actinin showed that fibroblasts knocked out of the Tyk2 gene could achieve efficient cardiomyocyte regeneration in the presence of transcription factor MT and small molecule compound C1. programming.

3.Tyk2 small molecule inhibitor promotes the reprogramming of neonatal mouse fibroblasts to cardiomyocytes

Neonatal mouse fibroblast isolation:

Order neonatal mice within 24 hours from Viton Lever, take the heart tissue from the ultra-clean bench and cut it into pieces with sterilized surgical instruments, add an appropriate amount of Type II Collagenase (1mg/mL), and digest at 37° constant temperature. After sufficient digestion, use IMDM (20% FBS + 1% PS + 1% NEAA + 1% Glu-Max) medium was washed twice, resuspended with this medium, and spread in a 10cm petri dish. After 24 hours, the medium was changed to add fresh IMDM, and the For four days, CD90.2 (anti-Thy1+) was used for MACS sorting, and the sorted cells were plated in 24-well plates (2-5×10^5/well), and Fu-tet-o was infected 24h after plating. -Mef2c-T2A-Tbx5 virus, and rtTA, were replaced with reprogramming medium after 24 hours, and the medium was changed every 3 days. Beating cells could be seen at 4 weeks, and a large amount of cTnI and a-actinin could be seen by immunofluorescence staining.

Reprogramming medium:

10% FBS, 10% KSR, DMEM/M199[4:1], 1% PS+1% NEAA+1% Glu-Max, 2uM SB431542, Tyk2 inhibitor (BMS-986165 or PF-06826647) every 3 days Change the fluid. Among them, Tyk2 inhibitor 1, 2, 5, 10uM can be used, and the optimum concentration can be seen in the concentration gradient curve.

The results are shown in Figures 25 and 26. The results showed that small molecule inhibitors of Tyk2 effectively promoted cardiomyocyte reprogramming.

Example 8. Substitution of Tyk2 inhibitor and TGFβ inhibitor to promote reprogramming and induce cardiomyocytes

In this example, another Tyk2 inhibitor, Ruxolitinib, was used to replace Baricitinib, and another TGFβ inhibitor, TEW-7197, was used to replace SB43152, and the effect of the combination of Ruxolitinib + TEW-7197 on reprogramming-induced cardiomyocytes was tested.

Mice MI surgery and virus injection

WT ICR males, 8w, were anesthetized with tribromoethanol, the thoracic cavity was opened, the heart was extruded, the left anterior descending coronary artery was ligated, and 10 μl of the concentrated retroviral vector pMX-MGT/pMX-MT was injected, put back into the heart, and the skin was sutured.

In vivo administration

The small molecule Tew-7197 and Ruxolitinib were dissolved in DMSO, and the concentration of the two small molecule stock solutions was 200 mM, and they were stored in a -20 degree refrigerator. Before drug injection, the small molecule stock solution is dissolved in the dosing solvent and prepared as-is. Tew-7197 was administered at a dose of 6 mg/kg/d, and Ruxolitinib was administered at a dose of 60 mg/kg/d, administered by intraperitoneal injection. Solvent formula: 5% Tween-80, 30% PEG300, 65% deionized water. Results were detected five weeks after dosing.

The experimental results are shown in Figures 27 and 28. The Tyk2 inhibitor Ruxolitinib and the TGFβ inhibitor TEW-7197 can also improve the efficiency of cardiac in situ reprogramming and improve cardiac fibrosis after MI.

Example 9. Combination of MYOCD and 2C improves hiCM efficiency

Normal human cardiac fibroblast cell culture

Cells were purchased from Lonza, Cat. CC2904, passage expanded in high glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS).

lentiviral packaging

293T medium: high glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), stored at 4°C.

2x HBS: 500ml HEPES buffer (50mM)+280mM NaCl+10mM KCl+1.5M _{Na2HPO4 +} 12mM Glucose, adjust pH to 7.05, filter with 0.22μm filter, and store in -20°C refrigerator.

2.5M CaCl ₂ : CaCl ₂ was dissolved in ddH2O, CaCl ₂ was 2.5M, filtered through a 0.22 μm filter, and stored in a -20°C refrigerator.

D-1, spread 293T on a 10cm petri dish. D0, when the cell confluence is ~70%, replace with fresh medium. Simultaneously premix the target plasmid (15μg) and the three packaging plasmids pMDLg/pRRE, RSV/Rev and VSV-G (5μg each) + 50μl 2.5M CaCl ₂ , add ddH ₂ O to make up to 500μl, and after mixing, Slowly add dropwise to 500 μl of 2x HBS, shake to mix well, add dropwise to a petri dish, and shake gently. 12 hours after transfection, the medium was replaced with fresh medium, and 48 hours after transfection, the medium containing virus was collected, filtered through a 0.45 μm filter, aliquoted, and stored in a -80°C refrigerator.

Retroviral packaging

D-1, spread 293T on a 10cm petri dish. D0, when the cell confluence is ~70%, replace with fresh medium. At the same time, premix transfection 8μg:8μg:1μg(retroviral DNA:pUMVC:VSV-G)+50μl 2.5M CaCl2, add ddH2O to make up to 500μl, after mixing, slowly add dropwise to 500μl of 2x HBS, shake and mix well, Add dropwise to a petri dish and shake gently. 12 hours after transfection, replace with fresh medium, 48 hours after transfection, collect virus-containing medium, filter with 0.45μm filter, add 1/5 volume of TransLvTM Lentivirus Precipitation Solution (Transgen, FV101), and mix at 4°C Let stand for 40min, centrifuge at 8000g at 4°C, discard the supernatant, and resuspend the pellet with PBS.

Generation of iCMs from fibroblasts

iCM Reprogramming Medium: DMEM/M199 (4:1), supplemented with 10% KnockOut Serum Replacement (KSR), 10% FBS, 1% GlutaMAX, 1% MEM NEAA, 1% Pen Strep, 2 μg/ml Dox and small molecules Mixture 2C (2 μM SB431542, 2 μM Baricitinib).

D-2, the 24-well plate was first coated with 0.1% gelatin, placed in a 37°C cell incubator for 30 minutes, the gelatin was aspirated, and the 24-well plate was seeded with 80,000 cells per well. D-1, cells were replaced with MEF medium containing 6ng/μl polybrene, and infected with FU-tet-o-MYOCD, FUdeltaGW-rtTA, and 200 μl of unconcentrated virus per well of each virus. D0, cells were replaced with iCM reprogramming medium, and the medium was changed every 3-4 days. Generation of iCMs was detected after 4 weeks of treatment.

The results are shown in Figure 29, the combination of MYOCD and 2C achieved significantly improved hiCM induction efficiency.

Example 10. Knockdown of TGF receptor Alk5

Isolation of neonatal mouse fibroblasts: order neonatal neonatal mice within 24 hours from Viton Lever, take the heart tissue from the ultra-clean bench and chop it up with sterilized surgical instruments, add an appropriate amount of Type II Collagenase (1mg/mL), and keep it at 37°. Digestion, after sufficient digestion, wash twice with IMDM (20%FBS+1%PS+1%NEAA+1%Glu-Max) medium, resuspend with this medium, spread in 10cm dish, and change the medium after 24h Fresh IMDM was added, and on the fourth day, CD90.2 (anti-Thy1+) was used for MACS sorting, and the sorted cells were plated on a 24-well plate (2-5×10^5/well). After plating After 24 hours of infection with Fu-tet-o-Mef2c-T2A-Tbx5 virus, and rtTA, the reprogramming medium was replaced after 24 hours, and the medium was changed every 3 days. Beating cells could be seen at 4 weeks, and a large number of cells could be seen by immunofluorescence staining. cTnI and a-actinin.

Reprogramming medium: 10% FBS, 10% KSR, DMEM/M199 [4:1], 1% PS+1% NEAA+1% Glu-Max, 2uM Baricitinib, and the medium was changed every 3 days. Among them, the concentration of SB431542 in 2C medium is 2uM.

Alk5 #1 and #2 target sequences

#1: CCGGATAGCTGAAATTGACCTAATTCTCGAGAATTAGGTCAATTTCAGCTATTTTTTG

#2: CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTTG

The results are shown in Figure 30. After knocking down Alk5, the combination of MT and Baricitinib can also generate a large number of cTnI and a-actinin positive cardiomyocytes in the absence of SB431542.

Example 11, 2C improves cardiac function

Retroviral packaging

D-1, spread 293T on a 10cm petri dish. D0, when the cell confluence is ~70%, replace with fresh medium. At the same time, premix transfection 8μg:8μg:1μg(retroviral DNA:pUMVC:VSV-G)+50μl 2.5M CaCl2, add ddH2O to make up to 500μl, after mixing, slowly add dropwise to 500μl of 2x HBS, shake and mix well, Add dropwise to a petri dish and shake gently. 12 hours after transfection, replace with fresh medium, 48 hours after transfection, collect virus-containing medium, filter with 0.45μm filter, add 1/5 volume of TransLvTM Lentivirus Precipitation Solution (Transgen, FV101), and mix at 4°C Let stand for 40min, centrifuge at 8000g at 4°C, discard the supernatant, and resuspend the pellet with PBS.

Mice MI surgery and virus injection

WT ICR males, 8w, anesthetized with tribromoethanol, opened the chest cavity, extruded the heart, ligated the left anterior descending coronary artery, injected 10 μl of concentrated pMX-MGT/pMX-MT, put it back into the heart, and sutured the skin.

In vivo administration

2C were dissolved in DMSO and stored at -20°C. Before each administration, dissolve in cosolvent (30% PEG+5% ddH20 of Tween80), C1 10mg/kg/d, C2 20mk/kg/d, intraperitoneal injection.

The experimental results are shown in Figure 31, 2C can improve cardiac function in the heart.

Claims (31)

1. A method of reprogramming a starting cell into a cardiomyocyte, the method comprising contacting the starting cell with at least one Tyk2 inhibitor and/or at least one TGFβ inhibitor.
2. The method of claim 1, wherein the Tyk2 inhibitor is selected from the group consisting of Baricitinib, Ruxolitinib, S-Ruxolitinib, Tofacitinib, Oclacitinib maleate, Itacitinib, Peficitinib, Gandotinib, FM-381, Filgotinib, PF-06826647, BMS-986165, or their Structural analogs.
3. The method of claim 1 or 2, wherein the TGFβ inhibitor is selected from the group consisting of SB43152, TEW-7197, RepSox, GW788388, SD-208, LY364947, Y-27632, LDN-193189, LY2109761 and Galunisertib, or structural analogs thereof .
4. 3. The method of any one of claims 1-3, wherein the concentration of the Tyk2 inhibitor is from about 0.1 [mu]M to about 50 [mu]M, preferably about 2 [mu]M.
5. 4. The method of any one of claims 1-4, wherein the concentration of the TGF[beta] inhibitor is from about 0.1 [mu]M to about 50 [mu]M, preferably about 2 [mu]M.
6. 5. The method of any one of claims 1-5, wherein the starting cells are contacted with the Tyk2 inhibitor and/or the TGF[beta] inhibitor for about 1 day to about 21 days or more.
7. 6. The method of any one of claims 1-6, further comprising providing the initiating cell with at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA.
8. The method of claim 7, wherein the at least one cardiomyocyte-inducing transcription factor is selected from the group consisting of MEF2C, TBX5, GATA4, MESP1, MYOCD, HAND2, SRF, ESRRG, ZFPM2, Nkx2.5, VEGF, Baf60c, and any combination thereof .
9. 8. The method of claim 7 or 8, wherein the at least one cardiomyocyte-inducing transcription factor comprises MEF2C.
10. 9. The method of claim 8 or 9, wherein the at least one cardiomyocyte-inducing transcription factor comprises TBX5.
11. 10. The method of any one of claims 8-10, wherein the at least one cardiomyocyte-inducing transcription factor comprises GATA4.
12. 11. The method of any one of claims 8-11, wherein the at least one cardiomyocyte-inducing transcription factor comprises MYOCD.
13. 12. The method of any one of claims 8-12, wherein the at least one cardiomyocyte-inducing transcription factor comprises MESP1.
14. 8. The method of claim 7 or 8, wherein the at least one cardiomyocyte-inducing transcription factor comprises MEF2C, GATA4, MYOCD, and MESP1.
15. The method of any one of claims 7-14, wherein said transcription factor and/or is provided by an expression vector comprising a nucleotide sequence encoding at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA The microRNA, preferably, the expression vector is a viral vector, more preferably, the viral vector is a lentiviral vector.
16. The method of any one of claims 1-15, wherein the starting cells are fibroblasts, such as skin fibroblasts or cardiac fibroblasts.
17. A method of treating cardiac disease in a subject, the method comprising administering to the subject at least one inhibitor of Tyk2 and/or at least one inhibitor of TGFβ.
18. 18. The method of claim 17, wherein the cardiac disease is heart failure or myocardial infarction.
19. The method of claim 17 or 18, wherein the Tyk2 inhibitor is selected from the group consisting of Baricitinib, Ruxolitinib, S-Ruxolitinib, Tofacitinib, Oclacitinib maleate, Itacitinib, Peficitinib, Gandotinib, FM-381, Filgotinib, PF-06826647, BMS-986165, or their structural analogs.
20. The method of any one of claims 17-19, wherein the TGFβ inhibitor is selected from the group consisting of SB43152, TEW-7197, RepSox, GW788388, SD-208, LY364947, Y-27632, LDN-193189, LY2109761 and Galunisertib, or their structural analogs.
21. 20. The method of any one of claims 17-20, further comprising administering to the subject at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA.
22. The method of claim 21, wherein the at least one cardiomyocyte-inducing transcription factor is selected from the group consisting of MEF2C, TBX5, GATA4, MESP1, MYOCD, HAND2, SRF, ESRRG, ZFPM2, Nkx2.5, VEGF, Baf60c, and any combination thereof .
23. 21. The method of claim 21 or 22, wherein the at least one cardiomyocyte-inducing transcription factor comprises MEF2C.
24. 23. The method of claim 22 or 23, wherein the at least one cardiomyocyte-inducing transcription factor comprises TBX5.
25. 24. The method of any one of claims 22-24, wherein the at least one cardiomyocyte-inducing transcription factor comprises GATA4.
26. 22. The method of any one of claims 22-25, wherein the at least one cardiomyocyte-inducing transcription factor comprises MYOCD.
27. 22. The method of any one of claims 22-26, wherein the at least one cardiomyocyte-inducing transcription factor comprises MESP1.
28. The method of claim 21 or 22, wherein the at least one cardiomyocyte-inducing transcription factor comprises MEF2C, GATA4, MYOCD, and MESP1.
29. The method of any one of claims 21-28, wherein an expression vector comprising a nucleotide sequence encoding at least one cardiomyocyte-inducing transcription factor and/or at least one cardiomyocyte-inducing microRNA is administered, preferably the expression vector is a viral vector, more preferably, the viral vector is a lentiviral vector.
30. 29. The method of any one of claims 17-29, wherein the administration is topical, such as intracardiac.
31. 29. The method of any one of claims 17-29, wherein the administering is systemic administration.

Images