WO2022010312A1 - Muc4 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물 - Google Patents
Muc4 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물 Download PDFInfo
- Publication number
- WO2022010312A1 WO2022010312A1 PCT/KR2021/008803 KR2021008803W WO2022010312A1 WO 2022010312 A1 WO2022010312 A1 WO 2022010312A1 KR 2021008803 W KR2021008803 W KR 2021008803W WO 2022010312 A1 WO2022010312 A1 WO 2022010312A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gastric cancer
- mutation
- muc4
- cancer
- gastric
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/165—Mathematical modelling, e.g. logarithm, ratio
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- compositions, kits, and information providing methods capable of excavating the MUC4 gene as a biomarker for predicting or diagnosing gastric cancer, and predicting or diagnosing gastric cancer when there is a mutation in the gene.
- GC Gastric cancer
- Hereditary cancer syndromes including hereditary diffuse gastric cancer (HDGC), account for less than 3% of all gastric cancer cases. The remaining 7% is found in individuals with a family history of undiagnosed hereditary cancer syndrome [McLean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol. 2014; 11 (11):664-74. Epub 2014/08/20. https://doi.org/10.1038/nrgastro.2014.143 PMID: 25134511].
- HDGC hereditary diffuse gastric cancer
- MUC1 belongs to the mucin family, is located on the apical surface of mucosal epithelial cells, and acts as a protective barrier against extrinsic damage. It is hypothesized that MUC1 mutations such as rs4072037 affect the quantity and quality of MUC1 protein and induce differences in gastric barrier function due to differences in gastric cancer susceptibility between individuals [Saeki N, Sakamoto H, Yoshida T. Mucin 1 gene (MUC1) and gastric cancer -cancer susceptibility. Int J Mol Sci. 2014; 15(5):7958-73. Epub 2014/05/09. https://doi.org/10.3390/ijms15057958 PMID: 24810688;PubMed Central PMCID: PMC4057712].
- WES whole-genome and whole-exome sequencing
- the present inventors recruited both family members suffering from gastric cancer and family members not suffering from gastric cancer, and identified MUC4 as a candidate predisposition gene with a great effect.
- the present inventors further verified the expression analysis of MUC4 in normal gastric mucosa and gastric cancer tissues in a group with a large number of cases and controls.
- an object of the present invention is to provide a biomarker for predicting or diagnosing gastric cancer.
- the present invention includes an agent for detecting a mutation in the mucin 4 (MUC4) gene, wherein the mutation is rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs771925912, rs7453765 of the MUC4 gene.
- rs148735556, rs11717039 and rs547775645 provides a mutation in one or more regions selected from the group consisting of, gastric cancer prediction or diagnosis composition.
- the present invention provides a kit for predicting or diagnosing gastric cancer, comprising the composition.
- the present invention provides a method comprising: extracting genomic DNA from a sample of a subject; In the extracted genomic DNA, one or more regions selected from the group consisting of rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs77192595612, rs745342765, rs11717039 and 777 It provides an information providing method for the prediction or diagnosis of gastric cancer, including the step of detecting a mutation of the.
- the present invention discovers the MUC4 gene as a biomarker for predicting or diagnosing gastric cancer, and unlike normal controls, in the case of gastric cancer patients, rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241 , rs771925912, rs745342765, rs148735556, rs11717039 and rs547775645 in one or more regions selected from the group consisting of mutations, in particular, a subject having a MUC4 germline missense mutation (rs547775645 missense mutation) is a noncancerous gastric mucosa ( Expression of noncancerous gastric mucosa) is downregulated, causing gastric cancer by loss of MUC4 function, and confirming that the expression of MUC4 in cancer tissues is increased compared to normal
- FIG. 1 is a pedigree of a family with a MUC4 mutation according to an aspect of the present invention.
- subjects whose DNA was analyzed according to an aspect of the present invention are indicated by numbers starting with "#”, and the age at the time of diagnosis of gastric cancer is written in parentheses after GC.
- An arrow in FIG. 1 indicates a proband, a cross indicates a deceased subject, and mut indicates a subject with gene mutation.
- #34 of subjects had c.5005A>G; It has another MUC4 mutation of p.S1669G.
- GC gastric cancer
- IGC intestinal-type gastric cancer
- DGC diffuse-type gastric cancer
- RCC renal cell cancer
- ca cancer
- TA tubule adenoma
- F family.
- FIGS. 2A to 2C show predisposition gene candidates for gastric cancer obtained by combining pVAAST and linkage analysis of one aspect of the present invention.
- Figure 2a shows the detected predisposition genes, and a complex likelihood ratio test (CLRT) based on the binomial likelihood for the number of alleles in gastric cancer cases and controls was performed, which was performed by the gene drop method. 10 Weighted with functional prediction likelihood performed with 6 permuted samples.
- Figure 2b shows a Manhattan plot of the LOD p values of all protein-coding genes obtained from pVAAST run, in Figure 2B each dot on the plot represents a p value for one gene, and the x-axis represents the location of the genomes arranged on the chromosome.
- Figure 2c shows a quantile-quantile (QQ) plot of LOD p values obtained from pVAAST.
- QQ quantile-quantile
- FIG. 3 shows family No. Representative micrographs of IHC for MUC4 in noncancerous and cancerous gastric mucosal tissues of 14 (original magnifications A-F, H and I are X400).
- A is the tissue of #50 (subject number); B and C are the tissue of #51; D is the tissue of #54; E and F are tissue #52; H and I are the tissues of #53.
- FIG. 4 shows a QQ plot for LOD p values of genes MUC4, MAGEC1 , and RETSAT according to an aspect of the present invention.
- mutant includes base substitution, deletion, insertion, amplification and rearrangement of the nucleotide and amino acid sequences of the gene, and the nucleotide mutation is a reference sequence (eg, wild-type sequence). ) to a change in nucleotide sequence (eg, insertion, deletion, inversion or substitution of one or more nucleotides, such as a single nucleotide polymorphism (SNP)).
- SNP single nucleotide polymorphism
- a nucleotide variation may be a somatic mutation or a germline polymorphism, and mutation may be used interchangeably with variant herein.
- an amino acid mutation is a change in the amino acid sequence (eg, insertion, substitution or deletion of one or more amino acids, such as an internal deletion or N- or C-terminal truncation).
- “stomach cancer prediction” means whether there is a possibility of developing gastric cancer for a subject, whether the likelihood of developing gastric cancer is relatively high, what is the causative factor of gastric cancer, or whether gastric cancer has already occurred may mean predicting or diagnosing
- “diagnosing gastric cancer” means confirming the presence or characteristics of a pathological condition with respect to a subject, and for the purpose of one aspect of the present invention, diagnosis means confirming whether or not gastric cancer occurs.
- the composition, kit or method according to an aspect of the present invention can be used to delay or prevent the onset of onset through special and appropriate management as a patient with a high risk of developing gastric cancer for any specific patient.
- the composition, kit or method according to one aspect of the present invention can be used clinically to determine treatment by diagnosing gastric cancer at an early stage and selecting the most appropriate treatment method.
- the present invention includes an agent for detecting a mutation in the mucin 4 (MUC4) gene, wherein the mutation is rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342, rs771925912 in the MUC4 gene. It provides a mutation in one or more regions selected from the group consisting of rs148735556, rs11717039 and rs547775645, a composition for predicting or diagnosing gastric cancer.
- MUC4 mucin 4
- Mutation of the MUC4 gene according to an aspect of the present invention may inhibit the expression of the MUC4 gene in noncancerous gastric mucosa.
- the mutation of the MUC4 gene according to one aspect of the present invention may increase the expression of the MUC4 gene in gastric cancer tissue compared to normal gastric tissue.
- the MUC4-stained cells showed a tendency to decrease in the non-cancerous gastric mucosa, indicating that the normal gastric mucosa of a subject with a MUC4 mutation showed higher MUC4 expression compared to a subject with the normal MUC4 gene. It means reduced, and subjects with MUC4 mutations show reduced expression of MUC4, suggesting that MUC4 mutations inhibit MUC4 expression in normal gastric mucosa, causing a deleterious effect.
- the above trend was most pronounced in a family member having a c.5375G>A:p.R1792H mutation of MUC4 (family No. 14 in FIG. 1 ), and MUC4 expression was increased in cancer tissues compared to normal tissues. , it was found that the excessive expression of MUC4 in cancer tissues plays a dual role of the MUC4 gene as an oncogene (Example 4 and FIG. 3).
- the mutation of the MUC4 gene according to one aspect of the present invention may be a mutation in the germline, specifically, a mutation in the exon region of the MUC4 gene, and more specifically, exon 2 and exon 24 of the MUC4 gene. It may be a mutation in one or more regions selected from the group consisting of.
- the mutation in the rs547775645 region of the MUC4 gene according to an aspect of the present invention may be a missense mutation.
- Mutations of the MUC4 gene according to an aspect of the present invention are NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G> C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C> It may be one or more mutations selected from the group consisting of T, NM_018406.7:c.6640G>T and NM_018406.7:c.3053G>C.
- the MUC4 gene mutation is specifically detected in gastric cancer subjects compared to normal control subjects, and based on this, the MUC4 gene mutation is provided as a biomarker for gastric cancer prediction or diagnosis. It is characterized.
- the detection agent may refer to a substance that can be used to detect the presence of a mutation in the MUC4 gene, which is a predictive or diagnostic marker for gastric cancer in a sample. It may be at least one selected from the group consisting of antisense oligonucleotides, primer pairs, probes, antibodies, peptides, and polynucleotides that specifically bind to the mutation.
- the composition according to one aspect of the present invention may be applied to a sample of a subject, and the sample refers to any sample obtained from an individual in which expression of a biomarker according to an aspect of the present invention can be detected, specifically,
- the sample may be at least one selected from the group consisting of saliva, biopsy, blood, skin tissue, liquid culture, feces, and urine, but is not limited thereto, and commonly used in the art. It can be prepared by processing in this way.
- the detection agent according to one aspect of the present invention may be at least one selected from the group consisting of antisense oligonucleotides, primer pairs, probes, and polynucleotides that specifically bind to the mutation. That is, the detection of a nucleic acid may be performed by an amplification reaction using one or more oligonucleotide primers that hybridize to a nucleic acid molecule encoding a gene or a complement of the nucleic acid molecule. For example, the detection of a nucleic acid using a primer may be performed by amplifying a gene sequence using an amplification method such as PCR, and then confirming whether the gene is amplified by a method known in the art.
- an amplification method such as PCR
- the term "primer” means a base of a sequence capable of complementary binding to the end of a specific region of a gene used to amplify a specific region corresponding to a target site of a gene using PCR. refers to a polynucleotide or a variant thereof.
- the primer is not required to be completely complementary to the end of a specific region, and may be used as long as it is complementary enough to hybridize to the end to form a double-stranded structure.
- probe means a polynucleotide having a base of a sequence capable of complementary binding to a target site of a gene, a variant thereof, or a polynucleotide and a labeling material bound thereto do.
- hybridization means that two single-stranded nucleic acids form a duplex structure by pairing complementary nucleotide sequences.
- Hybridization can occur not only when the complementarity between single-stranded nucleic acid sequences is perfect, but also when some mismatched bases are present.
- the detection agent according to one aspect of the present invention may be at least one selected from the group consisting of an antibody and a peptide that specifically bind to the amino acid site of the mutation.
- MUC4 mutations include p.Arg1792His, p.Ser1669Gly, p.Ala2553Val, p.Thr3727Ser, p.Thr5295Met, p.Ala3558Val, p.Leu2022Phe, p.Pro2550Thr, p.Ser2213Asn, p.Pro2214Thr and It may be one or more amino acid mutations selected from the group consisting of p.Ser1018Cys, and the detection agent according to an aspect of the present invention may be an agent capable of detecting the amino acid mutation of the mutation.
- the antibody may be one or more selected from the group consisting of polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof.
- the antibody is a polyclonal antibody, a monoclonal antibody, a recombinant antibody and a complete form having two full-length light chains and two full-length heavy chains, as well as functional fragments of the antibody molecule, e.g., Fab, F It may include all of (ab'), F(ab')2 and Fv.
- Antibody production can be easily prepared using techniques well known in the art to which the present invention pertains, and commercially available antibodies can be used.
- composition according to one aspect of the present invention is not only an agent for measuring the presence or expression of a MUC4 gene mutation, but also a label that enables quantitative or qualitative measurement of the formation of an antigen-antibody complex, a conventional method used for immunological analysis It may further include phosphorus tools, reagents, and the like.
- the label capable of qualitatively or quantitatively measuring the formation of the antigen-antibody complex includes enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioactive isotopes. , but not necessarily limited thereto.
- Enzymes available as detection labels include ⁇ -glucuronidase, ⁇ -glucosidase, ⁇ -galactosidase, urease, peroxidase, alkaline phosphatase, acetylcholinesterase, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decarboxylase, ⁇ -latamase, and the like.
- Fluorescent materials include, but are not limited to, fluorescein, isothiocyanate, rhodamine, phycoerythrine, phycocyanin, allophycocyanin, o-phthalaldehyde, fluorescamine, and the like.
- Ligands include, but are not limited to, biotin derivatives.
- the luminescent material includes, but is not limited to, acridinium ester, luciferin, luciferase, and the like.
- Microparticles include, but are not limited to, colloidal gold, colored latex, and the like.
- Redox molecules include ferrocene, ruthenium complex, viologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone, K 4 W(CN) 8 , [Os(bpy) 3 ] 2+ , [RU(bpy) 3 ] 2+ , [MO(CN) 8 ] 4- , and the like, but are not limited thereto.
- Radioisotopes include, but are not limited to, 3 H, 14 C, 32 P, 35 S, 36 Cl, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, 125 I, 13 1I, 186 Re, and the like.
- examples of the tools or reagents include, but are not limited to, suitable carriers, solubilizers, detergents, buffers, stabilizers, and the like.
- the labeling material is an enzyme
- it may include a substrate capable of measuring enzyme activity and a reaction terminator.
- the carrier includes a soluble carrier and an insoluble carrier, and an example of the soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS, and an example of the insoluble carrier is polystyrene, polyethylene, polypropylene, polyester, poly acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, other paper, glass, metal, agarose, and combinations thereof.
- Gastric cancer according to an aspect of the present invention may be at least one selected from the group consisting of diffuse-type gastric cancer, intestinal-type gastric cancer, and mixed-type gastric cancer, but if it is gastric cancer, the type is not limited does not Previously, biomarkers for gastric cancer related to a family history were limited to diffuse gastric cancer or HDGC (hereditary diffuse gastric cancer), but the composition according to one aspect of the present invention contains the MUC4 gene regardless of the type of gastric cancer. It is possible to predict or diagnose gastric cancer depending on the presence or absence of a mutation, thereby having an excellent effect of predicting or diagnosing a wider range of gastric cancer.
- composition according to one aspect of the present invention is gastric cancer in a subject suffering from one or more cancers selected from the group consisting of gastric adenocarcinoma (STAD), colorectal cancer (CRC) and uterine corpus endometrial cancer (UCEC).
- STAD gastric adenocarcinoma
- CRC colorectal cancer
- UCEC uterine corpus endometrial cancer
- the subject according to one aspect of the present invention may be a subject with or without a family history of gastric cancer, and the presence of a family history of gastric cancer means that there are two or more family members who currently have stomach cancer within 3 generations or who have had gastric cancer in the past. can mean
- an aspect of the present invention provides a kit for predicting or diagnosing gastric cancer comprising a composition for predicting or diagnosing gastric cancer comprising a mutation detection agent of the mucin 4 (mucin 4, MUC4) gene.
- a mutation detection agent of the mucin 4 (mucin 4, MUC4) gene The description of the MUC4 gene, the mutation of the MUC4 gene, the detection agent, gastric cancer, the subject, the sample, and the like is the same as described above.
- the kit according to one aspect of the present invention may further include instructions.
- mutations in one or more regions selected from the group consisting of rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 and rs11717039 in the MUC4 gene region are Predictive or diagnosing gastric cancer, if present, may be described.
- the kit according to an aspect of the present invention may be applied to a subject with or without a family history of gastric cancer, and the presence of a family history of gastric cancer means that there are two or more family members who currently have gastric cancer within 3 generations or who have had gastric cancer in the past can do.
- the kit according to one aspect of the present invention may be applied to a subject with cancer, and specifically, gastric adenocarcinoma (STAD), colorectal cancer (CRC) and endometrial cancer (uterine corpus endometrial cancer, UCEC) ) may be applied to a subject suffering from one or more cancers selected from the group consisting of.
- STAD gastric adenocarcinoma
- CRC colorectal cancer
- UCEC uterine corpus endometrial cancer
- the present invention provides a method comprising the steps of extracting genomic DNA from a sample of a subject; In the extracted genomic DNA, one or more regions selected from the group consisting of rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs77192595612, rs745342765, rs11717039 and 777 It provides an information providing method for the prediction or diagnosis of gastric cancer, including the step of detecting a mutation of the.
- the description of the MUC4 gene, MUC4 gene mutation, detection agent, gastric cancer, and the like is the same as described above.
- the step of detecting the mutation according to an aspect of the present invention comprises p.Arg1792His, p.Ser1669Gly, p.Ala2553Val, p.Thr3727Ser, p.Thr5295Met, p.Ala3558Val, p.Leu2022Phe, p. It may include the step of detecting one or more amino acid mutations selected from the group consisting of Pro2550Thr, p.Ser2213Asn, p.Pro2214Thr and p.Ser1018Cys, which can detect the amino acid mutation of the mutation according to one aspect of the present invention It may be a step of detecting an amino acid mutation using a detection agent.
- the mutation detection step according to an aspect of the present invention includes NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7 of the MUC4 gene.
- NM_018406.7:c.15884G>A NM_018406.7:c.10673G>A
- NM_018406.7:c.7648G>T NM_018406.7: reacting a primer specific to a continuous nucleotide sequence selected from the nucleotide sequence of one or more regions selected from the group consisting of c.6638C>T, NM_018406.7:c.6640G>T and NM_018406.7:c.3053G>C; and amplifying the reactant.
- the mutation detection step according to an aspect of the present invention may be performed by target molecule cloning and sequencing using techniques well known in the art. eg, DNA sequencing; Primer extension, including allele-specific nucleotide incorporation assays and allele-specific primer extension assays (e.g., allele-specific PCR, allele-specific ligation chain reaction (LCR) and gap-LCR) black; allele-specific oligonucleotide hybridization assays (eg, oligonucleotide ligation assays); cleavage protection assays using protection from cleavage agents to detect mismatched bases in nucleic acid duplexes; MutS protein binding assay; electrophoretic analysis comparing the mobility of mutant and wild-type nucleic acid molecules; denaturing-gradient gel electrophoresis (DGGE, eg as in Myers et al.
- DGGE denaturing-gradient gel electrophoresis
- the mutation of the MUC4 gene according to an aspect of the present invention is NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G >C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C It may be one or more mutations selected from the group consisting of >T, NM_018406.7:c.6640G>T and NM_018406.7:c.3053G>C.
- the information providing method may be to predict or diagnose gastric cancer when the MUC4 gene mutation is detected after the step of detecting the MUC4 gene mutation.
- the information providing method provides information for predicting or diagnosing one or more gastric cancers selected from the group consisting of diffuse-type gastric cancer, intestinal-type gastric cancer, and mixed-type gastric cancer method, but if it is stomach cancer, the type is not limited.
- biomarkers for gastric cancer related to family history have been limited to diffuse gastric cancer or HDGC (hereditary diffuse gastric cancer), but the information providing method according to one aspect of the present invention is provided regardless of the type of gastric cancer. It can provide information for predicting or diagnosing gastric cancer depending on the presence or absence of a MUC4 gene mutation, and thus has an excellent effect in predicting or diagnosing a wider range of gastric cancer.
- the subject according to one aspect of the present invention may be a subject with or without a family history of gastric cancer, and having a family history of gastric cancer means that there are two or more family members who currently have stomach cancer within 3 generations or who have had stomach cancer in the past. .
- the subject according to one aspect of the present invention may be a subject with cancer, specifically gastric adenocarcinoma (STAD), colorectal cancer (CRC), and endometrial cancer (uterine corpus endometrial cancer, UCEC) consisting of and may be a subject suffering from one or more cancers selected from the group.
- cancer specifically gastric adenocarcinoma (STAD), colorectal cancer (CRC), and endometrial cancer (uterine corpus endometrial cancer, UCEC) consisting of and may be a subject suffering from one or more cancers selected from the group.
- STAD gastric adenocarcinoma
- CRC colorectal cancer
- UCEC endometrial cancer
- whole-exome sequencing (whole-exome sequencing) was performed in 19 gastric cancer patients in 14 families and 36 immediate family members without gastric cancer in which 2 or more gastric cancer cases occurred within 3 generations.
- exome sequencing (WES) was performed.
- the subject registration method for this and the characteristics of the registered subjects are as follows.
- control group was defined as a person over 50 years of age who had a normal endoscopy within the past 6 months.
- pathological diagnosis by endoscopic biopsy or surgical specimen was based.
- the average age of patients diagnosed with gastric cancer was 59.0 years (range: 31-84 years), whereas the average age of relatives who did not have gastric cancer was 62 years.
- About half of gastric cancer patients were H.
- Example 1 In order to discover biomarkers for predicting or diagnosing gastric cancer in the subjects of Example 1, the subject's genome was analyzed as follows.
- Example 1 the genomic DNA of the subjects of Example 1 was isolated using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.
- Qiagen DNeasy Blood and Tissue Kit
- an Agilent SureSelect All Exon V6 (Agilent Technologies, Santa Clara, CA) with reagents was used with a sequencing library and capture. Sequencing was performed on an Illumina HiSeq 2500 platform (2x100 bp-paired end; Illumina, Inc., San Diego, CA).
- the sequence data set of 55 registrants of Example 1 was deposited with the European Nucleotide Archive (http://www.ebi.ac.uk/ena/data/view) with accession number PRJEB29071.
- Raw sequencing reads were aligned to Human Genome Reference Assembly GRCh37/hg19 using Burrows-Wheeler Aligner (BWA v0.7.15) software [Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009; 25(14):1754-60. Epub 2009/05/20. https://doi.org/10.1093/bioinformatics/btp324 PMID: 19451168; PubMed Central PMCID: PMC2705234].
- the BWA alignment files were converted to BAM files using SAM tools v1.3, and the copy was marked as Picard (https://sourceforge.net/projects/picard, v1.96).
- Genomic Variant Call Format gVCF
- GATK Genome Analysis Toolkit
- the loci of the disease susceptibility genes were identified using an autosomal dominant genetic model and linkage analysis and gene-based association tests with the Pedigree Variant Annotation, Analysis, and Search Tool (pVAAST) under the maximum allowable prevalence of the disease of 0.005.
- pVAAST Pedigree Variant Annotation, Analysis, and Search Tool
- LOD Logarithm of odds
- CLRT was calculated from 10 6 substituted samples using the gene-drop method.
- the present inventors compared the mutations in 19 gastric cancer patients with the 36 controls who did not develop gastric cancer in all 14 families.
- the present inventors compared the total exome allele number of 19 gastric cancer patients with the total genome allele number of 397 Korean controls obtained from the Korea National Biobank of the National Institute of Korea. compared.
- the gnomAD database http://gnomad.broadinstitute.org/ was used to determine the frequency of specific variants in the overall and East Asian control populations.
- TCGA data was downloaded from the Genomic Data Common Legacy (GRCh37/hg19) Archive and the Institute for Systems Biology Cancer Genomics Cloud at the Genomic Data Common Data Portal (https://portal.gdc.cancer.gov). did Sequence information was obtained from a database of genotypes and phenotypes (dbGaP).
- gastric cancer status among family members was assumed to be independent, and standard logistic regression analysis was applied using Rex Version 2.1 (http://rexsoft.org). For each gene, genetic risk scores were coded as 1 if one or more rare alleles were observed in the corresponding gene, and 0 otherwise. Gender, age, smoking status, and HDGC were included as covariates to adjust for effects.
- the WES data obtained from the above genetic analysis were generated from 55 subjects having a mean depth of 96 times in the target exome region. An average of 97% of all target areas were at least 20 fold.
- linkage analysis combined with association testing was performed. Based on the LOD p value, MUC4, MAGEC1 , and RETSAT were identified as putative genes related to gastric cancer, and these are shown in FIGS. 2A to 2C .
- 2B and 2C show Manhattan and quantile-quantile (QQ) plots for this linkage analysis, respectively, showing that this statistical analysis maintains a nominal level of significance.
- QQ quantile-quantile
- the frequency of the MUC1 rs4072037 A allele was 90.9%, similar to that of 1,124 Chinese gastric cancer patients [Qiu LX, Hua RX, Cheng L, He J, Wang MY, Zhou F, et al. Genetic variant rs4072037 of MUC1 and gastric cancer risk in an Eastern Chinese population. Oncotarget. 2016; 7(13):15930-6. Epub 2016/02/26.
- MUC4 mutation estimated in the present invention may contribute to the geographic difference in the incidence of gastric cancer parallel to the MUC1 mutation.
- gastric cancer has a heterogeneous etiology
- individuals in the gastric cancer family may show discrepancies between genetic susceptibility and clinical presentation.
- 5 gastric cancer patients without MUC4 mutation were identified among 4 independent families: #20, #28, #43, #45, and #46 (FIG. 1).
- Diffuse gastric cancer patient #28 who met the HDGC criteria had a novel missense mutation in CDH1 (NM_001317184: exon8:c.G1057A:p.E353K).
- Example 2 below in from the cohort of Example 1 the subject larger the more the correlation of genomic analysis results for the subjects with MUC4 mutant gastric cancer risk is increased As of the bar, the MUC4 variation hayeotneun to the gastric target size was verified in the same way.
- Blood samples were collected from 597 histologically confirmed gastric cancer patients and 9,758 non-gastric cancer patients (control group) at Seoul National University Bundang Hospital and Seoul National University Hospital Healthcare System Gangnam Center. The samples were genotyped by the Affymetrix Axiom Korean Chip consisting of 827,783 mutations.
- Bonferroni-adjusted 0.05 significance level was 1.18 ⁇ 10 -5 , PLINK (v1.90b4.5) and R (v3.5.2) were used in the process [Chang CC, Chow CC, Tellier LC, Vattikuti S, Purcell SM , Lee JJ. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 2015; 4:7. Epub 2015/02/28. https://doi.org/10.1186/s13742-015-0047-8 PMID: 25722852; PubMed Central PMCID: PMC4342193].
- MUC4 missense mutation was confirmed as a predisposition for familial aggregation of gastric cancer, and it was confirmed that a common mutation exists in MUC4 that has a significant association with gastric cancer.
- MUC4 is expressed not only in the stomach but also in other tissues such as colon, esophagus, small intestine, uterus and lung
- abnormal MUC4 expression has been reported in various types of carcinomas including lung, breast, pancreas, and gastric carcinoma [Chaturvedi P , Singh AP, Batra SK. Structure, evolution, and biology of the MUC4 mucin. FASEB J. 2008; 22(4):966-81. Epub 2007/11/21.
- the heterozygous rs774527434 SNP was identified in one patient (0.17%) of 295 stomach adenocarcinoma germline samples (Table 2). 6), which is about 4 times higher than in the general population (0.04%, Table 2).
- CRC colorectal cancer
- MUC4 mutations may be associated with gastrointestinal or urogenital tract cancer.
- IHC immunohistochemistry
- the antral noncancerous mucosa was evaluated using IHC from 15 gastric cancer patients and 8 non-gastric cancer patients who consented to endoscopic biopsy. For gastric cancer patients, cancer tissues were also stained.
- Antibody for detection of MUC4 (clone: 8G7) (1:100 dilution, Zeta Corporation, Arcadia, CA, USA) was used for IHC. The antibody used for the above IHC detects the MUC4 ⁇ region. The specificity of the antibody has been demonstrated by previous studies. Whole staining of sections (4 ⁇ m thick) was performed via the BenchMark XT Staining system and the ultraVIEW Universal DAB Detection Kit (Ventana Medical Systems, Inc., Arlington, AZ, USA).
- MUC4 expression was assessed as follows through the product (%) of intensity over area using a scientific microscope, where staining was observed in epithelial glands as follows (0 to 300): if no staining was observed 0; 1+ for faint/barely perceptible partial staining; 2+ for light or moderate staining; 3+ for strong dyeing. In cancer tissue, strongly stained areas were scored. Each sample was scored blindly by a single pathologist (Lee Hye-seung).
- MUC4 mutation-negative non-cancerous gastric mucosa (# 50, # 54) (Figs. 3A and 3D) are three patients having, MUC4 variation while showing a high strength MUC4 variation of (# 51, # 52 and # 53) -IHC results of positive noncancerous mucosa were weak or negative (Fig. 3B, Fig. 3E and Fig. 3H).
- the cancer tissues of 3 gastric cancer patients (#51, #52 and #53) showed high IHC scores ( FIGS. 3C , 3F and 3I ).
- MUC4-stained cells tended to decrease in non-cancerous gastric mucosa, which means that the normal gastric mucosa of subjects with MUC4 mutations had reduced MUC4 expression compared to subjects with wild-type.
- MUC4 the subjects with structurally similar to MUC4 variations and MUC1 can be seen that the bar indicating that the expression of MUC4 reduced, MUC4 mutations that cause harmful effects by inhibiting MUC4 expression in normal gastric mucosa, this trend MUC4 was most pronounced in family members with the c.5375G>A:p.R1792H mutation of (Family No. 14).
- the bar hayeotneun MUC4 expression increased in cancer tissues compared to normal tissues, over-expression of MUC4 in cancer tissue through which confirmed that the dual roles as MUC4 gene is an oncogene (oncogene).
- Motif retrieval, and peptide cleavage, glycosylation, and protein Prediction of structures was performed [O'Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016; 44(D1):D733-45. Epub 2015/11/11. https://doi.org/10.1093/nar/gkv1189 PMID:26553804; PubMed Central PMCID: PMC4702849]. Motif search was performed using the MotifFinder tool of GenomeNet (https://www.genome.jp).
- exon 2 9 of the 10 MUC4 mutations identified in Examples 2 to 4 are located in exon 2, which includes a tandem repeat region [Chaturvedi P, Singh AP, Batra SK. Structure, evolution, and biology of the MUC4 mucin. FASEB J. 2008; 22(4):966-81. Epub 2007/11/21. https://doi.org/10.1096/fj.07-9673rev PMID: 18024835;PubMed Central PMCID: PMC2835492], another mutation was present in exon 24.
- homology modeling or first ( ab initio ) structural modeling was not successful due to the lack of established MUC1 or MUC4 models, and coil structures of O-glycosylation-rich sites.
- a single codon change from G to A at this putative cleavage site could potentially inhibit proteolytic activity.
- a single codon change from C to T results in threonine synthesis of a potential N-glycosylation site between the second and third epidermal growth factor (EGF)-like domains of the MUC4 ⁇ subunit. interfered with
- the information obtained from persons Rico (in silico) prediction of glycosylation in the MUC4 structure is most areas the coded screen by MUC4 variation indicates that a potential O- glycosylation sites.
- O-glycosylation with glycan micro-heterogeneity is important for mucin structure and function.
- Mucin-type glycans can participate in specific ligand-receptor interactions, impart hygroscopicity, bind to various small molecules and proteins, and finally stabilize protein structures [Jayaprakash NG, Surolia A. Role of glycosylation in nucleating protein folding and stability. Biochem J. 2017; 474(14):2333-47. Epub 2017/07/05.
- Example 2 In the case of subjects with a MUC4 transition from to 4 bar hayeotneun confirmed that the gastric cancer risk is increased, the MUC4 mutation and the following genotyping (genotyping) and immunohistochemical (IHC) analysis in the same manner as association of gastric The results were re-verified.
- a total of 288 patients were selected from the patients at Seoul National University Bundang Hospital, and among them, 237 subjects (103 gastric cancer patients and non-gastric cancer patients) were subjected to immunohistochemical (IHC) analysis of gastric antrum and gastric cancer tissues. (control group) was 134 people).
- IHC immunohistochemical
- blood and gastric cancer tissues were obtained, and genomic DNA was isolated and extracted therefrom (Qiagen DNeasy blood and tissue kit (Qiagen, Hilden, Germany)) .
- genotyping was performed on two types of SNPs of MUC4 rs774527434 and rs531395109. As a result , a total of 14 subjects had the MUC4 gene mutation, of which 5 were non-gastric cancer patients and 9 were gastric cancer patients.
- primer and reporter sequences used for genotyping are as follows.
- -reporter 1 ACCACCCGTCTTCCT (SEQ ID NO: 3)
- -reporter 2 ACCACCCATCTTCCT (SEQ ID NO: 4)
- CTTCAGCATGCTCACG SEQ ID NO: 8
- the PCR reaction solution was prepared with 12.5 ⁇ l of TaqMan's Genotyping Master Mix (Cat No. 4371353), 1.25 ⁇ l of Genotyping Assay Mix (forward primer, reverse primer, reporter 1, reporter 2), and 10.25 ⁇ l of DNase-free water. Add 1 ⁇ l (10-50 ng) of genomic DNA to this to make a total of 25 ⁇ l, hold at 95°C for 10 minutes, denature at 92°C for 15 seconds, cycle annealing/extend at 60°C 50 times for 1 minute to make ViiA 7 Real Genotyping was performed by real-time PCR reaction using -Time PCR System (Applied Biosystems, USA).
- gastric cancer can be predicted or diagnosed when there is a MUC4 mutation even using genotyping, which can perform genetic analysis more efficiently and simply in terms of cost and time.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 위암을 예측 또는 진단하기 위한 바이오마커로 MUC4 유전자를 발굴하고, 상기 유전자에 돌연변이가 있는 경우 위암을 예측 또는 진단할 수 있는 조성물, 키트 및 정보제공방법에 관한 것으로, 본 발명의 일 측면에 따른 조성물은 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서 돌연변이를 검출하여 다수의 피험자를 대상으로 비용 및 시간 효율적으로 위암을 예측 또는 진단할 수 있는 우수한 효과가 있다.
Description
본 명세서에는 위암을 예측 또는 진단하기 위한 바이오마커로 MUC4 유전자를 발굴하고, 상기 유전자에 돌연변이가 있는 경우 위암을 예측 또는 진단할 수 있는 조성물, 키트 및 정보제공방법이 개시된다.
위암(gastric cancer, GC)은 가장 흔한 암 중 하나이며 2018년에 783,000 명이 사망한 것으로 추정되는, 전 세계적으로 암 사망률의 세 번째 주요 원인이다 [Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018; 68(6):394-424. Epub 2018/09/13. https://doi.org/10.3322/caac.21492 PMID: 30207593]. 한국은 세계에서 위암 발병률이 가장 높다. 남성, 헬리코박터 파일로리(Helicobacter pylori, H. pylori) 감염, 흡연, 및 빈번한 짠 음식과 아질산염(nitrite) 식이 외에도, 가족력은 위암의 잘 알려진 위험 요소이다 [Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection. Gut. 1997; 40(3):297-301. Epub 1997/03/01. https://doi.org/10.1136/gut.40.3.297 PMID: 9135515; PubMed Central PMCID: PMC1027076]. 대부분의 위암은 산발적이며, 지역 사회에서 발병하는 약 90%만이 평균 위험도를 가진다 [La Vecchia C, Negri E, Franceschi S, Gentile A. Family history and the risk of stomach and colorectal cancer. Cancer. 1992; 70(1):50-5. Epub 1992/07/01. https://doi.org/10.1002/1097-0142(19920701) 70:1<50::aid-cncr2820700109>3.0.co;2-i PMID: 1606546][Zanghieri G, Di Gregorio C, Sacchetti C, Fante R, Sassatelli R, Cannizzo G, et al. Familial occurrence of gastric cancer in the 2-year experience of a population-based registry. Cancer. 1990; 66(9):2047-51. Epub 1990/11/01. https://doi.org/10.1002/1097-0142(19901101)66:9<2047::aid-cncr2820660934>3.0. co;2-g PMID: 2224804]. 유전성 미만형 위암(hereditary diffuse gastric cancer, HDGC)를 포함하는 유전성 암 증후군은 전체 위암 사례들 중 3% 미만을 차지한다. 나머지 7%는 유전성 암 증후군을 진단받지 않은 가족력이 있는 개인에서 발견된다 [McLean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol. 2014; 11 (11):664-74. Epub 2014/08/20. https://doi.org/10.1038/nrgastro.2014.143 PMID: 25134511].
위암에 걸린 직계 가족 (first-degree relatives, FDRs)이 있는 개인은 위암 위험도가 2 내지 3 배 증가한다 [Choi YJ, Kim N. Gastric cancer and family history. Korean J Intern Med. 2016; 31(6):1042-53. Epub 2016/11/04. https://doi.org/10.3904/kjim.2016.147 PMID: 27809451; PubMed Central PMCID: PMC5094936]. 위암에 걸린 가족에서 위험도 증가는 식습관 또는 헬리코박터 파일로리 감염과 같은, 유사한 환경 요인의 공유에 부분적으로 기인한다. 그럼에도 불구하고, 위암에 걸린 가족에서 헬리코박터 파일로리 감염과 위암 발병 사이에 빈번하게 관찰된 약한 연관성은 [Choi YJ, Kim N, Jang W, Seo B, Oh S, Shin CM, et al. Familial Clustering of Gastric Cancer: A Retrospective Study Based on the Number of First-Degree Relatives. Medicine (Baltimore). 2016; 95(20): e3606. Epub 2016/05/20. https://doi.org/10.1097/MD.0000000000003606 PMID: 27196462; PubMed Central PMCID: PMC4902404][Sahasrabudhe R, Lott P, Bohorquez M, Toal T, Estrada AP, Suarez JJ, et al. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients With Gastric Cancer. Gastroenterology. 2017; 152(5):983-6 e6. Epub 2016/12/28. https://doi.org/10.1053/j.gastro. 2016.12.010 PMID: 28024868; PubMed Central PMCID: PMC5367981] 가족 응집의 유전적 기초를 제시한다.
문헌에 따르면, 위암과 관련된 몇 가지 SNP는 후보 유전자 접근법 [ean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol. 2014; 11 (11):664-74. Epub 2014/08/20. https://doi.org/10.1038/nrgastro.2014.143 PMID: 25134511][El-Omar EM, Carrington M, Chow WH, McColl KE, Bream JH, Young HA, et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000; 404(6776):398-402. Epub 2000/04/04. https://doi.org/10.1038/35006081 PMID: 10746728] 또는 게놈-전체 연관 연구(genome-wide association study, GWAS)를 통해 확인되었다 [Saeki N, Saito A, Choi IJ, Matsuo K, Ohnami S, Totsuka H, et al. A functional single nucleotide polymorphism in mucin 1, at chromosome 1q22, determines susceptibility to diffuse-type gastric cancer. Gastroenterology. 2011; 140(3):892-902. Epub 2010/11/13. https://doi.org/10.1053/j.gastro.2010.10.058 PMID: 21070779][ Study Group of Millennium Genome Project for C, Sakamoto H, Yoshimura K, Saeki N, Katai H, Shimoda T, et al. Genetic variation in PSCA is associated with susceptibility to diffuse-type gastric cancer. Nat Genet. 2008; 40(6):730-40. Epub 2008/05/20. https://doi.org/10.1038/ng.152 PMID: 18488030]. 가장 잘 알려진 것 중 하나는 MUC1과 위암의 연관성이다 [Saeki N, Sakamoto H, Yoshida T. Mucin 1 gene (MUC1) and gastric-cancer susceptibility. Int J Mol Sci. 2014; 15(5):7958-73. Epub 2014/05/09. https://doi.org/10.3390/ijms15057958 PMID: 24810688; PubMed Central PMCID: PMC4057712]. MUC1은 뮤신 패밀리에 속하며, 점막 상피세포의 선단 표면(apical surface)에 위치하고 외인적 손상에 대한 보호 장벽으로서 작용한다. rs4072037와 같은 MUC1 변이는 MUC1 단백질의 양과 질에 영향을 미치며 개인간 위암 감수성의 차이로 위에서 장벽 기능의 차이를 유발한다는 가설이 있다 [Saeki N, Sakamoto H, Yoshida T. Mucin 1 gene (MUC1) and gastric-cancer susceptibility. Int J Mol Sci. 2014; 15(5):7958-73. Epub 2014/05/09. https://doi.org/10.3390/ijms15057958 PMID: 24810688;PubMed Central PMCID: PMC4057712].
그러나, 이러한 SNP에 대한 연구는 특히 다른 위암 유형 및 민족성과 관련하여 일관성 없는 결과를 낳았다 [Saeki N, Saito A, Choi IJ, Matsuo K, Ohnami S, Totsuka H, et al. A functional single nucleotide polymorphism in mucin 1, at chromosome 1q22, determines susceptibility to diffuse-type gastric cancer. Gastroenterology. 2011; 140(3):892-902. Epub 2010/11/13. https://doi.org/10.1053/j.gastro.2010.10.058 PMID: 21070779][El-Omar EM, Rabkin CS, Gammon MD, Vaughan TL, Risch HA, Schoenberg JB, et al. Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology. 2003; 124(5):1193-201. Epub 2003/05/06. https://doi.org/10.1016/s0016-5085(03)00157-4 PMID: 12730860][Kim N, Cho SI, Yim JY, Kim JM, Lee DH, Park JH, et al. The effects of genetic polymorphisms of IL-1 and TNF-A on Helicobacter pylori-induced gastroduodenal diseases in Korea. Helicobacter. 2006; 11 (2):105-12. Epub 2006/04/04. https://doi.org/10.1111/j.1523-5378.2006.00384.x PMID: 16579840][Palmer AJ, Lochhead P, Hold GL, Rabkin CS, Chow WH, Lissowska J, et al. Genetic variation in C20orf54, PLCE1 and MUC1 and the risk of upper gastrointestinal cancers in Caucasian populations. Eur J Cancer Prev. 2012; 21(6):541-4. Epub 2012/07/19. https://doi.org/10.1097/CEJ. 0b013e3283529b79 PMID: 22805490; PubMed Central PMCID: PMC3460062]. 더욱이, GWAS로부터 얻은 SNP의 효과 크기는 일반적으로 2.0 미만으로 작았다. 최근에, 전체-게놈 및 전체-엑손 시퀀싱(whole-genome and whole-exome sequencing, WES)을 사용하여 가족성 위암의 작은 부분을 설명하는 PALB2, BRCA1, 및 CTNNA1을 포함하는 신규한 위암 유전자를 확인하였다 [Sahasrabudhe R, Lott P, Bohorquez M, Toal T, Estrada AP, Suarez JJ, et al. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients With Gastric Cancer. Gastroenterology. 2017; 152(5):983-6 e6. Epub 2016/12/28. https://doi.org/10.1053/j.gastro. 2016.12.010 PMID: 28024868; PubMed Central PMCID: PMC5367981][ Fewings E, Larionov A, Redman J, Goldgraben MA, Scarth J, Richardson S, et al. Germline pathogenic variants in PALB2 and other cancer-predisposing genes in families with hereditary diffuse gastric cancer without CDH1 mutation: a whole-exome sequencing study. Lancet Gastroenterol Hepatol. 2018; 3 (7):489-98. Epub 2018/05/01. https://doi.org/10.1016/S2468-1253(18)30079-7 PMID: 29706558; PubMed Central PMCID: PMC5992580][Majewski IJ, Kluijt I, Cats A, Scerri TS, de Jong D, Kluin RJ, et al. An alpha-E-catenin (CTNNA1) mutation in hereditary diffuse gastric cancer. J Pathol. 2013; 229(4):621-9. Epub 2012/12/05. https://doi.org/10.1002/path.4152 PMID: 23208944]. 위암의 가족 클러스터링에 대한 이전의 대부분의 연구는 HDGC 또는 미만형 위암에 중점을 두었지만[Sahasrabudhe R, Lott P, Bohorquez M, Toal T, Estrada AP, Suarez JJ, et al. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients With Gastric Cancer. Gastroenterology. 2017; 152(5):983-6 e6. Epub 2016/12/28. https://doi.org/10.1053/j.gastro. 2016.12.010 PMID: 28024868; PubMed Central PMCID: PMC5367981][ Fewings E, Larionov A, Redman J, Goldgraben MA, Scarth J, Richardson S, et al. Germline pathogenic variants in PALB2 and other cancer-predisposing genes in families with hereditary diffuse gastric cancer without CDH1 mutation: a whole-exome sequencing study. Lancet Gastroenterol Hepatol. 2018; 3 (7):489-98. Epub 2018/05/01. https://doi.org/10.1016/S2468-1253(18)30079-7 PMID: 29706558; PubMed Central PMCID: PMC5992580], 장형 위암의 상당 부분이 위암 가족 클러스터에서 발생한다[Choi YJ, Kim N, Jang W, Seo B, Oh S, Shin CM, et al. Familial Clustering of Gastric Cancer: A Retrospective Study Based on the Number of First-Degree Relatives. Medicine (Baltimore). 2016; 95(20): e3606. Epub 2016/05/20. https://doi.org/10.1097/MD.0000000000003606 PMID: 27196462; PubMed Central PMCID: PMC4902404][Kaurah P, MacMillan A, Boyd N, Senz J, De Luca A, Chun N, et al. Founder and recurrent CDH1 mutations in families with hereditary diffuse gastric cancer. JAMA. 2007; 297(21):2360-72. Epub 2007/06/05. https://doi.org/10.1001/jama.297.21.2360 PMID: 17545690]. 또한, 장형 위암의 유병률이 높은 아시아에서는 위암에 대한 WES 연구가 드물다.
본 발명자는 위암에 걸린 가족 구성원 및 위암에 걸리지 않은 가족 구성원을 모두 모집하고 큰 효과를 가진 후보 소인 유전자로 MUC4를 확인하였다. 본 발명자는 사례와 대조군의 수가 큰 집단에서 정상 위 점막 및 위암 조직에서 MUC4의 발현 분석을 통해 추가로 검증하였다.
따라서, 일 측면에서, 본 발명의 목적은, 위암을 예측 또는 진단하기 위한 바이오마커를 제공하는 것이다.
다른 측면에서, 본 발명의 목적은, 위암을 예측 또는 진단하기 위한 바이오마커의 돌연변이를 제공하는 것이다.
일 측면에서, 본 발명은, 뮤신 4 (mucin 4, MUC4) 유전자의 돌연변이 검출 제제를 포함하고, 상기 돌연변이는 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이인, 위암 예측 또는 진단용 조성물을 제공한다.
다른 측면에서, 본 발명은, 상기 조성물을 포함하는, 위암 예측 또는 진단용 키트를 제공한다.
또 다른 측면에서, 본 발명은, 피험자의 샘플로부터 게놈 DNA를 추출하는 단계; 상기 추출된 게놈 DNA에 뮤신 4 (mucin 4, MUC4) 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이를 검출하는 단계;를 포함하는, 위암 예측 또는 진단을 위한 정보제공방법을 제공한다.
본 발명은 일 측면에서, 위암을 예측 또는 진단하기 위한 바이오마커로서 MUC4 유전자를 발굴하고, 정상 대조군과 달리 위암 환자의 경우 상기 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서 돌연변이가 존재하고, 특히 MUC4 생식세포계열(germline) 미스센스 돌연변이(rs547775645 미스센스 돌연변이)를 갖는 피험자는 비암성 위 점막(noncancerous gastric mucosa)에서 발현이 억제되어(downregulated) MUC4의 기능 상실에 의해 위암을 유발하고, 정상 조직에 비해 암 조직에서의 MUC4의 발현이 증가함을 확인하였는바, MUC4 유전자 돌연변이 검출 제제를 포함하는 조성물은 다수의 피험자를 대상으로 비용 및 시간 효율적으로 위암을 예측 또는 진단할 수 있는 우수한 효과가 있다.
도 1은 본 발명의 일 측면에 따른 MUC4 변이를 가진 가족의 가계도이다. 도 1에서, 본 발명의 일 측면에 따라 DNA를 분석한 피험자는 "#"으로 시작하는 번호로 표시되고, 위암을 진단받은 당시의 연령은 GC 뒤의 괄호에 기재되었다. 도 1의 화살표는 발단자(proband)를 나타내며, 십자가는 사망한 피험자를 나타내고, mut는 유전자의 변이를 수반한 피험자를 나타낸다. 피험자 중 #34는 c.5005A>G; p.S1669G 의 또 다른 MUC4 돌연변이를 가진다. 도 1의 약어는 다음과 같다: GC, 위암(gastric cancer)(Lauren 분류로 알 수 없음); IGC, 장형 위암(intestinal-type gastric cancer); DGC, 미만형 위암(diffuse-type gastric cancer); RCC, 신장 세포암(renal cell cancer); ca, 암(cancer); TA, 세관 선종(tubule adenoma); F, 가족(family).
도 2a 내지 도 2c는 본 발명의 일 측면의 pVAAST와 연계 분석을 조합하여 얻은 위암에 대한 소인 유전자 후보들을 나타낸다. 도 2a는 검출된 소인 유전자를 나타내며, 위암 케이스 및 대조군의 대립 유전자 수에 대한 이항 가능성(binomial likelihood)에 기초한 복합 우도 비율 검정(CLRT)을 수행하였는데, 이는 유전자 드롭 방법(gene drop method)에 의해 106 개의 치환된 샘플로 수행한 기능 예측 가능성 비율(functional prediction likelihood)로 가중된 것이다. 도 2b는 pVAAST 수행으로부터 얻은 모든 단백질-암호화 유전자의 LOD p 값의 Manhattan 플롯을 나타내며, 도 2B에서 플롯의 각 점은 하나의 유전자에 대한 p 값을 나타내고, x 축은 염색체에 배열된 게놈의 위치를 보여준다. 도 2c는 pVAAST로부터 얻은 LOD p 값의 quantile-quantile (QQ) 플롯을 나타낸다.
도 3은 가족 No. 14의 비암성 및 암성 위 점막 조직에서의 MUC4에 대한 IHC의 대표적인 현미경 사진이다 (원래 배율 A-F, H 및 I는 X400). 도 3에서 A는 #50 (피험자 번호)의 조직이고; B 및 C는 #51의 조직; D는 #54의 조직; E 및 F는 #52의 조직; H 및 I는 #53의 조직이다. 대표적인 MUC4 변이-음성 대조군의 비암성 조직(A, D)에서 MUC4의 염색 강도(갈색)는 MUC4 변이-양성 위암 환자 (B, E 및 H)의 비암성 조직의 부재 또는 희미한 면역 반응성과 비교하여 제시된다. B, E 및 H의 한 쌍의 암 조직 (C, F 및 I)은 MUC4의 강하고 분산된 염색을 보여준다. MUC4 변이-양성 비암성 점막에서의 MUC4 면역강도는 MUC4 변이-음성에 비해 약했다(G의 왼쪽 그래프). MUC4 변이-양성 암 조직에서의 면역 강도의 경향이 증가함에도 불구하고, 통계적 유의성은 관찰되지 않았다(G의 오른쪽 그래프). G에서 흰색 막대는 MUC4 변이-음성을 나타내고 검은색 막대는 MUC4 변이-양성을 나타낸다.
도 4는 본 발명의 일 측면에 따른 유전자 MUC4, MAGEC1, 및 RETSAT의 LOD p 값에 대한 QQ 플롯을 나타낸다.
이하, 본 발명을 상세하게 설명한다.
본 발명의 일 측면에서, "돌연변이(mutant)"는 해당 유전자의 뉴클레오티드 및 아미노산 서열이 염기 치환, 결실, 삽입, 증폭 및 재배열된 것을 포함하고, 뉴클레오티드 변이는 참조 서열(예를 들어, 야생형 서열)에 대한 뉴클레오티드 서열의 변화(예를 들어, 1개 이상의 뉴클레오티드의 삽입, 결실, 역위 또는 치환, 예컨대 단일 뉴클레오티드다형성 (SNP))를 지칭한다. 상기 용어는 또한 달리 나타내지 않는다면, 뉴클레오티드 서열의 보체에서의 상응하는 변화도 포함한다. 뉴클레오티드 변이는 체세포 돌연변이 또는 배선 다형성일 수 있으며, 본 명세서에서 돌연변이는 변이(variant)와 상호 교환되어 사용될 수 있다.
또한, 본 발명의 일 측면에서, 아미노산 변이는 참조 서열(예를 들어, 야생형 서열)에 비해 아미노산 서열의 변화 (예를 들어, 1개 이상의 아미노산의 삽입, 치환 또는 결실, 예컨대 내부 결실 또는 N- 또는 C-말단의 말단절단(truncation))를 지칭한다.
또한, 본 발명의 일 측면에서, "위암 예측"이란 피험자에 대하여 위암이 발병할 가능성이 있는지, 위암이 발병할 가능성이 상대적으로 높은지, 위암의 원인인자가 무엇인지, 또는 위암이 이미 발병하였는지 여부를 예측 또는 진단하는 것을 의미할 수 있다. 또한, 본 발명의 일 측면에서, "위암 진단"이란 피험자에 대하여 병리 상태의 존재 또는 특징을 확인하는 것을 의미하며, 본 발명의 일 측면에 따른 목적상, 진단은 위암의 발병 여부를 확인하는 것을 의미할 수 있다. 본 발명의 일 측면에 따른 조성물, 키트 또는 방법은 임의의 특정 환자에 대한 위암 발병 위험도가 높은 환자로써 특별하고 적절한 관리를 통하여 발병 시기를 늦추거나 발병하지 않도록 하는데 사용할 수 있다. 또한, 본 발명의 일 측면에 따른 조성물, 키트 또는 방법은 위암을 조기에 진단하여 가장 적절한 치료방식을 선택함으로써 치료를 결정하기 위해 임상적으로 사용될 수 있다.
일 측면에서, 본 발명은 뮤신 4 (mucin 4, MUC4) 유전자의 돌연변이 검출 제제를 포함하고, 상기 돌연변이는 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이인, 위암 예측 또는 진단용 조성물을 제공한다.
본 발명의 일 측면에 따른 MUC4 유전자의 돌연변이는 비암성 위 점막(noncancerous gastric mucosa)에서 MUC4 유전자의 발현을 억제하는 것일 수 있다.
또한, 본 발명의 일 측면에 따른 일 측면에 따른 MUC4 유전자의 돌연변이는 정상 위 조직에 비하여 위암 조직에서 MUC4 유전자의 발현을 증가시키는 것일 수 있다.
본 발명의 일 실시예에 따르면, MUC4-염색된 세포는 비-암성 위 점막에서 감소하는 경향을 보였으며, 이는 MUC4 돌연변이를 가진 피험자의 정상 위 점막은 정상 MUC4 유전자를 가진 피험자에 비하여 MUC4 발현이 감소됨을 의미하고, MUC4 변이를 가진 피험자는 MUC4의 발현이 감소된 것을 나타내는데, 이를 통해 MUC4 변이가 정상 위 점막에서 MUC4 발현을 억제하여 유해한 효과를 유발함을 알 수 있다. 또한, 상기와 같은 경향은 MUC4의 c.5375G>A:p.R1792H 돌연변이를 가진 가족 구성원에서 가장 두드러졌으며(도 1의 가족 No. 14), 정상 조직에 비하여 암 조직에서 MUC4 발현이 증가하였는바, 이를 통해 암 조직에서의 MUC4의 과도한 발현은 MUC4 유전자가 종양 유전자(oncogene)로서 이중적인 역할을 함을 알 수 있었다(실시예 4 및 도 3).
본 발명의 일 측면에 따른 MUC4 유전자의 돌연변이는 생식세포계열(germline)에서의 돌연변이일 수 있고, 구체적으로 MUC4 유전자의 엑손 영역에서의 돌연변이일 수 있으며, 보다 구체적으로 MUC4 유전자의 엑손 2 및 엑손 24로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이일 수 있다.
본 발명의 일 측면에 따른 MUC4 유전자의 rs547775645 영역에서의 돌연변이는 미스센스(missense) 돌연변이일 수 있다.
본 발명의 일 측면에 따른 MUC4 유전자의 돌연변이는 NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G>C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C>T, NM_018406.7:c.6640G>T 및 NM_018406.7:c.3053G>C로 이루어진 군으로부터 선택된 하나 이상의 돌연변이일 수 있다.
본 발명의 일 측면에서, 정상 대조군 피험자에 비하여 위암 피험자에서 MUC4유전자 돌연변이가 특이적으로 검출됨을 규명하고, 이에 기초하여, MUC4 유전자 돌연변이를 위암 예측 또는 진단을 위한 바이오마커로 제공함을 특징으로 한다.
본 발명의 일 측면에 따른 검출 제제는 샘플 내에서 위암의 예측 또는 진단 마커인 MUC4 유전자의 돌연변이의 존재를 검출하기 위하여 사용될 수 있는 물질을 의미할 수 있다. 상기 돌연변이에 특이적으로 결합하는 안티센스 올리고뉴클레오티드, 프라이머 쌍, 프로브, 항체, 펩타이드 및 폴리뉴클레오티드로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명의 일 측면에 따른 조성물은 피험자의 샘플에 적용되는 것일 수 있고, 상기 샘플은 본 발명의 일 측면에 따른 바이오마커의 발현이 검출될 수 있는 개체로부터 얻어지는 모든 시료를 의미하며, 구체적으로, 상기 샘플은 타액(saliva), 생검(biopsy), 혈액, 피부 조직, 액체 배양물, 분변 및 소변으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않고, 본 발명의 기술분야에서 통상적으로 사용되는 방법으로 처리하여 준비될 수 있다.
본 발명의 일 측면에 따른 검출 제제는 상기 돌연변이에 특이적으로 결합하는 안티센스 올리고뉴클레오티드, 프라이머 쌍, 프로브 및 폴리뉴클레오티드로 이루어진 군으로부터 선택된 하나 이상일 수 있다. 즉, 핵산의 검출은 유전자를 암호화하는 핵산 분자 또는 상기 핵산 분자의 상보물에 혼성화되는 하나 이상의 올리고뉴클레오타이드 프라이머를 사용하는 증폭반응에 의해 수행될 수 있다. 예컨대, 프라이머를 이용한 핵산의 검출은 PCR과 같은 증폭 방법을 사용하여 유전자 서열을 증폭한 다음 당 분야에 공지된 방법으로 유전자의 증폭 여부를 확인함으로써 수행될 수 있다.
본 발명의 일 측면에서 "프라이머(primer)"란 유전자의 표적 부위에 해당하는 특정 영역을 PCR을 이용하여 증폭하기 위하여 사용하는 유전자 특정 영역의 말단에 상보적으로 결합할 수 있는 서열의 염기를 갖는 폴리뉴클레오티드 또는 그 변이체를 의미한다. 상기 프라이머는 특정 영역 말단과 완전히 상보적일 것을 요구하지 않으며, 상기 말단에 혼성화되어 이중사슬 구조를 형성할 정도로 상보적이라면 사용될 수 있다.
본 발명의 일 측면에서 "프로브(probe)"란 유전자의 표적 부위와 상보적으로 결합할 수 있는 서열의 염기를 갖는 폴리뉴클레오티드, 그 변이체, 또는 폴리뉴클레오티드와 이에 결합된 표지 물질을 포함하는 것을 의미한다.
본 발명의 일 측면에서 "혼성화(hybridization)"란 2개의 단일 가닥 핵산이 상보적인 염기 서열들의 페어링(pairing)에 의하여 이합체 구조(duplex structure)를 형성하는 것을 의미한다.
혼성화는 단일 가닥 핵산 서열 간의 상보성이 완전할 경우(perfect match) 뿐 아니라 일부 미스매치(mismatch) 염기가 존재하여도 일어날 수 있다.
본 발명의 일 측면에 따른 검출 제제는 상기 돌연변이의 아미노산 부위에 특이적으로 결합하는 항체 및 펩타이드로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명의 일 측면에 따른 MUC4 돌연변이는 p.Arg1792His, p.Ser1669Gly, p.Ala2553Val, p.Thr3727Ser, p.Thr5295Met, p.Ala3558Val, p.Leu2022Phe, p.Pro2550Thr, p.Ser2213Asn, p.Pro2214Thr 및 p.Ser1018Cys로 이루어진 군으로부터 선택된 하나 이상의 아미노산 변이일 수 있으며, 본 발명의 일 측면에 따른 검출 제제는 상기 돌연변이의 상기 아미노산 변이를 검출할 수 있는 제제일 수 있다.
본 발명의 일 측면에서, 상기 항체는 다클론 항체, 단클론 항체, 재조합 항체 및 이들의 조합으로 이루어진 군으로부터 선택된 하나 이상일 수 있다. 구체적으로, 상기 항체는 다클론 항체, 단클론 항체, 재조합 항체 및 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 및 항체 분자의 기능적인 단편, 예를 들어, Fab, F(ab'), F(ab')2 및 Fv를 모두 포함하는 것일 수 있다. 항체 생산은 본 발명이 속하는 분야에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있고, 제조되어 상업적으로 판매되는 항체를 이용할 수 있다.
본 발명의 일 측면에 따른 조성물은 상시 MUC4 유전자 돌연변이의 존재 또는 발현 여부를 측정하는 제제뿐만 아니라, 항원-항체 복합체의 형성을 정량 또는 정성적으로 측정 가능하게 하는 라벨, 면역학적 분석에 사용되는 통상적인 도구, 시약 등을 더 포함할 수 있다.
본 발명의 일 측면에서 상기 항원-항체 복합체의 형성을 정성 또는 정량적으로 측정 가능하게 하는 라벨에는 효소, 형광물, 리간드, 발광물, 미소입자(microparticle), 산화환원 분자 및 방사선 동위원소 등이 있으며, 반드시 이로 제한되는 것은 아니다. 검출 라벨로 이용 가능한 효소에는 β글루쿠로니다제, β글루코시다제, β갈락토시다제, 우레아제, 퍼옥시다아제, 알칼라인포스파타아제, 아세틸콜린에스테라제, 글루코즈옥시다제, 헥소키나제와 GDPase, RNase, 글루코즈옥시다제와루시페라제, 포스포프럭토키나제, 포스포에놀피루베이트카복실라제, 아스파르테이트아미노트랜스페라제, 포스페놀피루베이트데카복실라제, β라타마제 등이 있으며 이로 제한되지 않는다. 형광물에는 플루오레신, 이소티오시아네이트, 로다민, 피코에리테린, 피코시아닌, 알로피코시아닌, o-프탈데히드, 플루오레스카민 등이 있으며 이로 제한되지 않는다. 리간드에는바이오틴 유도체 등이 있으며 이로 제한되지 않는다. 발광물에는 아크리디늄에스테르, 루시페린, 루시퍼라아제 등이 있으며 이로 제한되지 않는다. 미소입자에는 콜로이드 금, 착색된 라텍스 등이 있으며 이로 제한되지 않는다. 산화환원 분자에는 페로센, 루테늄착화합물, 바이올로젠, 퀴논, Ti 이온, Cs 이온, 디이미드, 1,4-벤조퀴논, 하이드로퀴논, K4 W(CN)8, [Os(bpy)3]2+, [RU(bpy)3]2+, [MO(CN)8]4- 등이 있으며 이로 제한되지 않는다. 방사선동위원소에는 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, 186Re 등이 있으며 이로 제한되지 않는다.
본 발명의 일 측면에서 상기 도구 또는 시약의 일 예로, 적합한 담체, 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.
본 발명의 일 측면에 따른 위암은 미만형(diffuse-type) 위암, 장형(intestinal-type) 위암 및 혼합형(mixed-type) 위암으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 위암이라면 그 유형은 제한되지 않는다. 종래 가족력과 관련이 있는 위암에 대한 바이오마커는 미만형 위암 또는 HDGC(유전성 미만형 위암, hereditary diffuse gastric cancer)에 국한되어 있었지만, 본 발명의 일 측면에 따른 조성물은 위암의 유형에 관계없이 MUC4 유전자 돌연변이 유무에 따라 위암을 예측 또는 진단할 수 있어, 보다 폭넓은 유형의 위암을 예측 또는 진단할 수 있는 우수한 효과가 있다.
본 발명 일 측면에 따른 조성물은 위 선암종(stomach adenocarcinoma, STAD), 대장암(colorectal cancer, CRC) 및 자궁내막암(uterine corpus endometrial cancer, UCEC)으로 이루어진 군으로부터 선택된 하나 이상의 암에 걸린 피험자에서 위암을 예측 또는 진단하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 측면에 따른 피험자는 위암 가족력이 있는 피험자일 수 있거나 없는 피험자일 수 있고, 상기 위암 가족력이 있다는 것은 3 세대 이내에 현재 위암에 걸렸거나 과거에 위암에 걸렸던 가족 구성원이 2인 이상 있는 것을 의미할 수 있다.
다른 측면에서, 본 발명의 일 측면은 상기 뮤신 4 (mucin 4, MUC4) 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물을 포함하는 위암 예측 또는 진단용 키트를 제공한다. 상기 MUC4 유전자, MUC4 유전자의 돌연변이, 검출 제제, 위암, 피험자, 샘플 등에 대한 설명은 상술한 바와 같다.
본 발명의 일 측면에 따른 키트는 설명서를 추가로 포함할 수 있다.
본 발명의 일 측면에 따른 상기 설명서에는 상기 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서 돌연변이가 존재하면 위암으로 예측 또는 진단하는 것이 기재될 수 있다.
본 발명의 일 측면에 따른 키트는 위암 가족력이 있거나 없는 피험자에게 적용되는 것일 수 있고, 상기 위암 가족력이 있다는 것은 3 세대 이내에 현재 위암에 걸렸거나 과거에 위암에 걸렸던 가족 구성원이 2인 이상 있는 것을 의미할 수 있다.
본 발명의 일 측면에 따른 키트는 암에 걸린 피험자에게 적용되는 것일 수 있고, 구체적으로 위 선암종(stomach adenocarcinoma, STAD), 대장암(colorectal cancer, CRC) 및 자궁내막암(uterine corpus endometrial cancer, UCEC)으로 이루어진 군으로부터 선택된 하나 이상의 암에 걸린 피험자에게 적용되는 것일 수 있다.
또 다른 측면에서, 본 발명은 피험자의 샘플로부터 게놈 DNA를 추출하는 단계; 상기 추출된 게놈 DNA에 뮤신 4 (mucin 4, MUC4) 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이를 검출하는 단계;를 포함하는, 위암 예측 또는 진단을 위한 정보제공방법을 제공한다. 상기 MUC4 유전자, MUC4 유전자의 돌연변이, 검출 제제, 위암 등에 대한 설명은 상술한 바와 같다.
본 발명의 일 측면에 따른 상기 돌연변이 검출 단계는 상기 MUC4 유전자의 상기 영역에서의 p.Arg1792His, p.Ser1669Gly, p.Ala2553Val, p.Thr3727Ser, p.Thr5295Met, p.Ala3558Val, p.Leu2022Phe, p.Pro2550Thr, p.Ser2213Asn, p.Pro2214Thr 및 p.Ser1018Cys로 이루어진 군으로부터 선택된 하나 이상의 아미노산 변이를 검출하는 단계를 포함할 수 있으며, 본 발명의 일 측면에 따른 상기 돌연변이의 상기 아미노산 변이를 검출할 수 있는 검출 제제를 이용하여 아미노산 변이를 검출하는 단계일 수 있다.
본 발명의 일 측면에 따른 상기 돌연변이 검출 단계는 상기 MUC4 유전자의 NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G>C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C>T, NM_018406.7:c.6640G>T 및 NM_018406.7:c.3053G>C로 이루어진 군으로부터 선택된 하나 이상의 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열에 특이적인 프라이머를 반응시키는 단계; 및 상기 반응물을 증폭시키는 단계;를 포함할 수 있다.
본 발명의 일 측면에 따른 상기 돌연변이 검출 단계는 당업계에 널리 공지되어 있는 기술을 이용하여 표적 분자 클로닝 및 서열 분석에 의해 수행될 수 있다. 예컨대, DNA 서열분석; 대립유전자-특이적 뉴클레오티드 혼입 검정 및 대립유전자-특이적 프라이머 연장 검정 (예를 들어, 대립유전자-특이적 PCR, 대립유전자-특이적 라이게이션 연쇄 반응 (LCR) 및 갭-LCR)을 비롯한 프라이머 연장 검정; 대립유전자-특이적 올리고뉴클레오티드 혼성화 검정 (예를 들어, 올리고뉴클레오티드라이게이션 검정); 절단제로부터의 보호를 이용하여 핵산 이중나선 내의 미스매치된 염기를 검출하는 절단 보호 검정; MutS단백질 결합 분석; 변이체 및 야생형 핵산 분자의 이동성을 비교하는 전기영동 분석; 변성-구배 겔 전기영동(DGGE, 예를 들어 문헌 [Myers et al. (1985) Nature 313:495]에서와 같음); 미스매치된 염기 쌍에서의 RNase절단의 분석; 헤테로 이중나선 DNA의 화학적 또는 효소적 절단의 분석; 질량 분광측정법 (예를 들어, MALDITOF); 유전적 비트 분석 (GBA); 5' 뉴클레아제 검정 (예를 들어, 택맨(TaqMan); 및 분자 비콘을 사용하는 검정으로 이루어진 군으로부터 선택된 어느 하나 이상의 기술을 이용한 돌연변이 검출 단계를 포함할 수 있으나, 이에 제한되지 않는다.
본 발명의 일 측면에 따른 상기 MUC4 유전자의 돌연변이는 NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G>C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C>T, NM_018406.7:c.6640G>T 및 NM_018406.7:c.3053G>C로 이루어진 군으로부터 선택된 하나 이상의 돌연변이일 수 있다.
본 발명의 일 측면에 따른 정보제공방법은 상기 MUC4 유전자의 돌연변이 검출 단계 후, 상기 MUC4 유전자의 돌연변이가 검출되면 위암인 것으로 예측하거나 진단하는 것일 수 있다.
본 발명의 일 측면에 따른 정보제공방법은 미만형(diffuse-type) 위암, 장형(intestinal-type) 위암 및 혼합형(mixed-type) 위암으로 이루어진 군으로부터 선택된 하나 이상의 위암 예측 또는 진단을 위한 정보제공방법일 수 있으나, 위암이라면 그 유형은 제한되지 않는다. 종래 가족력과 관련이 있는 위암에 대한 바이오마커는 미만형 위암 또는 HDGC(유전성 미만형 위암, hereditary diffuse gastric cancer)에 국한되어 있었지만, 본 발명의 일 측면에 따른 정보제공방법은 위암의 유형에 관계없이 MUC4 유전자 돌연변이 유무에 따라 위암을 예측 또는 진단할 수 있는 정보를 제공할 수 있어, 보다 폭넓은 유형의 위암을 예측 또는 진단할 수 있는 우수한 효과가 있다.
본 발명의 일 측면에 따른 피험자는 위암 가족력이 있거나 없는 피험자일 수 있고, 상기 위암 가족력이 있다는 것은 3 세대 이내에 현재 위암에 걸렸거나 과거에 위암에 걸렸던 가족 구성원이 2인 이상 있는 것을 의미할 수 있다.
본 발명의 일 측면에 따른 피험자는 암에 걸린 피험자일 수 있고, 구체적으로 위 선암종(stomach adenocarcinoma, STAD), 대장암(colorectal cancer, CRC) 및 자궁내막암(uterine corpus endometrial cancer, UCEC)으로 이루어진 군으로부터 선택된 하나 이상의 암에 걸린 피험자일 수 있다.
이하, 실시예를 들어 본 발명의 구성 및 효과를 보다 구체적으로 설명한다. 그러나 아래 실시예는 본 발명에 대한 이해를 돕기 위해 예시의 목적으로만 제공된 것일 뿐 본 발명의 범주 및 범위가 그에 의해 제한되는 것은 아니다.
[실시예 1] 피험자의 특징
신규한 위암-감수성 유전자를 식별하기 위해, 2 이상의 위암 케이스(case)가 3 세대 이내에 발생한 14가구의 가족의 19명의 위암 환자와 36명의 위암에 걸리지 않은 직계 가족들에서 전체-엑솜 시퀀싱 (whole-exome sequencing, WES)을 수행하였다. 이를 위한 피험자 등록 방법 및 등록된 피험자들의 특징은 다음과 같다.
엑솜 시퀀싱을 위한 환자 등록
2017년 4월부터 2018년 3월까지 분당서울대학교병원의 가족 중 3세대 이내에 위암 진단을 받은 자가 2명 이상이 있는 위암 환자와 이의 직계 가족(first-degree relatives, FDRs)을 본 발명의 일 실시예에 따른 연구에 등록하였다. 비-위암 대조군(이하, 대조군)은 지난 6개월 이내에 정상적인 내시경 검사를 받은 50세 초과의 자로 정의되었다. 위암 진단을 위해, 내시경 생검(endoscopic biopsy) 또는 외과적 샘플(surgical specimen)에 의한 병리학적 진단을 기반으로 하였다.
위암의 가족력, 흡연, 음주, 식이 선호(dietary preference), 사회경제적 상태, 위장 증상 및 이전의 헬리코박터 파일로리 제균 이력은 설문지를 통해 얻었다. 김자 염색(Giemsa staining) 및 항-헬리코박터 파일로리 테스트에 의한 조직학적 평가는 헬리코박터 파일로리 감염 상태를 확인하기 위해 수행되었다[Choi YJ, Kim N, Jang W, Seo B, Oh S, Shin CM, et al. Familial Clustering of Gastric Cancer: A Retrospective Study Based on the Number of First-Degree Relatives. Medicine (Baltimore). 2016; 95(20): e3606. Epub 2016/05/20. https://doi.org/10.1097/MD.0000000000003606 PMID: 27196462; PubMed Central PMCID: PMC4902404.][Kim N, Cho SI, Yim JY, Kim JM, Lee DH, Park JH, et al. The effects of genetic polymorphisms of IL-1 and TNF-A on Helicobacter pylori-induced gastroduodenal diseases in Korea. Helicobacter. 2006; 11(2):105-12. Epub 2006/04/04. https://doi.org/10.1111/j.1523-5378.2006.00384.x PMID: 16579840].
피험자와 관련된 모든 절차는 기관 및 국가 연구위원회의 윤리 기준과 1964년 헬싱키 선언에 따라 수행되었다. 본 연구는 분당서울대학교병원 임상 시험 심사위원회의 승인을 받았다(B-1610-366-303). 본 연구에 참여한 모든 가족 구성원은 구체적인 사전 동의서에 서명하였다.
피험자의 특징
총 피험자는 14가구의 독립적인 가족으로부터 55명의 피험자(19명의 위암 환자 및 36명의 비-위암 친척)가 포함되었다. 14가구의 가족 중 가계도가 도 1에 나타나 있다. 국제 위암 연계 컨소시엄 2010(International Gastric Cancer Linkage Consortium 2010) 임상 기준에 부합하는 3가구의 HDGC(유전성 미만형 위암, hereditary diffuse gastric cancer) 가족 (No. 7, 8 및 13)이 포함되었다 [Fitzgerald RC, Hardwick R, Huntsman D, Carneiro F, Guilford P, Blair V, et al. Hereditary diffuse gastric cancer: updated consensus guidelines for clinical management and directions for future research. J Med Genet. 2010; 47(7):436-44. Epub 2010/07/02. https://doi.org/10.1136/jmg.2009.074237 PMID: 20591882; PubMed Central PMCID: PMC2991043]. 피험자의 임상 특징을 하기 표 1에 나타냈다(표 1).
[표 1]
위암 환자 및 비-위암 피험자의 임상 및 인구통계학적 특징
상기 표 1에 나타난 바와 같이 위암 진단을 받은 환자의 평균 연령은 59.0 세(범위: 31-84 세)인 반면, 위암에 걸리지 않은 친척들의 평균 연령은 62세였다. 다른 군보다 위암 군에 남성의 비율이 더 높은 경향이 있었다(위암 군 63.2% vs. 비-위암 군 33.3%, p = 0.034). 흡연 비율이 비-위암 군의 피험자에 비해 위암 환자에서 더 높았다 (위암 군 63.2% vs. 비-위암 군 27.8%, p = 0.011). 위암 환자의 약 절반은 H. pylori-양성이었고, 암에 걸리지 않은 친척들의 75.0%는 H. pylori-양성으로 이러한 비율에서 유의한 차이가 없었다. Lauren 분류에 따르면 등록된 위암 환자 중에서 3 명은 미만형, 13 명의 장형, 및 나머지는 혼합형으로 식별되었다. 오래 전에 위 수술이나 조직학적으로 환자를 치료한 병원에 나머지 환자들의 특정 조직학적 유형에 대한 정보를 요청했지만 이들의 유형을 식별할 수 없었다.
[실시예 2] 위암 관련 바이오마커 발굴을 위한 피험자의 게놈 분석
상기 실시예 1의 피험자들을 대상으로 위암 예측 또는 진단을 위한 바이오마커 발굴을 위하여 하기와 같은 방법으로 피험자의 게놈을 분석하였다.
DNA 분리 및 전체-엑솜 시퀀싱 (whole-exome sequencing, WES)
먼저, 제조사의 지시서에 따라 Qiagen DNeasy 혈액 및 조직 키트 (Qiagen, Hilden, Germany)를 사용하여 상기 실시예 1의 피험자들의 게놈 DNA를 분리하였다. WES를 수행하기 위해, 시약과 함께 Agilent SureSelect All Exon V6(Agilent Technologies, Santa Clara, CA)을 시퀀싱 라이브러리 및 캡처와 함께 사용하였다. 시퀀싱은 Illumina HiSeq 2500 플랫폼 (2x100 bp-paired end; Illumina, Inc., San Diego, CA)에서 수행되었다. 상기 실시예 1의 55명의 등록자들의 서열 데이터 세트는 유럽 Nucleotide Archive (http://www.ebi.ac.uk/ena/data/view)에 수탁번호 PRJEB29071로 기탁되었다.
변이 검출 및 주석(annotation)
원시 시퀀싱 판독은 Burrows-Wheeler Aligner(BWA v0.7.15) 소프트웨어를 사용하여 Human Genome Reference Assembly GRCh37/hg19에 정렬되었다[Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009; 25(14):1754-60. Epub 2009/05/20. https://doi.org/10.1093/bioinformatics/btp324 PMID: 19451168; PubMed Central PMCID: PMC2705234]. SAM tools v1.3을 사용하여 BWA 정렬 파일(BWA alignment files)을 BAM files로 변환하였으며 복사본은 Picard (https://sourceforge.net/projects/picard, v1.96)로 표시되었다. 최상의 케이스(best case)에 따라 Genome Analysis Toolkit (GATK v3.5)을 사용하여 피험자 각각의 각 샘플에 대해 게놈 Variant Call Format(genomic Variant Call Format, gVCF) 모드에서 국소 재배치(local realignment), 염기 정확도 재보정(base quality recalibration), 및 단상형(haplotype) 호출(calling)을 수행하였다[DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011; 43(5):491-8. Epub 2011/04/12. https://doi.org/10.1038/ng.806 PMID: 21478889; PubMed Central PMCID: PMC3083463]. 게놈 VCF(gVCF) 파일을 조합하고 GATK와 공동 유전자형을 만들었다. 유전자 변이의 기능적 주석은 집단 빈도로 ANNOVAR을 사용하여 수행하였다. MUC4 유전자의 엑손 24(Exon 24) 상에서의 변이는 생거 시퀀싱(Sanger sequencing)에 의해 확인되었고 모든 변이 판독은 Integrative Genomes Viewer로 검사되었다[Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011; 29(1):24-6. Epub 2011/01/12. https://doi.org/10.1038/nbt.1754 PMID: 21221095; PubMed Central PMCID: PMC3346182].
연계(linkage) 및 연관(association) 분석
질병 감수성 유전자의 유전자좌(loci)는 상 염색체 우성 유전 모델 및 질병의 최대허용 가능한 유병율인 0.005 하에서 Pedigree Variant Annotation, Analysis, 및 Search Tool (pVAAST)과의 연계 분석 및 유전자-기반 연관성 테스트를 사용하여 확인되었다[Hu H, Roach JC, Coon H, Guthery SL, Voelkerding KV, Margraf RL, et al. A unified test of linkage analysis and rare-variant association for analysis of pedigree sequence data. Nat Biotechnol. 2014; 32(7):663-9. Epub 2014/05/20. https://doi.org/10.1038/nbt.2895 PMID: 24837662; PubMed Central PMCID: PMC4157619]. 기능적 예측에 의해 가중된 케이스와 대조군의 대립 유전자 수에 기초한 이항 우도(linomial likelihood)에 대한 LOD (logarithm of odds) 점수 및 유전자-기초 부담-유형(burden-type) 복합 우도 비 테스트(composite likelihood ratio test, CLRT)의 p 값은 유전자-드롭 방법(gene-drop method)을 사용하여 106개의 치환된 샘플로부터 계산되었다. 연계 분석에서, 각각의 가족 구조를 고려하여 본 발명자는 19명의 위암 환자에서의 변이를, 14가구의 가족 모두에서 위암이 발병하지 않은 36명의 대조군과 비교하였다. 유전자 기반의 연관성 시험에서, 본 발명자는 19명의 위암 환자의 전체 엑솜의 대립 유전자 수를 한국 국립 보건원(National Institute of Korea)의 한국 국립 바이오뱅크에서 얻은 397개의 한국 대조군의 전체 게놈의 대립 유전자 수와 비교하였다. 총 19,491 종의 유전자를 분석하였고, Bonferroni-조정된 0.05 수준은 2.57Х10-6이었다. MUC4의 경우, 106개의 치환된 샘플에서 CLRT 점수의 p 값이 1.0Х10-6였기 때문에, 108개의 치환된 샘플이 사용되었다.
대립 유전자 빈도 결정
gnomAD 데이터베이스 (http://gnomad.broadinstitute.org/)를 사용하여 전체 및 동아시아 대조군 집단의 특정 변이의 빈도를 확인하였다.
TCGA(The Cancer Genome Atlas) 데이터 분석
TCGA 데이터는 게놈 데이터 공통 레거시(GRCh37/hg19) 아카이브 및 게놈 데이터 공통 데이터 포털(https://portal.gdc.cancer.gov)의 시스템 생물학 암 게놈 클라우드 협회(Institute for Systems Biology Cancer Genomics Cloud)로부터 다운로드하였다. 유전자형 및 표현형의 데이터베이스로부터(dbGaP) 서열 정보를 수득하였다.
효과 크기 분석
Bonferroni-조정된 0.05 유의 수준에서 모든 유의한 유전자에 대한 교차비(odds ratio, OR)는 로지스틱 회귀로 추정되었다. 가족 관계는 GMMAT로 추정되었으며[Chen H, Wang C, Conomos MP, Stilp AM, Li Z, Sofer T, et al. Control for Population Structure and Relatedness for Binary Traits in Genetic Association Studies via Logistic Mixed Models. Am J Hum Genet. 2016; 98(4):653-66. Epub 2016/03/29. https://doi.org/10.1016/j.ajhg.2016.02.012 PMID:27018471; PubMed Central PMCID: PMC4833218], 가족 관계를 설명하는 랜덤 효과의 분산은 0으로 추정되었다. 따라서, 가족 구성원 간의 위암 상태는 독립적인 것으로 가정되었고, 표준 로지스틱 회귀 분석은 Rex Version 2.1 (http://rexsoft.org)을 사용하여 적용되었다. 각 유전자에 대해, 상응하는 유전자에서 하나 이상의 희귀 대립 유전자가 관찰되면 유전자 위험 점수(genetic risk scores)는 1로 코딩되고, 그렇지 않으면 0으로 코딩되었다. 성별, 연령, 흡연 상태 및 HDGC가 공변량으로 포함되어 효과를 조정하였다.
위암과 관련된 생식세포계열(germline) 엑손 변이 발견
상기 유전자 분석으로부터 수득한 WES 데이터는 표적 엑솜 영역에서 평균 깊이(mean depth)가 96배인 55명의 피험자로부터 생성된 것이다. 모든 표적 영역의 평균 97%가 최소 20배가 되었다. 위암에 대한 희귀 변이 후보를 탐색하기 위해, 연관성 시험과 결합된 연계 분석을 수행하였다. LOD p 값에 기초하여, 위암과 관련된 추정 유전자로 MUC4, MAGEC1, 및 RETSAT을 확인하였으며, 이를 도 2a 내지 도 2c에 나타내었다. 연계 정보, 케이스-대조군 연관성 및 기능적 변이 예측을 통합한 유전자-기반 CLRT 분석에서, MUC4는 게놈-전체 유의성 수준에 달했다(p 값 ≤ 9.9Х10-9, 및 게놈 전체 Bonferroni-조정된 0.05 유의 수준 = 2.6Х10-6)(도 2a). 도 2b 및 도 2c는 각각 본 연계 분석에 대한 Manhattan 및 quantile-quantile (QQ) 플롯을 보여주며, 본 통계분석이 명목상의 유의 수준을 유지함을 보여준다. 도 4는 3 종의 다른 유전자 크기 그룹의 LOD p 값에 대한 QQ 플롯을 보여주며, 상기 분석이 유전자 크기에 영향을 받지 않음을 확인하였다.
MUC4 변이
상기 pVAAST를 사용하여 전체 데이터세트를 분석하였으며, MUC4의 14 종의 변이가 LOD 점수에 기여하는 것으로 나타났으며, 이들 중 10 종은 LOD 값이 0 초과인 것으로 최종 선택되었다. MUC4의 10 종의 변이는 14 가구의 독립적인 가족들 중에서 확인되었다 (표 2).
[표 2]
연구된 14가구의 가족에서 연계 분석에 의해 도출한 위암과 관련된 생식세포계열 MUC4 변이의 특징
상기 표 2에 나타난 바와 같이, MUC4 변이를 보유한 피험자는 케이스 #16, #37 및 #39를 제외하고 모두 위암 환자이다. MUC4 변이를 가진 위암 환자들은 #23를 제외하고 대부분 장형 위암이다 (도 1). 위암에 걸리지 않은 3명의 피험자 (#16, #37 및 #39)는 모두 여성이고 비흡연자였다. 2 종의 변이인 c.7658C>T p.A2553V 및 c.5005A>G p.S1669G가 관련 없는 3가구의 가족에서 확인되었다. 피험자 #15, #16, #19, #34 및 #51은 각각 2 종의 다른 변이를 가졌다. 동아시아 출신 집단의 변이 식별율은 대부분 전체 집단에서 관찰된 것보다 높았다 (표 2).
한편, 상기 실시예 1의 피험자 중에서 MUC1 rs4072037 A 대립 유전자의 빈도는 90.9%로 1,124 명의 중국인 위암 환자와 비슷한 반면 [Qiu LX, Hua RX, Cheng L, He J, Wang MY, Zhou F, et al. Genetic variant rs4072037 of MUC1 and gastric cancer risk in an Eastern Chinese population. Oncotarget. 2016; 7(13):15930-6. Epub 2016/02/26. https://doi.org/10.18632/oncotarget.7527 PMID: 26910281; PubMed Central PMCID: PMC4941287], A 및 G 대립 유전자의 빈도는 각각 아메리카 집단에서 57.9% 및 42.1%, 아프리카 집단에서 49.2% 및 50.8%였다 [Reis CA, David L, Seixas M, Burchell J, Sobrinho-Simoes M. Expression of fully and under-glycosylated forms of MUC1 mucin in gastric carcinoma. Int J Cancer. 1998; 79(4):402-10. Epub 1998/08/12. https://doi.org/10.1002/(sici)1097-0215(19980821)79:4<402::aid-ijc16>3.0.co;2-6 PMID: 9699534]. 이러한 결과는 동아시아 집단이 MUC1 변이를 통해 유전적으로 취약할 수 있음을 나타낸다. 상기 분석 결과로부터 확인된 MUC4 변이의 대부분의 빈도는 서양 출신을 포함하는 전세계적인 집단에 비하여 동아시아 집단에서 유전적으로 더 높았다 (표 2). 또한, TCGA에서 동아시아 위암 환자에서 MUC4의 1종의 변이 (rs774527434)가 확인되었다. 전반적으로, 본 발명에서 추정된 MUC4 변이는 MUC1 변이와 평행한 위암 발병률의 지리적 차이에 기여할 수 있다.
또한, 위암은 이종 병인(heterogeneous etiology)을 가지기 때문에, 위암 가족에서 개개인은 유전적 감수성 및 임상적 표현 사이에 불일치를 보일 수 있다. 상기 게놈 분석 결과에서, MUC4 변이가 없는 5명의 위암 환자는 4 가구의 독립된 가족들 사이에서 확인되었다: #20, #28, #43, #45, 및 #46 (도 1). HDGC 기준을 충족한 미만형 위암 환자 #28은 CDH1에서 신규한 미스센스 돌연변이를 가졌다 (NM_001317184: exon8:c.G1057A:p.E353K). 비록 가족 #46이 HDGC 기준을 충족하였어도, CDH1 또는 CTNNA1에서 돌연변이는 발견되지 않았다 [Majewski IJ, Kluijt I, Cats A, Scerri TS, de Jong D, Kluin RJ, et al. An alpha-E-catenin (CTNNA1) mutation in hereditary diffuse gastric cancer. J Pathol. 2013; 229(4):621-9. Epub 2012/12/05. https://doi.org/10.1002/path.4152 PMID: 23208944][ Hansford S, Kaurah P, Li-Chang H, Woo M, Senz J, Pinheiro H, et al. Hereditary Diffuse Gastric Cancer Syndrome: CDH1 Mutations and Beyond. JAMA Oncol. 2015; 1(1):23-32. Epub 2015/07/17. https://doi.org/10.1001/jamaoncol.2014.168 PMID: 26182300]. 환자 #43 및 #45는 신장 세포암 환자가 2명인 동일한 가족에 속했으며, 이는 다른 유전적 증후군의 가능성을 시사한다. 특히, MUC4 변이와 위암 발병은 한국인의 HDGC이 아니고 위암 대부분이 장형인 경우 강한 연관성을 가질 수 있음을 알 수 있었다.
위암 발병에서 MUC4 변이의 효과 크기
표준 로지스틱 회귀 분석은 성별, 흡연 및 HDGC를 조정하여 55명의 모든 피험자에게 적용되었으며, 그 결과는 하기 표 3과 같다.
[표 3]
이항 로지스틱 회귀 분석에 의한 위암에 대한 독립적 위험 요소의 교차비(odds ratios)
상기 표 3에 나타난 바와 같이, 임의의 MUC4 변이를 가지는 것은 위암 위험도 증가와 관련 있음을 알 수 있었다.
[실시예 3] 큰 코호트에서의
MUC4
와 위암의 연관성 검증
상기 실시예 2로부터 상기 실시예 1의 피험자들을 대상으로 한 게놈 분석 결과 MUC4 변이가 있는 피험자의 경우 위암 위험도가 증가함을 확인하였는바, 상기 MUC4 변이와 위암의 연관성을 보다 큰 크기의 코호트에서 하기와 같은 방법으로 검증하였다.
MUC4에 위치한 변이의 게놈 전체 연관성
분당서울대학교병원 및 서울대학교 병원 헬스케어 시스템 강남 센터에서 조직학적으로 확인된 위암 환자 597명과 비-위암 환자(대조군) 9,758명으로부터 혈액 샘플을 수집하였다. 상기 샘플들은 827,783개의 변이들로 구성된 Affymetrix Axiom Korean Chip에 의해 유전자형이 지정되었다.
이 때, 하기에 해당하는 피험자는 제외되었다: 1) 게놈에 의해 추정된 성별이 임상 정보와 다른 경우, 2) 피험자의 호출 속도(call rates)가 97% 미만인 경우, 3) 이형접합 비율이 평균에서 표준 편차의 3배인 경우, 4) 다른 피험자와의 IBD(identity-by-descent) 추정치가 0.185 초과이고 이의 짝 피험자에 비하여 결측률(missing rate)이 더 높은 경우.
또한, 하기의 변이는 제외되었다: 1) 결측률(missing rate)가 3% 초과이거나 위암 환자와 대조군간에 유의미하게 다른 경우 (p < 1Х10-5), 2) 마이너 대립유전자 빈도(minor allele frequency)가 5% 미만인 경우, 3) Anderson et al. 등에서 제안된대로, 하디-바인베르크 평형 정밀 시험에서의 p 값이 0.001 미만인 경우[Anderson CA, Pettersson FH, Clarke GM, Cardon LR, Morris AP, Zondervan KT. Data quality control in genetic case-control association studies. Nat Protoc. 2010; 5(9):1564-73. Epub 2010/11/19. https://doi.org/10.1038/nprot.2010.116 PMID: 21085122; PubMed Central PMCID: PMC3025522].
그런 다음, Michigan Imputation Server를 사용하여 유형이 지정되지 않은 변이를 대치하였다(impute)[Das S, Forer L, Schonherr S, Sidore C, Locke AE, Kwong A, et al. Next-generation genotype imputation service and methods. Nat Genet. 2016; 48(10):1284-7. Epub 2016/08/30. https://doi.org/10.1038/ng. 3656 PMID: 27571263; PubMed Central PMCID: PMC5157836]. 대치(imputation) 후, MUC4에 위치한 4,224 개의 변이 및 이의 0.5 MB 인접 영역(flanking region)을 샘플 관계 매트릭스의 성별, 나이, 및 상위 10 가지의 주요 요소의 영향을 조정하여 로지스틱 회귀(logistic regression)를 사용하여 분석하였다. Bonferroni-조정된 0.05 유의 수준은 1.18Х10-5이었으며, PLINK(v1.90b4.5) 및 R (v3.5.2)이 되어 과정에서 사용되었다[Chang CC, Chow CC, Tellier LC, Vattikuti S, Purcell SM, Lee JJ. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 2015; 4:7. Epub 2015/02/28. https://doi.org/10.1186/s13742-015-0047-8 PMID: 25722852; PubMed Central PMCID: PMC4342193].
큰 케이스 대조군 코호트에서
MUC4
와 위암의 연관성 검증
유전성 및 산발성 위암은 위암에 대한 유전적 배경을 공유할 수 있다고 가정하면서, SNP 어레이로 유전자형화된 상기의 597명의 위암 환자 및 9,759명의 건강한 대조군으로 구성된 큰 코호트에서 MUC4의 변이가 위암과 관련이 있는지를 추가로 분석하였다. 0.5 MB의 플랭킹 영역을 포함하는 MUC4 영역 (chr3: 195,473,637-195,539,149)의 공통 SNP를 분석하였고, Bonferroni-조정된 0.05 유의 수준은 1.18Х10-5였다. MUC4 병변에서 2 종의 공통 변이(rs148735556 및 rs11717039)를 검출하였고(표 4), 이는 MUC4와 위암의 연관성을 시사하였다.
[표 4]
0.5MB 플랭킹 영역을 포함하는 MUC4 영역 (chr3: 194,473,637-195,539,149)
MUC4의 엑손 2 및 엑손 24 영역에서, 25 개의 SNP가 있었고, 엑손 2에서 rs547775645 미스센스 변이가 0.05/25 = 2Х10-3 유의 수준에서 유의한 것으로 확인되었다(표 5).
[표 5]
MUC4 영역 (엑손 2 및 엑손 24)
MUC4에서 상기 언급된 10 종의 희귀 변이의 대치 품질(imputation quality)은 불량하여(INFO < 0.5), SNP 칩 분석에서 시험될 수 없었다. 그러나, 위암의 가족 응집(familial aggregation)에 대한 소인으로서 MUC4 미스센스 변이를 확인하였으며, 위암과 유의한 연관성을 갖는 MUC4에서 공통 변이가 존재함을 확인하였다.
즉, 위암의 큰 케이스 대조군 코호트에서 위암과 유의하게 연관된 MUC4 영역의 공통 변이를 발견하였는바, 이를 통해 MUC4와 위암이 연관성이 있음을 알 수 있었다.
다양한 암 유형의 환자에서
MUC4
생식세포계열(germline) 변이의 빈도
MUC4는 위뿐만 아니라 결장, 식도, 소장, 자궁 및 폐와 같은 다른 조직에서도 발현되고, 폐, 유방, 췌장, 및 위의 암종을 포함하는 다양한 유형의 암종에서 비정상 MUC4 발현이 보고되었기 때문에[Chaturvedi P, Singh AP, Batra SK. Structure, evolution, and biology of the MUC4 mucin. FASEB J. 2008; 22(4):966-81. Epub 2007/11/21. https://doi.org/10.1096/fj.07-9673rev PMID: 18024835; PubMed Central PMCID: PMC2835492], 다양한 암 유형의 환자의 생식세포계열(germline) 샘플에서 MUC4 변이의 대립 유전자 빈도를 조사하였으며, 생식세포계열 MUC4 변이를 가진 환자가 다양한 유형의 암이 발생할 위험이 더 높음을 확인하였다. 또한, 상기 실시예 2의 TCGA 데이터의 혈액으로부터 얻은 생식세포계열 변이를 사용하여 MUC4 유전자의 10 종의 희귀 변이가 암과 관련 있는지 여부를 테스트하였으며, 위암 및 4 종의 암 유형이 MUC4의 3 종의 희귀 변이와 관련이 있음을 확인하였다 (표 6).
[표 6]
TCGA로부터 다양한 암 유형에서의 3 종의 SNP의 빈도
상기 표 2에 나타난 가족성 위암과 연관된 MUC4 유전자의 10 종의 관련 변이 중에서, 295개의 위 선암종(stomach adenocarcinoma) 생식세포계열 샘플 중 한 명의 환자에서(0.17%) 이형접합 rs774527434 SNP가 확인되었고 (표 6), 이는 일반적인 집단에서보다 약 4 배 더 높은 것이다 (0.04%, 표 2). 2종의 변이인 rs534779185 및 rs77250903는 372명의 대장암(CRC) 환자에서 확인되었고, 빈도는 각각 4.0% 및 0.13%인데, 이는 일반적인 집단에서보다 더 높은 것이다 (각각 0.26% 및 0.06%, 표 2). 1종의 변이인 rs534779185는 0.56%의 빈도로 265개의 자궁내막암(uterine corpus endometrial cancer) 샘플에서 발견되었다. 408명의 폐 편평상피세포암(lung squamous cell cancer) 환자와 495명의 폐 선암종(lung adenocarcinoma) 환자에서는 MUC4 유전자의 10 종의 변이가 확인되지 않았다. 이를 통해 MUC4 변이가 위장관 또는 비뇨 생식관 암과 관련될 수 있음을 알 수 있었다.
[실시예 4] 면역조직화학(immunohistochemistry, IHC) 분석을 통한 위 조직에서의 기능적 효과 확인
상기 실시예 2 및 3을 통해 MUC4 변이가 있는 피험자의 경우 위암 위험도가 증가함을 확인하였는바, MUC4 변이가 실제 위 조직에서 어떠한 기능적 효과가 있는지를 확인하기 위해, 면역조직화학(IHC) 분석을 하기와 같이 수행하였다.
비암성 위 점막 및 위암 조직의 면역조직화학 분석
내시경 생검에 동의한 15 명의 위암 환자 및 8 명의 비-위암 환자로부터 IHC를 사용하여 유문부(antral) 비암성 점막을 평가하였다. 위암 환자의 경우, 암 조직도 염색하였다. IHC에 MUC4 검출용 항체 (클론: 8G7) (1:100 희석, Zeta Corporation, Arcadia, CA, USA)를 사용하였다. 상기 IHC에 사용한 항체는 MUC4α 영역을 검출하는 것이다. 항체의 특이성은 이전 연구에 의해 입증되었다. 섹션의 전체 염색 (두께 4μm)은 BenchMark XT Staining 시스템 및 ultraVIEW Universal DAB Detection Kit (Ventana Medical Systems, Inc., Tucson, AZ, USA)를 통해 수행되었다. MUC4 발현은 과학 현미경을 사용하여 면적에 따른 강도의 곱(%)을 통해 하기와 같이 평가되고, 여기서 염색은 하기와 같이 상피선(epithelial glands) 에서 관찰된다(0 내지 300): 염색 미관찰이면 0; 희미하거나/간신히 지각 가능한 부분적 염색이면 1+; 약하거나 중간 정도의 염색이면 2+; 강한 염색이면 3+. 암 조직에서는, 강하게 염색된 면적을 점수화하였다. 각 샘플은 단일 병리학자(이혜승)에 의해 맹검 방식으로 채점되었다.
MUC4
변이를 가진 피험자의 위 조직에서 MUC4 발현
확인된 변이의 기능적 효과를 조사하기 위해 수행한 상기 위 점막에서의 MUC4 발현의 IHC 분석 결과는 다음과 같다.
먼저, MUC4 변이(rs774527434)와 완전한 공집합을 보이고 가장 많은 수의 위암 환자를 포함하는 가족 No. 14의 5명의 피험자의 대표적인 면역화학적 결과를 도 3에 나타냈다. MUC4 변이-음성인 비암성 위점막(#50, #54)(도 3A 및 도 3D)은 높은 강도를 나타낸 반면, MUC4 변이를 갖는 3명의 환자(#51, #52 및 #53)의 MUC4 변이-양성 비암성 점막의 IHC 결과는 약하거나 음성이었다(도 3B, 도 3E 및 도 3H). 대조적으로, 3명의 위암 환자(#51, #52 및 #53)의 암 조직은 높은 IHC 점수를 보여주었다(도 3C, 도 3F 및 도 3I).
일반적으로, MUC4 변이를 가진 비암성 점막은 야생형을 가진 비암성 점막보다 MUC4-양성 염색 점수가 더 낮은 것을 보여준다 (도 3G; 중앙값 [사분위수 범위]: 0 [10.0-30.0] vs. 70 [9.5-165.0], p = 0.023). 암 조직에서는, 야생형과 비교하여 MUC4 변이가 있는 조직에서 IHC 염색이 더 두드러지는 경향이 있다 (도 3G; 중앙값 [사분위수 범위]: (75.0 (0-240.0) vs. 30 (0-105.0), p = 0.287).
상기 IHC 분석 결과에 따르면, MUC4-염색된 세포는 비-암성 위 점막에서 감소하는 경향을 보였으며, 이는 MUC4 변이를 가진 피험자의 정상 위 점막은 야생형을 가진 피험자에 비하여 MUC4 발현이 감소됨을 의미한다. MUC4는 구조적으로 MUC1과 유사하고 MUC4 변이를 가진 피험자는 MUC4의 발현이 감소된 것을 나타내는바, MUC4 변이가 정상 위 점막에서 MUC4 발현을 억제하여 유해한 효과를 유발함을 알 수 있으며, 이러한 경향은 MUC4의 c.5375G>A:p.R1792H 돌연변이를 가진 가족 구성원에서 가장 두드러졌다(Family No. 14). 또한, 정상 조직에 비하여 암 조직에서 MUC4 발현이 증가하였는바, 이를 통해 암 조직에서의 MUC4의 과도한 발현은 MUC4 유전자가 종양 유전자(oncogene)로서 이중적인 역할을 함을 확인하였다.
[실시예 5] MUC4 단백질 구조 예측
상기 실시예 2 내지 4를 통해 MUC4 변이가 위암을 예측 또는 진단하기 위한 바이오마커임을 확인하였는바, MUC4 단백질의 구조를 예측하기 위해 하기와 같이 컴퓨터 분석을 수행하였다.
MUC4 구조 컴퓨터 분석
MUC4 구조 분석을 위해 NCBI 참조 서열 데이터베이스로부터 얻은, 단백질 서열(refSeqID:NP_001191215) 및 mRNA 서열 (refSeqID:NM_018406.6)을 사용하여 모티프 검색, 및 펩티드 절단(cleavage), 글리코실화(glycosylation), 및 단백질 구조의 예측을 수행하였다[O'Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016; 44(D1):D733-45. Epub 2015/11/11. https://doi.org/10.1093/nar/gkv1189 PMID:26553804; PubMed Central PMCID: PMC4702849]. GenomeNet(https://www.genome.jp)의 MotifFinder 툴을 이용하여 모티프 검색을 수행하였다. 단백질 참조 서열(NP_001191215) 및 변이 서열의 MUC4α 영역에서 PeptideCutter [Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, et al. Protein identification and analysis tools in the ExPASy server. Methods Mol Biol. 1999; 112:531-52. Epub 1999/02/23. https://doi.org/10.1385/1-59259-584-7:531 PMID: 10027275]를 수행하여 펩티드 절단 예측을 수행하였다. NetOGlyc [Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester-Christensen MB, Schjoldager KT, et al. Precision mapping of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J. 2013; 32(10):1478-88. Epub 2013/04/16. https://doi.org/10.1038/emboj.2013.79 PMID: 23584533; PubMed Central PMCID: PMC3655468] 및 NetNGlyc (http://www.cbs.dtu.dk/services/NetNGlyc/)을 사용하여 각각 O-GalNAc (N-아세틸갈라토사민)(N-acetylgalactosamine) 및 N-GalNAc 변형의 위치를 예측하였다. MODELLER [Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen MY, et al. Comparative protein structure modeling using Modeller. Curr Protoc Bioinformatics. 2006;Chapter 5:Unit-5 6. Epub 2008/04/23. https://doi.org/10.1002/0471250953.bi0506s15 PMID: 18428767; PubMed Central PMCID: PMC4186674][ Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, et al. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018; 46(W1):W296-W303. Epub 2018/05/23. https://doi.org/10.1093/nar/gky427 PMID: 29788355; PubMed Central PMCID: PMC6030848] 및 SWISS-MODEL의 상동성 모델링을 사용하여 단백질 구조 예측을 수행하고자 하였다.
단백질 구조 예측 결과
상기 실시예 2 내지 4에서 확인된 10 종의 MUC4 변이 중 9 종은 엑손 2에 위치하고, 이는 탠덤 반복 영역(tandem repeat region)을 포함하며[Chaturvedi P, Singh AP, Batra SK. Structure, evolution, and biology of the MUC4 mucin. FASEB J. 2008; 22(4):966-81. Epub 2007/11/21. https://doi.org/10.1096/fj.07-9673rev PMID: 18024835;PubMed Central PMCID: PMC2835492], 다른 변이는 엑손 24에 존재했다. 다만, 상동성 모델링 또는 제1 (ab initio) 구조적 모델링은 확립된 MUC1 또는 MUC4 모델, 및 O-글리코실화-풍부 부위의 코일 구조의 부재로 인해 성공적이지 않았다.
글리코실화 예측에 따르면 [Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester-Christensen MB, Schjoldager KT, et al. Precision mapping of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J. 2013; 32(10):1478-88. Epub 2013/04/16. https://doi.org/10.1038/emboj.2013.79 PMID: 23584533; PubMed Central PMCID: PMC3655468][ Gupta R, Brunak S. Prediction of glycosylation across the human proteome and the correlation to protein function. Pac Symp Biocomput. 2002:310-22. Epub 2002/04/04. PMID: 11928486], 엑손 2의 대부분의 MUC4 변이는 O-글리코실화 부위이거나 이와 물리적으로 가까이에 있다 (표 7).
[표 7]
NetOGlyc 및 NetNGlyc을 이용한 글리코실화 부위 예측
특히, p.T3727S, p.S1669G 및 p.S2213N는 O-GalNAc 변형이 있을 가능성이 더 높았다 [Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester-Christensen MB, Schjoldager KT, et al. Precision mapping of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J. 2013; 32(10):1478-88. Epub 2013/04/16. https://doi.org/10.1038/emboj.2013.79 PMID: 23584533; PubMed Central PMCID: PMC3655468]. 이러한 추정된 절단 부위의 G에서 A로의 단일 코돈의 변화(c.5375G>A:p.R1792H)는 단백질 분해 활성을 잠재적으로 억제할 수 있다. C에서 T로의 단일 코돈 변화(c.15884C>T)는 MUC4 ß서브유닛의 제2 및 제3 표피성장인자(epidermal growth factor (EGF))-유사 도메인 사이의 잠재적 N-글리코실화 부위의 트레오닌 합성을 방해하였다.
즉, MUC4 구조에서 글리코실화의 인실리코(in silico) 예측으로부터 얻은 정보는 MUC4 변이에 의해 코딩화된 대부분 영역은 O-글리코실화 부위일 가능성이 있음을 나타낸다. 글리칸 마이크로-이종성(glycan micro-heterogeneity)을 갖는 O-글리코실화는 뮤신 구조 및 기능에 중요하다. 뮤신형 글리칸은 특정 리간드-수용체 상호작용에 관여하고 흡습성을 부여할 수 있고 다양한 소분자와 단백질에 결합하여, 최종적으로 단백질 구조를 안정화시킬 수 있다 [Jayaprakash NG, Surolia A. Role of glycosylation in nucleating protein folding and stability. Biochem J. 2017; 474(14):2333-47. Epub 2017/07/05. https://doi.org/10.1042/BCJ20170111 PMID: 28673927]. MUC4α 서브유닛에 수백 개의 O-글리코실화 부위가 존재하지만, 하나의 특정 부위에서의 하나의 아미노산 차이는 코딩된 변이 단백질의 기능을 변화시킬 수 있다 [van der Post S, Thomsson KA, Hansson GC. Multiple enzyme approach for the characterization of glycan modifications on the C-terminus of the intestinal MUC2mucin. J Proteome Res. 2014; 13(12):6013-23. Epub 2014/11/19. https://doi.org/10.1021/pr500874f PMID: 25406038; PubMed Central PMCID:PMC4261943]. 상기와 같은 O-글리코실화 부위 주변의 아미노산 위치 선호 [Thanka Christlet TH, Veluraja K. Database analysis of O-glycosylation sites in proteins. Biophys J. 2001; 80(2):952-60. Epub 2001/02/13. https://doi.org/10.1016/s0006-3495(01)76074-2 PMID: 11159462; PubMed Central PMCID: PMC1301293] 및 세린 또는 트레오닌에서의 변화에 기초하여[Chaturvedi P, Singh AP, Batra SK. Structure, evolution, and biology of the MUC4 mucin. FASEB J. 2008; 22(4):966-81. Epub 2007/11/21. https://doi.org/10.1096/fj.07-9673rev PMID: 18024835; PubMed Central PMCID: PMC2835492] MUC4의 글리코실화가 변경되었을 수 있다.
한편, 종래의 연구는 MUC4가 위암의 발병기 동안 ErbB2 종양 단백질을 활성화시킬 수 있음을 제안하였다 [Yokoyama A, Shi BH, Kawai T, Konishi H, Andoh R, Tachikawa H, et al. Muc4 is required for activation of ErbB2 in signet ring carcinoma cell lines. Biochem Biophys Res Commun. 2007; 355(1):200-3. Epub 2007/02/13. https://doi.org/10.1016/j.bbrc.2007.01.133 PMID: 17292332] [Senapati S, Chaturvedi P, Sharma P, Venkatraman G, Meza JL, El-Rifai W, et al. Deregulation of MUC4 in gastric adenocarcinoma: potential pathobiological implication in poorly differentiated non-signet ring cell type gastric cancer. Br J Cancer. 2008; 99(6):949-56. Epub 2008/09/11. https://doi.org/10.1038/sj.bjc.6604632 PMID: 18781152; PubMed Central PMCID: PMC253875247, 48]. 또한, 변이가 EGF-유사 도메인들 사이에서 N-글리코실화 부위의 아미노산 변화를 유발하기 때문에, 엑손 24에서의 변이, p.Thr5295Met는 ErbB2 신호 전달에 관여할 수 있다.
분석 결과를 종합하면, MUC4의 추정적 제3 EGF-유사 도메인의 구조적 모델은 F5300 내지 L5362의 잔기에 걸쳐져 있으며, 이는 변이 잔기인 T5295M에 매우 가깝다. 이 부위는 모델링된 EGF-유사 도메인로부터 오직 5 개의 잔기만큼 떨어져 있기 때문에, 이 변이가 EGF-유사 도메인의 기능에 영향을 끼칠 수 있는 것으로 보인다.
[실시예 6]
MUC4
변이와 위암의 연관성 검증
상기 실시예 2 내지 4로부터 MUC4 변이가 있는 피험자의 경우 위암 위험도가 증가함을 확인하였는바, 상기 MUC4 변이와 위암의 연관성을 하기와 같은 방법으로 지노타이핑(genotyping) 및 면역조직화학(IHC) 분석 결과로 재검증하였다.
먼저, 분당서울대병원의 환자 중 총 288명을 선별하고, 이 중 위 전정부(antrum)과 위암 조직의 면역조직화학(IHC) 분석이 완료된 237명의 피험자(위암 환자는 103명, 비-위암 환자(대조군)은 134명)를 선별하였다. 상기 선별된 237명의 피험자의 위 전정부(antrum)와 위암 환자인 경우에는 혈액 및 위암 조직을 수득하고, 이로부터 genomic DNA를 분리 및 추출하였다(Qiagen DNeasy blood and tissue kit(Qiagen, Hilden, Germany).
상기 추출된 DNA를 이용하여 MUC4 rs774527434 및 rs531395109의 2종의 SNP에 대하여 지노타이핑을 진행하였다. 그 결과 MUC4 유전자의 돌연변이가 있는 피험자는 총 14명으로, 이 중 비-위암 환자는 5명, 위암 환자는 9이었다.
참고로, 지노타이핑에 사용한 프라이머와 리포터 서열은 다음과 같다.
MUC4 rs774527434 SNP 측정
- forward primer: CTTTCTTCAGCTTCCACAGATGAC (서열번호 1)
- reverse primer: TGGATGCCGAGGAAACGT (서열번호 2)
- reporter 1: ACCACCCGTCTTCCT (서열번호 3)
- reporter 2: ACCACCCATCTTCCT (서열번호 4)
MUC4 rs531395109 SNP 측정
- forward primer: GCCATCGCATCTGAAGTAAGC (서열번호 5)
- reverse primer: GGTTGCTTTCTGTGTTAATCTGTGT (서열번호 6)
- reporter 1: TTCAGCGTGCTCACG (서열번호 7)
- reporter 2: CTTCAGCATGCTCACG (서열번호 8)
PCR 반응액은 TaqMan쪠 Genotyping Master Mix (Cat No. 4371353) 12.5 μl, Genotyping Assay Mix (forward primer, reverse primer, reporter 1, reporter 2) 1.25 μl, DNase-free water 10.25 μl로 만들었다. 여기에 genomic DNA 1 μl (10-50ng) 씩 첨가하여 총 25 μl로 만들고 10분간 95℃에서 holding한 후 92℃에서 15초간 denature, 60℃에서 1분간 anneal/extend을 50회 cycling하여 ViiA 7 Real-Time PCR System (Applied Biosystems, USA)을 사용하여 Real-time PCR 반응을 실시하여 지노타이핑을 수행하였다.
한편, 면역조직화학 분석은 실시예 4에서와 같이 수행되었다.
즉, 섹션의 전체 염색 (두께 4μm)은 BenchMark XT Staining 시스템 및 ultraVIEW Universal DAB Detection Kit (Ventana Medical Systems, Inc., Tucson, AZ, USA)를 통해 수행되었다. MUC1 및 MUC4 발현은 과학 현미경을 사용하여 면적에 따른 강도의 곱(%)을 통해 하기와 같이 평가되고, 여기서 염색은 하기와 같이 상피선(epithelial glands) 에서 관찰된다(0 내지 300): 염색 미관찰이면 0; 희미하거나/간신히 지각 가능한 부분적 염색이면 1+; 약하거나 중간 정도의 염색이면 2+; 강한 염색이면 3+. 암 조직에서는, 강하게 염색된 면적을 점수화하였다. 각 샘플은 단일 병리학자에 의해 맹검 방식으로 채점되었다.
면역조직화학 분석에 따른 MUC4의 상기 돌연변이가 있는 경우의 발현량 결과는 하기 표 8과 같다.
| 대조군의 위 전정부 (n=5) |
위암 환자의 위 전정부 (n=9) |
위암 환자의 암 조직 (n=9) |
P값 | |
| MUC4 발현량 | 54.80 ± 53.51 | 26.11 ± 51.95 | 76.11 ± 59.99 | 0.187 |
상기 표 8에 나타난 바와 같이, MUC4 돌연변이가 있는 피험자는 위암 환자의 경우 위 전정부에서 MUC4 발현이 감소하고, 위암 조직에서 MUC4 발현이 상승하는 경향을 보임을 확인하였다.
이를 통해, 비용 및 시간적 측면에서 보다 효율적이고 간단하게 유전자 분석을 수행할 수 있는 지노타이핑을 이용하여서도 MUC4 돌연변이가 있는 경우 위암을 예측 또는 진단할 수 있음을 알 수 있었다.
종합적으로, 본 발명의 일 실시예에 따르면, 정상 대조군과 달리 위암 환자의 경우 MUC4 유전자의 특정한 13 영역(rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645) 중 하나에 돌연변이가 존재하고, 특히 MUC4 생식세포계열(germline) 미스센스 돌연변이(rs547775645 미스센스 돌연변이)를 갖는 피험자는 비암성 위 점막(noncancerous gastric mucosa)에서 발현이 억제되어(downregulated) MUC4의 기능 상실에 의해 위암을 유발하고, 정상 조직에 비해 암 조직에서의 MUC4의 발현이 증가하였는바, 이를 통해, MUC4 유전자 돌연변이 검출 제제를 이용하면 위암을 예측 또는 진단할 수 있음을 알 수 있었다.
Claims (17)
- 뮤신 4 (mucin 4, MUC4) 유전자의 돌연변이 검출 제제를 포함하고,상기 돌연변이는 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이인, 피험자에서의 위암 예측 또는 진단용 조성물.
- 제1항에 있어서,상기 피험자는 위암 가족력이 있는 피험자인, 위암 예측 또는 진단용 조성물.
- 제1항에 있어서,상기 돌연변이는 비암성 위 점막(noncancerous gastric mucosa)에서 MUC4 유전자의 발현을 억제하는, 조성물.
- 제1항에 있어서,상기 돌연변이는 정상 위 조직에 비하여 위암 조직에서 MUC4 유전자의 발현을 증가시키는, 조성물.
- 제1항에 있어서,상기 rs547775645 영역에서의 돌연변이는 미스센스(missense) 돌연변이인, 조성물.
- 제1항에 있어서,상기 돌연변이는 NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G>C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C>T, NM_018406.7:c.6640G>T 및 NM_018406.7:c.3053G>C로 이루어진 군으로부터 선택된 하나 이상의 돌연변이인, 조성물.
- 제1항에 있어서,상기 검출 제제는 상기 돌연변이에 특이적으로 결합하는 안티센스 올리고뉴클레오티드, 프라이머 쌍, 프로브, 항체, 펩타이드 및 폴리뉴클레오티드로 이루어진 군으로부터 선택된 하나 이상인, 조성물.
- 제1항에 있어서,상기 위암은 미만형(diffuse-type) 위암, 장형(intestinal-type) 위암 및 혼합형(mixed-type) 위암으로 이루어진 군으로부터 선택된 하나 이상인, 조성물.
- 제1항에 있어서,상기 조성물은 위 선암종(stomach adenocarcinoma, STAD), 대장암(colorectal cancer, CRC) 및 자궁내막암(uterine corpus endometrial cancer, UCEC)으로 이루어진 군으로부터 선택된 하나 이상의 암에 걸린 피험자에서 위암을 예측 또는 진단하는, 조성물.
- 제1항 내지 제9항 중 어느 한 항의 조성물을 포함하는, 위암 예측 또는 진단용 키트.
- 제10항에 있어서,상기 키트는 설명서를 추가로 포함하고,상기 설명서에는 검출된 상기 MUC4 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서 돌연변이가 존재하면 위암으로 예측 또는 진단하는 것이 기재된, 키트.
- 제10항에 있어서,상기 키트는 위 선암종(stomach adenocarcinoma, STAD), 대장암(colorectal cancer, CRC) 및 자궁내막암(uterine corpus endometrial cancer, UCEC)으로 이루어진 군으로부터 선택된 하나 이상의 암에 걸린 피험자에게 적용되는 것인, 키트.
- 피험자의 샘플로부터 게놈 DNA를 추출하는 단계;상기 추출된 게놈 DNA에 뮤신 4 (mucin 4, MUC4) 유전자의 rs774527434, rs534579185, rs77250903, rs868067409, rs531395109, rs754808151, rs1304612772, rs774907241, rs771925912, rs745342765, rs148735556, rs11717039 및 rs547775645로 이루어진 군으로부터 선택된 하나 이상의 영역에서의 돌연변이를 검출하는 단계;를 포함하는, 위암 예측 또는 진단을 위한 정보제공방법.
- 제13항에 있어서,상기 피험자는 위암 가족력이 있는 피험자인, 위암 예측 또는 진단을 위한 정보제공방법.
- 제13항에 있어서,상기 돌연변이 검출 단계는 상기 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열에 특이적인 프라이머를 반응시키는 단계; 및상기 반응물을 증폭시키는 단계;를 포함하는, 정보제공방법.
- 제13항에 있어서,상기 돌연변이는 NM_018406.7:c.5375C>T, NM_018406.7:c.5005T>C, NM_018406.7:c.7658G>A, NM_018406.7:c.11180G>C, NM_018406.7:c.15884G>A, NM_018406.7:c.10673G>A, NM_018406.7:c.6064G>A, NM_018406.7:c.7648G>T, NM_018406.7:c.6638C>T, NM_018406.7:c.6640G>T 및 NM_018406.7:c.3053G>C로 이루어진 군으로부터 선택된 하나 이상의 돌연변이인, 정보제공방법.
- 제13항에 있어서,상기 정보제공방법은 상기 MUC4 유전자의 돌연변이 검출 단계 후,상기 MUC4 유전자의 돌연변이가 검출되면 위암인 것으로 예측하거나 결정하는 것인, 정보제공방법.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/015,198 US20230348989A1 (en) | 2020-07-10 | 2021-07-09 | Composition comprising muc4 gene mutation detecting agent for prediction or diagnosis of gastric cancer |
| CN202180062359.XA CN116569044A (zh) | 2020-07-10 | 2021-07-09 | 用于预测或诊断胃癌的包含muc4基因突变检测制剂的组合物 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20200085614 | 2020-07-10 | ||
| KR10-2020-0085614 | 2020-07-10 | ||
| KR1020200101967A KR102281058B1 (ko) | 2020-07-10 | 2020-08-13 | Muc4 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물 |
| KR10-2020-0101967 | 2020-08-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022010312A1 true WO2022010312A1 (ko) | 2022-01-13 |
Family
ID=77155143
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2021/008803 Ceased WO2022010312A1 (ko) | 2020-07-10 | 2021-07-09 | Muc4 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물 |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20230348989A1 (ko) |
| KR (2) | KR102281058B1 (ko) |
| CN (1) | CN116569044A (ko) |
| WO (1) | WO2022010312A1 (ko) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102479605B1 (ko) * | 2022-04-28 | 2022-12-23 | 주식회사 바스젠바이오 | 위암 발병의 위험도를 예측하기 위한 조성물 및 이를 이용한 방법 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008167715A (ja) * | 2007-01-15 | 2008-07-24 | Sysmex Corp | 胃がんのリンパ節転移マーカー、プライマおよびこのマーカーを用いた胃がんのリンパ節転移判定方法。 |
| KR20110103592A (ko) * | 2010-03-15 | 2011-09-21 | 동아대학교 산학협력단 | Muc4 유전자의 다형성 소위성을 이용한 dna 타이핑 키트 및 muc4유전자 관련 질병의 진단용 키트 |
| WO2012167112A2 (en) * | 2011-06-01 | 2012-12-06 | Illumina, Inc. | Gastric cancer biomarkers |
-
2020
- 2020-08-13 KR KR1020200101967A patent/KR102281058B1/ko active Active
-
2021
- 2021-07-09 CN CN202180062359.XA patent/CN116569044A/zh active Pending
- 2021-07-09 US US18/015,198 patent/US20230348989A1/en active Pending
- 2021-07-09 WO PCT/KR2021/008803 patent/WO2022010312A1/ko not_active Ceased
- 2021-07-16 KR KR1020210093387A patent/KR102701146B1/ko active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008167715A (ja) * | 2007-01-15 | 2008-07-24 | Sysmex Corp | 胃がんのリンパ節転移マーカー、プライマおよびこのマーカーを用いた胃がんのリンパ節転移判定方法。 |
| KR20110103592A (ko) * | 2010-03-15 | 2011-09-21 | 동아대학교 산학협력단 | Muc4 유전자의 다형성 소위성을 이용한 dna 타이핑 키트 및 muc4유전자 관련 질병의 진단용 키트 |
| WO2012167112A2 (en) * | 2011-06-01 | 2012-12-06 | Illumina, Inc. | Gastric cancer biomarkers |
Non-Patent Citations (3)
| Title |
|---|
| CHOI YOON JIN, OHN JUNG HUN, KIM NAYOUNG, KIM WONJI, PARK KYUNGTAEK, WON SUNGHO, SAEL LEE, SHIN CHEOL MIN, LEE SUN MIN, LEE SEJOON: "Family-based exome sequencing combined with linkage analyses identifies rare susceptibility variants of MUC4 for gastric cancer", PLOS ONE, vol. 15, no. 7, e0236179, 23 July 2020 (2020-07-23), XP055886713, DOI: 10.1371/journal.pone.0236197 * |
| CHOI YOON JIN; KIM NAYOUNG; SHIN CHEOL MIN; LEE DONG HO: "Su1069: The Role of Rare Variants in Muc4 in Gastric Cancer Susceptibility in Gastric Cancer Family", GASTROENTEROLOGY, ELSEVIER INC., US, vol. 156, no. 6, Suppl. 1, 1 May 2019 (2019-05-01), US , XP085678143, ISSN: 0016-5085, DOI: 10.1016/S0016-5085(19)38122-3 * |
| NABATCHIAN FARIBA; RAHIMI NAIINI MAHDIS; MORADI AFSHIN; TABATABAEIAN HOSSEIN; HOGHOUGHI NEGIN; AZADEH MANSOUREH; GHAEDI KAMRAN: "miR-581-Related Single Nucleotide Polymorphism, rs2641726, Located in MUC4 Gene, is Associated with Gastric Cancer Incidence", INDIAN JOURNAL OF CLINICAL BIOCHEMISTRY, SPRINGER PRIVATE LTD., IN, vol. 34, no. 3, 10 April 2018 (2018-04-10), IN , pages 347 - 351, XP036845306, ISSN: 0970-1915, DOI: 10.1007/s12291-018-0751-0 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102701146B1 (ko) | 2024-09-02 |
| KR102281058B1 (ko) | 2021-07-23 |
| KR20220007566A (ko) | 2022-01-18 |
| CN116569044A (zh) | 2023-08-08 |
| US20230348989A1 (en) | 2023-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| He et al. | Helicobacter pylori-related host gene polymorphisms associated with susceptibility of gastric carcinogenesis: a two-stage case-control study in Chinese | |
| Ruzzo et al. | Interleukin 1B gene (IL-1B) and interleukin 1 receptor antagonist gene (IL-1RN) polymorphisms in Helicobacter pylori-negative gastric cancer of intestinal and diffuse histotype | |
| Vinall et al. | Polymorphism of human mucin genes in chest disease: possible significance of MUC2 | |
| Torres et al. | TLR4 single-nucleotide polymorphisms alter mucosal cytokine and chemokine patterns in Mexican patients with Helicobacter pylori-associated gastroduodenal diseases | |
| US20110086796A1 (en) | Methods for predicting the development and resolution of acute respiratory distress syndrome | |
| CA2702169A1 (en) | Sequence variants for inferring human pigmentation patterns | |
| Pérez‐Rodríguez et al. | Polymorphisms in HLA‐DQ genes, together with age, sex, and Helicobacter pylori infection, as potential biomarkers for the early diagnosis of gastric cancer | |
| Vilaichone et al. | Gastric mucosal cytokine levels in relation to host interleukin-1 polymorphisms and Helicobacter pylori cagA genotype | |
| JP5807894B2 (ja) | 一塩基多型に基づく前立腺癌の検査方法 | |
| WO2022010312A1 (ko) | Muc4 유전자의 돌연변이 검출 제제를 포함하는 위암 예측 또는 진단용 조성물 | |
| Choi et al. | Family-based exome sequencing combined with linkage analyses identifies rare susceptibility variants of MUC4 for gastric cancer | |
| US20150284806A1 (en) | Materials and methods for determining susceptibility or predisposition to cancer | |
| WO2011081421A9 (en) | Complement c9 as markers for the diagnosis of cancer | |
| Krona et al. | Analysis of neuroblastoma tumour progression; loss of PHOX2B on 4p13 and 17q gain are early events in neuroblastoma tumourigenesis | |
| CN109234396B (zh) | 一种乳腺癌易感基因BRCA2位点 g.32336534T>C突变体及其应用 | |
| US20130217046A1 (en) | Method for determining predisposition to esophageal-related disorders | |
| Gezdirici et al. | Hereditary breast-ovarian cancer and BRCA1/BRCA2 variants: a single center experience | |
| Viana et al. | Association between single nucleotide polymorphisms and endometriosis in a Brazilian Population | |
| Feng et al. | Inflammatory cytokine gene polymorphisms in gastric cancer cases’ and controls’ family members from Chinese areas at high cancer prevalence | |
| WO2012060636A2 (ko) | 위암 진단 방법 | |
| Guillén et al. | Identification of novel SLC3A1 gene mutations in Spanish cystinuria families and association with clinical phenotypes | |
| WO2019132581A1 (ko) | 유방암 및 난소암 등 암 진단용 조성물 및 이의 용도 | |
| EP1155146B1 (en) | Diagnostic and screening method for male infertility | |
| Jahangiri et al. | Association between single nucleotide polymorphisms of DNA repair genes (BRCA1, BRCA2, and PALB2) and breast cancer incidence in a subset of Iranian population | |
| Tahara et al. | Association of polymorphism of TLR4 and CD14 genes with gastroduodenal diseases in Japan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21836798 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202180062359.X Country of ref document: CN |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21836798 Country of ref document: EP Kind code of ref document: A1 |






