WO2022005101A1 - Pharmaceutical composition for prevention or treatment of fatty liver disease - Google Patents

Pharmaceutical composition for prevention or treatment of fatty liver disease Download PDF

Info

Publication number
WO2022005101A1
WO2022005101A1 PCT/KR2021/007940 KR2021007940W WO2022005101A1 WO 2022005101 A1 WO2022005101 A1 WO 2022005101A1 KR 2021007940 W KR2021007940 W KR 2021007940W WO 2022005101 A1 WO2022005101 A1 WO 2022005101A1
Authority
WO
WIPO (PCT)
Prior art keywords
fibrosis
pharmaceutical composition
liver
alkyl
group
Prior art date
Application number
PCT/KR2021/007940
Other languages
French (fr)
Korean (ko)
Inventor
권영근
배초롱
장해영
김명화
안구현
Original Assignee
연세대학교 산학협력단
주식회사 큐라클
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단, 주식회사 큐라클 filed Critical 연세대학교 산학협력단
Publication of WO2022005101A1 publication Critical patent/WO2022005101A1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/125Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives containing carbohydrate syrups; containing sugars; containing sugar alcohols; containing starch hydrolysates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/575Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00Food ingredients
    • A23V2250/30Other Organic compounds
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • It relates to a novel pharmaceutical composition for the prevention or treatment of fatty liver disease.
  • Non-alcoholic fatty liver disease is a broad term encompassing chronic liver disease and is a major cause of symptoms related to metabolic syndrome including type 2 diabetes mellitus and insulin resistance (Maurice J et al. al., Clin Med (Lond)., 2018).
  • Non-alcoholic steatohepatitis is an advanced form of non-alcoholic fatty liver disease, and typically occurs together with liver steatosis, inflammation, and fibrosis.
  • various tests for the treatment of nonalcoholic steatohepatitis have been conducted through several studies, but there is no case approved as an effective treatment for nonalcoholic steatohepatitis so far.
  • the vascular endothelium is a key barrier between systemic circulation and tissues.
  • the endothelium of the liver mainly consists of liver sinusoidal endothelial cells (LSECs), which help the liver to maintain homeostasis and contribute to effective nutrient and gas exchange. do.
  • LSECs liver sinusoidal endothelial cells
  • Hepatic injury often begins with damage to the hepatic sinus endothelial cells.
  • the importance of hepatic sinus endothelial cell dysfunction in the pathogenesis of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis has been previously discussed. It has been reported in detail through studies (Villanova N et al., Hepatology, 2005; Senturk O et al., Intern Med J., 2008).
  • capillary endothelial cells of the hepatic sinusoids increase, and inflammatory and fibrotic features appear. Therefore, prevention of capillary capillary endothelial cells in the liver will be an important factor in the treatment of nonalcoholic steatohepatitis.
  • One object of the present invention is to provide a pharmaceutical composition for preventing or treating fatty liver disease, comprising a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient will do
  • Another object of the present invention is to provide a health functional food for preventing or improving fatty liver disease, comprising the compound represented by Formula 1, an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient will do
  • One aspect of the present invention is
  • composition for preventing or treating fatty liver disease is provided.
  • X is oxygen or sulfur
  • R 1 is hydrogen, halo, C 1-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-15 containing oxygen, sulfur or nitrogen as a heteroatom Heterocycloalkyl, C 3-15 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxyalkoxyalkyl, containing oxygen, sulfur or nitrogen as heteroatom C 3-10 heterocycloalkenyl, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 alkyl, carboxy-alkenyl
  • R 21 is C 2-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-30 carboxyalkyl, C 2-30 alkylcarboxyl, C 3-30 carboxy alkenyl, C 3-30 alkenyl, carboxyl, C 3-30 alkyl, carboxyalkyl, C 3-30 alkyl, carboxy alkenyl, C 3-30 alkenyl, carboxy alkyl, C 4-30 alkenyl, carboxy-alkenyl, heteroaryl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as atom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxy Alkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatom, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide
  • R 22 is hydrogen, hydroxy, halo or C 1-10 alkyl
  • R 23 is hydrogen, hydroxy or C 1-10 alkyl
  • R 21 together with R 22 and R 23 may form a double bond to the carbon it bonds;
  • R 23 together with R 21 and R 22 may form a double bond to the carbon it bonds;
  • R 22 when R 21 or R 23 forms a double bond at the carbon, R 22 contains no atoms;
  • R 3 and R 4 are each independently hydrogen or C 1-10 alkyl.
  • a health functional food for preventing or improving fatty liver disease containing a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
  • X, , R 1 , R 21 , R 22 , R 23 , R 3 , and R 4 are as defined above.
  • Another aspect of the present invention provides a method for treating fatty liver disease, comprising administering the compound, a stereoisomer thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof to an individual or subject in need thereof. .
  • Another aspect of the present invention provides the compound, a stereoisomer, a hydrate thereof, or a pharmaceutically acceptable salt thereof for use in the treatment of fatty liver disease.
  • Another aspect of the present invention provides the use of the compound, a stereoisomer, a hydrate thereof, or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for the treatment of fatty liver disease.
  • the present invention provides a novel pharmaceutical composition for use in the prevention or treatment of fatty liver disease, wherein the pharmaceutical composition has an effect of reducing fat accumulation in the liver, inhibiting liver fibrosis, alleviating hepatitis, and liver sinusoidal endothelial cells (liver sinusoidal endothelial cells). cells, LSECs), and the capillary attenuation effect.
  • Figure 1a is a choline-deficient L-amino acid (CDAA) induced non-alcoholic steatohepatitis (NASH) in mice, study 1 of Experimental Example 1 to confirm the effect of Example 1 on metabolic indicators (3 weeks) ), the schematic diagram of study 2 (6 weeks) is shown.
  • CDAA choline-deficient L-amino acid
  • NASH non-alcoholic steatohepatitis
  • GTT glucose tolerance test
  • qPCR quantitative real-time polymerase chain reaction
  • qPCR quantitative real-time polymerase chain reaction
  • FIG. 4c to 4f are ⁇ -SMA mRNA ( FIG. 4c ), Col1 ⁇ mRNA ( FIG. 4d ), Col4 ⁇ mRNA ( FIG. 4e ) involved in fibrosis-related genes in order to confirm the liver fibrosis alleviation effect of Example 1 in CDAA-induced NASH mice.
  • qPCR quantitative real-time polymerase chain reaction
  • Figure 6 shows the chilin deficient diet-induced NASH model.
  • One aspect of the present invention is
  • composition for preventing or treating fatty liver disease is provided.
  • X is oxygen or sulfur
  • R 1 is hydrogen, halo, C 1-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-15 containing oxygen, sulfur or nitrogen as a heteroatom Heterocycloalkyl, C 3-15 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxyalkoxyalkyl, containing oxygen, sulfur or nitrogen as heteroatom C 3-10 heterocycloalkenyl, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 alkyl, carboxy-alkenyl
  • R 21 is C 2-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-30 carboxyalkyl, C 2-30 alkylcarboxyl, C 3-30 carboxy alkenyl, C 3-30 alkenyl, carboxyl, C 3-30 alkyl, carboxyalkyl, C 3-30 alkyl, carboxy alkenyl, C 3-30 alkenyl, carboxy alkyl, C 4-30 alkenyl, carboxy-alkenyl, heteroaryl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as atom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxy Alkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatom, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide
  • R 22 is hydrogen, hydroxy, halo or C 1-10 alkyl
  • R 23 is hydrogen, hydroxy or C 1-10 alkyl
  • R 21 together with R 22 and R 23 may form a double bond to the carbon it bonds;
  • R 23 together with R 21 and R 22 may form a double bond to the carbon it bonds;
  • R 22 when R 21 or R 23 forms a double bond at the carbon, R 22 contains no atoms;
  • R 3 and R 4 are each independently hydrogen or C 1-10 alkyl.
  • X in Formula 1 may be oxygen.
  • R 1 of Formula 1 is hydrogen, halo, C 1-10 alkyl, C 3-8 cycloalkyl, C 2-10 alkenyl, C 3-8 cycloalkenyl, oxygen, sulfur or nitrogen as a heteroatom C 2-8 heterocycloalkyl comprising, C 3-10 heterocycloalkylalkyl comprising oxygen, sulfur or nitrogen as heteroatom, C 2-20 alkoxyalkyl, C 3-20 alkoxyalkoxyalkyl, oxygen as heteroatom, C 3-8 heterocycloalkenyl containing sulfur or nitrogen, C 1-10 alcohol, C 1-10 alkenol, C 2-20 acyl, C 1-10 amide, C 1-5 amine, C 2-15 ester, sulfate, carboxyl, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 Alkylcarboxyalkeny
  • R 1 of Formula 1 is hydrogen, C 1-10 alkyl, C 3-8 cycloalkyl, C 2-10 alkenyl, C 3-8 cycloalkenyl, C 2-8 heterocyclo containing oxygen as a heteroatom Alkyl, C 3-10 heterocycloalkylalkyl with oxygen as heteroatom, C 2-20 alkoxyalkyl, C 3-10 alkoxyalkoxyalkyl, C 3-8 heterocycloalkenyl with oxygen as heteroatom, C 1-10 alcohol, C 1-10 alkenol, C 1-10 amide, C 1-5 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxyalkenyl, C 3-20 Alkylcarboxyl , C 3-20 Alkenylcarboxyl , C 3-20 Alkylcarboxyalkyl, C 3-20 Alkylcarboxyalkenyl, C 3-20 Alkenylcarboxyalkyl , C 4-20 Alkenyl
  • the cycloalkyl or heterocycloalkyl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, C 6-20 aryl , may be substituted with C 7-20 arylcarboxyl or a combination thereof;
  • the C 3-10 cycloalkenyl or heterocycloalkenyl is hydroxy, halo, C 1-5 alkyl, C 2-8 alkylcarboxyl, C 3-8 alkylcarboxylalkyl, C 1-5 alcohol, C 1 -5 alkoxy, C 2-8 alkoxyalkyl, C 6-20 aryl, C 7-20 arylcarboxyl, or a combination thereof; said aryl is substituted by hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or combinations thereof can
  • the heteroaryl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or a combination thereof It may be substituted.
  • R 21 in Formula 1 is straight-chain or branched C 2-15 alkyl, C 3-10 cycloalkyl, C 2-15 alkenyl, C 3-10 cycloalkenyl, C 2-15 carboxyalkyl, C 2-15 Alkylcarboxyl , C 3-15 carboxyalkenyl, C 2-15 alkenylcarboxyl, C 3-15 alkylcarboxyalkyl, C 3-15 alkylcarboxyalkenyl, C 3-15 alkenylcarboxyalkyl, C 2- 30 alkenylcarboxyalkenyl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-20 Alkoxyalkyl , C 3-30 alkoxyalkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatoms, C 1-20 alcohol, C 1-20 alkenol, C 2-30
  • R 23 of Formula 1 may be C 1-5 alkyl or may form a double bond with respect to carbon bonded together with R 21 and R 22 .
  • R 3 and R 4 may be each independently C 1-3 alkyl.
  • R 23 is C 1-3 alkyl
  • R 21 and R 22 together form C 1-5 alkylvinyl, wherein the alkylvinyl may be substituted with C 1-3 alkoxycarbonyl.
  • R 1 may be C 3-8 heterocycloalkenyl containing oxygen, sulfur or nitrogen.
  • R 1 may be C 5 heterocycloalkenyl containing oxygen.
  • Chemical Formula 1 is a pharmaceutical composition, characterized in that it is a compound represented by the following Chemical Formula 2:
  • the fatty liver disease is simple fatty liver (fatty liver), alcoholic fatty liver (alcoholic fatty liver), nutritive fatty liver, starvation fatty liver, obese fatty liver, diabetic fatty liver, steatohepatitis, non-alcoholic fatty liver disease (non-alcoholic fatty) It may be at least one selected from the group consisting of liver disease, NAFLD), non-alcoholic steatohepatitis (NASH), and fibrosis.
  • the fibrosis may be one or more selected from the group consisting of renal fibrosis, cardiac fibrosis, pancreatic fibrosis, pulmonary fibrosis, vascular fibrosis, skin fibrosis, bone marrow fibrosis, liver fibrosis, intestinal fibrosis, scleroderma, and cystic fibrosis, but is limited thereto. it is not
  • the liver fibrosis is liver cirrhosis, hepatorenal syndrome, peliosis hepatis, metabolic liver disease, chronic liver disease, hepatitis B virus infection, hepatitis C virus infection. Hepatitis D virus infection, Schistosomiasis, alcoholic liver disease, nonalcoholic steatohepatitis, diabetes, protein deficiency, coronary artery disease, autoimmune hepatitis, ⁇ -1-Antitrypsin deficiency And it may be one selected from the group consisting of primary biliary cirrhosis, but is not limited thereto.
  • the lung fibrosis is bronchitis, acute bronchitis, diffuse panbronchiolitis (DPB), bronchiolitis, idiopathic pulmonary fibrosis (IPF), acute interstitial pneumonia, hyperactive interstitial pneumonia , lung transplantation, cystic fibrosis, radiation-induced pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), asthma, bronchiectasis, tuberculosis, pneumonia, pneumoconiosis, hypersensitivity pneumonia, pulmonary edema and sarcoids. It may be one or more selected from the group consisting of sarcoidosis, but is not limited thereto.
  • the renal fibrosis is kidney failure, catheterization, diabetic nephropathy, urinary tract obstruction, glomerular sclerosis, renal tubular interstitial, glomerulonephritis, chronic renal failure, diabetes mellitus.
  • Sexual proximal tubular fibrosis acute renal injury, chronic kidney disease, end-stage renal disease, ischemia-reperfusion injury, damage caused by nephrotoxic agents, damage caused by radiocontrast media, and albuminuria It may be at least one selected from the group consisting of, but is not limited thereto.
  • the liver fibrosis or cirrhosis may be caused by nonalcoholic steatohepatitis.
  • the nonalcoholic steatohepatitis may be induced by a choline-deficient L-amino acid diet.
  • the pharmaceutical composition may improve hepatic inflammation or systemic inflammation, may inhibit lipid accumulation in the liver, and may inhibit liver sinusoidal endothelial cells (LSECs) of It may also reduce capillarization.
  • LSECs liver sinusoidal endothelial cells
  • the pharmaceutical composition can reduce the expression of alanine aminotransferase (ALT) or aspartate transaminase (AST), and triglycerides (TG) or total cholesterol (total cholesterol, TC) content may be reduced.
  • ALT alanine aminotransferase
  • AST aspartate transaminase
  • TG triglycerides
  • total cholesterol total cholesterol
  • the pharmaceutical composition can reduce the expression of lipogenesis-related factors, and the lipid synthesis-related factors refer to factors known to be involved in conventional lipid synthesis, for example, sterol regulatory element-binding transcription (SREBP1c).
  • SREBP1c sterol regulatory element-binding transcription
  • factor-1c acetyl-CoA carboxylase
  • PPAR ⁇ peroxisome proliferator-activated receptors ⁇
  • FAS fatty acid synthase
  • the pharmaceutical composition can reduce the expression of a pro-inflammatory factor
  • the inflammatory factor refers to a conventionally known inflammatory factor, for example, F4/80, MCP-1 (monocyte chemoattractant protein-1) , IL-1 ⁇ (interleukin 1 ⁇ ), IL-1 ⁇ (interleukin 1 ⁇ ), TNF- ⁇ (tumor necrosis factor- ⁇ ), IL-6 or IL-8.
  • the pharmaceutical composition can reduce the expression of a fibrosis (pro-fibrotic)-related (fibrosis-related) factor
  • the fibrosis-related factor refers to a factor known as a factor involved in conventional fibrosis.
  • ⁇ -SMA ⁇ -smooth muscle actin
  • Col1 ⁇ collagen 1 ⁇
  • Col4 ⁇ Collagen 4 ⁇
  • TGF- ⁇ transforming growth factor- ⁇
  • the pharmaceutical composition may reduce the content of hydroxyproline.
  • the pharmaceutical composition may decrease the expression of an endothelial adhesion molecule, for example, E-selectin, intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) or cluster of differentiation 31 (CD31).
  • E-selectin intercellular adhesion molecule-1
  • VCAM-1 vascular cell adhesion molecule-1
  • CD31 cluster of differentiation 31
  • the compound represented by Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, and as the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful.
  • Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, phosphorous acid, etc., aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes.
  • Non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids, etc., organic acids such as trifluoroacetic acid, acetate, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid, etc.
  • Such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and Odide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, sube Late, sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfon
  • the acid addition salt according to the present invention can be prepared by a conventional method, for example, a precipitate formed by dissolving the derivative of Formula 1 in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, etc. and adding an organic or inorganic acid It can be prepared by filtration and drying, or by distilling the solvent and excess acid under reduced pressure, followed by drying and crystallization in an organic solvent.
  • an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, etc.
  • a pharmaceutically acceptable metal salt can be prepared using a base.
  • the alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate.
  • it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt.
  • the corresponding salt is also obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg silver nitrate).
  • the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof may be administered in various oral and parenteral formulations during clinical administration.
  • formulation it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, and emulsions.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • a pharmaceutical composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient may be administered parenterally, and parenteral administration is administered by subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. depending on how
  • the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is mixed with water together with a stabilizer or buffer to prepare a solution or suspension, which is an ampoule or vial unit dosage form.
  • a stabilizer or buffer to prepare a solution or suspension, which is an ampoule or vial unit dosage form.
  • the composition may be sterilized and/or contain adjuvants such as preservatives, stabilizers, wetting or emulsifying agents, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, and mixing, granulation, in the usual manner It can be formulated according to the method of formulation or coating.
  • Another aspect of the present invention provides a health functional food for preventing or improving fatty liver disease, comprising a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient do:
  • X, , R 1 , R 21 , R 22 , R 23 , R 3 , and R 4 are as defined above and thus omitted.
  • the compound represented by Formula 1 according to the present invention may be added to food as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be suitably determined according to the purpose of its use (for prevention or improvement).
  • the amount of the compound in the health food may be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food.
  • the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.
  • the compound represented by Formula 1 according to the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the compound represented by Formula 1 of the present invention may contain natural fruit juice, fruit juice, and pulp for the production of fruit juice beverages and vegetable beverages.
  • the compound represented by Formula 1 according to the present invention can be formulated in various forms depending on the purpose.
  • the above ingredients are mixed and filled in an airtight bag to prepare a powder.
  • tablets are prepared by tableting according to a conventional manufacturing method of tablets.
  • the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.
  • the content of the above ingredients per 1 ampoule (2 ml) is prepared.
  • each component is added to purified water to dissolve, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 ml by adding purified water, and then filled in a brown bottle. Sterilize to prepare a liquid.
  • GTT intraperitoneal glucose tolerance test
  • Triglycerides and total cholesterol were extracted from liver tissue with chloroform-methanol (2:1, vol:vol). Specifically, chloroform-methanol was added to the homogenized liver tissue, vortexed and centrifuged, and the settled phase was collected and evaporated at room temperature in a fume hood. The resulting semi-dried pellets were dissolved in 1% Triton X-100 (VWR, USA). Liver and serum triglyceride (TG) and total cholesterol (TC) contents were quantified using a commercially available kit (Asan Pharmaceutical Co., Seoul, Korea).
  • Liver function parameters such as alanine aminotransferase (ALT) and aspartate transaminase (AST) activities were also measured using a commercially available kit (Asan Pharmaceutical Co., Seoul, Korea). Serum concentrations of TNF- ⁇ and IL-6 were determined using Quantikine ELISA kits (R&D Systems, Minneapolis, MN, USA).
  • liver was fixed in 4% paraformaldehyde in PBS (Sigma, Steinheim, Germany) at room temperature for 48 hours, embedded in paraffin, partitioned into 6 ⁇ m, and stained with hematoxylin and eosin (H&E). Liver fibrosis was assessed by staining with the Picro Sirius Red kit (Abcam, Cambridge, MA, USA).
  • paraffin-embedded sections were treated with F4/80 (1:60; AbD Serotec, Oxford, UK), ⁇ -smooth muscle actin ( ⁇ -SMA, 1:300, Abcam), ICAM-1 (1: 200; Santa Cruz, CA, USA), and CD31 (1:200; Santa Cruz, CA, USA) and CD31 (1:200, R&D System, MN, USA) antibodies.
  • An eclipse microscope Nakon, Tokyo, Japan
  • F4/80, Sirius Red, ⁇ -SMA, ICAM-1 and CD31 positive regions were quantified using Image J.
  • qRT-PCR Quantitative real-time polymerase chain reaction
  • CD31 cluster of differentiation
  • FAS fatty acid synthase
  • ICAM-1 intercellular adhesion molecule 1
  • IL-1 ⁇ interleukin-1 ⁇
  • MCP1 monocyte chemoattractant protein-1
  • PPAR ⁇ peroxisome proliferator-activated receptor ⁇
  • SREBP-1c SREBP-1c, sterol regulatory element binding protein-1c
  • TGF- ⁇ transforming growth factor- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • VCAM-1 vascular cell adhesion protein-1
  • hydroxyproline levels were measured using a colorimetric assay kit (Bio Vision, Milpitas, CA). Absorbance was measured at 560 nm using a microplate reader (BMG Labtech, Ortenberg, Germany).
  • Compound 1 represented by the following formula (2) has a compound name of (E)-methyl 6-((3S,8S,9S,10R,13S,14S,17R)-3-(((5S,6R)-5-acetoxy- 6-(acetoxymethyl)-5,6-dihydro-2H-pyran-2-yl)oxy)-10,13-dimethyl-2,3,4,7,8,9,10,11,12, 13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl)hept-5-enoate, under the code name SAC-1004, Republic of Korea Patent Publication 10-2011-0047170 compounds disclosed in
  • Compound 1 is Maharjan S et al., Sac-1004, a novel vascular leakage blocker, enhances endothelial barrier through the cAMP/Rac/cortacin pathway. Biochem Biophys Res Commun. 2013; 435: synthesized according to the method described in 420-427.
  • the pharmaceutical composition according to Example 1 was prepared by using Compound 1 (50 mg/mL) with dimethyl sulfoxide (DMSO) as a solvent, and a diluted solution was prepared with phosphate buffered saline (PBS).
  • DMSO dimethyl sulfoxide
  • PBS phosphate buffered saline
  • mice Seven-week-old male mice were purchased from DBL (Seoul, Korea) and used in the experiment. Experimental animals were separated into the following groups after maintaining diet control (Purina Laboratory rodent diet 38057; Purina Korea Inc., Seoul, Korea) for 1 week:
  • CD group choline-deficient L-amino acid (CDAA) diet group (CDAA; A06071302; Research Diets Inc., New Brunswick, NJ);
  • Example 1 group CDAA diet group treated with compound 1 10 mg/kg/day for 3 weeks or 6 weeks
  • mice in the 3-week and 6-week groups received the CDAA diet for 1 week and 3 weeks, respectively, and then were treated with Compound 1 along with the CDAA diet for 2 weeks and 3 weeks. Mice were treated with an equal volume of oral control solution, vehicle or compound 1 (10 mg/kg body weight) once daily.
  • mice All experimental mice were housed in standard cages at constant temperature (23° C.) and humidity (60%) in a 12:12-hour light:dark cycle, with no restrictions on access to food and water. Mice were weighed once a week and fasted for 16 h before being euthanized for tissue collection. All experiments involving animals were previously approved by the Animal Care and Use Committee of the Yonsei University (Seoul, Korea), and were performed according to the approved guidelines (IACUC-A-201901-854-02).
  • Experimental Example 1 was performed in CDAA-induced NASH mice for 3 weeks (study 1) or 6 weeks (study 1) for Con group, CD group, and Example 1 group to confirm the effect on the metabolic parameters of Example 1 2), and test mice were orally treated with Example 1 for 2 weeks (study 1) or 3 weeks (study 2), respectively, 2 or 3 weeks before the end of the experiment ( FIG. 1A ).
  • the mouse according to Study 1 is a mild NASH mouse model
  • the mouse according to Study 2 is a severe NASH (moderate NASH) mouse model.
  • Example 1 can alleviate the liver damage of CDAA-induced NASH mice.
  • Example 1 affects the lipid accumulation in the liver in CDAA-induced NASH mice and to confirm the preventive effect on hepatic steatosis. It was carried out according to ⁇ Experimental Protocol> 2, 3, 4 and 6. The results are shown in FIGS. 2A to 2I.
  • fatty liver induced through the CDAA diet could be identified through the morphological analysis of the liver in the area stained with H&E.
  • the Example 1 group mice showed reduced lipid droplets compared to the CD group at both 3 weeks (study 1) and 6 weeks (study 2) ( FIGS. 2a and 2b ).
  • liver-to-body weight ratio increased in the group fed the CDAA diet compared to the control group, whereas the liver-to-body weight ratio of the CD group and the Example 1 group There was no significant difference in the proportions (Fig. 2c).
  • Example 1 significantly reduced the TG level in the liver ( FIG. 2D ) and the TC level in the liver ( FIG. 2E ).
  • hepatic TG levels did not show a significant decrease in mild NASH mice, whereas severe NASH mice effectively reduced hepatic TG levels, and liver TC levels were effectively reduced in both mild and severe NASH mice.
  • Example 1 sterol regulatory factor-binding transcription factor-1c (SREBP-1c) and acetyl-CoA carboxylase (ACC) mRNA was not affected by the treatment of Example 1 (Fig. 2f and 2g), on the other hand, FAS mRNA, as well as PPAR ⁇ mRNA expression, a transcription factor that regulates lipid metabolism and inflammatory response in the pathogenesis of NAFLD, was confirmed to be significantly reduced by the treatment of Example 1 (Fig. 2h and Fig. 2i).
  • SREBP-1c sterol regulatory factor-binding transcription factor-1c
  • ACC acetyl-CoA carboxylase
  • Example 1 effectively reduced the degree of liver damage and lipid accumulation in the liver of CDAA-induced NASH mice, and that this effect was correlated with the down-regulation of lipid synthesis-related genes such as FAS and PPAR ⁇ . .
  • Hepatitis is an important factor in NASH progression, and liver damage induces activation of Kupffer cells, resulting in increased expression of inflammatory cytokines and chemokines.
  • LSECs Liver sinusoidal endothelial cells
  • macrophages play an important anti-inflammatory role, which produces inflammatory mediators in NASH, and release of inflammatory cytokines from LSEC activates macrophages. It further contributes to the inflammatory response.
  • LSECs undergo morphological and functional changes in the fatty liver in the early stages of NAFLD. Therefore, in order to confirm the alleviation effect on hepatitis and systemic inflammation of Example 1 in CDAA-induced NASH mice, it was carried out according to ⁇ Experimental Protocol> 2, 3, 4 and 6. The results are shown in FIGS. 3A to 3G.
  • MCP-1 monocyte chemoattractant protein-1
  • the macrophage marker F4/80 in mice with mild or severe CDAA-induced NASH of the Example 1 group It was confirmed that the infiltration was significantly reduced ( FIGS. 3E and 3F ).
  • the level of inflammatory cytokines such as IL-6 was significantly decreased in the Example 1 group (particularly, mild NASH mice), and the mouse serum TNF- ⁇ level was also significantly decreased (particularly, severe NASH mice).
  • Example 1 has the effect of attenuating systemic inflammation by reducing macrophage infiltration in mice with NASH, and has the effect of reducing the expression of major inflammatory factors involved in the development of steatohepatitis.
  • LSECs play a role in preventing fibrosis by blocking HSC activation, whereas capillary LSECs release inflammatory mediators and contribute to recruitment of macrophages and HSCs to promote inflammation and fibrosis.
  • HSCs hepatic stellate cells
  • Example 1 is mild CDAA- It can be seen that there is an effect of inhibiting fibrosis in induced NASH mice.
  • fibrosis-related genes such as ⁇ -SMA ( ⁇ -smooth muscle actin), Col1 ⁇ (collagen 1 ⁇ ), Col4 ⁇ (collagen 4 ⁇ ) and TGF- ⁇ (transforming growth factor- ⁇ ) in the Example 1 group compared to the CD group It can be seen that mRNA expression is significantly reduced.
  • Example 1 has the effect of reducing the deposition of light fibrillar collagen in the liver by reducing the accumulation of collagen by suppressing HSC in the liver.
  • LSECs liver sinusoidal endothelial cells
  • NASHD nonalcoholic fatty liver disease
  • LSEC is E-selectin (E-selectin), ICAM-1 (intercellular adhesion molecule-1), VCAM-1 (vascular cell adhesion molecule-1) and CD31 (cluster of differentiation) 31), which is characterized by increasing the expression of endothelial cell adhesion molecules, such as molecules that affect cell-cell interactions and are tempered by inflammatory cytokines. Therefore, in order to analyze the changes in ICAM-1 and CD31 expression through immunohistochemical staining, it was performed according to ⁇ Experimental Protocol> 3, 4 and 6. The results are shown in Figures 5a to 5f.
  • the ICAM-1 positive region was significantly decreased in both the Example 1 group of mild NASH mice and severe NASH mice (FIG. 5A), and the expression of CD31 was effectively decreased in mild NASH mice (FIG. 5B). Since CD31 is a marker capable of evaluating increased LSEC capillaryization in NASH, it can be confirmed that the treatment of Example 1 in mild CDAA-induced NASH mice reduced the expression of CD31 through the above results.
  • Example 1 can play a role in downregulating the expression of cell adhesion molecules E-selectin, ICAM-1 and VCAM-1 by LSEC, and excellently improve LSEC capillaryization in mice with NASH It can be seen that there is an effect that

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The present invention provides a novel pharmaceutical composition for use in preventing or treating fatty liver disease. The pharmaceutical composition exhibits the effects of reducing fat accumulation in the liver, suppressing hepatic fibrosis, alleviating hepatitis and capillarization of liver sinusoidal endothelial cells (LSECs), etc. and as such, can be an important therapeutic agent candidate for fatty liver disease or metabolic syndromes.

Description

지방간 질환의 예방 또는 치료를 위한 약학적 조성물Pharmaceutical composition for preventing or treating fatty liver disease
지방간 질환의 예방 또는 치료를 위한 신규한 약학적 조성물에 관한 것이다.It relates to a novel pharmaceutical composition for the prevention or treatment of fatty liver disease.
간은 신진대사를 조절하는데 중요한 역할을 하며, 지방조직, 골격근에 영향을 미치고 지질 대사의 필수적인 역할을 수행한다. 지방간은 지질 축적 및 지질 처리의 불균형한 조절의 결과로 발생하며 일반적으로 NAFLD/NASH 진행 초기에 발생한다. 비알콜성 지방간 질환(Non-alcoholic fatty liver disease, NAFLD)은 만성 간 질환을 포괄하는 광범위한 용어이며, 제2형 당뇨병, 인슐린 저항성을 포함하는 대사 증후군과 관련된 증상의 주요 원인이 된다 (Maurice J et al., Clin Med(Lond)., 2018). 비알콜성 지방간염(Non-alcoholic steatohepatitis, NASH)은 비알콜성 지방간 질환이 진행된 형태로서, 전형적으로 간의 지방증, 염증, 섬유증과 함께 발병한다. 한편, 몇몇 연구를 통해 비알콜성 지방간염의 치료를 위한 다양한 시험이 진행되었으나 현재까지 비알콜성 지방간염의 효과적인 치료법으로 승인된 사례가 없다.The liver plays an important role in regulating metabolism, affects adipose tissue and skeletal muscle, and plays an essential role in lipid metabolism. Fatty liver occurs as a result of disproportionate regulation of lipid accumulation and lipid processing and usually occurs early in the NAFLD/NASH progression. Non-alcoholic fatty liver disease (NAFLD) is a broad term encompassing chronic liver disease and is a major cause of symptoms related to metabolic syndrome including type 2 diabetes mellitus and insulin resistance (Maurice J et al. al., Clin Med (Lond)., 2018). Non-alcoholic steatohepatitis (NASH) is an advanced form of non-alcoholic fatty liver disease, and typically occurs together with liver steatosis, inflammation, and fibrosis. On the other hand, various tests for the treatment of nonalcoholic steatohepatitis have been conducted through several studies, but there is no case approved as an effective treatment for nonalcoholic steatohepatitis so far.
혈관내피(vascular endothelium)는 체순환과 조직 사이의 핵심적인 장벽이다. 간의 내피는 주로 간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs)로 이루어져 있는데, 상기 간 동모양 혈관내피세포는 간이 항상성을 유지할 수 있도록 돕고 효과적인 영양소와 가스 교환이 이루어질 수 있도록 기여하는 역할을 한다. 간 손상은 종종 간 동모양 혈관내피세포에 손상이 생겨 시작되는데, 이에 관해 비알콜성 지방간 질환 및 비알콜성 지방간염의 발병기전에 있어서의 상기 간 동모양 혈관내피세포 기능 장애의 중요성은 이전의 연구들을 통해 자세히 보고되어 왔다 (Villanova N et al., Hepatology, 2005; Senturk O et al., Intern Med J., 2008). 간 손상 후에는 간 동모양 혈관내피세포의 모세관화가 증가하고, 염증 및 섬유증 특징이 나타나게 된다. 그러므로, 간 동모양 혈관내피세포의 모세관화를 예방하는 것은 비알콜성 지방간염의 치료에 중요한 요소가 될 것이다.The vascular endothelium is a key barrier between systemic circulation and tissues. The endothelium of the liver mainly consists of liver sinusoidal endothelial cells (LSECs), which help the liver to maintain homeostasis and contribute to effective nutrient and gas exchange. do. Hepatic injury often begins with damage to the hepatic sinus endothelial cells. In this regard, the importance of hepatic sinus endothelial cell dysfunction in the pathogenesis of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis has been previously discussed. It has been reported in detail through studies (Villanova N et al., Hepatology, 2005; Senturk O et al., Intern Med J., 2008). After liver injury, the capillary endothelial cells of the hepatic sinusoids increase, and inflammatory and fibrotic features appear. Therefore, prevention of capillary capillary endothelial cells in the liver will be an important factor in the treatment of nonalcoholic steatohepatitis.
본 발명의 일 목적은 하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 지방간 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.One object of the present invention is to provide a pharmaceutical composition for preventing or treating fatty liver disease, comprising a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient will do
[화학식 1][Formula 1]
Figure PCTKR2021007940-appb-img-000001
Figure PCTKR2021007940-appb-img-000001
본 발명의 다른 일 목적은 상기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품을 제공하는 것이다.Another object of the present invention is to provide a health functional food for preventing or improving fatty liver disease, comprising the compound represented by Formula 1, an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient will do
상기 목적을 달성하기 위하여,In order to achieve the above object,
본 발명의 일 측면은,One aspect of the present invention is
하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는,A compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof containing as an active ingredient,
지방간 질환의 예방 또는 치료용 약학적 조성물을 제공한다:Provided is a pharmaceutical composition for preventing or treating fatty liver disease:
[화학식 1][Formula 1]
Figure PCTKR2021007940-appb-img-000002
Figure PCTKR2021007940-appb-img-000002
이때 상기 화학식 1에서,In this case, in Formula 1,
X는 산소 또는 황이고;X is oxygen or sulfur;
Figure PCTKR2021007940-appb-img-000003
는 단일결합 또는 이중결합을 나타내고;
Figure PCTKR2021007940-appb-img-000003
represents a single bond or a double bond;
R1은 수소, 할로, C1-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-15 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-15 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민, C2-15 에스테르, 설페이트, 카르복실기, C3-20 카르복시알킬, C3-20 카르복시알케닐, C3-20 알킬카르복실, C3-20 알케닐카르복실, C3-20 알킬카르복시알킬, C3-20 알킬카르복시알케닐, C3-20 알케닐카르복시알킬, C4-20 알케닐카르복시알케닐, C6-30 아릴, C6-30 아랄킬, C6-30 알카릴, 헤테로원자로서 질소를 포함하는 C3-30 헤테로아릴 또는 C6-30 아릴카르보닐이고;R 1 is hydrogen, halo, C 1-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-15 containing oxygen, sulfur or nitrogen as a heteroatom Heterocycloalkyl, C 3-15 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxyalkoxyalkyl, containing oxygen, sulfur or nitrogen as heteroatom C 3-10 heterocycloalkenyl, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 alkyl, carboxy-alkenyl, C 3-20 alkenylcarboxyalkyl, C 4-20 alkenylcarboxyalkenyl, C 6-30 aryl, C 6-30 aralkyl, C 6-30 alkaryl, C 3-30 hetero containing nitrogen as a heteroatom aryl or C 6-30 arylcarbonyl;
R21은 C2-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, C2-30 카르복시알킬, C2-30 알킬카르복실, C3-30 카르복시알케닐, C3-30 알케닐카르복실, C3-30 알킬카르복시알킬, C3-30 알킬카르복시알케닐, C3-30 알케닐카르복시알킬, C4-30 알케닐카르복시알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-10 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민 또는 C2-15 에스테르이고;R 21 is C 2-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-30 carboxyalkyl, C 2-30 alkylcarboxyl, C 3-30 carboxy alkenyl, C 3-30 alkenyl, carboxyl, C 3-30 alkyl, carboxyalkyl, C 3-30 alkyl, carboxy alkenyl, C 3-30 alkenyl, carboxy alkyl, C 4-30 alkenyl, carboxy-alkenyl, heteroaryl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as atom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxy Alkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatom, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1 -10 amines or C 2-15 esters;
R22는 수소, 히드록시, 할로 또는 C1-10 알킬이고;R 22 is hydrogen, hydroxy, halo or C 1-10 alkyl;
R23은 수소, 히드록시 또는 C1-10 알킬이고;R 23 is hydrogen, hydroxy or C 1-10 alkyl;
R21은 R22 및 R23과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 21 together with R 22 and R 23 may form a double bond to the carbon it bonds;
R23은 R21 및 R22과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 23 together with R 21 and R 22 may form a double bond to the carbon it bonds;
R21 또는 R23이 상기 탄소에 이중결합을 형성하는 경우 R22는 원자를 포함하지 않고; 및when R 21 or R 23 forms a double bond at the carbon, R 22 contains no atoms; and
R3 및 R4는 서로 독립적으로 수소 또는 C1-10 알킬이다.R 3 and R 4 are each independently hydrogen or C 1-10 alkyl.
또한, 본 발명의 일 측면은,In addition, one aspect of the present invention,
하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품을 제공한다:Provided is a health functional food for preventing or improving fatty liver disease containing a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
[화학식 1][Formula 1]
Figure PCTKR2021007940-appb-img-000004
Figure PCTKR2021007940-appb-img-000004
상기 화학식 1에서,In Formula 1,
X,
Figure PCTKR2021007940-appb-img-000005
, R1, R21, R22, R23, R3, R4는 상기에서 정의한 바와 같다.
X,
Figure PCTKR2021007940-appb-img-000005
, R 1 , R 21 , R 22 , R 23 , R 3 , and R 4 are as defined above.
본 발명의 다른 일 측면은 상기 화합물, 이의 입체 이성질체, 이의 수화물, 또는 이의 약학적으로 허용 가능한 염을, 이를 필요로 하는 개체나 대상에 투여하는 단계를 포함하는, 지방간 질환의 치료방법을 제공한다.Another aspect of the present invention provides a method for treating fatty liver disease, comprising administering the compound, a stereoisomer thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof to an individual or subject in need thereof. .
본 발명의 또 다른 일 측면은 지방간 질환의 치료에 사용하기 위한 상기 화합물, 이의 입체 이성질체, 이의 수화물, 또는 이의 약학적으로 허용 가능한 염을 제공한다.Another aspect of the present invention provides the compound, a stereoisomer, a hydrate thereof, or a pharmaceutically acceptable salt thereof for use in the treatment of fatty liver disease.
본 발명의 다른 일 측면은 지방간 질환 치료용 약제의 제조에 사용하기 위한 상기 화합물, 이의 입체 이성질체, 이의 수화물, 또는 이의 약학적으로 허용 가능한 염의 용도(use)를 제공한다.Another aspect of the present invention provides the use of the compound, a stereoisomer, a hydrate thereof, or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for the treatment of fatty liver disease.
본 발명은 지방간 질환의 예방 또는 치료 용도의 신규한 약학적 조성물을 제공하며, 상기 약학적 조성물은 간의 지방 축적 감소 효과, 간 섬유증 억제 효과, 간염 완화 효과, 간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs) 모세관화 약화 효과 등을 나타낸다.The present invention provides a novel pharmaceutical composition for use in the prevention or treatment of fatty liver disease, wherein the pharmaceutical composition has an effect of reducing fat accumulation in the liver, inhibiting liver fibrosis, alleviating hepatitis, and liver sinusoidal endothelial cells (liver sinusoidal endothelial cells). cells, LSECs), and the capillary attenuation effect.
도 1a는 콜린-결핍 L-아미노산 (CDAA) 유도 비알콜성 지방간염(Non-alcoholic steatohepatitis, NASH) 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위한 실험예 1의 연구 1 (3주), 연구 2 (6주)를 설계한 도식표를 나타낸 것이다.Figure 1a is a choline-deficient L-amino acid (CDAA) induced non-alcoholic steatohepatitis (NASH) in mice, study 1 of Experimental Example 1 to confirm the effect of Example 1 on metabolic indicators (3 weeks) ), the schematic diagram of study 2 (6 weeks) is shown.
도 1b는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 연구 2의 각 실험 그룹의 체중(The body weight)을 확인한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).Figure 1b shows the results of confirming the body weight of each experimental group in Study 2 to confirm the effect of Example 1 on metabolic indicators in CDAA-induced NASH mice (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 1c는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 연구 2의 각 실험 그룹에 대해 포도당 내성 시험(Glucose tolerance test, GTT)을 한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).1c shows the results of a glucose tolerance test (GTT) for each experimental group in Study 2 to confirm the effect of Example 1 on metabolic indicators in CDAA-induced NASH mice (mean±SEM. , # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 1d 및 도 1e는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 각 실험 그룹의 혈청 트리글리세라이드(serum triglycerides, serum TG, 도 1d) 및 혈청 전체 콜레스테롤(serum total cholesterol, serum TC, 도 1e) 레벨을 확인할 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).1d and 1e show serum triglycerides (serum TG, FIG. 1d) and serum total cholesterol of each experimental group to confirm the effect of Example 1 on metabolic indicators in CDAA-induced NASH mice. Serum TC, Fig. 1e) shows the results to check the level (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 1f 및 도 1g는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 각 실험 그룹의 아스파르테이트 아미노전달효소(aspartate aminotransferase, AST, 도 1f) 및 알라닌 아미노전달효소(alanine aminotransferase, ALT, 도 1g) 레벨을 확인한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).1f and 1g show aspartate aminotransferase (AST, FIG. 1f) and alanine aminotransferase (alanine) of each experimental group to confirm the effect of Example 1 on metabolic markers in CDAA-induced NASH mice. aminotransferase, ALT, Fig. 1g) shows the results of checking the level (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 1h는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 연구 1의 각 실험 그룹의 체중(The body weight)을 확인한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).Figure 1h shows the results of checking the body weight of each experimental group in Study 1 to confirm the effect of Example 1 on metabolic indicators in CDAA-induced NASH mice (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 1i는 CDAA 유도 NASH 마우스에서 대사지표에 대한 실시예 1의 효과를 확인하기 위해 연구 1의 각 실험 그룹에 대해 포도당 내성 시험(Glucose tolerance test, GTT)을 한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).1i shows the results of a glucose tolerance test (GTT) for each experimental group in Study 1 to confirm the effect of Example 1 on metabolic indicators in CDAA-induced NASH mice (mean±SEM. , # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 2a는 CDAA 유도 NASH 마우스에서 실시예 1의 간의 지질 축적 감소 효과를 확인하기 위해 각 실험 그룹의 간 사진을 찍은 것이다 (n=10 mice/group).Figure 2a is a photograph of the liver of each experimental group to confirm the effect of reducing lipid accumulation in the liver of Example 1 in CDAA-induced NASH mice (n=10 mice/group).
도 2b는 H&E로 염색된 각 실험 그룹 간의 구역을 나타낸 것이다 (n=5 mice/group).Figure 2b shows the area between each experimental group stained with H&E (n=5 mice/group).
도 2c는 CDAA 유도 NASH 마우스에서 실시예 1의 간의 지질 축적 감소 효과를 확인하기 위해 각 실험 그룹의 간 대비 체중의 비율을 확인한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).Figure 2c shows the results of confirming the ratio of body weight to liver of each experimental group in order to confirm the effect of reducing lipid accumulation in the liver of Example 1 in CDAA-induced NASH mice (mean±SEM., # p<0.05 vs. Con group ; *p<0.05 vs. CD group; n=10 mice/group).
도 2d 및 도 2e는 CDAA 유도 NASH 마우스에서 실시예 1의 간의 지질 축적 감소 효과를 확인하기 위해 각 실험 그룹의 간 TG (도 2d) 및 TC (도 2e) 레벨을 확인할 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).2d and 2e show the results of checking the liver TG (Fig. 2d) and TC (Fig. 2e) levels of each experimental group to confirm the effect of reducing lipid accumulation in the liver of Example 1 in CDAA-induced NASH mice (mean± SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 2f 내지 도 2i는 CDAA 유도 NASH 마우스에서 실시예 1의 간의 지질 축적 감소 효과를 확인하기 위해 지질합성에 관여하는 유전자인 SREBP1c mRNA (도 2f), ACC mRNA (도 2g), FAS mRNA (도 2h) 및 PPARγ mRNA (도 2i) 발현 레벨을 정량적 실시간 중합 효소 연쇄 반응(qPCR) 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=9 mice/group).2f to 2i are genes involved in lipid synthesis SREBP1c mRNA (FIG. 2F), ACC mRNA (FIG. 2G), FAS mRNA (FIG. 2h) to confirm the effect of reducing liver lipid accumulation in Example 1 in CDAA-induced NASH mice. ) and PPARγ mRNA (FIG. 2i) expression levels of quantitative real-time polymerase chain reaction (qPCR) analysis are shown (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=9 mice/group).
도 3a 내지 도 3d는 CDAA 유도 NASH 마우스에서 실시예 1의 항염 효과를 확인하기 위하여 염증성 사이토카인에 관여하는 유전자인 F4/80 mRNA (도 3a), MCP-1 mRNA (도 3b), IL-1β mRNA (도 3c) 및 TNF-α mRNA (도 3d) 발현 레벨을 정량적 실시간 중합 효소 연쇄 반응(qPCR) 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=9 mice/group).3a to 3d are genes F4/80 mRNA (FIG. 3A), MCP-1 mRNA (FIG. 3B), IL-1β which are genes involved in inflammatory cytokines to confirm the anti-inflammatory effect of Example 1 in CDAA-induced NASH mice. It shows the results of quantitative real-time polymerase chain reaction (qPCR) analysis of mRNA ( FIG. 3c ) and TNF-α mRNA ( FIG. 3d ) expression levels (mean±SEM., # p<0.05 vs. Con group; *p< 0.05 vs. CD group; n=9 mice/group).
도 3e는 간에서 F4/80의 면역조직화학분석 결과 및 염색된 양성 영역을 정량적으로 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=8 mice/group).Figure 3e shows the results of immunohistochemical analysis of F4/80 in the liver and quantitative analysis of stained positive regions (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=8 mice/group).
도 3f 및 도 3g는 CDAA 유도 NASH 마우스에서 실시예 1의 항염 효과를 확인하기 위하여 혈청 염증성 사이토카인 IL-6 (도 3f) 및 TNF-α (도 3g) 레벨을 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=10 mice/group).3f and 3g show the results of analysis of serum inflammatory cytokines IL-6 (FIG. 3F) and TNF-α (FIG. 3G) levels in order to confirm the anti-inflammatory effect of Example 1 in CDAA-induced NASH mice (mean ±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=10 mice/group).
도 4a는 CDAA 유도 NASH 마우스에서 실시예 1의 간 섬유증 완화 효과를 확인하기 위하여 picro-sirius red로 염색한 간 구역의 이미지 및 그 결과를 정량적으로 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=4 mice/group).Figure 4a shows the results of quantitative analysis of images and results of liver sections stained with picro-sirius red in order to confirm the liver fibrosis alleviation effect of Example 1 in CDAA-induced NASH mice (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=4 mice/group).
도 4b는 CDAA 유도 NASH 마우스에서 실시예 1의 간 섬유증 완화 효과를 확인하기 위하여 간 α-SMA 함량을 면역조직화학적 분석한 결과 및 그 결과를 정량적으로 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=4 mice/group).Figure 4b shows the results of immunohistochemical analysis of liver α-SMA content in order to confirm the liver fibrosis alleviation effect of Example 1 in CDAA-induced NASH mice and the results of quantitative analysis of the results (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=4 mice/group).
도 4c 내지 도 4f는 CDAA 유도 NASH 마우스에서 실시예 1의 간 섬유증 완화 효과를 확인하기 위하여 섬유증 관련 유전자에 관여하는 α-SMA mRNA (도 4c), Col1α mRNA (도 4d), Col4α mRNA (도 4e) 및 TGF-β mRNA (도 4f) 발현 레벨을 정량적 실시간 중합 효소 연쇄 반응(qPCR) 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=9 mice/group).4c to 4f are α-SMA mRNA ( FIG. 4c ), Col1α mRNA ( FIG. 4d ), Col4α mRNA ( FIG. 4e ) involved in fibrosis-related genes in order to confirm the liver fibrosis alleviation effect of Example 1 in CDAA-induced NASH mice. ) and TGF-β mRNA (FIG. 4f) shows the results of quantitative real-time polymerase chain reaction (qPCR) analysis of expression levels (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=9 mice/group).
도 4g는 CDAA 유도 NASH 마우스에서 실시예 1의 간 섬유증 완화 효과를 확인하기 위하여 간의 하이드록시프롤린을 측정하여 간조직 내 콜라겐 함량을 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=5 mice/group).Figure 4g shows the results of analyzing the collagen content in the liver tissue by measuring hydroxyproline in the liver to confirm the liver fibrosis alleviation effect of Example 1 in CDAA-induced NASH mice (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=5 mice/group).
도 5a는 CDAA 유도 NASH 마우스에서 실시예 1의 LSEC 모세관화 감소 효과를 확인하기 위하여 간의 ICAM-1를 면역조직화학적으로 분석한 결과 및 그 결과를 정량적으로 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=5 mice/group).Figure 5a shows the results of immunohistochemical analysis of liver ICAM-1 in order to confirm the effect of reducing LSEC capillarization of Example 1 in CDAA-induced NASH mice and the results of quantitative analysis of the results (mean±SEM. , # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=5 mice/group).
도 5b는 CDAA 유도 NASH 마우스에서 실시예 1의 LSEC 모세관화 감소 효과를 확인하기 위하여 간의 CD31를 면역조직화학적으로 분석한 결과 및 그 결과를 정량적으로 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=5 mice/group).Figure 5b shows the results of immunohistochemical analysis of liver CD31 in order to confirm the effect of reducing LSEC capillaryization of Example 1 in CDAA-induced NASH mice and the results of quantitative analysis of the results (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=5 mice/group).
도 5c 내지 도 5f는 CDAA 유도 NASH 마우스에서 실시예 1의 LSEC 모세관화 감소 효과를 확인하기 위하여 내피세포 부착 분자 관련 유전자인 E-셀렉틴(E-selectin) mRNA (도 5c), ICAM-1 mRNA (도 5d), VCAM-1 mRNA (도 5e) 및 CD31 mRNA (도 5f) 발현 레벨을 정량적 실시간 중합 효소 연쇄 반응(qPCR) 분석한 결과를 나타낸 것이다 (평균±SEM., #p<0.05 vs. Con 그룹; *p<0.05 vs. CD 그룹; n=9 mice/group).5c to 5f are endothelial cell adhesion molecule-related genes E-selectin mRNA (FIG. 5c), ICAM-1 mRNA ( Figure 5d) shows the results of quantitative real-time polymerase chain reaction (qPCR) analysis of the expression levels of VCAM-1 mRNA (Figure 5e) and CD31 mRNA (Figure 5f) (mean±SEM., # p<0.05 vs. Con group; *p<0.05 vs. CD group; n=9 mice/group).
도 6은 Chilin deficient diet-induced NASH model을 나타낸 것이다.Figure 6 shows the Chilin deficient diet-induced NASH model.
이하, 본 발명을 상세하게 설명한다.Hereinafter, the present invention will be described in detail.
본 발명의 일 측면은,One aspect of the present invention is
하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는,A compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof containing as an active ingredient,
지방간 질환의 예방 또는 치료용 약학적 조성물을 제공한다:Provided is a pharmaceutical composition for preventing or treating fatty liver disease:
[화학식 1][Formula 1]
Figure PCTKR2021007940-appb-img-000006
Figure PCTKR2021007940-appb-img-000006
상기 화학식 1에서,In Formula 1,
X는 산소 또는 황이고;X is oxygen or sulfur;
Figure PCTKR2021007940-appb-img-000007
는 단일결합 또는 이중결합을 나타내고;
Figure PCTKR2021007940-appb-img-000007
represents a single bond or a double bond;
R1은 수소, 할로, C1-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-15 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-15 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민, C2-15 에스테르, 설페이트, 카르복실기, C3-20 카르복시알킬, C3-20 카르복시알케닐, C3-20 알킬카르복실, C3-20 알케닐카르복실, C3-20 알킬카르복시알킬, C3-20 알킬카르복시알케닐, C3-20 알케닐카르복시알킬, C4-20 알케닐카르복시알케닐, C6-30 아릴, C6-30 아랄킬, C6-30 알카릴, 헤테로원자로서 질소를 포함하는 C3-30 헤테로아릴 또는 C6-30 아릴카르보닐이고;R 1 is hydrogen, halo, C 1-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-15 containing oxygen, sulfur or nitrogen as a heteroatom Heterocycloalkyl, C 3-15 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxyalkoxyalkyl, containing oxygen, sulfur or nitrogen as heteroatom C 3-10 heterocycloalkenyl, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 alkyl, carboxy-alkenyl, C 3-20 alkenylcarboxyalkyl, C 4-20 alkenylcarboxyalkenyl, C 6-30 aryl, C 6-30 aralkyl, C 6-30 alkaryl, C 3-30 hetero containing nitrogen as a heteroatom aryl or C 6-30 arylcarbonyl;
R21은 C2-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, C2-30 카르복시알킬, C2-30 알킬카르복실, C3-30 카르복시알케닐, C3-30 알케닐카르복실, C3-30 알킬카르복시알킬, C3-30 알킬카르복시알케닐, C3-30 알케닐카르복시알킬, C4-30 알케닐카르복시알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-10 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민 또는 C2-15 에스테르이고;R 21 is C 2-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-30 carboxyalkyl, C 2-30 alkylcarboxyl, C 3-30 carboxy alkenyl, C 3-30 alkenyl, carboxyl, C 3-30 alkyl, carboxyalkyl, C 3-30 alkyl, carboxy alkenyl, C 3-30 alkenyl, carboxy alkyl, C 4-30 alkenyl, carboxy-alkenyl, heteroaryl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as atom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxy Alkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatom, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1 -10 amines or C 2-15 esters;
R22는 수소, 히드록시, 할로 또는 C1-10 알킬이고;R 22 is hydrogen, hydroxy, halo or C 1-10 alkyl;
R23은 수소, 히드록시 또는 C1-10 알킬이고;R 23 is hydrogen, hydroxy or C 1-10 alkyl;
R21은 R22 및 R23과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 21 together with R 22 and R 23 may form a double bond to the carbon it bonds;
R23은 R21 및 R22과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 23 together with R 21 and R 22 may form a double bond to the carbon it bonds;
R21 또는 R23이 상기 탄소에 이중결합을 형성하는 경우 R22는 원자를 포함하지 않고; 및when R 21 or R 23 forms a double bond at the carbon, R 22 contains no atoms; and
R3 및 R4는 서로 독립적으로 수소 또는 C1-10 알킬이다.R 3 and R 4 are each independently hydrogen or C 1-10 alkyl.
이때 상기 화학식 1의 X는 산소일 수 있다.In this case, X in Formula 1 may be oxygen.
또한, 상기 화학식 1의 R1은 수소, 할로, C1-10 알킬, C3-8 사이클로알킬, C2-10 알케닐, C3-8 사이클로알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-8 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-20 알콕시알킬, C3-20 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-8 헤테로사이클로알케닐, C1-10 알코올, C1-10 알케놀, C2-20 아실, C1-10 아미드, C1-5 아민, C2-15 에스테르, 설페이트, 카르복실기, C3-20 카르복시알킬, C3-20 카르복시알케닐, C3-20 알킬카르복실, C3-20 알케닐카르복실, C3-20 알킬카르복시알킬, C3-20 알킬카르복시알케닐, C3-20 알케닐카르복시알킬, C4-20 알케닐카르복시알케닐, C6-20 아릴, C6-20 아랄킬, C6-20 알카릴, 헤테로원자로서 질소를 포함하는 C3-20 헤테로아릴 또는 C6-20 아릴카르보닐일 수 있다.In addition, R 1 of Formula 1 is hydrogen, halo, C 1-10 alkyl, C 3-8 cycloalkyl, C 2-10 alkenyl, C 3-8 cycloalkenyl, oxygen, sulfur or nitrogen as a heteroatom C 2-8 heterocycloalkyl comprising, C 3-10 heterocycloalkylalkyl comprising oxygen, sulfur or nitrogen as heteroatom, C 2-20 alkoxyalkyl, C 3-20 alkoxyalkoxyalkyl, oxygen as heteroatom, C 3-8 heterocycloalkenyl containing sulfur or nitrogen, C 1-10 alcohol, C 1-10 alkenol, C 2-20 acyl, C 1-10 amide, C 1-5 amine, C 2-15 ester, sulfate, carboxyl, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 Alkylcarboxyalkenyl, C 3-20 alkenylcarboxyalkyl, C 4-20 alkenylcarboxyalkenyl, C 6-20 aryl, C 6-20 aralkyl, C 6-20 alkaryl, including nitrogen as a heteroatom may be C 3-20 heteroaryl or C 6-20 arylcarbonyl.
상기 화학식 1의 R1은 수소, C1-10 알킬, C3-8 사이클로알킬, C2-10 알케닐, C3-8 사이클로알케닐, 헤테로원자로서 산소를 포함하는 C2-8 헤테로사이클로알킬, 헤테로원자로서 산소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-20 알콕시알킬, C3-10 알콕시알콕시알킬, 헤테로원자로서 산소를 포함하는 C3-8 헤테로사이클로알케닐, C1-10 알코올, C1-10 알케놀, C1-10 아미드, C1-5 아민, C2-15 에스테르, 설페이트, 카르복실기, C3-20 카르복시알킬, C3-20 카르복시알케닐, C3-20 알킬카르복실, C3-20 알케닐카르복실, C3-20 알킬카르복시알킬, C3-20 알킬카르복시알케닐, C3-20 알케닐카르복시알킬, C4-20 알케닐카르복시알케닐, C6-20 아릴, C6-20 아랄킬, C6-20 알카릴, 헤테로원자로서 질소를 포함하는 C3-20 헤테로아릴 또는 C6-20 아릴카르보닐일 수 있다. R 1 of Formula 1 is hydrogen, C 1-10 alkyl, C 3-8 cycloalkyl, C 2-10 alkenyl, C 3-8 cycloalkenyl, C 2-8 heterocyclo containing oxygen as a heteroatom Alkyl, C 3-10 heterocycloalkylalkyl with oxygen as heteroatom, C 2-20 alkoxyalkyl, C 3-10 alkoxyalkoxyalkyl, C 3-8 heterocycloalkenyl with oxygen as heteroatom, C 1-10 alcohol, C 1-10 alkenol, C 1-10 amide, C 1-5 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxyalkenyl, C 3-20 Alkylcarboxyl , C 3-20 Alkenylcarboxyl , C 3-20 Alkylcarboxyalkyl, C 3-20 Alkylcarboxyalkenyl, C 3-20 Alkenylcarboxyalkyl , C 4-20 Alkenylcarboxyal kenyl, C 6-20 aryl, C 6-20 aralkyl, C 6-20 alkaryl, C 3-20 heteroaryl containing nitrogen as a heteroatom or C 6-20 arylcarbonyl.
상기 화학식 1의 R1에서 상기 사이클로알킬 또는 헤테로사이클로알킬은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, C6-20 아릴, C7-20 아릴카르복실 또는 이들의 조합에 의해 치환될 수 있고; 상기 C3-10 사이클로알케닐 또는 헤테로사이클로알케닐은 히드록시, 할로, C1-5 알킬, C2-8 알킬카르복실, C3-8 알킬카르복실알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, C6-20 아릴, C7-20 아릴카르복실 또는 이들의 조합에 의해 치환될 수 있으며; 상기 아릴은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, 니트로, C2-8 알킬카르복실아미노 또는 이들의 조합에 의해 치환될 수 있고; 상기 아랄킬은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, 니트로, C2-8 알킬카르복실아미노 또는 이들의 조합에 의해 치환될 수 있고; 상기 알카릴은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, 니트로, C2-8 알킬카르복실아미노 또는 이들의 조합에 의해 치환될 수 있으며; 상기 아릴카르보닐은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, 니트로, 또는 C2-8 알킬카르복실아미노 또는 이들의 조합에 의해 치환될 수 있으며; 상기 헤테로아릴은 히드록시, 할로, C1-5 알킬, C1-5 알코올, C1-5 알콕시, C2-8 알콕시알킬, 니트로, C2-8 알킬카르복실아미노 또는 이들의 조합에 의해 치환될 수 있는 것일 수 있다.In R 1 of Formula 1, the cycloalkyl or heterocycloalkyl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, C 6-20 aryl , may be substituted with C 7-20 arylcarboxyl or a combination thereof; The C 3-10 cycloalkenyl or heterocycloalkenyl is hydroxy, halo, C 1-5 alkyl, C 2-8 alkylcarboxyl, C 3-8 alkylcarboxylalkyl, C 1-5 alcohol, C 1 -5 alkoxy, C 2-8 alkoxyalkyl, C 6-20 aryl, C 7-20 arylcarboxyl, or a combination thereof; said aryl is substituted by hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or combinations thereof can be; The aralkyl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or a combination thereof may be substituted; The alkaryl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or a combination thereof may be substituted; The arylcarbonyl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, or C 2-8 alkylcarboxylamino or combinations thereof. may be substituted by; The heteroaryl is hydroxy, halo, C 1-5 alkyl, C 1-5 alcohol, C 1-5 alkoxy, C 2-8 alkoxyalkyl, nitro, C 2-8 alkylcarboxylamino or a combination thereof It may be substituted.
상기 화학식 1의 R21은 직쇄 또는 분쇄의 C2-15 알킬, C3-10 사이클로알킬, C2-15 알케닐, C3-10 사이클로알케닐, C2-15 카르복시알킬, C2-15 알킬카르복실, C3-15 카르복시알케닐, C2-15 알케닐카르복실, C3-15 알킬카르복시알킬, C3-15 알킬카르복시알케닐, C3-15 알케닐카르복시알킬, C2-30 알케닐카르복시알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-10 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-20 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민 또는 C2-15 에스테르일 수 있다. R 21 in Formula 1 is straight-chain or branched C 2-15 alkyl, C 3-10 cycloalkyl, C 2-15 alkenyl, C 3-10 cycloalkenyl, C 2-15 carboxyalkyl, C 2-15 Alkylcarboxyl , C 3-15 carboxyalkenyl, C 2-15 alkenylcarboxyl, C 3-15 alkylcarboxyalkyl, C 3-15 alkylcarboxyalkenyl, C 3-15 alkenylcarboxyalkyl, C 2- 30 alkenylcarboxyalkenyl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-20 Alkoxyalkyl , C 3-30 alkoxyalkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatoms, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine or C 2-15 ester.
상기 화학식 1의 R23은 C1-5 알킬이거나 또는 R21 및 R22과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있다. R 23 of Formula 1 may be C 1-5 alkyl or may form a double bond with respect to carbon bonded together with R 21 and R 22 .
상기 화학식 1의
Figure PCTKR2021007940-appb-img-000008
는 이중결합일 수 있다.
of Formula 1
Figure PCTKR2021007940-appb-img-000008
may be a double bond.
R3 및 R4는 서로 독립적으로 C1-3 알킬일 수 있다.R 3 and R 4 may be each independently C 1-3 alkyl.
R23은 C1-3 알킬이고;R 23 is C 1-3 alkyl;
R21 및 R22는 함께 C1-5 알킬바이닐을 형성하고, 이때 상기 알킬바이닐은 C1-3 알콕시카보닐로 치환되는 것일 수 있다.R 21 and R 22 together form C 1-5 alkylvinyl, wherein the alkylvinyl may be substituted with C 1-3 alkoxycarbonyl.
R1은 산소, 황 또는 질소를 포함하는 C3-8 헤테로사이클로알케닐일 수 있다.R 1 may be C 3-8 heterocycloalkenyl containing oxygen, sulfur or nitrogen.
R1은 산소를 포함하는 C5 헤테로사이클로알케닐일 수 있다.R 1 may be C 5 heterocycloalkenyl containing oxygen.
가장 바람직하게는, 상기 화학식 1은 하기 화학식 2로 표시되는 화합물인 것을 특징으로 하는 약학적 조성물이다:Most preferably, Chemical Formula 1 is a pharmaceutical composition, characterized in that it is a compound represented by the following Chemical Formula 2:
[화학식 2][Formula 2]
Figure PCTKR2021007940-appb-img-000009
.
Figure PCTKR2021007940-appb-img-000009
.
상기 지방간 질환은 단순 지방간(fatty liver), 알코올성 지방간(alcoholic fatty liver), 영양성 지방간, 기아성 지방간, 비만성 지방간, 당뇨병성 지방간, 지방간염(steatohepatitis), 비알콜성 지방간 질환(non-alcoholic fatty liver disease, NAFLD), 비알콜성 지방간염(non-alcoholic steatohepatitis, NASH) 및 섬유증으로 이루어지는 군으로부터 선택되는 1종 이상일 수 있다.The fatty liver disease is simple fatty liver (fatty liver), alcoholic fatty liver (alcoholic fatty liver), nutritive fatty liver, starvation fatty liver, obese fatty liver, diabetic fatty liver, steatohepatitis, non-alcoholic fatty liver disease (non-alcoholic fatty) It may be at least one selected from the group consisting of liver disease, NAFLD), non-alcoholic steatohepatitis (NASH), and fibrosis.
상기 섬유증은 신장 섬유증, 심장 섬유증, 췌장 섬유증, 폐 섬유증, 혈관 섬유증, 피부 섬유증, 골수 섬유증, 간 섬유증, 장 섬유증, 경피증 및 낭포성 섬유증으로 이루어지는 군으로부터 선택되는 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.The fibrosis may be one or more selected from the group consisting of renal fibrosis, cardiac fibrosis, pancreatic fibrosis, pulmonary fibrosis, vascular fibrosis, skin fibrosis, bone marrow fibrosis, liver fibrosis, intestinal fibrosis, scleroderma, and cystic fibrosis, but is limited thereto. it is not
상기 간 섬유증은 간경변증(liver cirrhosis), 간신증후군(hepatorenal syndrome), 간자반병(peliosis hepatis), 대사성 간질환, 만성 간질환, B형 간염 바이러스 감염, C형 간염 바이러스 감염. D형 간염 바이러스 감염, 주혈흡충증(Schistosomiasis), 알콜성 간질환, 비알콜성 지방간염, 당뇨, 단백질 결핍증, 관상동맥질환, 자가면역 간염, 알파-1 항트립신 결핍증(α-1-Antitrypsin deficiency) 및 일차성 담즙성 간경화증으로 이루어지는 군으로부터 선택되는 1종일 수 있으나, 이에 제한되는 것은 아니다.The liver fibrosis is liver cirrhosis, hepatorenal syndrome, peliosis hepatis, metabolic liver disease, chronic liver disease, hepatitis B virus infection, hepatitis C virus infection. Hepatitis D virus infection, Schistosomiasis, alcoholic liver disease, nonalcoholic steatohepatitis, diabetes, protein deficiency, coronary artery disease, autoimmune hepatitis, α-1-Antitrypsin deficiency And it may be one selected from the group consisting of primary biliary cirrhosis, but is not limited thereto.
상기 폐 섬유증은 기관지염, 급성 기관지염, 미만성범세기관지염(diffuse panbronchiolitis, DPB), 모세기관지염(bronchiolitis), 특발성 폐섬유증(Idiopathic pulmonary fibrosis, IPF), 급성 간질성 폐렴(acute interstitial pneumonia), 과민성 간질성 폐렴, 폐이식, 낭포성 섬유증, 방사선 유발 폐섬유증, 만성폐쇄성 폐질환(chronic obstructive pulmonary disease, COPD), 천식(asthma), 기관지확장증(bronchiectasis), 폐결핵, 폐렴, 진폐증, 과민성폐렴, 폐부종 및 사르코이드증(sarcoidosis)으로 이루어지는 군으로부터 선택되는 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.The lung fibrosis is bronchitis, acute bronchitis, diffuse panbronchiolitis (DPB), bronchiolitis, idiopathic pulmonary fibrosis (IPF), acute interstitial pneumonia, hyperactive interstitial pneumonia , lung transplantation, cystic fibrosis, radiation-induced pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), asthma, bronchiectasis, tuberculosis, pneumonia, pneumoconiosis, hypersensitivity pneumonia, pulmonary edema and sarcoids. It may be one or more selected from the group consisting of sarcoidosis, but is not limited thereto.
상기 신장 섬유증은 신부전(kidney failure), 도관 설치, 당뇨병성 신증(diabetic nephropathy), 요로 폐쇄(ureteral obstruction), 사구체 경화증(glomerular sclerosis), 신세뇨관간질성, 사구체 신염(glomerulonephritis), 만성 신부전증, 당뇨병성 근위세뇨관 섬유화, 급성 신손상, 만성 신장 질환, 말기 신장 질환, 허혈 재관류 손상 (ischemia-reperfusion injury), 신독성 약제(nephrotoxic agents)에 의한 손상, 조영제(radiocontrast media)에 의한 손상 및 알부민뇨 발생으로 이루어지는 군으로부터 선택되는 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.The renal fibrosis is kidney failure, catheterization, diabetic nephropathy, urinary tract obstruction, glomerular sclerosis, renal tubular interstitial, glomerulonephritis, chronic renal failure, diabetes mellitus. Sexual proximal tubular fibrosis, acute renal injury, chronic kidney disease, end-stage renal disease, ischemia-reperfusion injury, damage caused by nephrotoxic agents, damage caused by radiocontrast media, and albuminuria It may be at least one selected from the group consisting of, but is not limited thereto.
상기 간섬유증 또는 간경변은 비알콜성 지방간염에 의해 유발된 것일 수 있다.The liver fibrosis or cirrhosis may be caused by nonalcoholic steatohepatitis.
상기 비알콜성 지방간염은 콜린-결핍 L-아미노산 식단(choline-deficient L-amino acid diet)에 의해 유발된 것일 수 있다.The nonalcoholic steatohepatitis may be induced by a choline-deficient L-amino acid diet.
상기 약학적 조성물은 간 내 염증(hepatic inflammation) 또는 전신 염증(systemic inflammation)을 개선시킬 수 있으며, 간 내 지질 축적을 억제시킬 수도 있고, 간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs)의 모세관화(capillarization)를 감소시킬 수도 있다.The pharmaceutical composition may improve hepatic inflammation or systemic inflammation, may inhibit lipid accumulation in the liver, and may inhibit liver sinusoidal endothelial cells (LSECs) of It may also reduce capillarization.
또한, 상기 약학적 조성물은 알라닌 아미노전달효소(alanine aminotransferase, ALT) 또는 아스파르테이트 아미노전달효소(aspartate transaminase, AST)의 발현을 감소시킬 수 있으며, 트리글리세라이드(triglycerides, TG) 또는 전체 콜레스테롤(total cholesterol, TC) 함량을 감소시킬 수도 있다.In addition, the pharmaceutical composition can reduce the expression of alanine aminotransferase (ALT) or aspartate transaminase (AST), and triglycerides (TG) or total cholesterol (total cholesterol, TC) content may be reduced.
상기 약학적 조성물은 지질합성(lipogenesis) 관련 인자의 발현을 감소시킬 수 있는데, 상기 지질합성 관련 인자는 종래 지질의 합성에 관여하는 것으로 알려진 인자를 말하며, 예를 들면 SREBP1c(sterol regulatory element-binding transcription factor-1c), ACC(acetyl-CoA carboxylase), PPARγ(peroxisome proliferator-activated receptors γ) 또는 FAS(fatty acid synthase)이다.The pharmaceutical composition can reduce the expression of lipogenesis-related factors, and the lipid synthesis-related factors refer to factors known to be involved in conventional lipid synthesis, for example, sterol regulatory element-binding transcription (SREBP1c). factor-1c), ACC (acetyl-CoA carboxylase), PPARγ (peroxisome proliferator-activated receptors γ), or FAS (fatty acid synthase).
상기 약학적 조성물은 염증성(pro-inflammatory) 인자의 발현을 감소시킬 수 있는데, 상기 염증성 인자는 종래 염증성 인자로 알려진 것을 말하며, 예를 들면, F4/80, MCP-1(monocyte chemoattractant protein-1), IL-1β(interleukin 1β), IL-1α(interleukin 1α), TNF-α(tumor necrosis factor-α), IL-6 또는 IL-8이다.The pharmaceutical composition can reduce the expression of a pro-inflammatory factor, the inflammatory factor refers to a conventionally known inflammatory factor, for example, F4/80, MCP-1 (monocyte chemoattractant protein-1) , IL-1β (interleukin 1β), IL-1α (interleukin 1α), TNF-α (tumor necrosis factor-α), IL-6 or IL-8.
상기 약학적 조성물은 섬유증(pro-fibrotic) 관련(fibrosis-related) 인자의 발현을 감소시킬 수 있는데, 상기 섬유증 관련 인자는 종래 섬유증에 관여하는 인자로 알려진 인자를 말하며. 예를 들면, α-SMA(α-smooth muscle actin), Col1α(collagen 1α), Col4α(Collagen 4α) 또는 TGF-β(transforming growth factor-β)이다.The pharmaceutical composition can reduce the expression of a fibrosis (pro-fibrotic)-related (fibrosis-related) factor, the fibrosis-related factor refers to a factor known as a factor involved in conventional fibrosis. For example, α-SMA (α-smooth muscle actin), Col1α (collagen 1α), Col4α (Collagen 4α) or TGF-β (transforming growth factor-β).
상기 약학적 조성물은 하이드록시프롤린(hydroxyproline)의 함량을 감소시킬 수 있다.The pharmaceutical composition may reduce the content of hydroxyproline.
상기 약학적 조성물은 내피 부착 분자(endothelial adhesion molecule)의 발현을 감소시킬 수 있는데, 상기 내피 부착 분자의 예를 들면, E-셀렉틴(E-selectin), ICAM-1(intercellular adhesion molecule-1), VCAM-1(vascular cell adhesion molecule-1) 또는 CD31(cluster of differentiation 31)이다.The pharmaceutical composition may decrease the expression of an endothelial adhesion molecule, for example, E-selectin, intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) or cluster of differentiation 31 (CD31).
본 발명의 상기 화학식 1로 표시되는 화합물은 약학적으로 허용가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산, 아인산 등과 같은 무기산류, 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류 등과 같은 무독성 유기산, 트리플루오로아세트산, 아세테이트, 안식향산, 구연산, 젖산, 말레인산, 글루콘산, 메탄설폰산, 4-톨루엔설폰산, 주석산, 푸마르산 등과 같은 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염의 종류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트, 만델레이트 등을 포함한다.The compound represented by Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, and as the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, phosphorous acid, etc., aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. Non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids, etc., organic acids such as trifluoroacetic acid, acetate, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid, etc. get it from Examples of such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and Odide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, sube Late, sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate and the like.
본 발명에 따른 산 부가염은 통상의 방법으로 제조할 수 있으며, 예를 들면 화학식 1의 유도체를 메탄올, 에탄올, 아세톤, 메틸렌클로라이드, 아세토니트릴 등과 같은 유기용매에 녹이고 유기산 또는 무기산을 가하여 생성된 침전물을 여과, 건조시켜 제조하거나, 용매와 과량의 산을 감압 증류한 후 건조시켜 유기용매 하에서 결정화시켜서 제조할 수 있다.The acid addition salt according to the present invention can be prepared by a conventional method, for example, a precipitate formed by dissolving the derivative of Formula 1 in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, etc. and adding an organic or inorganic acid It can be prepared by filtration and drying, or by distilling the solvent and excess acid under reduced pressure, followed by drying and crystallization in an organic solvent.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 음염(예, 질산은)과 반응시켜 얻는다.In addition, a pharmaceutically acceptable metal salt can be prepared using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. In this case, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt. The corresponding salt is also obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg silver nitrate).
상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염은 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.The compound represented by Formula 1 or a pharmaceutically acceptable salt thereof may be administered in various oral and parenteral formulations during clinical administration. In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, and emulsions. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효 성분으로 하는 약학적 조성물은 비경구 투여할 수 있으며, 비경구 투여는 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사를 주입하는 방법에 의한다.A pharmaceutical composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient may be administered parenterally, and parenteral administration is administered by subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. depending on how
이때, 비경구 투여용 제형으로 제제화하기 위하여 상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 안정제 또는 완충제와 함께 물에 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알 단위 투여형으로 제조할 수 있다. 상기 조성물은 멸균되고/되거나 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염 및/또는 완충제 등의 보조제, 및 기타 치료적으로 유용한 물질을 함유할 수 있으며, 통상적인 방법인 혼합, 과립화 또는 코팅 방법에 따라 제제화할 수 있다.At this time, in order to formulate a formulation for parenteral administration, the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is mixed with water together with a stabilizer or buffer to prepare a solution or suspension, which is an ampoule or vial unit dosage form. can be manufactured with The composition may be sterilized and/or contain adjuvants such as preservatives, stabilizers, wetting or emulsifying agents, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, and mixing, granulation, in the usual manner It can be formulated according to the method of formulation or coating.
본 발명의 다른 일 측면은 하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품을 제공한다:Another aspect of the present invention provides a health functional food for preventing or improving fatty liver disease, comprising a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient do:
[화학식 1][Formula 1]
Figure PCTKR2021007940-appb-img-000010
Figure PCTKR2021007940-appb-img-000010
상기 화학식 1에서,In Formula 1,
X,
Figure PCTKR2021007940-appb-img-000011
, R1, R21, R22, R23, R3, R4는 상기에서 정의한 바와 같으므로 생략한다.
X,
Figure PCTKR2021007940-appb-img-000011
, R 1 , R 21 , R 22 , R 23 , R 3 , and R 4 are as defined above and thus omitted.
본 발명에 따른 상기 화학식 1로 표시되는 화합물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합량은 그의 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 건강식품 중의 상기 화합물의 양은 전체 식품 중량의 0.1 내지 90 중량부로 가할 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.The compound represented by Formula 1 according to the present invention may be added to food as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be suitably determined according to the purpose of its use (for prevention or improvement). In general, the amount of the compound in the health food may be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food. However, in the case of long-term intake for health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.
나아가, 상기 외에 본 발명에 따른 화학식 1로 표시되는 화합물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 충진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 화학식 1로 표시되는 화합물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다.Furthermore, in addition to the above, the compound represented by Formula 1 according to the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the compound represented by Formula 1 of the present invention may contain natural fruit juice, fruit juice, and pulp for the production of fruit juice beverages and vegetable beverages.
한편, 본 발명에 따른 상기 화학식 1로 표시되는 화합물은 목적에 따라 여러 형태로 제제화가 가능하다. On the other hand, the compound represented by Formula 1 according to the present invention can be formulated in various forms depending on the purpose.
하기는 본 발명에 따른 상기 화학식 1로 표시되는 화합물을 활성성분으로 함유시킨 몇몇 제제화 방법을 예시한 것으로 본 발명이 이에 한정되는 것은 아니다.The following exemplifies some formulation methods containing the compound represented by Formula 1 according to the present invention as an active ingredient, but the present invention is not limited thereto.
<제제예 1> 약학적 제제의 제조<Formulation Example 1> Preparation of pharmaceutical formulations
1-1. 산제의 제조1-1. Preparation of powders
화학식 1의 화합물 500 ㎎500 mg of compound of formula 1
유당 100 ㎎ Lactose 100 mg
탈크 10 ㎎ talc 10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.The above ingredients are mixed and filled in an airtight bag to prepare a powder.
1-2. 정제의 제조1-2. manufacture of tablets
화학식 1의 화합물 500 ㎎500 mg of compound of formula 1
옥수수전분 100 ㎎ Corn Starch 100 mg
유당 100 ㎎ Lactose 100 mg
스테아린산 마그네슘 2 ㎎ Magnesium stearate 2 mg
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.After mixing the above ingredients, tablets are prepared by tableting according to a conventional manufacturing method of tablets.
1-3. 캅셀제의 제조1-3. Capsule preparation
화학식 1의 화합물 500 ㎎500 mg of compound of formula 1
옥수수전분 100 ㎎ Corn Starch 100 mg
유당 100 ㎎ Lactose 100 mg
스테아린산 마그네슘 2 ㎎ Magnesium stearate 2 mg
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.According to a conventional capsule preparation method, the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.
1-4. 주사제의 제조1-4. manufacture of injections
화학식 1의 화합물 500 ㎎500 mg of compound of formula 1
주사용 멸균 증류수 적량Appropriate amount of sterile distilled water for injection
pH 조절제 적량Appropriate amount of pH adjuster
통상의 주사제의 제조방법에 따라 1 앰플당(2 ㎖) 상기의 성분 함량으로 제조한다.According to a conventional method for preparing injections, the content of the above ingredients per 1 ampoule (2 ml) is prepared.
1-5. 액제의 제조1-5. Preparation of liquids
화학식 1의 화합물 100 ㎎100 mg of compound of formula 1
이성화당 10 g10 g isomerized sugar
만니톨 5 g5 g of mannitol
정제수 적량Purified water appropriate amount
통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬 향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100 ㎖로 조절한 후 갈색 병에 충진하여 멸균시켜 액체를 제조한다.According to a conventional liquid preparation method, each component is added to purified water to dissolve, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 ml by adding purified water, and then filled in a brown bottle. Sterilize to prepare a liquid.
이하, 본 발명의 실시예 및 실험예를 하기에 구체적으로 예시하여 설명한다. 다만, 후술하는 실시예 및 실험예는 본 발명의 일부를 예시하는 것일 뿐, 본 발명에 이에 한정되는 것은 아니다.Hereinafter, Examples and Experimental Examples of the present invention will be specifically illustrated and described below. However, the Examples and Experimental Examples to be described below are only illustrative of a part of the present invention, and are not limited thereto.
<실험 프로토콜><Experimental protocol>
1. 포도당 내성 시험1. Glucose Tolerance Test
복강 내 포도당 내성 시험(Glucose tolerance test, GTT) (GTT, 1 g/kg 체중의 포도당)은 16시간 단식 후 마우스에서 수행되었다. 혈액 샘플은 포도당 주입 후 0, 15, 30, 60 및 120분 후 수집하였으며, 글루코미터 (Roche, Germany, Acuue chek)로 측정하였다.An intraperitoneal glucose tolerance test (GTT) (GTT, 1 g/kg body weight of glucose) was performed in mice after fasting for 16 hours. Blood samples were collected 0, 15, 30, 60 and 120 minutes after glucose infusion and were measured with a glucometer (Roche, Germany, Acuue chek).
2. 혈청 및 간의 생화학적 분석2. Biochemical analysis of serum and liver
트리글리세라이드 및 전체 콜레스테롤은 클로로포름-메탄올 (2:1, vol:vol)로 간 조직으로부터 추출하였다. 구체적으로, 클로로포름-메탄올을 균질화된 간 조직에 첨가하고, 볼텍싱한 후 원심분리하였으며, 이때 가라앉은 상을 수집하고 퓸 후드안에서 상온에서 증발시켰다. 그 결과 얻어진 반 건조된 펠릿을 1% 트리톤 X-100 (VWR, USA)에 용해시켰다. 간 및 혈청 트리글리세라이드(TG) 및 전체 콜레스테롤(TC) 함량을 시판 키트 (Asan Pharmaceutical Co., Seoul, Korea)를 이용하여 정량화하였다. 알라닌 아미노전달효소(alanine aminotransferase, ALT) 및 아스파르테이트 아미노전달효소(aspartate transaminase, AST) 활성과 같은 간 기능 파라미터도 시판 키트 (Asan Pharmaceutical Co., Seoul, Korea)를 이용하여 측정하였다. TNF-α 및 IL-6의 혈청 농도는 Quantikine ELISA kits (R&D Systems, Minneapolis, MN, USA)를 이용하여 결정하였다.Triglycerides and total cholesterol were extracted from liver tissue with chloroform-methanol (2:1, vol:vol). Specifically, chloroform-methanol was added to the homogenized liver tissue, vortexed and centrifuged, and the settled phase was collected and evaporated at room temperature in a fume hood. The resulting semi-dried pellets were dissolved in 1% Triton X-100 (VWR, USA). Liver and serum triglyceride (TG) and total cholesterol (TC) contents were quantified using a commercially available kit (Asan Pharmaceutical Co., Seoul, Korea). Liver function parameters such as alanine aminotransferase (ALT) and aspartate transaminase (AST) activities were also measured using a commercially available kit (Asan Pharmaceutical Co., Seoul, Korea). Serum concentrations of TNF-α and IL-6 were determined using Quantikine ELISA kits (R&D Systems, Minneapolis, MN, USA).
3. 조직학 및 면역조직화학 분석3. Histological and immunohistochemical analysis
간을 4% 파라포름알데하이드 in PBS (Sigma, Steinheim, Germany)에 상온에서 48시간 동안 고정시키고, 파라핀에 매립한 후, 6 μm로 구획한 뒤 헤마톡실린 및 에오신(H&E)으로 염색하였다. 간 섬유증은 Picro Sirius Red kit (Abcam, Cambridge, MA, USA)로 염색하여 평가하였다. 면역조직화학 분석을 위해, 파라핀-매립 구역을 F4/80 (1:60; AbD Serotec, Oxford, UK), α-평활근 액틴 (α-SMA, 1:300, Abcam), ICAM-1 (1:200; Santa Cruz, CA, USA), 및 CD31 (1:200; Santa Cruz, CA, USA) 및 CD31 (1:200, R&D System, MN, USA)의 항체로 염색하였다. 이미지는 eclipse microscope (Nikon, 도쿄, 일본)을 사용하였고, F4/80, Sirius Red, α-SMA, ICAM-1 및 CD31 양성 영역은 Image J를 이용하여 정량화하였다.The liver was fixed in 4% paraformaldehyde in PBS (Sigma, Steinheim, Germany) at room temperature for 48 hours, embedded in paraffin, partitioned into 6 μm, and stained with hematoxylin and eosin (H&E). Liver fibrosis was assessed by staining with the Picro Sirius Red kit (Abcam, Cambridge, MA, USA). For immunohistochemical analysis, paraffin-embedded sections were treated with F4/80 (1:60; AbD Serotec, Oxford, UK), α-smooth muscle actin (α-SMA, 1:300, Abcam), ICAM-1 (1: 200; Santa Cruz, CA, USA), and CD31 (1:200; Santa Cruz, CA, USA) and CD31 (1:200, R&D System, MN, USA) antibodies. An eclipse microscope (Nikon, Tokyo, Japan) was used for images, and F4/80, Sirius Red, α-SMA, ICAM-1 and CD31 positive regions were quantified using Image J.
4. RNA 분리 및 정량적 RT-PCR 분석4. RNA Isolation and Quantitative RT-PCR Analysis
easy-BLUE (iNtRON, 성남, 한국)을 이용하여 간으로부터 전체 RNA를 분리하였으며, cDNA는 몰로니 뮤린 백혈병 바이러스 역전사효소(Moloney murine leukemia virus reverse transcriptase)를 이용하여 합성하였다. 정량적 실시간 중합 효소 연쇄 반응(qRT-PCR)은 하기 표 1의 유전자 특이적 프라이머 및 Bio-Rad RT-PCR 검출 시스템의 SYBR Green (Invitrogen)를 이용하여 수행하였다. 리보솜 단백질 36B4 mRNA의 레벨은 표준화에 사용하였다.Total RNA was isolated from the liver using easy-BLUE (iNtRON, Seongnam, Korea), and cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the gene-specific primers in Table 1 below and SYBR Green (Invitrogen) of the Bio-Rad RT-PCR detection system. The level of ribosomal protein 36B4 mRNA was used for normalization.
유전자gene ForwardForward ReverseReverse
α-SMAα-SMA TGCTGCATCCATGAAACCACCTATGCTGCATCCATGAAACCACCTA GTTTGCTGATCCACATCTGCTGGAGTTTGCTGATCCACATCTGCTGGA
ACCACC CCCATCCAAACAGAGGGAACCCCATCCAAACAGAGGGGAAC CTGACAAGGTGGCGTGAAGCTGACAAGGTGGCGTGAAG
CD31CD31 CCAAAGCCAGTAGCATCATGGTCCCAAAGCCAGTAGCATCATGGTC GGATGGTGAAGTTGGCTACAGGGGATGGTGAAGTTGGCTACAGG
Col1αCol1α AGTAACGTCGTCGTGCCTAGCAACATAGTAACGTCGTCGTGCCTAGCAACAT GAATACTGAGCAGCAAAGTTCCCAGGAATACTGAGCAGCAAAGTTCCCAG
Col4αCol4α CCAGGATGCAACGGTACAAACCAGGATGCAACGGTACAAA ACGTGGCCGAGAATTTCACACGTGGCCGAGAATTTCAC
E-selectinE-selectin AGATACTTTCGGAAGAAAGCAAAGAAAGATACTTTCGGAAGAAAGCAAAGAA GTAAGAAGGCACATGGTAGTTTTCAAGTAAGAAGGCACATGGTAGTTTTCAA
FASFAS GCTGCTGTTGGAAGTCAGCGCTGCTGTTGGAAGTCAGC AGTGTTCGTTCCTCGGAGTGAGTGTTCGTTCCTCGGAGTG
F4/80F4/80 GACACTTCGGGCCATGTTGACACTTCGGGCCATGTT GAGGAGGACCAGGCCAATGAGGAGGACCAGGCCAAT
ICAM-1ICAM-1 CGTGTGCCATGCCTTTAGCTCGTGTGCCATGCCTTTAGCT TCCAGTTATTTTGAGAGTGGTACAGTACTGTCCAGTTATTTTGAGAGTGGTACAGTACTG
IL-1βIL-1β AGCACCTTCTTTCCCTTCATCTTTAGCACCTTCTTTCCCTTCATCTTT GAGGTGGAGAGCTTTCAGTTCATAGAGGTGGAGAGCTTTCAGTTCATA
MCP-1MCP-1 GGCTCAGCCAGATGCAGTTAAGGCTCAGCCAGATGCAGTTAA AGCCTACTCATTGGGATCATCTTAGCCTACTCATTGGGATCATCTT
PPARγPPARγ AGGCCGAGAAGGAGAAGCTGTTGAGGCCGAGAAGGAGAAGCTGTTG TGGCCACCTCTTTGCTCTGCTCTGGCCACCTCTTTGCTCTGCTC
SREBP-1cSREBP-1c TTCCTCAGACTGTAGGCAAATCTTTCCTCAGACTGTAGGCAAATCT AGCCTCAGTTTACCCACTCCTAGCCTCAGTTTTACCCACTCCT
TGF-βTGF-β CAACTACTGCTTCAGCTCCACAGAGCAACTACTGCTTCAGCTCCACAGAG CAAGGACCTTGCTGTACTGTGTGTCCAAGGACCTTGCTGTACTGTGTGTC
TNF-αTNF-α TGGCCCAGACCCTCACACTCAGATCTGGCCCAGACCCTCACACTCAGATC GCCTTGTCCCTTGAAGAGAACCTGGGCCTTGTCCCTTGAAGAGAACCTGG
VCAM-1VCAM-1 CCCTGAATACAAAACGATCGCCCCTGAATACAAAACGATCGC CAGCCCGTAGTGCTGCAAGCAGCCCCGTAGTGCTGCAAG
36B436B4 TCATTGTGGGAGCAGACAATGTGGTCATTGTGGGAGCAGACAATGTGG AGGTCCTCCTTGGTGAACACAAAGAGGTCCTCCTTGGTGAACACAAAG
α-SMA, α-smooth muscle actin;α-SMA, α-smooth muscle actin;
ACC, acetyl CoA carboxylase;ACC, acetyl CoA carboxylase;
CD31, cluster of differentiation;CD31, cluster of differentiation;
Col1α, collagen 1α;Col1α, collagen 1α;
Col4α, collagen 4α;Col4α, collagen 4α;
FAS, fatty acid synthase;FAS, fatty acid synthase;
ICAM-1, intercellular adhesion molecule 1;ICAM-1, intercellular adhesion molecule 1;
IL-1β, interleukin-1β;IL-1β, interleukin-1β;
MCP1, monocyte chemoattractant protein-1;MCP1, monocyte chemoattractant protein-1;
PPARγ, peroxisome proliferator-activated receptor γ;PPARγ, peroxisome proliferator-activated receptor γ;
SREBP-1c, sterol regulatory element binding protein-1c;SREBP-1c, sterol regulatory element binding protein-1c;
TGF-β, transforming growth factor-βTGF-β, transforming growth factor-β
TNF-α, tumor necrosis factor-α;TNF-α, tumor necrosis factor-α;
VCAM-1, vascular cell adhesion protein-1.VCAM-1, vascular cell adhesion protein-1.
5. 하이드록시프롤린 분석5. Hydroxyproline Analysis
간의 콜라겐 함량을 평가하기 위하여, 비색 분석 키트 (Bio Vision, Milpitas, CA)를 이용하여 하이드록시프롤린(hydroxyproline) 레벨을 측정하였다. 흡광도는 마이크로플레이트 리더 (BMG Labtech, Ortenberg, Germany)를 이용하여 560 nm에서 측정하였다.To evaluate the collagen content in the liver, hydroxyproline levels were measured using a colorimetric assay kit (Bio Vision, Milpitas, CA). Absorbance was measured at 560 nm using a microplate reader (BMG Labtech, Ortenberg, Germany).
6. 통계 분석6. Statistical Analysis
모든 값은 평균±SEM으로 표현하였다. SPSS 소프트웨어 (Window 12.0 버전; IBM, Armonk, NY, USA)를 이용하여 데이터를 분석하였다. 통계적 유의성은 post hoc Tukey-Kramer test와 함께 Student's t-test 및 one-way ANOVA를 이용하여 평가하였다. 이때, P 값이 < 0.05일 때, 차이가 유의한 것으로 간주하였다.All values were expressed as mean±SEM. Data were analyzed using SPSS software (Windows version 12.0; IBM, Armonk, NY, USA). Statistical significance was evaluated using Student's t-test and one-way ANOVA with post hoc Tukey-Kramer test. At this time, when the P value was <0.05, the difference was considered significant.
<실시예1> 비알콜성 지방간염의 예방 또는 치료를 위한 약학적 조성물의 준비<Example 1> Preparation of a pharmaceutical composition for the prevention or treatment of nonalcoholic steatohepatitis
하기 화학식 2로 표시되는 화합물 1은 화합물 명이 (E)-메틸 6-((3S,8S,9S,10R,13S,14S,17R)-3-(((5S,6R)-5-아세톡시-6-(아세톡시메틸)-5,6-디하이드로-2H-피란-2-일)옥시)-10,13-디메틸-2,3,4,7,8,9,10,11,12,13,14,15,16,17-테트라데카하이드로-1H-사이클로펜타[a]페난트렌-17-일)헵트-5-에노에이트이며, 코드명 SAC-1004로 대한민국 공개특허 10-2011-0047170에 개시된 화합물이다. Compound 1 represented by the following formula (2) has a compound name of (E)-methyl 6-((3S,8S,9S,10R,13S,14S,17R)-3-(((5S,6R)-5-acetoxy- 6-(acetoxymethyl)-5,6-dihydro-2H-pyran-2-yl)oxy)-10,13-dimethyl-2,3,4,7,8,9,10,11,12, 13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl)hept-5-enoate, under the code name SAC-1004, Republic of Korea Patent Publication 10-2011-0047170 compounds disclosed in
화합물 1은 Maharjan S et al., Sac-1004, a novel vascular leakage blocker, enhances endothelial barrier through the cAMP/Rac/cortacin pathway. Biochem Biophys Res Commun. 2013; 435: 420-427.에 기재된 방법에 따라 합성하였다. 실시예 1에 따른 약학적 조성물은 화합물 1 (50 mg/mL)을 다이메틸 설폭사이드(DMSO)를 용매로하여 제조하였으며, 포스페이트 완충 식염수(PBS)로 희석용액을 제조하였다. Compound 1 is Maharjan S et al., Sac-1004, a novel vascular leakage blocker, enhances endothelial barrier through the cAMP/Rac/cortacin pathway. Biochem Biophys Res Commun. 2013; 435: synthesized according to the method described in 420-427. The pharmaceutical composition according to Example 1 was prepared by using Compound 1 (50 mg/mL) with dimethyl sulfoxide (DMSO) as a solvent, and a diluted solution was prepared with phosphate buffered saline (PBS).
[화학식 2][Formula 2]
Figure PCTKR2021007940-appb-img-000012
Figure PCTKR2021007940-appb-img-000012
<실험예 1> CDAA-유도 NASH 마우스에서 대사지표에 대한 효과 평가<Experimental Example 1> Evaluation of effects on metabolic indicators in CDAA-induced NASH mice
7주령의 수컷 마우스를 DBL (서울, 한국)에서 구입하여 실험에 이용하였다. 실험용 동물은 1주일 동안 식이 조절 (Purina Laboratory rodent diet 38057; Purina Korea Inc., 서울, 한국)을 유지한 후 하기와 같은 그룹으로 분리하였다:Seven-week-old male mice were purchased from DBL (Seoul, Korea) and used in the experiment. Experimental animals were separated into the following groups after maintaining diet control (Purina Laboratory rodent diet 38057; Purina Korea Inc., Seoul, Korea) for 1 week:
Con 그룹: 대조군(control diet);Con group: control diet;
CD 그룹: 콜린-결핍 L-아미노산(choline-deficient L-amino acid, CDAA) 식단 그룹 (CDAA; A06071302; Research Diets Inc., New Brunswick, NJ);CD group: choline-deficient L-amino acid (CDAA) diet group (CDAA; A06071302; Research Diets Inc., New Brunswick, NJ);
실시예 1 그룹: 화합물 1 10 mg/kg/day로 3주 또는 6주 동안 처리된 CDAA 식단 그룹Example 1 group: CDAA diet group treated with compound 1 10 mg/kg/day for 3 weeks or 6 weeks
상기 실시예 1 그룹에서 3주 및 6주 그룹의 마우스는 각각 CDAA 식단을 1주 및 3주 동안 받은 후 2주 및 3주 동안 CDAA 식단과 함께 화합물 1로 처리되었다. 마우스는 동일한 부피의 경구용 컨트롤 용액, 비히클 또는 화합물 1 (10 mg/kg 체중)로 하루 한번 처리되었다.In the Example 1 group, mice in the 3-week and 6-week groups received the CDAA diet for 1 week and 3 weeks, respectively, and then were treated with Compound 1 along with the CDAA diet for 2 weeks and 3 weeks. Mice were treated with an equal volume of oral control solution, vehicle or compound 1 (10 mg/kg body weight) once daily.
모든 실험용 마우스는 12:12-시간 명:암 주기에서 일정 온도 (23 ℃) 및 습도 (60%)의 표준 케이지에 수용되었으며, 먹이와 물의 접근에 제한이 없도록 하였다. 마우스는 일주일에 한번 그 무게를 재었으며, 조직 수집을 위해 안락시키기 전에 16시간 동안 금식시켰다. 동물이 관여되는 모든 실험은 사전에 Animal Care 및 Use Committee of the Yonsei University (서울, 한국)에 승인받았으며, 승인된 가이드라인 (IACUC-A-201901-854-02)에 따라 수행하였다.All experimental mice were housed in standard cages at constant temperature (23° C.) and humidity (60%) in a 12:12-hour light:dark cycle, with no restrictions on access to food and water. Mice were weighed once a week and fasted for 16 h before being euthanized for tissue collection. All experiments involving animals were previously approved by the Animal Care and Use Committee of the Yonsei University (Seoul, Korea), and were performed according to the approved guidelines (IACUC-A-201901-854-02).
실험예 1은 CDAA-유도 NASH 마우스에서 실시예 1의 대사지표(metabolic parameters)에 대한 효과를 확인하기 위하여 Con 그룹, CD 그룹, 실시예 1 그룹에 대하여 3주 (연구 1) 또는 6주 (연구 2) 동안 시험하였으며, 시험 마우스는 실험 종료 전 각각 2주 또는 3주 전에 실시예 1을 2주 (연구 1) 또는 3주 (연구 2) 동안 경구로 처리되었다 (도 1a). 이때 상기 연구 1에 의한 마우스는 경증 NASH (mild NASH) 마우스 모델이고, 연구 2에 의한 마우스는 중증 NASH (moderate NASH) 마우스 모델이다.Experimental Example 1 was performed in CDAA-induced NASH mice for 3 weeks (study 1) or 6 weeks (study 1) for Con group, CD group, and Example 1 group to confirm the effect on the metabolic parameters of Example 1 2), and test mice were orally treated with Example 1 for 2 weeks (study 1) or 3 weeks (study 2), respectively, 2 or 3 weeks before the end of the experiment ( FIG. 1A ). In this case, the mouse according to Study 1 is a mild NASH mouse model, and the mouse according to Study 2 is a severe NASH (moderate NASH) mouse model.
실험은 상기 <실험 프로토콜> 1, 2 및 6에 따라 수행하였다. 그 결과를 도 1b 내지 도 1i에 나타내었다.Experiments were performed according to <Experiment Protocol> 1, 2, and 6 above. The results are shown in FIGS. 1B to 1I.
각 실험 그룹의 체중을 기록한 결과, 연구 1과 연구 2의 마우스의 체중이 CDAA 식단을 3주 또는 6주 공급받은 동안 CD 그룹과 실시예 1 그룹에 비해 대조군 동물의 체중이 증가하는 것으로 확인되었으며, 한편 CD 그룹과 실시예 1 그룹 사이에서 유의한 체중 차이는 나타나지 않았다 (도 1b, 도 1h).As a result of recording the body weight of each experimental group, it was confirmed that the weight of the mice in Study 1 and Study 2 increased compared to the CD group and Example 1 group while the mice received the CDAA diet for 3 or 6 weeks, Meanwhile, there was no significant difference in body weight between the CD group and the Example 1 group ( FIGS. 1b and 1h ).
또한, 포도당 내성 시험(GTT), 혈청 트리글리세라이드(TG) 및 아스파르테이트 아미노전달효소(AST) 분석 결과, CD 그룹과 실시예 1 그룹 사이에 큰 차이를 확인할 수 없었다 (도 1c, 도 1d, 도 1f 및 도 1i). 한편, 전체 콜레스테롤(TC) 및 알라닌 아미노전달효소(ALT) 분석에서는 연구 2에서 실시예 1 그룹이 CD 그룹과 비교할 때 유의한 정도의 낮은 수치를 확인할 수 있었다.In addition, as a result of glucose tolerance test (GTT), serum triglyceride (TG) and aspartate aminotransferase (AST) analysis, no significant difference was found between the CD group and the Example 1 group (Fig. 1c, Fig. 1d, 1f and 1i). On the other hand, in the analysis of total cholesterol (TC) and alanine aminotransferase (ALT), it was confirmed that the Example 1 group in Study 2 was significantly lower than the CD group.
이를 통해, 실시예 1을 이용하여 CDAA-유도 NASH 마우스의 간 손상을 완화시킬 수 있음을 확인할 수 있다.Through this, it can be confirmed that using Example 1 can alleviate the liver damage of CDAA-induced NASH mice.
<실험예 2> CDAA-유도 NASH 마우스에서 지방간 예방 효과 평가<Experimental Example 2> Evaluation of the effect of preventing fatty liver in CDAA-induced NASH mice
지질은 NASH 발달 초기 단계에 간에 축적되기 시작한다. 이때 실시예 1이 CDAA-유도 NASH 마우스에서 간의 지질 축적에 영향을 주는지 확인하고 지방간(hepatic steatosis)에 대한 예방 효과를 확인하기 위하여 상기 <실험 프로토콜> 2, 3, 4 및 6에 따라 수행하였다. 그 결과를 도 2a 내지 도 2i에 나타내었다.Lipids begin to accumulate in the liver at an early stage in NASH development. At this time, in order to confirm that Example 1 affects the lipid accumulation in the liver in CDAA-induced NASH mice and to confirm the preventive effect on hepatic steatosis, it was carried out according to <Experimental Protocol> 2, 3, 4 and 6. The results are shown in FIGS. 2A to 2I.
먼저, 도 2b의 CD 그룹에서 나타낸 것처럼 H&E로 염색한 구역의 간의 형태학적 분석을 통해 CDAA 식단을 통해 유발된 지방간을 확인할 수 있었다. 한편, 실시예 1 그룹 마우스는 3주 (연구 1) 및 6주 (연구 2)에서 모두 CD 그룹에 비해 지질방울(lipid droplets)이 감소된 것으로 나타났다 (도 2a 및 도 2b).First, as shown in the CD group of FIG. 2b, fatty liver induced through the CDAA diet could be identified through the morphological analysis of the liver in the area stained with H&E. On the other hand, the Example 1 group mice showed reduced lipid droplets compared to the CD group at both 3 weeks (study 1) and 6 weeks (study 2) ( FIGS. 2a and 2b ).
CDAA-유도 NASH 마우스의 3주 또는 6주 후의 간 대비 체중 비율을 확인한 결과, 대조군에 비해 CDAA 식단을 공급받은 그룹에서 간 대비 체중 비율이 증가한 반면, CD 그룹과 실시예 1 그룹의 간 대지 체중의 비율에는 유의한 차이가 없었다 (도 2c).As a result of confirming the liver-to-body weight ratio after 3 or 6 weeks of CDAA-induced NASH mice, the liver-to-body weight ratio increased in the group fed the CDAA diet compared to the control group, whereas the liver-to-body weight ratio of the CD group and the Example 1 group There was no significant difference in the proportions (Fig. 2c).
간의 생화학적 분석 결과, 실시예 1의 처리는 간의 TG 레벨 (도 2d) 및 간의 TC 레벨 (도 2e)을 유의하게 감소시키는 것으로 나타났다. 특히, 간의 TG 레벨은 경증 NASH 마우스에서는 유의한 감소를 나타내지 못한 반면, 중증 NASH 마우스에서는 효과적으로 간의 TG 레벨을 감소시켰고, 간의 TC 레벨은 경증 및 중증 NASH 마우스에서 모두 효과적으로 감소하였다.As a result of liver biochemical analysis, it was shown that the treatment of Example 1 significantly reduced the TG level in the liver ( FIG. 2D ) and the TC level in the liver ( FIG. 2E ). In particular, hepatic TG levels did not show a significant decrease in mild NASH mice, whereas severe NASH mice effectively reduced hepatic TG levels, and liver TC levels were effectively reduced in both mild and severe NASH mice.
다음으로, 지질합성(lipogenesis)과 관련된 유전자 발현을 조사하였다. 그 결과 스테롤(sterol) 조절 인자-결합 전사 인자-1c(SREBP-1c) 및 아세틸-CoA carboxylase(ACC) mRNA의 발현은 실시예 1의 처리에 의해 영향을 받지 않는 것으로 나타났으며 (도 2f 및 도 2g), 반면 FAS mRNA 뿐만 아니라, NAFLD의 발병 기전에서 지질 대사 및 염증 반응을 조절하는 전사 인자인 PPARγ mRNA 발현은 실시예 1의 처리에 의해 유의한 정도로 감소된 것을 확인할 수 있었다 (도 2h 및 도 2i).Next, gene expression related to lipogenesis was investigated. As a result, the expression of sterol regulatory factor-binding transcription factor-1c (SREBP-1c) and acetyl-CoA carboxylase (ACC) mRNA was not affected by the treatment of Example 1 (Fig. 2f and 2g), on the other hand, FAS mRNA, as well as PPARγ mRNA expression, a transcription factor that regulates lipid metabolism and inflammatory response in the pathogenesis of NAFLD, was confirmed to be significantly reduced by the treatment of Example 1 (Fig. 2h and Fig. 2i).
이를 통해, 실시예 1의 처리가 CDAA-유도 NASH 마우스 간에서 간 손상 정도 및 지질 축적을 효과적으로 감소시키며, 이러한 효과는 FAS 및 PPARγ과 같은 지질합성 관련 유전자의 하향 조절과 상관관계가 있음을 확인하였다. Through this, it was confirmed that the treatment of Example 1 effectively reduced the degree of liver damage and lipid accumulation in the liver of CDAA-induced NASH mice, and that this effect was correlated with the down-regulation of lipid synthesis-related genes such as FAS and PPARγ. .
<실험예 3> CDAA-유도 NASH 마우스에서 간염 및 전신 염증 완화 효과 평가<Experimental Example 3> Evaluation of the effect of alleviating hepatitis and systemic inflammation in CDAA-induced NASH mice
간염은 NASH 진행에 중요한 요소이며, 간 손상은 쿠퍼 세포(Kupffer cells)의 활성화를 유발하여 염증성 사이토카인 및 케모카인의 발현을 증가시킨다.Hepatitis is an important factor in NASH progression, and liver damage induces activation of Kupffer cells, resulting in increased expression of inflammatory cytokines and chemokines.
간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs)는 대식세포와 함께 중요한 항염증 역할을 수행하는데, LSEC는 NASH에서 염증성 매개체를 생성하고, LSEC로부터 염증성 사이토카인의 방출은 대식세포를 활성화시킴으로써 염증 반응에 추가로 기여한다. 이때, LSECs는 NAFLD의 초기 단계에서 지방간의 형태학적 및 기능적 변화를 겪게 된다. 따라서 CDAA-유도 NASH 마우스에서 실시예 1의 간염 및 전신 염증(systemic inflammation)에 대한 완화 효과를 확인하기 위하여 상기 <실험 프로토콜> 2, 3, 4 및 6에 따라 수행하였다. 그 결과를 도 3a 내지 3g에 나타내었다.Liver sinusoidal endothelial cells (LSECs), along with macrophages, play an important anti-inflammatory role, which produces inflammatory mediators in NASH, and release of inflammatory cytokines from LSEC activates macrophages. It further contributes to the inflammatory response. At this time, LSECs undergo morphological and functional changes in the fatty liver in the early stages of NAFLD. Therefore, in order to confirm the alleviation effect on hepatitis and systemic inflammation of Example 1 in CDAA-induced NASH mice, it was carried out according to <Experimental Protocol> 2, 3, 4 and 6. The results are shown in FIGS. 3A to 3G.
그 결과, 연구 1에 따른 경증 NASH 마우스는 실시예 1의 처리에 의해 F4/80 및 MCP-1(monocyte chemoattractant protein-1)의 mRNA 발현이 유의적으로 감소한 것으로 나타났다 (도 3a 및 도 3b). 연구 2의 중증 NASH 마우스는 실시예 1의 처리에 의해 MCP-1과 같은 M1 대식세포 마커, 인터루킨 1(interleukin 1, IL-1β) 및 종양괴사인자-α(tumor necrosis factor-α, TNF-α)의 mRNA 발현이 유의적으로 감소한 것으로 나타났다 (도 3b 내지 도 3d).As a result, it was found that the mRNA expression of F4/80 and monocyte chemoattractant protein-1 (MCP-1) was significantly reduced in the mild NASH mice according to Study 1 by the treatment of Example 1 ( FIGS. 3A and 3B ). Severe NASH mice in Study 2 were treated in Example 1 with M1 macrophage markers such as MCP-1, interleukin 1 (IL-1β) and tumor necrosis factor-α (tumor necrosis factor-α, TNF-α). ) was significantly reduced in mRNA expression ( FIGS. 3b to 3d ).
F4/80에 대한 면역조직화학적 염색을 통해 실시예 1에 의해 F4/80 양성 영역비율을 확인한 결과, 실시예 1 그룹의 경증 또는 중증의 CDAA-유도 NASH를 갖는 마우스에서 대식세포 마커 F4/80의 침윤을 상당히 감소시키는 것을 확인하였다 (도 3e 및 도 3f). 또한, 실시예 1 그룹에서 IL-6와 같은 염증성 사이토카인 레벨이 유의하게 감소하였으며 (특히, 경증 NASH 마우스), 마우스 혈청 TNF-α 레벨도 유의하게 감소하였다 (특히, 중증 NASH 마우스).As a result of confirming the F4/80 positive area ratio by Example 1 through immunohistochemical staining for F4/80, the macrophage marker F4/80 in mice with mild or severe CDAA-induced NASH of the Example 1 group It was confirmed that the infiltration was significantly reduced ( FIGS. 3E and 3F ). In addition, the level of inflammatory cytokines such as IL-6 was significantly decreased in the Example 1 group (particularly, mild NASH mice), and the mouse serum TNF-α level was also significantly decreased (particularly, severe NASH mice).
이를 통해, 실시예 1이 NASH를 갖는 마우스에서 대식세포의 침윤을 감소시켜 전신 염증을 약화시키는 효과가 있으며, 지방간염 발병에 관여하는 주요 염증 인자의 발현을 감소시키는 효과가 있음을 알 수 있다.Through this, it can be seen that Example 1 has the effect of attenuating systemic inflammation by reducing macrophage infiltration in mice with NASH, and has the effect of reducing the expression of major inflammatory factors involved in the development of steatohepatitis.
<실험예 4> CDAA-유도 NASH 마우스에서 간 섬유증 억제 효과 평가<Experimental Example 4> Evaluation of the effect of inhibiting liver fibrosis in CDAA-induced NASH mice
건강한 간에서 LSEC는 HSC의 활성화를 막아 섬유화를 방지하는 역할을 하는 반면, 모세관화된 LSECs는 염증 매개체를 방출하고, 대식세포 및 HSC의 동원(recruitment)에 기여하여 염증 및 섬유증을 촉진시키게 된다. 이에, CDAA-유도 NASH 마우스 모델에서 실시예 1의 간 성상 세포(hepatic stellate cells, HSCs) 활성화에 영향을 미치는지 여부를 확인하기 위하여 상기 <실험 프로토콜> 3, 4, 5 및 6에 따라 수행하였다. 그 결과를 도 4a 내지 4g에 나타내었다.In healthy liver, LSECs play a role in preventing fibrosis by blocking HSC activation, whereas capillary LSECs release inflammatory mediators and contribute to recruitment of macrophages and HSCs to promote inflammation and fibrosis. Accordingly, in order to determine whether the CDAA-induced NASH mouse model affects the hepatic stellate cells (HSCs) activation of Example 1, it was performed according to <Experimental Protocol> 3, 4, 5 and 6. The results are shown in Figs. 4a to 4g.
HSC의 활성화는 Sirius red 및 α-SMA 염색 증가에 의해 나타난 것처럼 형태 및 세포외 매트릭스의 변화를 유도한다. 한편, 도 4a 및 도 4b를 통해 CD 식단 공급 3주 후 (경증 NASH) 실시예 1 그룹에서 Sirius red 염색 및 α-SMA 양성 영역이 감소하는 것을 확인할 수 있으며, 이를 통해 실시예 1은 경증 CDAA-유도 NASH 마우스에서 섬유증을 억제하는 효과가 있다는 것을 알 수 있다.Activation of HSCs induces changes in morphology and extracellular matrix, as indicated by increased Sirius red and α-SMA staining. On the other hand, it can be confirmed that Sirius red staining and α-SMA-positive areas are decreased in Example 1 group after 3 weeks of CD diet supply (mild NASH) through FIGS. 4a and 4b, and through this, Example 1 is mild CDAA- It can be seen that there is an effect of inhibiting fibrosis in induced NASH mice.
또한, CD 그룹에 비해 실시예 1 그룹에서 α-SMA(α-smooth muscle actin), Col1α(collagen 1α), Col4α(collagen 4α) 및 TGF-β(transforming growth factor-β)와 같은 섬유증 관련 유전자의 mRNA 발현이 유의하게 감소하는 것을 확인할 수 있다.In addition, compared to the CD group, fibrosis-related genes such as α-SMA (α-smooth muscle actin), Col1α (collagen 1α), Col4α (collagen 4α) and TGF-β (transforming growth factor-β) in the Example 1 group compared to the CD group It can be seen that mRNA expression is significantly reduced.
특히, 하이드록시프롤린(hydroxyproline) 레벨은 실시예 1에서 매우 우수하게 감소하는 것으로 나타났다.In particular, it was found that the hydroxyproline level decreased very well in Example 1.
이를 통해, 실시예 1이 간에서 HSC를 억제함으로써 콜라겐의 축적을 감소시킴으로써 간에서 가벼운 원섬유성(fibrillar) 콜라겐의 침착을 감소시키는 효과가 있음을 알 수 있다.Through this, it can be seen that Example 1 has the effect of reducing the deposition of light fibrillar collagen in the liver by reducing the accumulation of collagen by suppressing HSC in the liver.
<실험예 5> CDAA-유도 NASH 마우스에서 LSEC 모세관화 개선 효과 평가<Experimental Example 5> Evaluation of LSEC capillary improvement effect in CDAA-induced NASH mice
간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs)의 모세관화 및 기능장애는 대사성 간 질환의 진행 초기에 발생하며, 이러한 LSEC 모세관화는 지방간에서 발생하여 간 혈관의 저항 증가에 기여하게 된다. 비알콜성 지방간 질환(NAFLD)에 있어서, LSEC는 E-셀렉틴(E-selectin), ICAM-1(intercellular adhesion molecule-1), VCAM-1(vascular cell adhesion molecule-1) 및 CD31(cluster of differentiation 31)와 같은 내피세포 부착 분자의 발현을 증가시키는 것을 특징으로 하는데, 이 분자들은 세포-세포 상호작용에 영향을 미치며 염증성 사이토카인에 의해 조질되는 분자들이다. 이에, 면역조직화학 염색을 통해 ICAM-1 및 CD31 발현 변화를 분석하기 위해 상기 <실험 프로토콜> 3, 4 및 6에 따라 수행하였다. 그 결과를 도 5a 내지 5f에 나타내었다. Capillarization and dysfunction of liver sinusoidal endothelial cells (LSECs) occur early in the progression of metabolic liver disease, and this LSEC capillaryization occurs in fatty liver and contributes to increased resistance of hepatic blood vessels. In nonalcoholic fatty liver disease (NAFLD), LSEC is E-selectin (E-selectin), ICAM-1 (intercellular adhesion molecule-1), VCAM-1 (vascular cell adhesion molecule-1) and CD31 (cluster of differentiation) 31), which is characterized by increasing the expression of endothelial cell adhesion molecules, such as molecules that affect cell-cell interactions and are tempered by inflammatory cytokines. Therefore, in order to analyze the changes in ICAM-1 and CD31 expression through immunohistochemical staining, it was performed according to <Experimental Protocol> 3, 4 and 6. The results are shown in Figures 5a to 5f.
ICAM-1 양성 영역은 경증 NASH 마우스 및 중증 NASH 마우스의 실시예 1 그룹에서 모두 유의하게 감소하는 것으로 나타났으며 (도 5a), CD31의 발현은 경증 NASH 마우스에서 효과적으로 감소하였다 (도 5b). CD31은 NASH에서 증가된 LSEC 모세관화를 평가할 수 있는 마커이므로, 경증 CDAA-유도 NASH 마우스에서 실시예 1의 처리는 CD31의 발현을 감소시킨 상기 결과를 통해 모세관화가 감소되었음을 확인할 수 있다.The ICAM-1 positive region was significantly decreased in both the Example 1 group of mild NASH mice and severe NASH mice (FIG. 5A), and the expression of CD31 was effectively decreased in mild NASH mice (FIG. 5B). Since CD31 is a marker capable of evaluating increased LSEC capillaryization in NASH, it can be confirmed that the treatment of Example 1 in mild CDAA-induced NASH mice reduced the expression of CD31 through the above results.
내피세포 부착 분자 관련 유전자에 관여하는 E-셀렉틴 및 ICAM-1의 mRNA 발현은 실시예 1 그룹에서 모두 유의하게 나타났으며, 경증 NASH 및 중증 NASH에서 모두 효과적으로 감소하였다(도 5c 및 도 5d). VCAM-1 및 CD31 mRNA의 발현 역시 실시예 1 그룹에서 유의하게 감소하는 것을 확인할 수 있다 (도 5e 및 5f).The mRNA expression of E-selectin and ICAM-1, which are involved in endothelial cell adhesion molecule-related genes, were all significant in the Example 1 group, and were effectively decreased in both mild NASH and severe NASH ( FIGS. 5c and 5d ). It can be seen that the expression of VCAM-1 and CD31 mRNA also significantly decreased in the Example 1 group ( FIGS. 5e and 5f ).
이를 통해, 실시예 1이 LSEC에 의한 세포 부착 분자인 E-셀렉틴, ICAM-1 및 VCAM-1의 발현을 하향 조절하는 역할을 수행할 수 있으며, NASH를 갖는 마우스에서 LSEC 모세관화를 우수하게 개선시키는 효과가 있음을 알 수 있다.Through this, Example 1 can play a role in downregulating the expression of cell adhesion molecules E-selectin, ICAM-1 and VCAM-1 by LSEC, and excellently improve LSEC capillaryization in mice with NASH It can be seen that there is an effect that
이상, 본 발명을 바람직한 제조예, 실시예 및 실험예를 통해 상세히 설명하였으나, 본 발명의 범위는 특성 실시예에 한정되는 것은 아니며, 첨부된 특허청구범위에 의하여 해석되어야 할 것이다. 또한, 이 기술분야에서 통상의 지식을 습득한 자라면, 본 발명의 범위에서 벗어나지 않으면서도 많은 수정과 변형이 가능함을 이해하여야 할 것이다.As mentioned above, although the present invention has been described in detail through preferred preparation examples, examples and experimental examples, the scope of the present invention is not limited to the characteristic examples, and should be interpreted by the appended claims. In addition, those skilled in the art should understand that many modifications and variations are possible without departing from the scope of the present invention.

Claims (19)

  1. 하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는,A compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof containing as an active ingredient,
    지방간 질환의 예방 또는 치료용 약학적 조성물:A pharmaceutical composition for preventing or treating fatty liver disease:
    [화학식 1][Formula 1]
    Figure PCTKR2021007940-appb-img-000013
    Figure PCTKR2021007940-appb-img-000013
    상기 화학식 1에서,In Formula 1,
    X는 산소 또는 황이고;X is oxygen or sulfur;
    Figure PCTKR2021007940-appb-img-000014
    는 단일결합 또는 이중결합을 나타내고;
    Figure PCTKR2021007940-appb-img-000014
    represents a single bond or a double bond;
    R1은 수소, 할로, C1-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-15 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-15 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민, C2-15 에스테르, 설페이트, 카르복실기, C3-20 카르복시알킬, C3-20 카르복시알케닐, C3-20 알킬카르복실, C3-20 알케닐카르복실, C3-20 알킬카르복시알킬, C3-20 알킬카르복시알케닐, C3-20 알케닐카르복시알킬, C4-20 알케닐카르복시알케닐, C6-30 아릴, C6-30 아랄킬, C6-30 알카릴, 헤테로원자로서 질소를 포함하는 C3-30 헤테로아릴 또는 C6-30 아릴카르보닐이고;R 1 is hydrogen, halo, C 1-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-15 containing oxygen, sulfur or nitrogen as a heteroatom Heterocycloalkyl, C 3-15 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxyalkoxyalkyl, containing oxygen, sulfur or nitrogen as heteroatom C 3-10 heterocycloalkenyl, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1-10 amine, C 2-15 ester, sulfate, carboxyl group, C 3-20 carboxyalkyl, C 3-20 carboxy alkenyl, C 3-20 alkyl, carboxyl, C 3-20 alkenyl, carboxyl, C 3-20 alkyl, carboxyalkyl, C 3-20 alkyl, carboxy-alkenyl, C 3-20 alkenylcarboxyalkyl, C 4-20 alkenylcarboxyalkenyl, C 6-30 aryl, C 6-30 aralkyl, C 6-30 alkaryl, C 3-30 hetero containing nitrogen as a heteroatom aryl or C 6-30 arylcarbonyl;
    R21은 C2-30 알킬, C3-10 사이클로알킬, C2-30 알케닐, C3-10 사이클로알케닐, C2-30 카르복시알킬, C2-30 알킬카르복실, C3-30 카르복시알케닐, C3-30 알케닐카르복실, C3-30 알킬카르복시알킬, C3-30 알킬카르복시알케닐, C3-30 알케닐카르복시알킬, C4-30 알케닐카르복시알케닐, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C2-10 헤테로사이클로알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알킬알킬, C2-30 알콕시알킬, C3-30 알콕시알콕시알킬, 헤테로원자로서 산소, 황 또는 질소를 포함하는 C3-10 헤테로사이클로알케닐, C1-20 알코올, C1-20 알케놀, C2-30 아실, C1-10 아미드, C1-10 아민 또는 C2-15 에스테르이고;R 21 is C 2-30 alkyl, C 3-10 cycloalkyl, C 2-30 alkenyl, C 3-10 cycloalkenyl, C 2-30 carboxyalkyl, C 2-30 alkylcarboxyl, C 3-30 carboxy alkenyl, C 3-30 alkenyl, carboxyl, C 3-30 alkyl, carboxyalkyl, C 3-30 alkyl, carboxy alkenyl, C 3-30 alkenyl, carboxy alkyl, C 4-30 alkenyl, carboxy-alkenyl, heteroaryl, C 2-10 heterocycloalkyl containing oxygen, sulfur or nitrogen as atom, C 3-10 heterocycloalkylalkyl containing oxygen, sulfur or nitrogen as heteroatom, C 2-30 alkoxyalkyl, C 3-30 alkoxy Alkoxyalkyl, C 3-10 heterocycloalkenyl containing oxygen, sulfur or nitrogen as heteroatom, C 1-20 alcohol, C 1-20 alkenol, C 2-30 acyl, C 1-10 amide, C 1 -10 amines or C 2-15 esters;
    R22는 수소, 히드록시, 할로 또는 C1-10 알킬이고;R 22 is hydrogen, hydroxy, halo or C 1-10 alkyl;
    R23은 수소, 히드록시 또는 C1-10 알킬이고;R 23 is hydrogen, hydroxy or C 1-10 alkyl;
    R21은 R22 및 R23과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 21 together with R 22 and R 23 may form a double bond to the carbon it bonds;
    R23은 R21 및 R22과 함께 결합하는 탄소에 대하여 이중결합을 형성할 수 있고;R 23 together with R 21 and R 22 may form a double bond to the carbon it bonds;
    R21 또는 R23이 상기 탄소에 이중결합을 형성하는 경우 R22는 원자를 포함하지 않고; 및when R 21 or R 23 forms a double bond at the carbon, R 22 contains no atoms; and
    R3 및 R4는 서로 독립적으로 수소 또는 C1-10 알킬이다.R 3 and R 4 are each independently hydrogen or C 1-10 alkyl.
  2. 제1항에 있어서,According to claim 1,
    상기 화학식 1의 X는 산소인 것을 특징으로 하는 약학적 조성물.X of Formula 1 is a pharmaceutical composition, characterized in that oxygen.
  3. 제1항에 있어서,According to claim 1,
    R3 및 R4는 서로 독립적으로 C1-3 알킬인 것을 특징으로 하는 약학적 조성물.R 3 and R 4 are each independently C 1-3 alkyl.
  4. 제1항에 있어서,According to claim 1,
    R23은 C1-3 알킬이고;R 23 is C 1-3 alkyl;
    R21 및 R22는 함께 C1-5 알킬바이닐을 형성하고, 이때 상기 알킬바이닐은 C1-3 알콕시카보닐로 치환되는 것을 특징으로 하는 약학적 조성물.R 21 and R 22 together form C 1-5 alkylvinyl, wherein the alkylvinyl is substituted with C 1-3 alkoxycarbonyl.
  5. 제1항에 있어서,According to claim 1,
    R1은 산소, 황 또는 질소를 포함하는 C3-8 헤테로사이클로알케닐인 것을 특징으로 하는 약학적 조성물.R 1 is oxygen, sulfur or nitrogen-containing C 3-8 heterocycloalkenyl pharmaceutical composition, characterized in that.
  6. 제1항에 있어서,According to claim 1,
    R1은 산소를 포함하는 C5 헤테로사이클로알케닐인 것을 특징으로 하는 약학적 조성물.R 1 is C 5 heterocycloalkenyl containing oxygen A pharmaceutical composition, characterized in that.
  7. 제1항에 있어서,According to claim 1,
    상기 화학식 1의
    Figure PCTKR2021007940-appb-img-000015
    는 이중결합인 것을 특징으로 하는 약학적 조성물.
    of Formula 1
    Figure PCTKR2021007940-appb-img-000015
    is a pharmaceutical composition, characterized in that the double bond.
  8. 제1항에 있어서,According to claim 1,
    상기 화학식 1은 하기 화학식 2로 표시되는 화합물인 것을 특징으로 하는 약학적 조성물:Formula 1 is a pharmaceutical composition, characterized in that the compound represented by the following formula 2:
    [화학식 2][Formula 2]
    Figure PCTKR2021007940-appb-img-000016
    .
    Figure PCTKR2021007940-appb-img-000016
    .
  9. 제1항에 있어서,According to claim 1,
    상기 지방간 질환은 단순 지방간(fatty liver), 알코올성 지방간(alcoholic fatty liver), 영양성 지방간, 기아성 지방간, 비만성 지방간, 당뇨병성 지방간, 지방간염(steatohepatitis), 비알콜성 지방간 질환(non-alcoholic fatty liver disease, NAFLD), 비알콜성 지방간염(non-alcoholic steatohepatitis, NASH) 및 섬유증으로 이루어지는 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.The fatty liver disease is simple fatty liver (fatty liver), alcoholic fatty liver (alcoholic fatty liver), nutritive fatty liver, starvation fatty liver, obese fatty liver, diabetic fatty liver, steatohepatitis, non-alcoholic fatty liver disease (non-alcoholic fatty) Liver disease, NAFLD), non-alcoholic steatohepatitis (NASH), and a pharmaceutical composition, characterized in that at least one selected from the group consisting of fibrosis.
  10. 제9항에 있어서,10. The method of claim 9,
    상기 섬유증은 신장 섬유증, 심장 섬유증, 췌장 섬유증, 폐 섬유증, 혈관 섬유증, 피부 섬유증, 골수 섬유증, 간 섬유증, 장 섬유증, 경피증 및 낭포성 섬유증으로 이루어지는 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.The fibrosis is at least one selected from the group consisting of renal fibrosis, cardiac fibrosis, pancreatic fibrosis, pulmonary fibrosis, vascular fibrosis, skin fibrosis, bone marrow fibrosis, liver fibrosis, intestinal fibrosis, scleroderma and cystic fibrosis. composition.
  11. 제10항에 있어서,11. The method of claim 10,
    상기 간 섬유증은 간경변증, 간신증후군, 간자반병, 대사성 간질환, 만성 간질환, B형 간염 바이러스 감염, C형 간염 바이러스 감염. D형 간염 바이러스 감염, 주혈흡충증, 알콜성 간질환, 비알콜성 지방간염, 당뇨, 단백질 결핍증, 관상동맥질환, 자가면역 간염, 알파-1 항트립신 결핍증 및 일차성 담즙성 간경화증으로 이루어지는 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.The liver fibrosis is cirrhosis, hepatic nephrotic syndrome, hepatic purpura, metabolic liver disease, chronic liver disease, hepatitis B virus infection, hepatitis C virus infection. Hepatitis D virus infection, schistosomiasis, alcoholic liver disease, nonalcoholic steatohepatitis, diabetes, protein deficiency, coronary artery disease, autoimmune hepatitis, alpha-1 antitrypsin deficiency and primary biliary cirrhosis A pharmaceutical composition, characterized in that at least one of the
  12. 제10항에 있어서,11. The method of claim 10,
    상기 폐 섬유증은 기관지염, 급성 기관지염, 미만성범세기관지염, 모세기관지염, 특발성 폐섬유증, 급성 간질성 폐렴, 과민성 간질성 폐렴, 폐이식, 낭포성 섬유증, 방사선 유발 폐섬유증, 만성폐쇄성 폐질환, 천식, 기관지확장증, 폐결핵, 폐렴, 진폐증, 과민성폐렴, 폐부종 및 사르코이드증(sarcoidosis)으로 이루어지는 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.The lung fibrosis is bronchitis, acute bronchitis, diffuse panbronchitis, bronchiolitis, idiopathic pulmonary fibrosis, acute interstitial pneumonia, hypersensitivity interstitial pneumonia, lung transplantation, cystic fibrosis, radiation-induced pulmonary fibrosis, chronic obstructive pulmonary disease, asthma, bronchi A pharmaceutical composition, characterized in that at least one selected from the group consisting of dilatation, pulmonary tuberculosis, pneumonia, pneumoconiosis, hypersensitivity pneumonia, pulmonary edema and sarcoidosis.
  13. 제10항에 있어서,11. The method of claim 10,
    상기 신장 섬유증은 신부전, 도관 설치, 당뇨병성 신증, 요로 폐쇄, 사구체 경화증, 신세뇨관간질성, 사구체 신염, 만성 신부전증, 당뇨병성 근위세뇨관 섬유화, 급성 신손상, 만성 신장 질환, 말기 신장 질환, 허혈 재관류 손상, 신독성 약제에 의한 손상, 조영제에 의한 손상 및 알부민뇨 발생으로 이루어지는 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.The renal fibrosis is renal failure, catheterization, diabetic nephropathy, urinary tract obstruction, glomerulosclerosis, renal tubulointerstitial, glomerulonephritis, chronic renal failure, diabetic proximal tubular fibrosis, acute renal injury, chronic kidney disease, end-stage renal disease, ischemic reperfusion. A pharmaceutical composition, characterized in that at least one selected from the group consisting of damage, damage caused by nephrotoxic agents, damage caused by contrast agents, and albuminuria.
  14. 제10항에 있어서,11. The method of claim 10,
    상기 간 섬유증은 비알콜성 지방간염에 의해 유발된 것을 특징으로 하는 약학적 조성물.The liver fibrosis is a pharmaceutical composition, characterized in that caused by non-alcoholic steatohepatitis.
  15. 제1항에 있어서,According to claim 1,
    상기 약학적 조성물은 간 내 염증(hepatic inflammation) 또는 전신 염증(systemic inflammation)을 개선시키는 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition is a pharmaceutical composition, characterized in that it improves liver inflammation (hepatic inflammation) or systemic inflammation (systemic inflammation).
  16. 제1항에 있어서,According to claim 1,
    상기 약학적 조성물은 간 내 지질 축적을 억제하는 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition is a pharmaceutical composition, characterized in that inhibiting the accumulation of lipids in the liver.
  17. 제1항에 있어서,According to claim 1,
    상기 약학적 조성물은 간 섬유화를 억제하는 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition is a pharmaceutical composition, characterized in that inhibiting liver fibrosis.
  18. 제1항에 있어서,According to claim 1,
    상기 약학적 조성물은 간 동모양 혈관내피세포(liver sinusoidal endothelial cells, LSECs)의 모세관화(capillarization)를 감소시키는 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition is a pharmaceutical composition, characterized in that it reduces the capillarization of liver sinusoidal endothelial cells (liver sinusoidal endothelial cells, LSECs).
  19. 하기 화학식 1로 표시되는 화합물, 이의 이성질체, 이의 용매화물, 이의 수화물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품:A health functional food for preventing or improving fatty liver disease containing a compound represented by the following formula (1), an isomer thereof, a solvate thereof, a hydrate thereof, or a pharmaceutically acceptable salt thereof as an active ingredient:
    [화학식 1][Formula 1]
    Figure PCTKR2021007940-appb-img-000017
    Figure PCTKR2021007940-appb-img-000017
    상기 화학식 1에서,In Formula 1,
    X,
    Figure PCTKR2021007940-appb-img-000018
    , R1, R21, R22, R23, R3, R4는 청구항 1에서 정의한 바와 같다.
    X,
    Figure PCTKR2021007940-appb-img-000018
    , R 1 , R 21 , R 22 , R 23 , R 3 , and R 4 are as defined in claim 1.
PCT/KR2021/007940 2020-07-03 2021-06-24 Pharmaceutical composition for prevention or treatment of fatty liver disease WO2022005101A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0082298 2020-07-03
KR1020200082298A KR102693566B1 (en) 2020-07-03 2020-07-03 Pharmaceutical composition for prevention or treatment of fatty liver disease

Publications (1)

Publication Number Publication Date
WO2022005101A1 true WO2022005101A1 (en) 2022-01-06

Family

ID=79315436

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007940 WO2022005101A1 (en) 2020-07-03 2021-06-24 Pharmaceutical composition for prevention or treatment of fatty liver disease

Country Status (2)

Country Link
KR (1) KR102693566B1 (en)
WO (1) WO2022005101A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000066611A1 (en) * 1999-04-30 2000-11-09 Arch Development Corporation Steroid derivatives
KR20110086177A (en) * 2008-11-19 2011-07-27 인터셉트 파마슈티컬즈, 인크. Tgr5 modulators and method of use thereof
US20110218143A1 (en) * 2007-11-20 2011-09-08 University Of Florida Research Foundation Compositions and methods for tissue repair
US20180105547A1 (en) * 2010-05-24 2018-04-19 Children's Medical Center Corporation Methods for the treatment and prevention of inflammatory diseases

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102656153B (en) * 2009-10-29 2015-02-18 延世大学校产学协力团 Novel vascular leak inhibitor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000066611A1 (en) * 1999-04-30 2000-11-09 Arch Development Corporation Steroid derivatives
US20110218143A1 (en) * 2007-11-20 2011-09-08 University Of Florida Research Foundation Compositions and methods for tissue repair
KR20110086177A (en) * 2008-11-19 2011-07-27 인터셉트 파마슈티컬즈, 인크. Tgr5 modulators and method of use thereof
US20180105547A1 (en) * 2010-05-24 2018-04-19 Children's Medical Center Corporation Methods for the treatment and prevention of inflammatory diseases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MIYAO MASASHI, KOTANI HIROKAZU, ISHIDA TOKIKO, KAWAI CHIHIRO, MANABE SHO, ABIRU HITOSHI, TAMAKI KEIJI: "Pivotal role of liver sinusoidal endothelial cells in NAFLD/NASH progression", LABORATORY INVESTIGATION, vol. 95, no. 10, 1 October 2015 (2015-10-01), The United States and Canadian Academy of Pathology, Inc. , pages 1130 - 1144, XP055884394, ISSN: 0023-6837, DOI: 10.1038/labinvest.2015.95 *

Also Published As

Publication number Publication date
KR102693566B1 (en) 2024-08-08
KR20220004451A (en) 2022-01-11

Similar Documents

Publication Publication Date Title
WO2010134676A1 (en) Composition comprising the purified extract of bee venom for preventing and treating degenerative brain diseases
WO2013029279A1 (en) Novel glp-i analogue, preparation method and use thereof
WO2019098699A1 (en) Composition for preventing or treating neurodegenerative diseases, containing diterpene-based compound
WO2015111832A1 (en) Composition for preventing or treating prostate-related diseases, containing poncirus trifoliate extract
WO2022005101A1 (en) Pharmaceutical composition for prevention or treatment of fatty liver disease
WO2020130502A1 (en) Pharmaceutical composition comprising empagliflozin and sitagliptin
WO2019022482A2 (en) Composition for preventing or treating fibrotic diseases comprising dendropanax morbifera extract as active ingredient
WO2012134187A2 (en) Pharmaceutical composition for preventing or treating macular degeneration
WO2023048453A1 (en) Nanoparticles comprising drug dimers, and use thereof
WO2020027534A1 (en) Composition comprising punicalagin for inhibiting par2 activity
WO2022260434A1 (en) Pharmaceutical composition for preventing or treating autoimmune disease
WO2021256858A1 (en) Composition for improving, preventing or treating non-alcoholic fatty liver disease and preparation method therefor
WO2019088378A1 (en) Lipolytic composition containing phosphocholine derivatives
WO2021020820A1 (en) Pharmaceutical composition comprising udenafil
WO2020130696A1 (en) Composition comprising cyp4a-inhibiting compound as active ingredient for preventing or treating metabolic diseases
WO2020055015A1 (en) Pharmaceutical composition for preventing or treating non-alcoholic steatohepatitis, containing, as active ingredient, tazemetostat or derivative thereof
WO2023163470A1 (en) Injectable formulation comprising isoxazoline derivative and method for preparing same
WO2023096448A1 (en) Use of obatoclax in treating metabolic and fibrotic diseases
WO2023163538A1 (en) Novel pomalidomide derivative, preparation method therefor, and use thereof
WO2023182877A1 (en) Injectable preparation comprising isoxazoline derivative, and preparation method therefor
WO2011122805A2 (en) A composition comprising ajoene for preventing or treating a disease caused by overexpression of lxr-alpha
WO2024147659A1 (en) Composition and soft capsule formulation comprising naphthoquinone-based compound
WO2023182567A1 (en) Peptide having antidiabetic activity, peptide complex, and use thereof
WO2018026150A1 (en) Pharmaceutical composition for prevention or treatment of neurodegenerative diseases
WO2023096446A1 (en) Use of etravirine in treatment of metabolic diseases and fibrotic diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21834601

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21834601

Country of ref document: EP

Kind code of ref document: A1