WO2022008642A1

WO2022008642A1 - Treatment of sars-cov-2 infection with a combination of targets

Info

Publication number: WO2022008642A1
Application number: PCT/EP2021/068955
Authority: WO
Inventors: Gerald WIRNSBERGER
Original assignee: Apeiron Biologics Ag
Priority date: 2020-07-08
Filing date: 2021-07-08
Publication date: 2022-01-13

Abstract

The invention provides a combination of a SARS-CoV-2 cellular entry receptor and a viral proliferation inhibitor for the treatment of a SARS-CoV-2 infection and combined pharmaceutical preparations and kit-in-parts.

Description

Treatment of SARS-CoV-2 infection with a combination of targets

The present invention relates to the field of pharmaceutical treatments of viral infections.

Background of the invention

SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) has spread rapidly with severe morbidity and death. Many treat- ment candidates are being investigated (Andersen et al., Inter- national Journal of Infectious Diseases 93 (2020): 268-276). Un- der much scrutiny, early promising candidates, chloroquine and hydroxychloroquine, were linked to increased in-hospital mortal- ity risk for patients with Covid-19.

Remdesivir, an antiviral proliferation inhibitor, in partic- ular a RNA polymerase inhibitor, acts as an adenosine analogue, incorporating into nascent viral RNA chains, leading to their premature termination (Gordon et al. J Biol Chem (2020) 295, 4773-4779) . Remdesivir was initially developed to block replica- tion of Ebola and Marburg viruses, and shows antiviral activity against coronaviruses including MERS, SARS-CoV and SARS-CoV-2. However, the efficacy of Remdesivir on viral load and mortality in COVID-19 patients is still unclear (Wang et al., Lancet (2020) 395, 1569-1578).

Angiotensin converting enzyme 2 (ACE2) is a critical recep- tor for the Spike glycoprotein of SARS-CoV-2, required to infect cells (Walls et al., Cell (2020) 181(2): 281-292; Wan et al., J

Virol (2020) doi:10.1128/JVI.00127-20; Wrapp et al., Science (2020) doi:10.1126/science.abb2507). Recently, it was reported that human recombinant soluble ACE2 (hrsACE2; APN01), can sig- nificantly block early stages of SARS-CoV-2 infections by a fac- tor of 1000-5000 (Monteil et al., Cell (2020) 181, 905-913).

HrsACE2 is a biologic that acts as a molecular decoy to block virus entry, as well as a regulator of the renin-angiotensin- system.

Still, the intense research into therapeutic candidates has not yet delivered a working therapy for SARS-CoV-2 infection. It is therefore a goal to provide a therapeutic treatment for a SARS-CoV-2 infection, in particular for Covid-19.

Summary of the Invention The present invention relates to a method of treating a SARS-CoV-2 infection in a patient comprising administering a SARS-CoV-2 cellular entry receptor and a viral proliferation in- hibitor, preferably a RNA polymerase inhibitor, to said patient. Related thereto, the invention provides SARS-CoV-2 cellular entry receptor for use in a treatment of a SARS-CoV-2 infection in combination with a viral proliferation inhibitor. Also pro- vided is a viral proliferation inhibitor for use in a treatment of a SARS-CoV-2 infection in combination with a SARS-CoV-2 cel- lular entry receptor. Also provided is a SARS-CoV-2 cellular en- try receptor and a viral proliferation inhibitor for use in the treatment of a SARS-CoV-2 infection. Also related to the treatment, the invention provides a SARS-CoV-2 cellular entry receptor for the manufacture of a me- dicament for the treatment of a SARS-CoV-2 infection in combina- tion with a viral proliferation inhibitor. Also provided is a viral proliferation inhibitor for the manufacture of a medica- ment for a treatment of a SARS-CoV-2 infection in combination with a SARS-CoV-2 cellular entry receptor. Also provided is a SARS-CoV-2 cellular entry receptor and a viral proliferation in- hibitor for the manufacture of a medicament for the treatment of a SARS-CoV-2 infection. The invention also provides a kit or kit-in-parts comprising containers with an ACE2 polypeptide and with remdesivir or a prodrug of remdesivir or an ester of remdesivir. Further provided is a pharmaceutical preparation comprising an ACE polypeptide and remdesivir or a prodrug of remdesivir or an ester of remdesivir. The kit and the pharmaceutical preparation may be used for the inventive method, i.e. the ACE2 polypeptide as SARS-CoV-2 cellular entry receptor and remdesivir as viral proliferation inhibitor or be adapted for a use in such methods. All detailed descriptions of the invention relate to all these embodiments equally. E.g. descriptions of the method can relate to properties or components of the kit or preparation suitable for the method. All descriptions of kits and prepara- tions can relate to compounds used in the method. Brief description of the Figure Figure 1. Combined effects of blocking entry and replication of SARS-CoV-2 infections: (a) Remdesivir and (b) rsACE2 inhibition of SARS-CoV-2 infections of Vero E6 cells. Both drugs, and as a control murine recombinant soluble ACE2, were added to the cul- ture at the indicated concentrations. Viral RNA level was deter- mined by qRT-PCR 15 hours after inoculation of SARS-CoV-2 (Swe- dish isolate, 10⁶ PFU). (c) Treatment of SARS-CoV-2 (10⁶ PFU) in- fected Vero-E6 cells with hrsACE2 (200µg/ml) and Remdesivir (4µM). Viral RNA level was determined at 15 hours after virus inoculation. (d) Treatment of SARS-CoV-2 (10⁶ PFU) infected human kidney organoids with (200µg/ml) and/or Remdesivir (4µM). Viral RNA was determined by qRT-PCR 72 hours after the inoculation to 10⁶ PFU of SARS-CoV-2. (e) Treatment of SARS-CoV-2 (10⁶ PFU) in- fected Vero-E6 cells with clinical doses of hrsACE2 (5 and 10µg/ml) and Remdesivir (4µM). *: p<0.05; **: p<0.01; ****: p<0.0001; One-way ANOVA followed by student t-test between in- ternal groups. Detailed description of the invention The present invention is based on the combination of two different modalities of anti-viral activity, namely blocking the intracellular virus life cycle by targeting viral proliferation and targeting SARS-CoV-2 entry into cells by competitive inhibi- tion, e.g. by using an ACE2 polypeptide, which shows synergic benefits. The invention provides a method of treating a SARS-CoV-2 in- fection in a patient comprising administering a SARS-CoV-2 cel- lular entry receptor and a viral proliferation inhibitor to said patient. Further provided is/are a SARS-CoV-2 cellular entry re- ceptor and/or a viral proliferation inhibitor for use in the treatment of a SARS-CoV-2 infection; and a SARS-CoV-2 cellular entry receptor and/or a viral proliferation inhibitor for the manufacture of a medicament for the treatment of a SARS-CoV-2 infection. The entire description on methods of treatment also read on the uses of the SARS-CoV-2 cellular entry receptor and the viral proliferation inhibitor. SARS-CoV-2 cellular entry receptor is a molecule, usually a protein, the surface of cells that enables SARS-CoV-2 to bind the cell surface and enter the cell. Binding is either directly to the SARS-CoV-2 cellular entry receptor or mediated by the SARS-CoV-2 cellular entry receptor. Examples are ACE2 and TMPRSS2 (Hoffmann et al., Cell (2020) 181(2): 271-280.e8). On the virus side, the protein modulating binding is the Spike gly- coprotein of SARS-CoV-2. Accordingly, the SARS-CoV-2 cellular entry receptor is preferably a receptor, in particular a binding partner, of Spike glycoprotein of SARS-CoV-2. Like other corona- viruses, SARS-CoV-2 has four structural proteins, known as the S (spike), E (envelope), M (membrane), and N (nucleocapsid) pro- teins. The spike protein is the protein responsible for allowing the SARS-CoV-2 virus to attach to the membrane of a host cell, the receptor binding domain (“RBD”) of the spike protein of SARS-CoV-2 recognizes and e.g. attaches to the angiotensin- converting enzyme 2 (“ACE2”) of host cells to use them as a mechanism of cell entry. As such, ACE2 is a receptor for the Spike glycoprotein of SARS-CoV-2. The SARS-CoV-2 cellular entry receptor, in particular soluble versions thereof, can be admin- istered to a patient for competitive binding of SARS-CoV-2. In preferred embodiments, the SARS-CoV-2 cellular entry re- ceptor is an ACE2 polypeptide. ACE2 is a key metalloprotease of the Renin Angiotensin System (RAS), primarily existing as a mem- brane anchored zinc metalloprotease (WO 2004/000367). ACE2 is expressed in the vascular system as well as in most organs, but predominantly in the lungs, kidneys, liver, heart, intestine and testis. In a normal adult human lung, ACE2 is expressed primari- ly in alveolar epithelial type II cells, which can serve as a viral reservoir. These cells produce surfactant which reduces surface tension, thus preventing alveoli from collapsing, and hence are critical to the gas exchange function of the lung. Many variants of ACE2 have been generated for therapeutic uses, including recombinant soluble ACE2 and shorter fragments suitable for glomerular filtration (WO 2008/151347, US 10,443,049 B2). In particular the C-terminus is suitable for large deletions while still maintaining activity of the enzyme. The ACE2 polypeptide of the invention preferably still main- tains the amino acids responsible for binding of Spike glycopro- tein of SARS-CoV-2 as was investigated in several references (Walls et al., Cell (2020) 181(2): 281-292; Wan et al., J Virol (2020) doi:10.1128/JVI.00127-20; Wrapp et al., Science (2020) doi:10.1126/science.abb2507), so that it can act as molecular decoy to block virus entry. The amino acid sequence of human recombinant ACE2 amino ac- ids 1 to 740 is provided in SEQ ID NO: 1. SEQ ID NO: 2 provides the full-length amino acid sequence of human ACE2 with 805 amino acids in length. The full-length amino acid sequence is also provided in database UniProtKB, database entry Q9BYF1 as of 17 June 2020 (human ACE2). Amino acids 1-17 are the signal se- quence, amino acids 19-740 form the extracellular domain, amino acids 741-761 are the transmembrane domain and amino acids 762- 805 are the cytoplasmic domain. Amino acids 1 to 740 of SEQ ID NO:2 are identical to SEQ ID NO: 1. Corresponding amino acids and domains exist in other ACE2 polypeptides, including ACE2 from other mammals. ACE2 polypeptides of the invention can be variants of natu- rally occurring ACE2 proteins. Such ACE2 variants may be used in methods and products of the invention. Changes which result in production of a chemically equivalent or chemically similar ami- no acid sequence are included within the scope of the invention. Variants of ACE2 may occur naturally, for example, by mutation, or may be made, for example, with polypeptide engineering tech- niques such as site directed mutagenesis, which are well known in the art for substitution of amino acids. For example, a hy- drophobic residue, such as glycine can be substituted for anoth- er hydrophobic residue such as alanine. An alanine residue may be substituted with a more hydrophobic residue such as leucine, valine or isoleucine. A negatively charged amino acid such as aspartic acid may be substituted for glutamic acid. A positively charged amino acid such as lysine may be substituted for another positively charged amino acid such as arginine. Therefore, the invention includes polypeptides having con- servative changes or substitutions in amino acid sequences. Con- servative amino acid substitutions insert one or more amino ac- ids, which have similar chemical properties as the replaced ami- no acids. The invention includes sequences where conservative amino acid substitutions are made that do not destroy enzymatic activity and/or binding to Spike glycoprotein of SARS-CoV-2. Amino acids 147-555 of SEQ ID NO: 1 or 2 are considered im- portant for catalytic activity and should preferably be retained with a high degree in the ACE2 polypeptide of the invention. Such as with the ACE2 polypeptide of the invention comprising a sequence with a sequence identity of at least 90%, preferably at least 95& or at least 98% or at least 99%, to amino acids 147- 555 of SEQ ID NO: 1 or 2. Other amino acid changes may lead to a loss of enzymatic activity, however maintaining or even increas- ing enzymatic activity and/or binding to Spike glycoprotein of SARS-CoV-2 is preferred. Identity is calculated according to methods known in the art. Sequence identity is most preferably assessed by the BLAST version 2.1 program advanced search (parameters as above). BLAST is a series of programs that are available online at blast.ncbi.nlm.nih.gov/. The BLAST search may be set to default parameters (i.e. Matrix BLOSUM62; Gap existence cost 11; Per residue gap cost 1; Lambda ratio 0.85 default). References to BLAST searches are: Altschul et al., J. Mol. Biol. (1990) 215: 403-410; Gish & States, Nature Genet. (1993) 3: 266-272; Madden et al., Meth. Enzymol. (1996) 266: 131-141; Altschul et al. Nu- cleic Acids Res. (1997) 25: 3389-3402. “Conservative amino acid substitutions” are those substitu- tions that are predicted to interfere least with the properties of the reference polypeptide. In other words, conservative amino acid substitutions substantially conserve the structure and the function of the reference protein. The following Table provides a list of exemplary conservative amino acid substitutions:

Conservative amino acid substitutions generally maintain one or more of: (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a beta sheet or alpha helical conformation, (b) the charge or hydrophobicity of the molecule at the site of the substitution, and/or (c) the bulk of the side chain. Preferably about 1, 2, 3, 4, 5, 6 to 10, 11 to 25, 26 to 50 or 51 to 100, or 101 to 250 amino acids of SEQ ID NO: 1 or SEQ ID NO: 2 are modified or deleted. The invention includes poly- peptides with mutations that cause an amino acid change in a portion of the polypeptide not involved in providing activity of SARS-Cov-2 binding or an amino acid change in a portion of the polypeptide involved in providing activity or SARS-Cov-2 binding so that the mutation increases or decreases the activity or SARS-Cov-2 binding of the polypeptide. For example, it is possi- ble to increase SARS-Cov-2 spike protein binding of the ACE2 polypeptide according to the known interactions (Walls et al., Cell (2020) 181(2): 281-292; Wan et al., J Virol (2020) doi:10.1128/JVI.00127-20; Wrapp et al., Science (2020) doi:10.1126/science.abb2507). Improvement can be in comparison to an unmodified ACE2 of SEQ ID NO: 1. Amino acid changes to im- prove SARS-Cov-2 spike protein binding of ACE2 polypeptide can e.g. be to the receptor binding domain of the spike protein. Amin acids of ACE2 polypeptide are e.g. K31, E35, D38, M82 and K353 of SEQ ID NO: 1 or 2. These amino acids and adjacent amino acids or regions including amino acids 25 to 45, 75 to 90 or 345 to 360 corresponding to SEQ ID NO: 1 or 2 may be changed as com- pared to SEQ ID NO: 1 or 2 in an ACE2 polypeptide of the inven- tion to alter spike protein binding. Polypeptides comprising one or more d-amino acids are con- templated within the invention. Also contemplated are polypep- tides where one or more amino acids are acetylated at the N- terminus. Those with skill in the art recognize that a variety of techniques are available for constructing polypeptide mimet- ics with the same or similar desired compound activity as the corresponding polypeptide compound of the invention but with more favourable activity than the polypeptide with respect to solubility, stability, and/or susceptibility to hydrolysis and proteolysis. The invention also includes hybrids and polypeptides, for example where a amino acid sequence is combined with a second sequence. A possibility is a fusion with an antibody portion, such as a Fc fragment or a CH3 domain of a Fc fragment (US 10,443,049 B2). Preferably, the ACE2 polypeptide is soluble ACE2. “Soluble” refers to solubility in water, especially under physiological conditions, in the sense that the ACE2 polypeptide is not ad- hered to a cellular surface. Soluble ACE2 polypeptides thus lack an anchor region that would bind it to a cell membrane, such as a functional transmembrane domain as found in native ACE2. In particular, the transmembrane domain corresponding to amino ac- ids 741-761 of SEQ ID NO: 2 should be missing in a soluble ACE2 polypeptide. Besides the amino acid sequence, the solubility of a protein is also influenced by its folding as well as post-translational modifications. Glycosylation structures are the main cause of an increase in the solubility of a protein and have a major influ- ence on its pharmacological profile. The ACE2 polypeptide of the invention can be glycosylated, e.g. through expression in suitable expression systems, which further increases solubility. Due to its solubility, ACE2 can be administered intravenous as a bolus. For the same reasons the bioavailability is guaranteed immediately after administration. Preferably the ACE2 polypeptide is glycosylated with high, highly branched and complex proportion of the glycosylation structures. The glycosylation structures preferably contain si- alic acid, preferably the molar amount of glycosylation struc- tures containing at least one sialic acid is at least 50%. Such glycosylation structures increase the half life of the ACE2 pol- ypeptide in vivo. Preferably, the ACE2 polypeptide is glycosylated on at least 70 % of the possible N-glycosylation sites and/or has a propor- tion of glycosylation structure of more than 10 % (w/w of total ACE2). N-glycosylation sites of SEQ ID Nos: 1 and 2 are Asn53, Asn90, Asn103, Asn322, Asn432, Asn546, Asn690. Corresponding N- glycosylation sites are usually found in other ACE2 polypep- tides, such as from other mammals. ACE2 polypeptides that are fragments of ACE2 may miss one or more N-glycosylation sites. Preferably, the ACE2 polypeptide has a molecular weight of at least 90 kDa, preferably at least 92 kDa, particularly pref- erably at least 94 kDa, in particular at least 96 kDa, and high- ly preferably at least 98 kDa, most preferably at least 100 kDa, 100.5 kDa, 101 kDa, 101.5 kDa or at least 102 kDa. An absolute molecular mass – i.e. of the peptide per se without the hydrate sheath – can be determined by peptide mapping. More highly gly- cosylated forms may also have molecular masses of at least 103 kDa, 104 kDa, 105 kDa, 106 kDa, 107 kDa or at least 108 kDa. ACE2 polypeptides have been expressed with a molecular weight of up to about 120 kDa. Higher molecular weights are possible by modification of the ACE2 polypeptide, for example PEGylation. PEGylation is one of the preferred modifications of the ACE2 polypeptide but any fusion or modification as known in the art for pharmaceutical proteins can be used according to the inven- tion. Such fusions or modifications are disclosed in Strohl et al., BioDrugs (2015) 29:215–239 (incorporated herein by refer- ence) and include Fc fusion proteins, scFva fusion, fusion to human serum albumin, fusion to human transferrin, fusion to car- boxy-terminal peptide, and other polypeptide fusions, XTENyla- tion, rPEG, PASylation, ELPylation, HAPylation, GLK fusion, CTP fusion. Such fusions and modifications can adjust the ACE2 poly- peptide to a desirable pharmacokinetic profile, in particular increase of the half-life. An Fc fusion is preferably to an Fc of IgG, IgM, IgD, or IgA or a part thereof, such as a CH1, CH2 or CH3 domain, or FcRn. A CH3 domain is preferred. It may or may not include the C-terminus of the Fc part. IG is preferably hu- man IgG₁, IgG₂, and IgG₄. Modifications, amino acid changes, se- lected glycosylation patters and fusions can protect the ACE2 polypeptide from proteolytic degradation, e.g. reduce proteolyt- ic degradation as compared to unmodified ACE2, such as according to SEQ ID NO: 1 without modifications or fusions. Proteolytic degradation may from or in human serum. In preferred embodiment, the ACE2 polypeptide comprises ami- no acids 19 to 600 of SEQ ID NO: 1. In particular preferments, the ACE2 polypeptide consists of or comprises amino acids 19 to 605 or amino acids 19 to 619, each of SEQ ID NO: 1, including embodiments of the ACE2 polypeptide comprising amino acids 1 to 605 or amino acids 1 to 619, each of SEQ ID NO: 1. Such ACE2 polypeptides, being fragments of native human ACE2 but retaining its activity are disclosed in US 10,443,049. In preferred embod- iments the ACE2 polypeptide comprises or consists of an amino acid sequence with at least 70%, preferably at least 80%, at least 90%, at least 95%, at least 98% or at least 99%, sequence identity to amino acids 19 to 619 of SEQ ID NO: 1 or with amino acids 19 to 605 of SEQ ID NO: 1. Preferably, the ACE2 polypeptide consists of or comprises amino acids 18 to 740 of SEQ ID NO: 1. Such ACE2 polypeptides are disclosed in WO 2008/151347 and in WO 2014/108530 (both in- corporated herein by reference) and are preferred embodiments of the ACE2 polypeptide used according to the invention. In pre- ferred embodiments the ACE2 polypeptide comprises or consists of an amino acid sequence with at least 70%, preferably at least 80%, at least 90%, at least 95%, at least 98% or at least 99%, sequence identity to SEQ ID NO: 1 or with amino acids 18 to 740 of SEQ ID NO: 1. The ACE2 polypeptide can be APN01 (a soluble recombinant human ACE2 – “srhACE2”) or GSK2586881 (a recombinant human angiotensin converting enzyme type 2 – “rhACE2”). Preferably, a serine (or C-terminal amino acid) of the ACE2 polypeptide corresponding to Ser740 of SEQ ID NO: 1 (for example the C-terminal end) is O-glycosylated. The ACE2 polypeptide may be a monomer or a dimer, as de- scribed in WO 2008/151347, or a multimer. The ACE2 polypeptide is preferably catalytically active in hydrolysing angiotensin II to angiotensin-(1-7) and/or in hydro- lysing angiotensin I to angiotensin-(1-9) (Vickers et al., J Bi- ol Chem (2002) 277(17): 14838–14843). Preferably, the catalytic activity of the ACE2 polypeptide or preparation, ccat, is at least 4 s^-1, preferably at least 5 s^-1, particularly preferably at least 6 s^-1, highly preferably at least 7 s^-1, and most preferably at least 7.6 s^-1 with respect to the Ang 1-7 (angiotensin 1-7) conversion. Ang 1-7 is formed from Ang II (angiotensin II) by means of ACE2. The conversion can be tested in a simple manner, as described in WO 2008/151347. This conversion or the catalytic activity of the ACE2 polypeptide can also be extrapolated from other assay data. The activity can, for example, be measured as described in WO 2008/046125 A. The ACE2 polypeptide is preferably for administration at a dose of 10 µg/kg to 1500 µg/kg daily. In particular preferred embodiments, the daily dose is about 400 µg/kg, in other embodi- ments, the daily dose is about 200 µg/kg. ACE2 is also investi- gated as a sole active ingredient and the daily dose of about 400 µg/kg may be used for such aspects. The inventive combina- tion treatment can also facilitate such doses or even lower dos- es, since synergic efficacy with the viral proliferation inhibi- tor allows lower doses than would have been effective for either agent when administered alone, i.e. not in combination. Given that recombinant soluble ACE2 is well tolerated, even at high doses and no adverse effects have been shown by the present in- vention by combining ACE2 with the viral proliferation inhibi- tor, a broader dose range is possible. Accordingly, the inven- tion provides for a daily dose of 10 µg/kg to 100 µg/kg, 100 µg/kg to 200 µg/kg, 200 µg/kg to 300 µg/kg, 300 µg/kg to 400 µg/kg, 400 µg/kg to 500 µg/kg, 500 µg/kg to 600 µg/kg, 700 µg/kg to 800 µg/kg, 800 µg/kg to 1000 µg/kg, 1000 µg/kg to 1500 µg/kg and any combination of these ranges, such as 200 µg/kg to 600 µg/kg, or 10 µg/kg to 300 µg/kg. µg/kg refers to the amount of ACE2 polypeptide in µg per kg of the patient’s body weight. A skilled artisan (e.g. a physician or veterinarian) may reduce or increase dosage in accordance with these or other conditions or requirements. Variants of ACE2 have been described as ACE2 polypeptides suitable for the present invention. Despite molecular weight differences of different ACE2 polypeptides, the above amounts refer to any ACE2 polypeptide, given that differences in molar concentration for a given mass amount are minor. The inventive kits and pharmaceutical compositions prefera- bly contain dosage forms for these daily doses in a container for a 70 kg subject. E.g. the kit or pharmaceutical composition may comprise the ACE2 polypeptide in an amount of 700 µg to 105 mg per container, more preferably 700 µg to 1 mg, 1 mg to 5 mg, 5 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 60 mg to 70 mg, 80 mg to 90 mg, 90 mg to 105 mg, each per container. Any combination of these ranges is possible, such as 10 mg to 40 mg, or 1 mg to 20 mg for lower doses than 400 µg/kg as mentioned above, given the efficacy of the in- ventive combination therapy. The daily dose may be administered once per day, or as split doses more than once per day, wherein the daily dose is divided by the number of administrations to the patient on a day. The administration may be 2x per day, 3x per day or more often. It is also possible to administer with intermittent administration- free days, such as every 2^nd day (with a dose twice the daily dose). In case of non-daily administrations, the daily dose is adjusted so that the daily dose is achieved on average per day over the treatment time span. The treatment time span may be 1, day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or more, such as up to 30 days or up to 40 days or even more. Any ranges in between these treatment times is possible. In some embodiments, the ACE2 polypeptide is administered to the subject at about 0.4 mg/kg through intravenous rejection twice a day up to 7 days. Although human ACE2 (SEQ ID NOs 1 and 2) is preferred for most therapeutic applications, ACE2 from other mammals, for ex- ample mouse, rat, hamster, pig, primates or cattle, can also be used. ACE2 is a universal enzyme in all mammals with the Ang II substrate which is identical in the various species. Hence, in principle it can also be used in other organisms. Thus, the ACE2 polypeptide according to the invention can be used regardless of the origin of the ACE2, for example from humans, mice, rats, hamsters, pigs, primates or cattle. However, in preferred embod- iments, the origin of the ACE2 and the organism (patient) to be treated is the same. Viral proliferation depends on host cells that are infected by the virus. A viral proliferation inhibitor inhibits or reduc- es a virus’ ability to proliferate by host cells. Many viral proliferation inhibitors have been developed, sometimes for oth- er viruses than Covid-19 but which have been found to be effec- tive against SARS-CoV-2. In some embodiments, the viral proliferation inhibitor is selected from the group consisting of remdesivir, GS-441524, chloroquine, hydroxychloroquine, lopinavir, ritonavir, favi- lavir, mesalazine, toremifene, eplerenone, paroxetine, siroli- mus, dactinomycin, irbesartan, emodin, mercaptopurine, melato- nin, quinacrine, carvedilol, colchicine, camphor, equilin, ox- ymetholone, nafamosta (and any salts thereof such as nafamostat mesilate), camostat (any salts thereof such as camostat mesyl- ate), flavipavir, favipiravir, 3Clpro (Mpro), famotinine, nita- zoxanide, umifenovir, ivermectin, corticosteroids, tocilizumab, sarilumab, bevacizumab, flovoxamine, solnatide, niclosamide, galdecivir, gemcitabine, rapamycin, ABT-263, cyclosporine, eme- tine, ribavirin, luteolin, tilorone, glycyrrhizin, eflornithine, monesin, arbidol, silvestrol, emodin, amiodarone, dasatinib, lopinavir, nelfinavir, oritavancin, ritonavir, dalbavancin, teicoplanin, homoharringtonine, alisporivir, cepharanthine, hex- achlorophene, memantine, indomethacin, saracatinib, telavancin, promethazine, trametinib, mefloquine, boceprevir, GC-376, cal- pain inhibitor II, calpain inhibitor XII, and derivatives of any thereof, or any combination thereof, including combinations of 2, 3, 4, 5, 6 or more of these viral proliferation inhibitors. Example viral proliferation inhibitor are selected from vi- ral RNA polymerase inhibitor, i.e. inhibitors of the viral RNA polymerase, host cell inhibitors, i.e. inhibits that inhibit the host cells machinery to be affected by and act on behalf of the virus that infects the cell, and viral protease inhibitors, i.e. inhibitors of the viral protease. Viral RNA polymerase inhibitors are for example: remdesivir, GS-441524, chloroquine, hydroxychloroquine, favilavir, favipi- ravir, mesalazine, toremifene, eplerenone, paroxetine, siroli- mus, dactinomycin, irbesartan, emodin, mercaptopurine, melato- nin, quinacrine, carvedilol, colchicine, camphor, equilin, ox- ymetholone, flavipavir. Viral protease inhibitors are for example selected from lop- inavir, ritonavir, 3Clpro (Mpro), famotinine, nitazoxanide, bo- ceprevir, calpain inhibitor II, calpain inhibitor XII, GC-376 (Ma et al., Cell Res 2020, doi.org/10.1038/s41422-020-0356-z; incorporated herein by reference). Host cell inhibitors are for example selected from nafa- mostat, nafamostat mesilate, camostat, camostat mesilate, umifenovir, ivermectin, corticosteroids, tocilizumab, sarilumab, bevacizumab, flovoxamine, solnatide. The present invention (in the methods, kits, compositions etc.) relates to a combination of a SARS-CoV-2 cellular entry receptor, preferably an ACE2 polypeptide, with a (meaning one or more) viral proliferation inhibitor. In particular embodiments, more than one, e.g. 2, 3, 4, 5, 6 or more different viral pro- liferation inhibitors can be used. Especially preferred are com- binations of viral proliferation inhibitors with different tar- gets, such as the combination with a viral polymerase inhibitor and a viral protease inhibitor; with a viral RNA polymerase in- hibitor and a host cell inhibitor; with a viral protease inhibi- tor and a host cell inhibitor; or with a viral polymerase inhib- itor and a viral protease inhibitor and a host cell inhibitor. In further or combinable embodiments, more than one, e.g. 2, 3, 4, 5, 6 or more different viral RNA polymerase inhibitors can be selected (of which remdesivir or GS-441524 or an ester or pro- drug thereof, e.g. a compound of Formula 1, are preferred as in all embodiments of the invention as at least one of the viral RNA polymerase inhibitors). In further or combinable embodi- ments, more than one, e.g. 2, 3, 4, 5, 6 or more different viral protease inhibitors can be selected. In further or combinable embodiments, more than one, e.g. 2, 3, 4, 5, 6 or more different host cell inhibitors can be selected. In a preferred embodiment of the invention, the viral pro- liferation inhibitor is a viral RNA polymerase inhibitor. In particular preferred the viral RNA polymerase inhibitor is a nu- cleoside or nucleotide analogue. In particular preferred is an adenosine (A) analogue. Nucleoside analogues resemble one of the natural nucleosides used in the genetic code as found in DNA or RNA, i.e. A, G, C, T, U and taken up to DNA or RNA polymerases instead of one of said natural nucleosides and inhibit the poly- merase for being a non-functional nucleoside. In case of SARS- CoV-2, it is preferred that the nucleoside analogue is an inhib- itor of the SARS-CoV-2 RNA polymerase. Preferably, the viral RNA polymerase inhibitor is remdesivir or GS-441524 or a GS-441524 prodrug or ester. The chemical structures of remdesivir or GS-441524 are:

Remdesivir GS-441524 Remdesivir (2-Ethylbutyl (2S)-2-{[(S)-{[(2R,3S,4R,5R)-5-(4- aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxy- tetrahydrofuran-2-yl]methoxy}(phenoxy)phosphoryl]amino}- propanoate, also termed “GS-5734”) is a prodrug of GS-441524. GS-441524 or a prodrug of GS-441524 other than remdesivir, such as any ester of GS-441524 with esterification of the OH group at the 5’ position according to nucleotide nomenclature (i.e. where remdesivir contains a phosphate ester group), are likewise pos- sible. Remdesivir and other prodrugs and esters of GS-441524 are disclosed in WO 2017/049060 A1 (incorporated herein by refer- ence), which can be used according to the present invention. A preferred ester of GS-441524 is GS-441524 phosphate, in particu- lar GS-441524 monophosphate. In preferments of the invention, the viral RNA polymerase inhibitor is a compound according to general Formula 1:

wherein R¹ is selected from an ester group, preferably a phos- phate group. The phosphate group may contain further ester groups, preferably hydrolysable esters, in particular hydrolysa- ble in physiological environments, such as in a cell in vivo or plasma in vivo. In preferred embodiments, R¹ is selected from a group consisting of:

a) H, -C(=O)R¹¹, -C(=O)OR¹¹ _t -C(=O)NR¹¹R¹², -C(=O)SR¹¹, -S(O)R¹¹, -S(O)₂R¹¹, -S(O)(OR¹¹), -S(O)₂(OR¹¹), or -SO₂NR¹¹R¹², wherein each (C₁-C₈)alkyl, (C₂-C₈)alkenyl, (C₂-C₈)alkynyl or

(C₆-C₂₀)aryIC₁-C₈)alkyI of each R^{1 1} or R¹² is, independently, optionally substituted with one or moire halo, hydroxy, CN, N₃, N(R³)₂ or OR^a; and wherein one or more of the non-terminal carbon atoms of each said (C₁-C₈)alkyl may be optionally replaced with -O-, -S- or -NR^a-,

wherein:

R^c is selected front phenyl, 1 -naphthyl, 2-naphthyl,

R^d is H or CH₃;

R^el and R^e2 are each independently H, (C₁-C₆)alkyl or benzyl; R¹ is selected from H, (C₁-C₈)alkyl, benzyl, (C₁-C₈)cycloalkyl, and -CH₂-f (C₃-C₆)cycloalky;l

R⁸ is selected front (C₁-C₈)alkyl, -O-(C₁-C₈)alkyl, benzyl,

-O-benzyl, -CH₂-d (C₁-C₈)cycloalky,l -O-CHr- (C₃-C₆) cycloalky alnd CF₃; and n’ is selected from 1, 2, 3, and 4; and d) a group of the formula: wherein:

Q is O, S, NR, ⁺N(O)(R), N(OR), ⁺N(O)(OR), or N-NR₂; Z¹ and Z¹, when taken together, are -Q¹(C(R^y)₂)₃Q¹-; wherein each Q¹ is independently 0, S, or NR; and

each R^y is independently H, F, Cl, Br, I, OH, R, -

C(=Q²)R, -C(=Q²)OR, -C(=Q²)N(R)₂, -N(R)₂, - *N(R)₃, -SR, -S(O)R, -S(=Q)₂R, -S(OXOR), -

S(O)₂(OR), -OC(=Q^:l)R, -OC(=Q²)OR, - OC(=Q²)(N(R)₂), -SC(=Q²)R, -SC(=Q²)OR, - SC(=Q²)(N(R)₂), -N(R)C(=Q²)R, - N(R)C(=Q²)OR, -N(R)C(=Q²)N(R)₂, -SO₂NR₂, -CN, -N₃, -NO₂, -OR, orZ³; or when taken together, two R^y on the same carbon atom form a carbocyclic ring of 3 to 7 carbon atoms; each Q² is independently, O, S, NR, ⁺N(O)(R), N(OR), +N(O)(OR), or N-NR₂; or

Z¹ and Z² are each, independently, a group of the Formula la:

wherein: each Q² is independently a bond, O, CRi, NR,

⁺N(O)(R), N(OR), ÷N(O)(OR), N-NR_2, S, S-S, S(O), or S(O)₂;

M2 is 0, 1 or 2; each R* is independently R^y or the formula:

wherein: each M1a, M1c, and M1d is independently 0 or

1;

Ml 2c is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12;

Z³ is Z⁴ or Z⁵;

Z⁴ is R, -C(Q²)R^s; -C(Q²)Z⁵, -SO₂R^y, or -StXZ³; and

Z⁵ is a carbocycle or a heterocycle wherein Z³ is independently substituted with 0 to 3 R^y groups; each R¹¹ or R¹² is independently H, (C₁-C₈)alkyl, (C₂-C₈)alkenyl, (C₂-C₈)alkyriyl, (C₄-C₈)carbocyclylalkyI, (C₆-C₂₀)optionally substituted aryl, optionally substituted heteroaryl, -C(=O){Cj-Cg)alkyl, -S(0)_n{Ci-Cg)aikyl or (C₆-C₂₀)aryl(C₁-C₈)alkyl; or R¹¹ and R¹² taken together with a nitrogen to which they are both attached form a 3 to 7 membered heterocyclic ring wherein any one carbon atom of said heterocyclic ring can optionally be replaced with -0-, -S- or -NR^a-; each R^a is independently H, (C₁-C₈)alkyl, (C₂-C₈)alkenyl, (C₂-C₈)alkynyl,

(C₆-C₂₀)aryI(C ₁-C₈)alkyI, (C₄-C₈)carbocyclylalkyl, -C(=0)R, -C(=O)OR, -C(=O)NR₂, -C(=O)SR, -S(O)R, -S(O)₂R, -S(O)(OR), -S(O)₂(OR), or -SO₂NR₂; wherein each R is independently H, (C₁-C₈) alkyl, (C₁-C₈) substituted alkyl, (C₂-C₈)alkenyl, (C₂-C₈) substituted alkenyl, (C₂-C₈) alkynyl, (C₂-C₈) substituted alkynyl, (C₆,-C₂₀)aryl, (C₆-C₂₀)substtluted aryl, (C₂-C₈ )helerocyclyl, (C₂-C₂₀)substituted heterocyclyl, (C₆-C₂₀)aiyl (C₁-C₈)alkyl or substituted

(C₆— C₂₀) ary 1(C₁-C₈)aIkyI ; each n is independently 0, 1, or 2; and wherein each (C₁-C₈)alkyl, (C₂-C₈)alkenyl, (C₂-C₈)alkynyl or (C₆-C₂₀)aryl(C₁-C₈)alkyl of each R¹¹ or R¹² is, independently, op- tionally substituted with one or more halo, hydroxy, CN, N₃, N(R^a)₂ or OR^a; and wherein one or more of the non-terminal carbon atoms of each said (C₁-C₈)alkyl may be optionally replaced with - 0-, -S- or -NR^a-.

In preferred embodiments, R¹ is selected from:

Further preferred RNA polymerase inhibitors are selected from any one of

Further RNA polymerase inhibitors are described in WO 2017/049060 A1, in particular in Formulas I, II, III, IV of WO 2017/049060 A1 (incorporated herein by reference). Such com- pounds may be prodrugs or esters of GS-441524.

Chemical groups and chemical group properties, such as al- kyl, aryl, alkenyl, alkynyl, hetero, substituted, cyclo, and the like have the meaning as commonly known in the art. In case of doubt, the definitions as given in WO 2017/049060 A1 shall ap- ply.

The compounds of Formula 1, in particular Remdesivir, have been designed to efficiently deliver the monophosphate nucleo- side analog GS-441524 into cells. Inside cells, the GS-441524 monophosphate undergoes rapid conversion to the pharmacological- ly active nucleoside triphosphate form GS-443902 ("GS-441524 triphosphate") .

The nucleoside triphosphate GS-443902 acts as an analog of adenosine triphosphate (ATP) and competes with the natural ATP substrate to selectively inhibit viral RNA polymerase. The pri- mary mechanism of inhibition is the incorporation of the nucleoside triphosphate GS-443902 into nascent RNA chains by vi- ral RNA polymerase, causing delayed RNA chain termination during the process of viral replication. Remdesivir's plasma pharmaco- kinetic profile shows a tl/2 of approximately 1 hour after a single administration. However, intracellular GS-443902 metabo- lite persists longer, with a plasma tl/2 of approximately 24.5 hours. A main contributor to the low tl/2 of remdesivir in plas- ma is esterase activity in plasma, which transforms it into GS- 443902 or its monophosphate ester.

Table 1: Summary Statistics of Remdesivir Plasma Pharmacokinetic Parameters Following 30-Minute IV Infusion (s) of Remdesivir 200 mg on Day 1 and 100 mg Daily for 4 Days in Healthy Adult Sub- jects

remdesivir gilead_en.pdf)

Table 2: Summary Statistics of Nucleoside Metabolite GS-441524 Plasma Pharmacokinetic Parameters Following 30-minutes IV Infu- sion (s) of Remdesivir 200 mg on Day 1 and 100 mg Daily for 4 Days in Healthy Adult Subjects

Remdesivir is investigated as sole active agent for admin istration of 200 mg on day 1 followed by 100 mg on days 2-10 in single daily infusions (Grein et al., N Engl J Med (2020) 382: 2327-36). Wang et al. (Lancet (2020) 395, 1569-1578) report that this dose may not be effective in the treatment of Covid-19. The inventive combination with a SARS-CoV-2 cellular entry receptor, in particular with an ACE2 polypeptide, allows effective use of remdesivir and other prodrugs and esters of GS-441524 due to synergistic activities. The reported doses of 200mg/100mg or even lower doses for remdesivir, such as half of this investi- gated dose or even lower, can be effective in the inventive com bination .

The dose of 200 mg represents a proposed dose for the treat ment of patients with acute COVID-19. Administration of remdesivir 200 mg results in day 1 peak systemic concentrations (Cmax) of 9.0 mM for remdesivir and 0.5 mM for GS-441524 (EMA, "Summary on compassionate use" 3 April 2020).

Side-effects of such high doses of remdesivir include hepa- totoxicity, constipation, hypoalbuminaemia, hypokalaemia, anae mia, thrombocytopenia, and increased total bilirubin, in partic ular at clinically investigated doses (Grein et al., Wang et al). However, higher doses are required for Covid-19 treatment when using remdesivir alone. The inventive treatment with combi nation with a SARS-CoV-2 cellular entry receptor allows lower doses, that have been found to synergize with the inhibitor ac cording to the present invention. Remdesivir is preferably for administration at a dose of 10 μg/kg to 4 mg/kg daily. In particular preferred embodiments, the daily dose is 1.4 mg/kg or lower, e.g. 1.2 mg/kg or lower, to avoid or reduce toxic adverse reaction associated with remdesivir. A preferred daily dose is about 1 mg/kg, in other embodiments, the daily dose is about 0.5 mg/kg. In particular, the invention provides for a daily dose of 10 μg/kg to 100 μg/kg, 100 μg/kg to 200 μg/kg, 200 μg/kg to 400 μg/kg, 400 μg/kg to 600 μg/kg, 600 μg/kg to 800 μg/kg, 800 μg/kg to 1 mg/kg, 1 mg/kg to 1.1 mg/kg, 1.1 mg/kg to 1.2 mg/kg, 1.2 mg/kg to 1.3 mg/kg, 1.3 mg/kg to 1.4 mg/kg, 1.4 mg/kg to 1.5 mg/kg, 1.5 mg/kg to 1.6 mg/kg, 1.6 mg/kg to 1.8 mg/kg, 1.8 mg/kg to 2 mg/kg, 2 mg/kg to 2.2 mg/kg, 2.2 mg/kg to 2.5 mg/kg, 2.5 mg/kg to 3 mg/kg, 3 mg/kg to 3.5 mg/kg, 3.5 mg/kg to 4 mg/kg, and any com- bination of these ranges, such as 500 μg/kg to 1.3 mg/kg, or 300 μg/kg to 1.1 mg/kg. μg/kg or mg/kg refers to the amount of remdesivir in μg or mg, respectively, per kg of the patient's body weight. A skilled artisan (e.g., a physician or veterinari- an) may reduce or increase dosage in accordance with these or other conditions or requirement. In particular preferred embodi- ments remdesivir is administered at a dose of 1 mg/kg or lower per day.

The viral proliferation inhibitor, e.g. remdesivir, GS- 441524, an ester or prodrug of GS-441524, or a compound of For- mula 1 is preferably for administration at a dose of 0.002 μmol/kg to 6 μmol/kg daily. In particular preferred embodiments, the daily dose is 2 μmol/kg or lower, e.g. 1.8 μmol/kg or lower, to avoid or reduce toxic adverse reaction associated with some viral proliferation inhibitors. A preferred daily dose is about

1.5 μmol/kg, in other embodiments, the daily dose is about 0.8 μmol /kg. In particular, the invention provides for a daily dose of 0.002 μmol/kg to 0.01 μmol/kg, 0.01 μmol/kg to 0.05 μmol/kg, 0.05 μmol/kg to 0.1 μmol/kg, 0.1 μmol/kg to 0.2 μmol/kg, 0.2 μmol/kg to 0.3 μmol/kg, 0.3 μmol/kg to 0.4 μmol/kg, 0.4 μmol/kg to 0.6 μmol/kg, 0.6 μmol/kg to 0.8 μmol/kg, 0.8 μmol/kg to 1 μmol/kg, 1 μmol/kg to 1.2 μmol/kg, 1.2 μmol/kg to 1.4 μmol/kg,

1.4 μmol/kg to 1.6 μmol/kg, 1.6 μmol/kg to 1.8 μmol/kg, 1.8 μmol/kg to 2 μmol/kg, 2 μmol/kg to 2.2 μmol/kg, 2.2 μmol/kg to

2.5 μmol/kg, 2.5 μmol/kg to 3 μmol/kg, 3 μmol/kg to 3.5 μmol/kg,

3.5 μmol/kg to 4 μmol/kg, 4 μmol/kg to 4.5 μmol/kg, 4.5 μmol/kg to 5 mpioΐ/kg, 5 mpioΐ/kg to 5.5 μmol/kg, 5.5 μmol/kg to 6 μmol/kg, and any combination of these ranges, such as 0.8 μmol/kg to 2 μmol/kg, or 0.5 μmol/kg to 1.8 mpioΐ. Also, other daily doses are possible for any viral proliferation inhibitor of the invention, in particular the inhibitors described above, including any one of the viral polymerase inhibitors, viral pro- tease inhibitors and host cell inhibitors as only viral prolif- eration inhibitor or in combination with other viral prolifera- tion inhibitors. Such further dose are 1 nmol/kg to 10 nmol/kg, 10 nmol/kg to 100 nmol/kg, 100 nmol/kg to 1 μmol/kg, 1 μmol/kg to 10 μmol/kg, 10 μmol/kg to 100 μmol/kg, 100 μmol/kg to 1 mmol/kg, 1 mmol/kg to 10 mmol/kg, 10 mmol/kg to 100 mmol/kg, 100 mmol/kg to 1 mol/kg or any combination of these ranges, μmol/kg refers to the molar amount of the viral proliferation inhibitor in μmol per kg of the patient's body weight. A skilled artisan (e.g., a physician or veterinarian) may reduce or increase dos- age in accordance with these or other conditions or requirement. In particular preferred embodiments the viral proliferation in- hibitor is administered at a dose of 1.6 μmol/kg or lower per day.

The inventive kits and pharmaceutical compositions prefera- bly contain dosage forms for these daily doses in a container for a 70 kg subject. E.g. the kit or pharmaceutical composition may comprise remdesivir in an amount of 700 μg to 280 mg per container, more preferably, 700 μg to 1 mg, 1 mg to 5 mg, 5 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 80 mg to 90 mg, 90 mg to 110 mg, 110 mg to 130 mg, 130 mg to 150 mg, 150 mg to 175 mg, 175 mg to 200 mg, 200 mg to 220 mg, or 220 mg to 250 mg, 250 mg to 280 mg, each per container. As above any combination of these ranges is possible, such as 35 mg to 95 mg, or 20 mg to 75 mg for lower doses are preferred. In molar amounts, the kit or pharmaceutical composition may comprise viral proliferation in- hibitor, e.g. remdesivir, GS-441524, an ester or prodrug of GS- 441524, or a compound of Formula 1 in an amount of 1 μmol to 500 μmol per container, more preferably, 1 μmol to 2 μmol, 2 μmol to 5 μmol, 5 μmol to 10 μmol, 10 μmol to 20 μmol, 20 μmol to 30 μmol, 30 μmol to 40 μmol, 40 μmol to 60 μmol, 60 μmol to 80 μmol, 80 μmol to 100 μmol, 100 μmol to 125 μmol, 125 μmol to 150 μmol, 150 μmol to 175 μmol, 175 μmol to 200 μmol, 200 μmol to 250 mpioΐ, 250 mpioΐ to 300 mpioΐ, 350 mpioΐ to 400 mpioΐ, 400 mpioΐ to 450 mpioΐ, 450 mpioΐ to 500 mpioΐ, each per container. As above any combination of these ranges is possible, such as 60 mpioΐ to 165 mpioΐ, or 30 mpioΐ to 125 mpioΐ for lower doses are preferred. Such doses may be preferred for single injections, infusions or other types of single administration unit. Also, other doses are possible for any viral proliferation inhibitor of the invention, in particular the inhibitors described above, including any one of the viral polymerase inhibitors, viral protease inhibitors and host cell inhibitors as only viral proliferation inhibitor or in combination with other viral proliferation inhibitors.

Such further dose are 1 nmol to 10 nmol, 10 nmol to 100 nmol,

100 nmol to 1 mpioΐ, 1 μmol to 10 mpioΐ, 10 μmol to 100 mpioΐ, 100 μmol to 1 mmol, 1 mmol to 10 mmol, 10 mmol to 100 mmol, 100 mmol to 1 mol or 1 mol to 10 mol, or any combination of these ranges, each per container.

The daily dose may be administered once per day, or as split doses more than once per day, wherein the daily dose is dived by the number of administrations to the patient on a day. The ad ministration may be 2x per day, 3x per day or more often. It is also possible to administer with intermittent administration- free days, such as every 2^nd day (with a dose twice the daily dose). In case of non-daily administrations, the daily dose is adjusted so that the daily dose is achieved on average per day over the treatment time span. The treatment time span may be 1, day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or more such as up to 30 days or up to 40 days or even more. Any ranges in between these treatment times is possible.

In some embodiments, the remdesivir is administered to the subject at about 1.1 mg/kg through intravenous rejection once a day up to 10 days. In particular preferred, remdesivir is admin- istered at a dose of 80 mg daily or lower, preferably to a human adult with an age of at least 18 years. On the first day of ad ministration, remdesivir is preferably administered at twice the daily dose as on the following day. In particular preferred em bodiments the daily dose for administration of remdesivir is 1.5 mg/kg or lower.

Preferred doses for GS-441524 or its monophosphate are equal or preferably half the mass doses given for remdesivir because approximately GS-441524 has about half the molecular weight of remdesivir (291.26 g -mol^-1 for GS-441524; 602.585 g -mol^-1 for remdesivir), thereby resulting in about the same molar doses.

In further embodiments, a dose is selected to reach a de- sired plasma level of remdesivir or the viral proliferation in- hibitor in general. Healthy adult volunteers receiving doses of 200 mg on day 1, 100 mg on days 2-4 had mean peak plasma concentrations of 5.4 μg/mL (percentage coefficient of variation 20.3) on day 1 and 2.6 μg/mL (12.7) on day 5 (Wang et al., Lancet (2020) 395, 1569-1578). Further pharmacological data is given above, which allows the skilled practitioner to select suitable administration doses.

In preferred embodiments, the dose for an administration of viral proliferation inhibitor, preferably remdesivir or another GS-441524 prodrug or ester or compound of Formula 1, is suitable to result in a plasma concentration of 1.3 μM or lower (for remdesivir preferably 800 ng/mL or lower) 1 hour after admin- istration; or 2.6 μM or lower (for remdesivir preferably 1600 ng/mL or lower) immediately after finishing the administration. In particular preferred embodiments, the is suitable to result in a plasma concentration of the viral proliferation inhibitor of 0.01 μM to 4 μM, e.g. 0.01 μM to 0.05 μM, 0.05 μM to 0.1 μM, 0.1 μM to 0.2 μM, 0.2 μM to 0.3 μM, 0.3 μM to 0.4 μM, 0.4 μM to 0.5 μM, 0.6 μM to 0.7 μM, 0.7 μM to 0.8 μM, 0.9 μM to 1 μM, 1.5 μM to 2 μM, 2 μM to 2.5 μM, 2.5 μM to 3 μM, 3 μM to 3.5 μM, 3.5 μM to 4 μM, 4 μM to 10 μM, 10 μM to 20 μM, 20 μM to 30 μM, 30 μM to 40 μM, 40 μM to 50 μM, 50 μM to 60 μM, 60 μM to 80 μM, 80 μM to 100 μM, 100 μM to 130 μM or any combined ranges thereof, im- mediately after finishing the administration or 1 hour after ad- ministration. The plasma concentration 1 hour after administra- tion may be preferred for prolonged administrations, such as an i.v. infusion over 30 min to 2h so that differences due to the administration speed are mitigated. Preferred example ranges are 0.2 μM to 1.5 μM for a plasma concentration immediately after administration or 0.1 μM to 0.8 μM for a plasma concentration 1 hour after administration. "After administration" refers to the time when the complete dose intended for administration in one sitting has been administered, e.g. when the contents of an in- fusion bag has entered the patient.

The present invention (in the methods, kits, compositions, etc.) further relates to a combination of a SARS-CoV-2 cellular entry receptor, preferably an ACE 2 polypeptide, with a (meaning one or more) host cell inhibitor as viral proliferation inhibi- tor. In particular embodiments, more than one, e.g. 2, 3, 4, 5,

6 or more different host cell inhibitors can be used. In a pre- ferred embodiment of the invention, the host cell inhibitor is a host cell protease inhibitor. In particular preferred the host cell protease inhibitor is a transmembrane protease inhibitor.

In particular preferred the transmembrane protease inhibitor is an inhibitor of transmembrane protease serine 2 (TMPRSS2). Some coronaviruses, e.g. SARS-CoV-1, MERS-CoV, and SARS-CoV-2 are ac- tivated by transmembrane serine protease, preferably TMPRSS2, and can thus be inhibited by TMPRSS2 inhibitors. Host cell in- hibitors can interfere earlier in the infection with Sars CoV-2 and thus can prevent or reduce the risk of the infection as such.

Preferably, the inhibitor of enzyme transmembrane protease serine 2 inhibitor is camostat or nafamostat. In vitro camostat and nafamostat bind and inhibit TMPRSS2 with great potency and affinity, IC506.2 nM and 0.27 nM, respectively (Monitcelli M., et al., Genes 2021, 12(4), 596). Inhibition of TMPRSS2 can par- tially block infection by SARS-CoV-2. An in vitro study showed that camostat can significantly reduce the infection of Calu-3 lung cells by SARS-CoV-2 (Hoffmann M. et al., EBioMedicine 65 (2021) 103255).

The SARS-CoV-2 spike protein (S) uses the host cell factors angiotensin-converting enzyme 2 (ACE2) and transmembrane prote- ase serine 2 (TMPRSS2) in the cell membrane for entry into tar- get cells. TMPRSS2 is a cellular type II transmembrane serine protease (TTSP) expressed in human respiratory epithelium that cleaves and thereby activates the viral S protein on the virus envelope to be able to penetrate the lung cells. Activation is essential for viral infectivity, and it was found that the host cell inhibitor, especially the protease inhibitor camostat, e.g. Camostat mesylate, which is known to block TMPRSS2 activity, in- hibits SARS-CoV-2 infection of lung cells. Host protease inhibi- tors, e.g. camostat, camostat mesylate, nafamostat and nafa- mostat mesylate, interfere early in the interaction with SARS- CoV-2 and reduce the likelihood of SARS-CoV-2 penetration and thus can prevent the infection as such. Camostat is preferably for administration at a dose of more than 100 mg daily. In particular preferred embodiments, the dai- ly dose is 100 mg to 2500 mg, preferably 300 mg to 600 mg. Such doses can be used in the inventive kits or compositions, e.g. in containers, e.g. as amounts of the compound in containers, e.g. containers suitable for administration. The camostat metabolite GBPA inhibits the activity of recombinant TMPRSS2 with reduced potency as compared to camostat mesylate. Healthy fasting humans given a single oral dose of 100 mg camostat mesylate reach maxi- mal plasma levels of GBPA 0.15 mM. It is therefore likely that camostat mesylate doses well below 2100 mg will be sufficient in achieving relevant SARS-CoV-2 inhibitory plasma concentrations (Breining P., et al., Basic Clin Pharmacol Toxicol. 2020;00:1- 9). A skilled artisan (e.g, a physician or veterinarian) may re- duce or increase dosage in accordance with the requirements. In particular preferred embodiments camostat is administered at a dose of 100 mg to 600 mg per day.

Therefore, as compared to the combined usage of ACE2 poly- peptides and viral protease inhibitors such a treatment regimen with ACE2 polypeptide and a host cell inhibitor represents a strategy of earlier interference with viral infection and the modes of action of host protease inhibitors and ACE2 polypep- tides is expected to thereby provide synergistic effects equal or even beyond those observed for ACE2 polypeptides and viral polymerase inhibition, e.g. with remdesivir.

As used herein, the term "subject" may be used interchangea- bly with the term "patient" or "individual" and may include an "animal" and in particular a "mammal", that can be treated ac- cording to the invention. Mammalian subjects may include humans and non-human primates, domestic animals, farm animals, and com- panion animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, and the like. Preferably, the pa- tient to be treated by the inventive method and uses of the in- vention is a human, preferably a human adult of the age of 18 years or more.

In accordance with the invention, a pharmaceutical composi- tion or medicine comprising the SARS-CoV-2 cellular entry recep- tor and/or the viral proliferation inhibitor can be provided.

The pharmaceutical composition may be in a container, such as a vial, flask or bag, and/or in kit. Such compositions may be pharmaceutically acceptable salts themselves, with additional buffers, tonicity components or pharmaceutically acceptable car- riers. Pharmaceutical carrier substances serve to improve the compatibility of the composition and provide better solubility as well as better bioavailability of the active ingredients. Ex- amples are emulsifiers, thickeners, redox components, starches, alcoholic solutions, polyethylene glycol and lipids. Selection of a suitable pharmaceutical carrier is highly dependent on the administration route. For oral administration, liquid or solid carriers may be used; for injections, liquid final compositions are required.

Preferably, the SARS-CoV-2 cellular entry receptor and/or the viral proliferation inhibitor (preferably ACE2 polypeptide and/or remdesivir) are provided in a composition comprising buffers or tonic substances. The buffer can adjust the pH of the medicine to the physiological conditions and further, can reduce or buffer variations in pH. An example is a phosphate buffer. Tonic substances can adjust the osmolarity and may include ionic substances, such as inorganic salts, for example NaCl or KC1, or non-ionic substances such as glycerin or carbohydrates.

Preferably, the composition or the kit-in-parts for use in accordance with the invention is suitably prepared for systemic, topical, oral or intranasal administration or as an inhaled preparation. Such administration routes are preferred embodi- ments of the inventive methods. These forms of administration for the composition of the present invention allow fast, uncom- plicated take-up. When the SARS-CoV-2 cellular entry receptor and/or the viral proliferation inhibitor are intended for oral administration, it is preferably provided in a formulation which is resistant to stomach acid or it is encapsulated. For oral ad- ministration, solid or liquid medicines can be taken directly or dissolved or diluted, for example. The pharmaceutical composi- tion or kit for use in accordance with the invention is prefera- bly produced for intravenous, intra-arterial, intramuscular, in- travascular, intraperitoneal or subcutaneous administration. In- jections or transfusions, for example, are suitable for this purpose. Administration directly into the bloodstream has the advantage that the active ingredient of the medicine can be dis- tributed through the entire body and the target tissue, such as lungs, heart, kidney, intestine or liver, is reached quickly. The term "pharmaceutically acceptable" indicates that the designated carrier, vehicle, diluent, excipient(s), and/or salt is generally chemically and/or physically compatible with the other ingredients comprising the formulation, and physiological- ly compatible with the recipient thereof. In some embodiments, compounds, materials, carriers, compositions, and/or dosage forms that are pharmaceutically acceptable refer to those ap- proved by a regulatory agency (such as U.S. Food and Drug Admin- istration, National Medicine or European Medicines Agency) or listed in generally recognized pharmacopoeia (such as U.S. Phar- macopoeia, China Pharmacopoeia or European Pharmacopoeia) for use in animals, and more particularly in humans.

Pharmaceutical acceptable carriers for use in the pharmaceu- tical compositions disclosed herein may include, for example, pharmaceutically acceptable liquid, gel, or solid carriers, aqueous vehicles, non-aqueous vehicles, antimicrobial agents, isotonic agents, buffers, tonicity-adjusting agents, antioxi- dants, anesthetics, suspending/dispending agents, sequestering or chelating agents, diluents, adjuvants, excipients, or non- toxic auxiliary substances, other components known in the art, or various combinations thereof. Suitable carriers and auxiliary components may include, for example, fillers, binders, disinte- grants, buffers, preservatives, lubricants, flavorings, thicken- ers, coloring agents, emulsifiers or stabilizers such as sugars and cyclodextrins. In some embodiments, the suitable buffers may include, for example, a phosphate buffer or a MES (2-(N- morpholino)ethane sulfonic acid) buffer.

To further illustrate, pharmaceutical acceptable carriers may include, for example, aqueous vehicles such as sodium chlo- ride injection, Ringer's injection, isotonic dextrose injection, sterile water injection, or dextrose and lactated Ringer's in- jection, nonaqueous vehicles such as fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, or peanut oil, an- timicrobial agents at bacteriostatic or fungistatic concentra- tions, isotonic agents such as sodium chloride or dextrose, buffers such as phosphate or citrate buffers or MES (2-(N- morpholino)ethane sulfonic acid) buffers, antioxidants such as sodium bisulfate, local anesthetics such as procaine hydrochlo- ride, suspending and dispersing agents such as sodium carbox- ymethylcelluose, hydroxypropyl methylcellulose, or polyvinylpyr- rolidone, emulsifying agents such as Polysorbate 80 (TWEEN-80), sequestering or chelating agents such as EDTA (ethylenedia- minetetraacetic acid) or EGTA (ethylene glycol tetraacetic ac id), ethyl alcohol, polyethylene glycol, propylene glycol, sodi um hydroxide, hydrochloric acid, citric acid, or lactic acid. Antimicrobial agents utilized as carriers may be added to phar maceutical compositions in multiple-dose containers that include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, ben- zalkonium chloride and benzethonium chloride. Suitable excipi ents may include, for example, water, saline, dextrose, glycer ol, or ethanol. Suitable non-toxic auxiliary substances may in clude, for example, wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, or agents such as so dium acetate, sorbitan monolaurate, triethanolamine oleate, or cyclodextrin .

The pharmaceutical compositions for either the SARS-CoV-2 cellular entry receptor and/or the viral proliferation inhibitor or both can be a liquid solution, suspension, emulsion, pill, capsule, tablet, sustained release formulation, or powder. Oral formulations can include standard carriers such as pharmaceuti cal grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium saccharine, cellulose, magnesium carbonate, etc.

The form of pharmaceutical compositions depends on a number of criteria, including, but not limited to, route of administra tion, extent of disease, or dose to be administered. The pharma ceutical compositions can be formulated for intravenous, oral, nasal, rectal, percutaneous, or intramuscular administration.

For example, dosage forms for intravenous administration, may be formulated as lyophilized powder or fluid formulation; dosage forms for nasal administration may conveniently be formulated as aerosols, solutions, drops, gels or dry powders. In accordance to the desired route of administration, the pharmaceutical com positions can be formulated in the form of tablets, capsule, pill, dragee, powder, granule, sachets, cachets, lozenges, sus pensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), spray, inhalant, or suppository.

In some embodiments, the pharmaceutical compositions are formulated into an injectable composition. The injectable phar- maceutical compositions may be prepared in any conventional form, such as for example liquid solution, suspension, emulsion, or solid forms suitable for generating liquid solution, suspen- sion, or emulsion. Preparations for injection may include ster- ile and/or non-pyretic solutions ready for injection, sterile dry soluble products, such as lyophilized powders, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just pri- or to use, and sterile and/or non-pyretic emulsions. The solu- tions may be either aqueous or nonaqueous. Aqueous is preferred.

In some embodiments, unit-dose i.v. or parenteral prepara- tions are packaged in an ampoule, a vial, bag or a syringe with a needle. All preparations for parenteral administration should be sterile and not pyretic, as is known and practiced in the art.

Depending on the route of administration, the SARS-CoV-2 cellular entry receptor and/or the viral proliferation inhibitor can be coated with or disposed in a selected material to protect it from natural conditions which may detrimentally affect its ability to perform its intended function. It may be administered alone, or in conjunction with a pharmaceutically acceptable car- rier. The viral proliferation inhibitor also may be administered as a prodrug, which is converted to its active form in vivo.

Such pharmaceutical compositions can be provided as part of the invention, in particular for an ACE2 polypeptide as SARS- CoV-2 cellular entry receptor and with remdesivir, GS-441524, an ester or prodrug of GS-441524, or a compound of Formula 1 as vi- ral proliferation inhibitor in preferred embodiments. The SARS- CoV-2 cellular entry receptor and the viral proliferation inhib- itor may be in a container.

The invention further relates to a kit comprising containers with an ACE2 polypeptide as SARS-CoV-2 cellular entry receptor, in preferred embodiments, and with remdesivir, GS-441524, an es- ter or prodrug of GS-441524, or a compound of Formula 1 as viral proliferation inhibitor. The kit comprises the SARS-CoV-2 cellu- lar entry receptor and the viral proliferation inhibitor in sep- arate containers and/or as separate pharmaceutical compositions.

The kit or container in a kit or pharmaceutical preparation preferably comprises the ACE2 polypeptide in an amount of 700 μg to 105 mg per container with ACE2 polypeptide.

The kit or container in a kit or pharmaceutical preparation preferably comprises remdesivir in an amount of 1 mg to 80 mg in a container comprising remdesivir or a prodrug of remdesivir or an ester of remdesivir.

The kit may comprise one or more than one container for each substance, wherein a container may comprise one dose of either the SARS-CoV-2 cellular entry receptor or the viral prolifera- tion inhibitor (separate administration units or both (combined administration units). In the inventive methods, the SARS-CoV-2 cellular entry receptor or the viral proliferation inhibitor may be administered concurrently or separately or successively.

A container for the pharmaceutical composition or in a kit may comprise one administration dose in a suitable encapsula- tion, such as a vial, flask, bag, syringe or the like.

The kit comprises such containers, wherein the containers are packaged together, e.g. in a packaging envelope such as a box or bag.

It is also possible to combine any compound of the invention with one or more additional active therapeutic agents in a uni- tary dosage form for simultaneous or sequential administration to a patient. The combination therapy may be administered as a simultaneous or sequential regimen.

Co-administration of a compound of the invention (the SARS- CoV-2 cellular entry receptor or the viral proliferation inhibi- tor) with one or more other active therapeutic agents (the other of the group of the SARS-CoV-2 cellular entry receptor or the viral proliferation inhibitor) generally refers to simultaneous or sequential administration of a compound of the invention and one or more other active therapeutic agents, such that therapeu- tically effective amounts of the compound of the invention and one or more other active therapeutic agents are both present in the body of the patient.

Co-administration includes administration of unit dosages of the compounds of the invention before or after administration of unit dosages of one or more other active therapeutic agents, for example, administration of the compounds of the invention within seconds, minutes, or hours of the administration of one or more other active therapeutic agents. For example, a unit dose of a compound of the invention can be administered first, followed within seconds or minutes by administration of a unit dose of one or more other active therapeutic agents. Alternatively, a unit dose of one or more other therapeutic agents can be admin- istered first, followed by administration of a unit dose of a compound of the invention within seconds or minutes. In some cases, it may be desirable to administer a unit dose of a com- pound of the invention first, followed, after a period of hours (e.g., 1-12 hours), by administration of a unit dose of one or more other active therapeutic agents. In other cases, it may be desirable to administer a unit dose of one or more other active therapeutic agents first, followed, after a period of hours (e.g., 1-12 hours), by administration of a unit dose of a com- pound of the invention.

Throughout the present disclosure, the articles "a," "an," and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the arti- cle.

As used herein, words of approximation such as, without lim- itation, "about", "substantial" or "substantially" refer to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skill in the art recognize the modi- fied feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as "about" may vary from the stated value by e.g. ±10%.

As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising". The terms "comprise" and "comprising" should be interpreted as being "open" transitional terms that permit the inclusion of addition- al components further to those components that are recited. "Comprising" in connection with a component connected to a range shall mean that further non-recited components are allowed but the recited component linked to that range shall be within said range and not outside said range. The terms "consist" and "con- sisting of" should be interpreted as being "closed" transitional terms that do not permit the inclusion of additional components other than the recited. The term "consisting essentially of" should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamental- ly alter the nature of the recited subject matter, such as not permitting further non-recited active ingredients but allowing further non-recited auxiliary substances, like buffer compo- nents, fillers, and the like.

The present invention is further illustrated by the follow- ing examples, without being limited to these embodiments of the invention .

Examples :

Virus. SARS-CoV-2 was isolated on Vero-E6 cells, from a nasopha- ryngeal sample of a patient in Sweden (Monteil et al., Cell (2020) 181, 905-913). Virus titers were determined using a plaque assay as previously described (Becker et al., Proc Natl Acad Sci USA (2008) 105: 19944-19949) with fixation of cells 72 hours post infection. The SARS-CoV-2 isolate was sequenced by Next-Generation Sequencing (Genbank accession number MT093571). Preparation of soluble recombinant human. Clinical-grade human recombinant soluble ACE2 (hrsACE2, APN01, amino acids 1-740) was produced by Polymun Scientific (contract manufacturer) from CHO cells according to Good Manufacturing Practice guidelines and formulated as a physiologic aqueous solution (Monteil et al., Cell (2020) 181, 905-913; Haschke et al., Clin Pharmacokinet

(2013) 52, 783-792).

Liver and kidney cytotoxicity assays. To determine whether hrsA- CE2 or remdesivir at effective anti-viral doses are toxic to liver and kidney cells, liver spheroids (Bell et al., Sci Rep (2016) 6: 25187) and kidney organoids (Garreta et al., Nat Mater

(2019) 18: 397-405) were treated with several concentration of hrsACE2 (50-800 μg/ml) or remdesivir (4mM-80mM) in triplicate for 24h. Three days post-treatment (for kidney organoids) and 15h post-treatment (for liver spheroids) cytotoxicity (CC50) was determined using the CellTiter-Glo^® Luminescent cell viability assay (Promega) following manufacturer's protocol using 50m1 of CellTiter-Glo® Reagent per well.

Treatments of Vero E6 cells with hrsACE2 and remdesivir. Vero E6 cells were seeded in 48-well plates (5.10⁴ cells per well) (Sar- stedt) in DMEM containing 10% FBS. 24 hours post-seeding, dilu- tion of remdesivir were prepared in DMEM 5% FBS in a final vol- ume of IOOmI per well. Cells were treated with remdesivir or mock-treated for one hour. During this incubation time, hrsACE2 was mixed with different concentration of virus (1:1) in a final volume of IOOmI per well in DMEM (5% FBS) at 37°C for 30min then remdesivir was added or not to mixes before infection. Vero-E6 were then infected either with mixes containing hrsACE2/SARS- CoV-2, remdesivir/SARS-CoV-2 or hrsACE2/remdesivir/SARS-CoV-2 for 15 hours without washing. 15 hours post-infection, superna- tants were removed, cells were washed 3 times with PBS and then lysed using Trizol™ (Thermofisher) before analysis by qRT-PCR for viral RNA detection.

Treatments of kidney organoids with hrsACE2 and remdesivir. The kidney organoid model for SARS-CoV-2 infection has been de- scribed recently (Monteil et al., Cell (2020) 181, 905-913). Di- lution of remdesivir was prepared in DMEM 5% FBS in a final vol- ume of IOOmI per well. Kidneys were treated with remdesivir or mock-treated for one hour. During this incubation time, hrsACE2 (200μg/ml) was mixed with 106 PFU of virus (1:1) in a final volume of IOOmI per well in Advanced RPMI medium (Thermofisher) at 37°C for 30min then remdesivir was added or not to mixes be- fore infection. Kidney supernatants were then removed and kid- neys were infected either with mixes containing hrsACE2/SARS- CoV-2, remdesivir/SARS-CoV-2 or hrsACE2/remdesivir/SARS-CoV-2 for 3 days. 3 days post-infection, supernatants were removed, kidneys were washed 3 times with PBS and then lysed using Tri- zol™ (Thermofisher) before analysis by qRT-PCR for viral RNA de- tection. qRT-PCR. Samples were extracted using Direct-zol RNA MiniPrep kit (Zymo Research). qRT-PCR was performed using E-gene SARS- CoV-2 primers/probe following guidelines by the World Health Or- ganization (Corman et al., Diagnostic detection of Wuhan corona- virus 2019 by real-time RT-PCR, Berlin, 13.1.2020).

Forward primer: 5'-ACAGGTACGTTAATAGTTAATAGCGT-3' (SEQ ID NO: 3) Reverse primer: 5'-ATATTGCAGCAGTACGCACACA-3' (SEQ ID NO: 4) Probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-MGB (SEQ ID NO: 5)

RNase P was used as an endogenous gene control to normalize the levels of intracellular viral RNA.

Forward primer: AGATTTGGACCTGCGAGCG (SEQ ID NO: 6) Reverse primer GAGCGGCTGTCTCCACAAGT (SEQ ID NO: 7) probe: FAM-TTCTGACCTGAAGGCTCTGCGCG-MGB (SEQ ID NO: 8)

Statistics. Statistical analyses were conducted using GraphPad Prism 8 (GraphPad) and significance was determined by one-way ANOVA followed by Students t-test for internal groups.

Results. In infected Vero E6 cells, remdesivir and hrsACE2 sig- nificantly reduced the virus load in a dose dependent manner (Fig. la, b), confirming previous data (Monteil et al., Cell (2020) 181, 905-913; Wang et al., Cell Research (2020) 30, 269-

271). To evaluate cytotoxicity of both hrsACE2 and remdesivir, we exposed primary human liver spheroids and kidney organoids engineered from human stem cells, remdesivir exhibited signifi- cant liver and kidney toxicity at doses similar or even lower than the effective dose to control SARS-CoV-2 replication (Fig. la; Table 4). These toxicities are in agreement with clinical observations of ALT and AST elevations and increased creatinine in remdesivir-treated patients (Mulangu et al., N Engl J Med (2019) 381: 2293-2303; Grein et al., N Engl J Med (2020) 382: 2327-36) . Thus, both drugs separately exhibit similar and dose- dependent efficacies to inhibit SARS-CoV-2 replication, albeit at a higher concentration remdesivir exhibits organoid toxicity.

Table 4. CC50 data for remdesivir and hrsACE2 in Vero E6 cells, liver spheroids and kidney organoids

Vero Liver Kidneys

HACE2 6259g/mI 633MQ/mI >8G0pg/ml

Remdesivir 98,26mM 6,77mM 10,5mM

Based on this toxicity data, hrsACE2 was tested together with low-dose remdesivir. Treatment of Vero E6 cells with hrsA- CE2 (200μg/ml) plus low dose remdesivir (4mM; a concentration below the toxic range in the organotypic cell culture assays) reduced viral load by another 60% (Fig. lc). Similar to Vero E6 cells, the synergic effect of hrsACE2 and remdesivir extended to SARS-CoV-2 infected kidney organoids (Fig. Id), albeit at the dose used for hrsACE2 (200μg/ml). Finally, hrsACE2 doses were tested that showed very low anti-viral inhibitory efficacy (5 and 10μg/ml) and these doses were tested in combination with the non-toxic dose of remdesivir. Importantly, low doses of remdesivir and hrsACE2 synergized, resulting in strong reduction of SARS-CoV-2 infectivity (Fig. le). These data indicate that combination therapies targeting two different critical paths of SARS-CoV-2 replication, viral entry and intracellular viral RNA expansion, could be used to enhance the therapeutic effects and also reduce drug doses to safe levels.

Previously, the first genetic evidence that ACE2 functions as a negative regulator of the renin angiotensin system (RAS) in multiple tissues such as the cardiovascular system was provided (Crackower et al., Nature (2002) 417, 822-828). Genetic experi- ments showed that ACE2 is the critical receptor for SARS-CoV in vivo and that ACE2 protects the lung from injury, providing a molecular explanation for the severe lung failure and death due to SARS-CoV infections (Imai et al., Nature (2005) 436: 112-116; Kuba et al., Nat Med (2005) 11: 875-879). The data provided here significantly extend these findings and show that combination of two therapeutic modalities with conceptually different targets, blocking entry via hrsACE2 and inhibiting intracellular viral RNA replication via remdesivir, exhibit strong synergic effects at sub-toxic concentrations. Our data indicate that combination therapies are useful for safe and effective viral control of a SARS-CoV-2 infection in COVID-19 patients.

Claims

Claims:

1. A method of treating a SARS-CoV-2 infection in a patient comprising administering a SARS-CoV-2 cellular entry receptor and a viral proliferation inhibitor to said patient.

2. The method of claim 1, wherein the SARS-CoV-2 cellular entry receptor is a receptor of Spike glycoprotein of SARS-CoV-2.

3. The method of claim 1, wherein the SARS-CoV-2 cellular entry receptor is an ACE2 polypeptide.

4. The method of claim 3, wherein the ACE2 polypeptide is solu ble ACE2.

5. The method of claim 3, wherein the ACE2 polypeptide lacks the transmembrane domain of ACE2.

6. The method of claim 3, wherein the ACE2 polypeptide compris es amino acids 19 to 600 of SEQ ID NO: 1.

7. The method of claim 3, wherein the ACE2 polypeptide compris es amino acids 18 to 740 of SEQ ID NO: 1.

8. The method of any one of claims 1 to 7, wherein the viral proliferation inhibitor is a viral RNA polymerase inhibitor, a viral protease inhibitor, a host cell inhibitor, preferably a nucleoside or nucleotide analogue.

9. The method of any one of claims 1 to 8, wherein the viral proliferation inhibitor is remdesivir or GS-441524 or a GS- 441524 prodrug or ester.

10. The method of any one of claims 1 to 9, wherein the viral proliferation inhibitor is a host cell protease inhibitor, pref- erably an inhibitor of transmembrane protease serine 2, more preferably camostat, camostat mesylate, nafamostat or nafamostat mesylate.

11. The method of any one of claims 1 to 9, wherein the SARS- CoV-2 cellular entry receptor is an ACE2 polypeptide at a dose of 10 μg/kg to 1500 μg/kg daily.

12. The method of any one of claims 1 to 10, wherein the viral proliferation inhibitor is remdesivir at a dose of 80 mg daily or lower; or a daily dose of 1.5 mg/kg or lower; or a dose suf- ficient to result in a plasma concentration of remdesivir of 800 ng/mL or lower (1.3 μM or lower) 1 hour after administration.

13. The method of any one of claims 1 to 12, wherein the viral proliferation inhibitor is camostat at a dose of more than 300 mg daily, preferably more than 600 mg daily.

14. A SARS-CoV-2 cellular entry receptor and/or a viral prolif- eration inhibitor for use in a method of any one of claims 1 to 13.

15. A kit comprising containers with an ACE2 polypeptide and with remdesivir, GS-441524, an ester or prodrug of GS-441524, or a compound of Formula 1, or camostat, camostat mesylate, nafa- mostat or nafamostat mesylate.

16. A pharmaceutical preparation comprising an ACE polypeptide and remdesivir, GS-441524, an ester or prodrug of GS-441524, or a compound of Formula 1, or camostat, camostat mesylate, nafa- mostat or nafamostat mesylate, in a container.

17. Kit or pharmaceutical preparation according to claim 15 or 16, wherein the ACE2 polypeptide is in an amount of 700 μg to 105 mg per container with ACE2 polypeptide.

18. Kit or pharmaceutical preparation according to any one of claims 15 to 17, wherein remdesivir, GS-441524, an ester or pro- drug of GS-441524, or a compound of Formula 1 is in an amount of 1 μmol to 135 μmol in a container comprising remdesivir, GS- 441524, an ester or prodrug of GS-441524, or a compound of For- mula 1.

19. Kit or pharmaceutical preparation according to any one of claims 15 to 17, wherein camostat is in a dose of more than 300 mg, preferably more than 600 mg, in a container comprising camo- stat.