WO2021248027A1 - Compositions and methods of inhibiting angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2) - Google Patents

Compositions and methods of inhibiting angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2) Download PDF

Info

Publication number
WO2021248027A1
WO2021248027A1 PCT/US2021/035944 US2021035944W WO2021248027A1 WO 2021248027 A1 WO2021248027 A1 WO 2021248027A1 US 2021035944 W US2021035944 W US 2021035944W WO 2021248027 A1 WO2021248027 A1 WO 2021248027A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
certain embodiments
modified
nucleobase
oligonucleotide
Prior art date
Application number
PCT/US2021/035944
Other languages
French (fr)
Inventor
Susan M. Freier
Eric E. Swayze
Original Assignee
Ionis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals, Inc. filed Critical Ionis Pharmaceuticals, Inc.
Publication of WO2021248027A1 publication Critical patent/WO2021248027A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===

Definitions

  • Embodiments described herein relate to compounds, compositions, and methods for inhibiting Angiotensin-converting enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2) in a cell, such as a lung cell, to inhibit the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) and prevent or treat its associated disease, Coronavirus Disease 2019 (COVID-19).
  • ACE2 Angiotensin-converting enzyme 2
  • TMPRSS2 Transmembrane Serine Protease 2
  • SARS-CoV-2 The Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) is a global pandemic that has infected over 5.6 million people and killed over 352,000 people worldwide as of May 27, 2020 according to the Johns Hopkins Coronavirus Resource Center Dashboard. These numbers represent the total confirmed cases, but the true numbers of infections and deaths are surely higher due to underreporting and the shortage of testing.
  • SARS-CoV-2 is highly contagious. It has a long incubation period of 1 to 14 days of contagiousness before an infected individual shows symptoms, if at all. A recent report indicated that COVID-19 may be most contagious 1 to 2 days before symptoms appear. Infected but asymptomatic individuals are dubbed superspreaders.
  • COVID-19 The most common symptoms of COVID-19 are fever, fatigue, and dry cough. For some individuals, especially the elderly and people with underlying medical conditions, COVID-19 can cause difficulty breathing leading to hospitalization and intubation with a ventilator because patients can no longer breathe on their own. COVID-19 is fatal when patients succumb to lung damage, respiratory failure, and/or pneumonia.
  • Embodiments described herein relate to the design and synthesis of compounds and compositions that can be administered to inhibit the replication or infectivity of SARS-CoV-2 and to prevent or treat (COVID- 19) by targeting ACE2 and/or TMPRSS2, host cell factors that the SARS-CoV-2 virus uses to enter cells.
  • each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase.
  • compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
  • Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.
  • 2’-deoxynucleoside means a nucleoside comprising 2’-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • “2’-0-methoxyethyl” refers to an O- methoxy-ethyl modification at the 2’ position of a furanosyl ring.
  • a 2’-0-methoxyethyl modified sugar is a modified sugar.
  • “2’-MOE nucleoside” (also 2’-0-methoxyethyl nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.
  • “2 ’-substituted nucleoside” or “2 -modified nucleoside” means a nucleoside comprising a 2 ’-substituted or 2’-modified sugar moiety.
  • “2’ -substituted” or “2 -modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • 3’ target site refers to the nucleotide of a target nucleic acid which is complementary to the 3 ’-most nucleotide of a particular compound.
  • 5’ target site refers to the nucleotide of a target nucleic acid which is complementary to the 5 ’-most nucleotide of a particular compound.
  • 5-methylcytosine means a cytosine with a methyl group attached to the 5 position.
  • “About” means within ⁇ 10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of ACE2 or TMPRSS2”, it is implied that ACE2 or TMPRSS2 levels are inhibited within a range of 60% and 80%.
  • ACE2 specific inhibitor refers to any agent capable of specifically inhibiting ACE2 RNA and/or ACE2 protein expression or activity at the molecular level.
  • ACE2 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of ACE2 RNA and/or ACE2 protein.
  • administering refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function.
  • An example of a route of administration that can be used includes, but is not limited to inhalation such as through a nebulizer or inhaler.
  • administering means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.
  • “Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antisense activity means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.
  • Antisense compound means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siR As, shRNAs, ssR As, and occupancy-based compounds.
  • Antisense inhibition means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
  • Antisense mechanisms are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.
  • Bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • Branching group means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups.
  • a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
  • Cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • cEt or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH 3 )-0-2’.
  • cEt nucleoside means a nucleoside comprising a cEt modified sugar moiety.
  • Cyhemical modification in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit.
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.
  • “Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-0-methoxyethyl modifications.
  • Chimeric antisense compounds means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
  • “Chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • cleavable bond means any chemical bond capable of being split.
  • a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
  • “Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • “Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5- methyl cytosine ( m C) and guanine (G) unless otherwise specified.
  • oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches.
  • “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
  • Conjugate group means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • Conjugate linker means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • Conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • Contiguous in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • Coronavirus Disease 2019 refers to the disease caused by the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) and includes, but is not limited to, one or more symptoms associated with SARS-CoV-2 infection such as respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, and nasal congestion.
  • SARS-CoV-2 Severe Acute Respiratory Syndrome Coronavirus
  • Designing or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition can be a liquid, e.g. saline solution.
  • “Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications.
  • a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified.
  • DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified.
  • nucleoside comprising a 2’-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2’-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
  • Dose means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose may be administered in two or more boluses, tablets, or injections.
  • the desired dose may require a volume not easily accommodated by a single injection.
  • two or more injections may be used to achieve the desired dose.
  • a dose may be administered in two or more injections to minimize injection site reaction in an individual.
  • the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.
  • Dosing regimen is a combination of doses designed to achieve one or more desired effects.
  • Double -stranded antisense compound means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.
  • Effective amount means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.
  • “Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.
  • “Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • Hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
  • “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.
  • “Intemucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide.
  • “Modified intemucleoside linkage” means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.
  • Lengthened oligonucleotides are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.
  • Linked nucleosides means adjacent nucleosides linked together by an intemucleoside linkage.
  • Linker-nucleoside means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker- nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.
  • nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized.
  • a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.
  • “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.
  • “Motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • Non-bicyclic modified sugar or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single -stranded nucleic acids, and double-stranded nucleic acids.
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G).
  • a “modified nucleobase” is a naturally occurring nucleobase that is chemically modified.
  • a “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.
  • Nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage.
  • Nucleoside means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
  • Modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • “Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or intemucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or intemucleoside modification.
  • Parent oligonucleotide means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries.
  • the newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.
  • Parenteral administration means administration through injection or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • “Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual.
  • a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.
  • Phosphorothioate linkage means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom.
  • a phosphorothioate intemucleoside linkage is a modified intemucleoside linkage.
  • Phosphorus moiety means a group of atoms comprising a phosphorus atom.
  • a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
  • “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.
  • Prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. In the context of preventing COVID-19, “prevent” refers to forestalling the onset, development or progression of any symptoms associated with SARS- CoV-2 infection and/or delaying or forestalling the onset or increase in SARS-CoV-2 replication, infectivity, viral titer, or viral load in the individual.
  • Prodrug means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof.
  • the metabolized form is the active, or more active, form of the compound (e.g., drug).
  • conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.
  • Reduce means to bring down to a smaller extent, size, amount, or number.
  • Regular is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • “Segments” are defined as smaller or sub-portions of regions within a nucleic acid.
  • SARS-CoV-2 severe Acute Respiratory Syndrome Coronavirus
  • SARS-CoV-2 refers to all strains and isolates of coronavirus that causes COVID-19.
  • Side effects means physiological disease and/or conditions attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Single-stranded in reference to a compound means the compound has only one oligonucleotide.
  • Self-complementary means an oligonucleotide that at least partially hybridizes to itself.
  • a compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound.
  • a single -stranded compound may be capable of binding to a complementary compound to form a duplex.
  • Sites are defined as unique nucleobase positions within a target nucleic acid.
  • Specifically hybridizable refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.
  • Specifically inhibit with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid’s expression.
  • “Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • “Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.
  • “Unmodified sugar moiety” or “unmodified sugar” means a 2’-OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1 ’, 3 ’, and 4’ positions, an oxygen at the 3 ’ position, and two hydrogens at the 5’ position.
  • “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • Modified furanosyl sugar moiety means a furanosyl sugar comprising a non hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety.
  • a modified furanosyl sugar moiety is a 2 ’-substituted sugar moiety.
  • Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.
  • “Sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.
  • Targeting means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.
  • Target nucleic acid all mean a nucleic acid capable of being targeted by compounds described herein.
  • Target region means a portion of a target nucleic acid to which one or more compounds is targeted.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which a compound is targeted.
  • 5’ target site refers to the 5’-most nucleotide of a target segment.
  • 3’ target site refers to the 3’- most nucleotide of a target segment.
  • Terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • “Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
  • TMPRSS2 specific inhibitor refers to any agent capable of specifically inhibiting TMPRSS2 RNA and/or TMPRSS2 protein expression or activity at the molecular level.
  • TMPRSS2 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of TMPRSS2 RNA and/or TMPRSS2 protein.
  • Treat refers to administering a compound or pharmaceutical composition to an individual in order to effect an alteration or improvement of a disease, disorder, or condition in the individual.
  • “treat” refers to improving any symptoms associated with SARS-CoV-2 infection and/or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the individual.
  • Certain embodiments provide methods, compounds and compositions for inhibiting or reducing SARS- CoV-2 replication, infectivity, viral titer, or viral load, thereby inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the lung cells, by targeting ACE2 and/or TMPRSS2 in a cell, such as a lung cell. Certain embodiments provide methods, compounds and compositions for inhibiting or reducing ACE2 and/or TMPRSS2 in a cell, such as a lung cell.
  • inhibiting or reducing ACE2 and/or TMPRSS2 in a cell are effective to inhibit or reduce SARS-CoV-2 replication, infectivity, viral titer, or viral load.
  • human ACE2 mRNA has the sequence set forth in GENBANK Accession No. NM_021804.1 (designated herein as SEQ ID NO: 1).
  • human ACE2 pre-mRNA has the sequence of the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102 (designated herein as SEQ ID NO: 2).
  • human ACE2 mRNA has the sequence set forth in GENBANK Accession No. NM_021804.3 (designated herein as SEQ ID NO: 3) or ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 4).
  • human TMPRSS2 mRNA has the sequence set forth in ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 5).
  • human TMPRSS2 RNA has the sequence set forth in ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 (designated herein as SEQ ID NO: 6)
  • the SARS-CoV-2 RNA has the sequence set forth in the complement of GENBANK Accession No. NC_045512.2, designated herein as SEQ ID NO: 2494.
  • the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded.
  • the compound is double-stranded.
  • the modified oligonucleotide consists of 10 to 30 linked nucleosides.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded.
  • the compound is double-stranded.
  • the modified oligonucleotide consists of 10 to 30 linked nucleosides.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded.
  • the compound is double-stranded.
  • the modified oligonucleotide consists of 10 to 30 linked nucleosides.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded.
  • the compound is double-stranded.
  • the modified oligonucleotide consists of 11 to 30 linked nucleosides.
  • Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded.
  • the compound is double-stranded.
  • the modified oligonucleotide consists of 12 to 30 linked nucleosides.
  • Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • the compound is an antisense compound or oligomeric compound.
  • the compound is single-stranded. In certain embodiments, the compound is double-stranded.
  • any of the foregoing modified oligonucleotides has at least one modified intemucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.
  • At least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar.
  • the modified sugar comprises a 2’-0-methoxyethyl group.
  • the modified sugar is a bicyclic sugar, such as a 4’-CH(CH 3 )-0-2’ group, a 4’- CEh-O-2’ group, or a 4’-(CEh) 2 -0-2’group.
  • At least one intemucleoside linkage of the modified oligonucleotide comprises a modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage.
  • At least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.
  • a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide consists of 16 to 30 linked nucleosides.
  • the modified oligonucleotide consists of 16 linked nucleosides.
  • a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
  • the modified oligonucleotide consists of 16 to 30 linked nucleo
  • the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to an ACE2 or TMPRSS2 RNA.
  • the modified oligonucleotide is described by its Compound Number or ION number in the Examples section below.
  • the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
  • the compound can consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides.
  • the compound comprises or consists of an oligonucleotide.
  • a compound is a modified oligonucleotide described by its Compound Number or ION number in the Examples section below.
  • compounds or compositions provided herein comprise a salt of the modified oligonucleotide.
  • the salt is a sodium salt.
  • the salt is a potassium salt.
  • Certain embodiments provided herein relate to methods of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, which can be useful for preventing or treating COVID-19 in an individual, by administration of a compound that targets ACE2 or TMPRSS2 RNA.
  • the compound can be an antisense compound, oligomeric compound, or oligonucleotide complementary to ACE2 or TMPRSS2 RNA.
  • a method of inhibiting or reducing ACE2 or TMPRSS2 levels in a cell comprises contacting the cell with a compound comprising ACE2 or TMPRSS2 specific inhibitor, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in the cell.
  • the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • the cell is a lung cell.
  • a method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, in lung cells comprises contacting lung cells with a compound comprising an ACE2 or TMPRSS2 specific inhibitor, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in a cell, and thereby inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in cells.
  • the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • a method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, in an individual comprises administering to the individual a compound comprising a ACE2 or TMPRSS2 specific inhibitor, thereby preventing or treating COVID-19 in the individual.
  • the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for use in inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells or an individual. Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for use in preventing or treating COVID-19 in an individual.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Certain embodiments are drawn to use of a compound comprising an ACE2 or TMPRSS2 specific inhibitor for the manufacture or preparation of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells or an individual. Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for the manufacture or preparation of a medicament for preventing or treating COVID-19 in an individual.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide consists of 16 to 30 linked nucleosides.
  • the modified oligonucleotide consists of 16 linked nucleosides.
  • the compound can be targeted to ACE2 or TMPRSS2 RNA.
  • the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length.
  • the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-6.
  • the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase.
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage
  • the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl
  • the modified nucleobase is a 5-methylcytosine.
  • the modified oligonucleotide comprises a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide can be 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides in length.
  • the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-6.
  • the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase.
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage
  • the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl
  • the modified nucleobase is a 5-methylcytosine.
  • the modified oligonucleotide comprises a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide can be one that is described by its Compound Number or ION number in the Examples section below.
  • the compound can be administered in an aerosol form.
  • the compound can be administered to the lungs of a patient.
  • the compound can be administered by inhalation.
  • the compound can be administered by an inhaler.
  • the compound can be administered by a nebulizer.
  • Embodiment 1 A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • Embodiment 2 A compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • Embodiment 3 A compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • Embodiment 4 A compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • Embodiment 5 A compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
  • Embodiment 6 A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Embodiment 7 A compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Embodiment 8 A compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Embodiment 9 A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • Embodiment 10 The compound of any one of embodiments 1-9, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • Embodiment 11 The compound of embodiment 10, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 12 The compound of embodiment 10 or 11, wherein the modified sugar is a bicyclic sugar.
  • Embodiment 13 The compound of embodiment 12, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH 2 )-0-2' (LNA); 4'-(CH 2 ) 2 -0-2' (ENA); and 4'-CH(CH 3 )-0-2' (cEt).
  • Embodiment 14 The compound of embodiment 10 or 11, wherein the modified sugar is 2 -0- methoxy ethyl.
  • Embodiment 15 The compound of any one of embodiments 10-14, wherein the modified nucleobase is a 5-methylcytosine.
  • Embodiment 16 The compound of any one of embodiments 1-15, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • Embodiment 17 A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
  • Embodiment 18 The compound of any one of embodiments 1-17, wherein the oligonucleot
  • Embodiment 19 The compound of any one of embodiments 1-18, wherein the compound is single-stranded.
  • Embodiment 20 The compound of any one of embodiments 1-18, wherein the compound is double-stranded.
  • Embodiment 21 The compound of any one of embodiments 1-20, wherein the compound comprises ribonucleotides.
  • Embodiment 22 The compound of any one of embodiments 1-20, wherein the compound comprises deoxyribonucleotides.
  • Embodiment 23 The compound of any one of embodiments 1-22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.
  • Embodiment 24 The compound of any one of embodiments 1-23, wherein the compound consists of the modified oligonucleotide.
  • Embodiment 25 A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments 1-24.
  • Embodiment 26 The compound of embodiment 25, wherein the pharmaceutically acceptable salt is a sodium salt.
  • Embodiment 27 The compound of embodiment 25, wherein the pharmaceutically acceptable salt is a potassium salt.
  • Embodiment 28 A composition comprising the compound of any one of embodiments 1-27 and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 29 A composition comprising the compound of any one of embodiments 1-27 and water.
  • Embodiment 30 A composition comprising a compound of any one of embodiments 1-27, for use in therapy.
  • Embodiment 31 A method of inhibiting or reducing ACE2 or TMPRSS2 levels in lung cells or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells, comprising contacting the lung cells with the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in the lung cells or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the lung cells.
  • Embodiment 32 A method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual comprising administering to the individual the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby inhibiting or reducing SARS- CoV-2 replication, infectivity, viral titer, or viral load in the individual.
  • Embodiment 33 A method of preventing or treating COVID-19 in an individual comprising administering to the individual the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby preventing or treating COVID-19 in the individual.
  • Embodiment 34 The method of any of embodiments 31-33, wherein contacting or administering the compound of any one of embodiments 1-27 or composition of any one of embodiments 28- 30 prevents or improves a COVID-19 symptom.
  • Embodiment 35 The method of embodiment 34, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
  • the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
  • Embodiment 36 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
  • Embodiment 37 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
  • Embodiment 38 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for preventing or treating COVID-19 in an individual.
  • Embodiment 39 The use of any of embodiments 36-38, for preventing or improving a COVID-
  • Embodiment 40 The use of embodiment 39, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
  • Embodiment 41 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
  • Embodiment 42 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
  • Embodiment 43 Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for preventing or treating COVID-19 in an individual.
  • Embodiment 44 The use of any of embodiments 41-43, for the preparation or manufacture of a medicament for preventing or improving a COVID-19 symptom.
  • Embodiment 45 The use of embodiment 44, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
  • a first agent comprising a compound described herein is co-administered with one or more secondary agents.
  • such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • a first agent is designed to treat an undesired side effect of a second agent.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
  • one or more compounds or compositions provided herein are co administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately.
  • a secondary agent can be one or more of the following: remdesivir, azithromycin, and/or ivermectin.
  • compounds described herein can be antisense compounds.
  • the antisense compound comprises or consists of an oligomeric compound.
  • the oligomeric compound comprises a modified oligonucleotide.
  • the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
  • a compound described herein comprises or consists of a modified oligonucleotide.
  • the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
  • a compound or antisense compound is single -stranded.
  • Such a single- stranded compound or antisense compound comprises or consists of an oligomeric compound.
  • such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group.
  • the oligonucleotide is an antisense oligonucleotide.
  • the oligonucleotide is modified.
  • the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.
  • compounds are double-stranded.
  • Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide.
  • the modified oligonucleotide is an RNA oligonucleotide.
  • the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase.
  • compound comprises a conjugate group.
  • one of the modified oligonucleotides is conjugated.
  • both the modified oligonucleotides are conjugated.
  • the first modified oligonucleotide is conjugated.
  • the second modified oligonucleotide is conjugated.
  • the first modified oligonucleotide is 12-30 linked nucleosides in length and the second modified oligonucleotide is 12-30 linked nucleosides in length.
  • one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 13-2493.
  • antisense compounds are double -stranded.
  • Such double -stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
  • the first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group.
  • the oligonucleotide of the second oligomeric compound of such double -stranded antisense compound may be modified or unmodified.
  • Either or both oligomeric compounds of a double -stranded antisense compound may comprise a conjugate group.
  • the oligomeric compounds of double -stranded antisense compounds may include non-complementary overhanging nucleosides.
  • single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.
  • shRNAs small hairpin RNAs
  • ssRNAs single-stranded siRNAs
  • microRNA mimics microRNA mimics.
  • a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • a compound described herein comprises an oligonucleotide 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a eompound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length.
  • a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length.
  • a compound described herein comprises an oligonucleotide 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length.
  • oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits in length, respectively.
  • a compound described herein comprises an oligonucleotide 14 linked subunits in length.
  • a compound described herein comprises an oligonucleotide 16 linked subunits in length.
  • a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50,
  • the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
  • linked subunits in length, or a range defined by any two of the above values.
  • the linked subunits are nucleotides, nucleosides, or nucleobases.
  • the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide.
  • a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide)
  • the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.
  • compounds may be shortened or truncated.
  • a single subunit may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation).
  • a shortened or truncated compound targeted to an ACE2 or TMPRSS2 R A may have two subunits deleted from the 5’ end, or alternatively may have two subunits deleted from the 3 ’ end, of the compound.
  • the deleted nucleosides may be dispersed throughout the compound.
  • the additional subunit When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5’ or 3’ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.
  • RNAi interfering RNA compounds
  • siRNA double -stranded RNA compounds
  • ssRNA single- stranded RNAi compounds
  • siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post- transcriptional gene silencing RNA (ptgsRNA), and others.
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • a compound described herein can comprise any of the oligonucleotide sequences targeted to an ACE2 or TMPRSS2 RNA described herein.
  • the compound can be double-stranded.
  • the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 13- 2493 and a second strand.
  • the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493 and a second strand.
  • the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 13-2493.
  • the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on SARS-CoV-2 RNA to which any of SEQ ID NOs: 13-2493 is targeted, and (ii) a second strand.
  • the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe).
  • the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification.
  • the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound.
  • the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661.
  • the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000
  • the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand.
  • the second strand of the compound is complementary to the first strand.
  • each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length.
  • the first or second strand of the compound can comprise a conjugate group.
  • a compound described herein can comprise any of the oligonucleotide sequences targeted to SARS-CoV-2 RNA described herein.
  • the compound is single stranded.
  • such a compound is a single-stranded RNAi (ssRNAi) compound.
  • the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 13-2493.
  • the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
  • the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 13-2493.
  • the compound comprises a nucleobase sequence complementary to the site on SARS- CoV-2 RNA to which any of SEQ ID NOs: 13-2493 is targeted.
  • the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe).
  • the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification.
  • the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound.
  • the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661.
  • the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.
  • the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.
  • the compound can comprise a conjugate group.
  • compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or b such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 3 ⁇ 4 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.
  • compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid.
  • Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.
  • hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • compounds described herein are sufficiently “DNA- like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • RNA-induced silencing complex RISC
  • compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain compounds described herein result in cleavage of the target nucleic acid by Argonaute.
  • Compounds that are loaded into RISC are RNAi compounds.
  • RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to an ACE2 or TMPRSS2 RNA sequence.
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a human ACE2 mRNA having the sequence set forth in GENBANK Accession No. NM_021804.1 (designated herein as SEQ ID NO: 1).
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human ACE2 RNA having the sequence of the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102 (designated herein as SEQ ID NO: 2).
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human ACE2 mRNA having the sequence set forth in GENBANK Accession No. NM_021804.3 (designated herein as SEQ ID NO: 3) or ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 4).
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human TMPRSS2 mRNA having the sequence set forth in ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 5).
  • compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human TMPRSS2 RNA having the sequence set forth in ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl 3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 (designated herein as SEQ ID NO: 6).
  • compounds described herein complementary to ACE2 or TMPRSS2 are capable of inhibiting SARS-CoV-2.
  • SARS-CoV-2 RNA sequences include, without limitation, the following Genbank Accession NOs, each of which is incorporated by reference in its entirety: NC_045512.2 (designated herein as SEQ ID NO: 1); the complement ofNC_045512.2 (designated herein as SEQ ID NO: 2); NC_045512,
  • hybridization occurs between a compound disclosed herein and an ACE2 or TMPRSS2 RNA.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the compounds provided herein are specifically hybridizable with an ACE2 or TMPRSS2 RNA.
  • An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions.
  • Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5 -methyl cytosine (mC) and guanine (G) unless otherwise specified.
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches.
  • An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
  • compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and an ACE2 or TMPRSS2 RNA may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of ACE2 or TMPRSS2 RNA such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the compounds provided herein, or a specified portion thereof are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an ACE2 or TMPRSS2 RNA, a target region, target segment, or specified portion thereof.
  • the compounds provided herein, or a specified portion thereof are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to an ACE2 or TMPRSS2 RNA, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.
  • a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid.
  • Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • compounds described herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • a compound may be fully complementary to an ACE2 or TMPRSS2 RNA, or a target region, or a target segment or target sequence thereof.
  • “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid.
  • a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound.
  • the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.
  • compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the compound is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5 ’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.
  • non-complementary nucleobase may be at the 5 ’ end or 3 ’ end of the compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the compound.
  • two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.
  • compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an ACE2 or TMPRSS2 RNA, or specified portion thereof.
  • compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an ACE2 or TMPRSS2 RNA, or specified portion thereof.
  • a target nucleic acid such as an ACE2 or TMPRSS2 RNA, or specified portion thereof.
  • compounds described herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of a compound.
  • the— compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the compounds are complementary to at least a 9 nucleobase portion of a target segment.
  • the compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof.
  • compounds described herein are antisense compounds or oligomeric compounds.
  • compounds described herein are modified oligonucleotides.
  • a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • compounds described herein, or portions thereof are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.
  • compounds described herein comprise or consist of antisense compounds.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • compounds described herein comprise or consist of oligonucleotides.
  • a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage).
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • sugar moieties are non-bicyclic modified sugar moieties.
  • modified sugar moieties are bicyclic or tricyclic sugar moieties.
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2 ’ , 4 ’ , and/or 5 ’ positions .
  • one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-0O3 ⁇ 4 (“OMe” or “O-methyl”), and 2'-0(CEb) 2 0CE[ 3 (“MOE”).
  • these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4’- substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g ., methoxy), alkyl, and those described in Manoharan et ah, WO 2015/106128.
  • Examples of 5’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 ’-methyl (R or S), 5'-vinyl, and 5 ’-methoxy.
  • non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ah, US2010/190837 and Rajeev et ah, US2013/0203836.
  • a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
  • Nucleosides comprising modified sugar moieties are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside.
  • nucleosides comprising 2 ’-substituted or 2-modified sugar moieties are referred to as 2 ’-substituted nucleosides or 2-modified nucleosides.
  • Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -0-2' (“ENA”), 4'-CH(CH 3 )-0-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CFb- O-CFb-2’, 4’-CFb-N(R)-2’, 4'-CH(CH 2 0CH 3 )-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
  • such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -
  • n -0-. -C(R a ) C(R b )-.
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an UNA nucleoside (described herein) may be in the a-U configuration or in the b-D configuration.
  • general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., FNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, CJ. Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g., Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; and Swayze et al., U.S. 9,005,906, F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety
  • modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F.
  • Ri is F and R2 is H
  • Ri is methoxy and R2 is H
  • Ri is methoxyethoxy and R2 is H
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as “modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.
  • compounds described herein comprise modified oligonucleotides.
  • modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase.
  • modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase.
  • modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5 -substituted pyrimidines, 6- azapy rim i o dines alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine,
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • compounds targeted to an ACE2 or TMPRSS2 RNA comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • RNA and DNA are a 3' to 5' phosphodiester linkageln certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et ak, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (.S'p) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (i3 ⁇ 4>) configuration.
  • modified oligonucleotides comprising (i?p) and/or (.S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates anucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • compounds targeted to an ACE2 or TMPRSS2 RNA comprise one or more modified intemucleoside linkages.
  • the modified intemucleoside linkages are phosphorothioate linkages.
  • each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.
  • compounds described herein comprise oligonucleotides.
  • Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphoms atom.
  • Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous- containing and non-phosphorous-containing linkages are well known.
  • nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers.
  • Representative chiral intemucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
  • oligonucleotides comprise modified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified intemucleoside linkage motif.
  • intemucleoside linkages are arranged in a gapped motif.
  • the intemucleoside linkages in each of two wing regions are different from the intemucleoside linkages in the gap region.
  • the intemucleoside linkages in the wings are phosphodiester and the intemucleoside linkages in the gap are phosphorothioate.
  • the nucleoside motif is independently selected, so such oligonucleotides having a gapped intemucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.
  • oligonucleotides comprise a region having an alternating intemucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified intemucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.
  • the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages.
  • the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide.
  • oligonucleotides comprise one or more methylphosponate linkages.
  • oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages.
  • one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.
  • the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate intemucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester intemucleoside linkages while retaining nuclease resistance.
  • compounds described herein comprise oligonucleotides.
  • Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages.
  • modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase.
  • modified oligonucleotides comprise one or more modified intemucleoside linkage.
  • the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif.
  • the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • compounds described herein comprise oligonucleotides.
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides. In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
  • each nucleoside of the gap is an unmodified 2 ’-deoxy nucleoside.
  • each nucleoside of each wing is a modified nucleoside.
  • a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified comprises the same 2’- modification.
  • a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated by reference in its entirety herein.
  • modified oligomeric compounds useful for inhibiting target nucleic acid expression which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid.
  • the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs.
  • the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any intemucleoside linkage motif to form potent antisense oligonucleotides.
  • compounds described herein comprise oligonucleotides.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at the 5 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety.
  • the modified nucleobase is selected from: a 2- thiopyrimidine and a 5-propynepyrimidine.
  • compounds described herein comprise oligonucleotides.
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages.
  • the terminal intemucleoside linkages are modified.
  • compounds described herein comprise modified oligonucleotides.
  • the above modifications are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications.
  • an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range.
  • a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6- 10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif.
  • Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20).
  • a and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20).
  • a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited.
  • a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any
  • the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (orterminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (orterminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
  • the oligonucleotide is modified.
  • the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid.
  • oligonucleotides are complementary to a messenger RNA (mRNA).
  • mRNA messenger RNA
  • oligonucleotides are complementary to a sense transcript.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • compositions and Methods for Formulating Pharmaceutical Compositions Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising one or more compounds or a salt thereof.
  • the compounds are antisense compounds or oligomeric compounds.
  • the compounds comprise or consist of a modified oligonucleotide.
  • the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises a sterile saline solution and one or more compound.
  • such pharmaceutical composition consists of a sterile saline solution and one or more compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises one or more compound and sterile water.
  • a pharmaceutical composition consists of one compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • a pharmaceutical composition consists of one or more compound and sterile PBS.
  • the sterile PBS is pharmaceutical grade PBS.
  • a compound described herein targeted to an ACE2 or TMPRSS2 RNA can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection.
  • employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to an ACE2 or TMPRSS2 RNA and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is water.
  • the compound comprises or consists of a modified oligonucleotide provided herein.
  • compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the compounds are antisense compounds or oligomeric compounds.
  • the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.
  • the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
  • RNA nucleoside comprising a 2 ’-OH sugar moiety and a thymine base
  • RNA having a modified sugar 2 ’-OH for the natural 2’-H of DNA
  • RNA having a modified base thymine (methylated uracil) for natural uracil of RNA
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5 -position.
  • Example 1 Antisense inhibition of human ACE2 in A-431 cells by 3-10-3 cEt gapmers
  • Modified oligonucleotides complementary to an ACE2 nucleic acid were synthesized and tested for their effect on ACE2 RNA levels in vitro.
  • the modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below.
  • the modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides).
  • the intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate linkages.
  • All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.
  • “Start site” indicates the 5 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary.
  • the modified oligonucleotides are complementary to either the human ACE2 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_021804.1) or to the human ACE2 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102) or to both.
  • the modified oligonucleotide is not complementary to either SEQ ID NO: l or SEQ ID NO:2, they are designed to be complementary to either the human ACE2 mRNA, designated herein as SEQ ID NO: 3 (GENBANKAccessionNo. NM_021804.3) ortothe humanACE2 mRNA, designated herein as SEQ ID NO: 4 (ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.
  • Human primer probe set RTS52383 forward sequence GCCACTGCTCAACTACTTTG, designated herein as SEQ ID NO: 7; reverse sequence GCTTATCCTCACTTTGATGCTTTG, designated herein as SEQ ID NO: 8; probe sequence ACTCCAGTCGGTACTCCATCCCA, designated herein as SEQ ID NO: 9 was used to measure RNA levels.
  • ACE2 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • Results are presented as percent change of ACE2 RNA, relative to PBS control.
  • the symbol “i” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.
  • Example 2 Antisense inhibition of human TMPRSS2 in C4-2 cells by 3-10-3 cEt gapmers
  • Modified oligonucleotides complementary to an TMPRSS2 nucleic acid were synthesized and tested for their effect on TMPRSS2 RNA levels in vitro.
  • the modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below.
  • the modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides).
  • the intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate linkages.
  • All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.
  • Start site indicates the 5 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary.
  • “Stop site” indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary.
  • the modified oligonucleotides are complementary to either the human TMPRSS2 mRNA, designated herein as SEQ ID NO: 5 (ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020) or to the human TMPRSS2 genomic sequence, designated herein as SEQ ID NO: 6 (ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl 3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 ) orto both.
  • SEQ ID NO: 5 ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020
  • SEQ ID NO: 6 ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl 3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 )
  • Human primer probe set RTS52381 forward sequence CTGCATCAACCCCTCTAACTG, designated herein as SEQ ID NO: 10; reverse sequence GACTTCCTCTGAGATGAGTACA, designated herein as SEQ ID NO: 11; probe sequence ACACACCGATTCTCGTCCTCCC, designated herein as SEQ ID NO: 12 was used to measure RNA levels.
  • TMPRSS2 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent change of TMPRSS2 RNA, relative to PBS control.
  • the symbol “1” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.
  • Example 3 Activity of modified oligonucleotides complementary to a ACE2 RNA against SARS-CoV-2 infection, in vitro, dose response
  • H1437 cells were seeded at a density of 3000 cells/well in 384-well plates and treated with modified oligonucleotide by free uptake for 24 hours at doses indicated in the table below. After the 24 hour incubation, the modified oligonucleotide was rinsed off the cells, and the cells were infected with SARS-CoV-2 WA1/2020 strain (BEI resources Catalog # NR-52281) at an MOI of 1 for 48 hours. Two days post infection, the cells were fixed with 4% paraformaldehyde (PFA), permeabilized with 0.03% Triton X-100, and blocked with antibody buffer (1.5% BSA, 1% goat semm, and 0.0025% Tween 20).
  • PFA paraformaldehyde
  • cells were stained overnight with SARS-CoV-2 nucleoprotein primary antibody (ProSci Catalog #35-579, 1:2000) and then stained with anti-mouse IgGAlexaFluor 647 secondary (Invitrogen Catalog #A21235, 1:1000), and Hoechst 33342 (Invitrogen Catalog #H3570, 1:2000). The stained cells were imaged to determine infection levels in cells treated with modified oligonucleotides.
  • Compound No. 792169 a control modified oligonucleotide with a sequence (from 5’ to 3’) of CGCCGATAAGGTACAC (SEQ ID NO: 2495), was designed to not target SARS-CoV-2, and was added to the experiment as a negative control.
  • the sugar motif for Compound No. 792169 is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2 -(i-D-dcoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety.
  • Results are presented in the tables below as percent of the amount of infection of SARS-COV-2 in cells treated with modified oligonucleotide complementary to ACE2.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Embodiments described herein relate to compounds, compositions, and methods for inhibiting Angiotensin-converting enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2) in a cell, such as a lung cell, to inhibit the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) and prevent or treat its associated disease, Coronavirus Disease 2019 (COVID-19).

Description

COMPOSITIONS AND METHODS OF INHIBITING
ANGIOTENSIN-CONVERTING ENZYME 2 (ACE2) AND TRANSMEMBRANE SERINE
PROTEASE 2 (TMPRSS2)
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0392WOSEQ_ST25.txt created June 2, 2021, which is 730 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
Field
Embodiments described herein relate to compounds, compositions, and methods for inhibiting Angiotensin-converting enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2) in a cell, such as a lung cell, to inhibit the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) and prevent or treat its associated disease, Coronavirus Disease 2019 (COVID-19).
Background
The Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) is a global pandemic that has infected over 5.6 million people and killed over 352,000 people worldwide as of May 27, 2020 according to the Johns Hopkins Coronavirus Resource Center Dashboard. These numbers represent the total confirmed cases, but the true numbers of infections and deaths are surely higher due to underreporting and the shortage of testing.
SARS-CoV-2 is highly contagious. It has a long incubation period of 1 to 14 days of contagiousness before an infected individual shows symptoms, if at all. A recent report indicated that COVID-19 may be most contagious 1 to 2 days before symptoms appear. Infected but asymptomatic individuals are dubbed superspreaders.
The most common symptoms of COVID-19 are fever, fatigue, and dry cough. For some individuals, especially the elderly and people with underlying medical conditions, COVID-19 can cause difficulty breathing leading to hospitalization and intubation with a ventilator because patients can no longer breathe on their own. COVID-19 is fatal when patients succumb to lung damage, respiratory failure, and/or pneumonia.
Summary Embodiments described herein relate to the design and synthesis of compounds and compositions that can be administered to inhibit the replication or infectivity of SARS-CoV-2 and to prevent or treat (COVID- 19) by targeting ACE2 and/or TMPRSS2, host cell factors that the SARS-CoV-2 virus uses to enter cells.
Detailed Description
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.
DEFINITIONS
Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
“2’-deoxynucleoside” means a nucleoside comprising 2’-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
“2’-0-methoxyethyl” (also 2’-MOE, MOE, methoxyethyl, and 2’-0(CH2)2-0CH3) refers to an O- methoxy-ethyl modification at the 2’ position of a furanosyl ring. A 2’-0-methoxyethyl modified sugar is a modified sugar. “2’-MOE nucleoside” (also 2’-0-methoxyethyl nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.
“2 ’-substituted nucleoside” or “2 -modified nucleoside” means a nucleoside comprising a 2 ’-substituted or 2’-modified sugar moiety. As used herein, “2’ -substituted” or “2 -modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
“3’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3 ’-most nucleotide of a particular compound.
“5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5 ’-most nucleotide of a particular compound.
“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.
“About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of ACE2 or TMPRSS2”, it is implied that ACE2 or TMPRSS2 levels are inhibited within a range of 60% and 80%.
“ACE2 specific inhibitor” refers to any agent capable of specifically inhibiting ACE2 RNA and/or ACE2 protein expression or activity at the molecular level. For example, ACE2 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of ACE2 RNA and/or ACE2 protein.
"Administration" or "administering" refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to inhalation such as through a nebulizer or inhaler.
“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.
“Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.
“Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siR As, shRNAs, ssR As, and occupancy-based compounds.
“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.
“Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
“Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
“cEt” or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH3)-0-2’.
“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety. “Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.
“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-0-methoxyethyl modifications.
“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
“Chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5- methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches. “Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
"Contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
“Coronavirus Disease 2019 (COVID- 19)” refers to the disease caused by the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2) and includes, but is not limited to, one or more symptoms associated with SARS-CoV-2 infection such as respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, and nasal congestion.
“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.
“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.
“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2’-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2’-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.
“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.
“Double -stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.
“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.
“Efficacy” means the ability to produce a desired effect.
“Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.
“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
“Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).
“Individual” means a human or non-human animal selected for treatment or therapy.
"Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity. “Intemucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified intemucleoside linkage” means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.
“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.
“Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.
“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker- nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.
“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.
“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.
“Motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
“Natural” or “naturally occurring” means found in nature.
“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single -stranded nucleic acids, and double-stranded nucleic acids.
“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.
“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage.
“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
“Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or intemucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or intemucleoside modification.
“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.
“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.
“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual. “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.
“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate intemucleoside linkage is a modified intemucleoside linkage.
“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.
“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. In the context of preventing COVID-19, “prevent” refers to forestalling the onset, development or progression of any symptoms associated with SARS- CoV-2 infection and/or delaying or forestalling the onset or increase in SARS-CoV-2 replication, infectivity, viral titer, or viral load in the individual.
“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.
“Reduce” means to bring down to a smaller extent, size, amount, or number.
“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
“RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.
“Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2)” refers to all strains and isolates of coronavirus that causes COVID-19. “Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
“Single-stranded” in reference to a compound means the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single -stranded compound may be capable of binding to a complementary compound to form a duplex.
“Sites” are defined as unique nucleobase positions within a target nucleic acid.
“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.
“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid’s expression.
“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” or “unmodified sugar” means a 2’-OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1 ’, 3 ’, and 4’ positions, an oxygen at the 3 ’ position, and two hydrogens at the 5’ position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. “Modified furanosyl sugar moiety” means a furanosyl sugar comprising a non hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2 ’-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.
“Sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.
“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.
“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.
“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.
“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5’ target site” refers to the 5’-most nucleotide of a target segment. “3’ target site” refers to the 3’- most nucleotide of a target segment.
“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
“TMPRSS2 specific inhibitor” refers to any agent capable of specifically inhibiting TMPRSS2 RNA and/or TMPRSS2 protein expression or activity at the molecular level. For example, TMPRSS2 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of TMPRSS2 RNA and/or TMPRSS2 protein.
“Treat” refers to administering a compound or pharmaceutical composition to an individual in order to effect an alteration or improvement of a disease, disorder, or condition in the individual. In the context of treating COVID-19, “treat” refers to improving any symptoms associated with SARS-CoV-2 infection and/or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the individual.
Certain Embodiments
Certain embodiments provide methods, compounds and compositions for inhibiting or reducing SARS- CoV-2 replication, infectivity, viral titer, or viral load, thereby inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the lung cells, by targeting ACE2 and/or TMPRSS2 in a cell, such as a lung cell. Certain embodiments provide methods, compounds and compositions for inhibiting or reducing ACE2 and/or TMPRSS2 in a cell, such as a lung cell. In certain embodiments, inhibiting or reducing ACE2 and/or TMPRSS2 in a cell, such as a lung cell, with compounds and compositions described herein are effective to inhibit or reduce SARS-CoV-2 replication, infectivity, viral titer, or viral load.
Certain embodiments provide compounds targeted to human ACE2 RNA. In certain embodiments, human ACE2 mRNA has the sequence set forth in GENBANK Accession No. NM_021804.1 (designated herein as SEQ ID NO: 1). In certain embodiments, human ACE2 pre-mRNA has the sequence of the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102 (designated herein as SEQ ID NO: 2). In certain embodiments, human ACE2 mRNA has the sequence set forth in GENBANK Accession No. NM_021804.3 (designated herein as SEQ ID NO: 3) or ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 4).
Certain embodiments provide compounds targeted to human TMPRSS2 RNA. In certain embodiments, human TMPRSS2 mRNA has the sequence set forth in ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 5). In certain embodiments, human TMPRSS2 RNA has the sequence set forth in ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 (designated herein as SEQ ID NO: 6)
In certain embodiments, the SARS-CoV-2 RNA has the sequence set forth in the complement of GENBANK Accession No. NC_045512.2, designated herein as SEQ ID NO: 2494.
In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.
Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.
Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.
Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.
Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
In certain embodiments, any of the foregoing modified oligonucleotides has at least one modified intemucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.
In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2’-0-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4’-CH(CH3)-0-2’ group, a 4’- CEh-O-2’ group, or a 4’-(CEh)2-0-2’group.
In certain embodiments, at least one intemucleoside linkage of the modified oligonucleotide comprises a modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage.
In certain embodiments, at least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.
In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to an ACE2 or TMPRSS2 RNA.
In certain embodiments, the modified oligonucleotide is described by its Compound Number or ION number in the Examples section below.
In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
In any of the foregoing embodiments, the compound can consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.
In certain embodiments, a compound is a modified oligonucleotide described by its Compound Number or ION number in the Examples section below. In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.
Certain Indications
Certain embodiments provided herein relate to methods of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, which can be useful for preventing or treating COVID-19 in an individual, by administration of a compound that targets ACE2 or TMPRSS2 RNA. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide complementary to ACE2 or TMPRSS2 RNA.
In certain embodiments, a method of inhibiting or reducing ACE2 or TMPRSS2 levels in a cell comprises contacting the cell with a compound comprising ACE2 or TMPRSS2 specific inhibitor, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in the cell. In certain embodiments, the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, the cell is a lung cell.
In certain embodiments, a method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, in lung cells comprises contacting lung cells with a compound comprising an ACE2 or TMPRSS2 specific inhibitor, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in a cell, and thereby inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in cells. In certain embodiments, the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
In certain embodiments, a method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load, in an individual comprises administering to the individual a compound comprising a ACE2 or TMPRSS2 specific inhibitor, thereby preventing or treating COVID-19 in the individual. In certain embodiments, the compound comprises an antisense compound targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises an oligonucleotide targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for use in inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells or an individual. Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for use in preventing or treating COVID-19 in an individual. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
Certain embodiments are drawn to use of a compound comprising an ACE2 or TMPRSS2 specific inhibitor for the manufacture or preparation of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells or an individual. Certain embodiments are drawn to a compound comprising an ACE2 or TMPRSS2 specific inhibitor for the manufacture or preparation of a medicament for preventing or treating COVID-19 in an individual. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, a compound comprises a modified oligonucleotide having the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
In any of the foregoing methods or uses, the compound can be targeted to ACE2 or TMPRSS2 RNA. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-6. In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
In any of the foregoing methods or uses, the modified oligonucleotide can be 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-6. In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
In any of the foregoing methods or uses, the modified oligonucleotide can be one that is described by its Compound Number or ION number in the Examples section below. In any of the foregoing methods or uses, the compound can be administered in an aerosol form. In any of the foregoing methods or uses, the compound can be administered to the lungs of a patient. In any of the foregoing methods or uses, the compound can be administered by inhalation. In any of the foregoing methods or uses, the compound can be administered by an inhaler. In any of the foregoing methods or uses, the compound can be administered by a nebulizer.
Certain Numbered Embodiments
The following are certain numbered embodiments that are not limiting on any other embodiments described herein:
Embodiment 1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
Embodiment 2. A compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
Embodiment 3. A compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
Embodiment 4. A compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
Embodiment 5. A compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
Embodiment 6. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
Embodiment 7. A compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
Embodiment 8. A compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493. Embodiment 9. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
Embodiment 10. The compound of any one of embodiments 1-9, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
Embodiment 11. The compound of embodiment 10, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
Embodiment 12. The compound of embodiment 10 or 11, wherein the modified sugar is a bicyclic sugar.
Embodiment 13. The compound of embodiment 12, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH2)-0-2' (LNA); 4'-(CH2)2-0-2' (ENA); and 4'-CH(CH3)-0-2' (cEt).
Embodiment 14. The compound of embodiment 10 or 11, wherein the modified sugar is 2 -0- methoxy ethyl.
Embodiment 15. The compound of any one of embodiments 10-14, wherein the modified nucleobase is a 5-methylcytosine.
Embodiment 16. The compound of any one of embodiments 1-15, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
Embodiment 17. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. Embodiment 18. The compound of any one of embodiments 1-17, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1-6.
Embodiment 19. The compound of any one of embodiments 1-18, wherein the compound is single-stranded.
Embodiment 20. The compound of any one of embodiments 1-18, wherein the compound is double-stranded.
Embodiment 21. The compound of any one of embodiments 1-20, wherein the compound comprises ribonucleotides.
Embodiment 22. The compound of any one of embodiments 1-20, wherein the compound comprises deoxyribonucleotides.
Embodiment 23. The compound of any one of embodiments 1-22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.
Embodiment 24. The compound of any one of embodiments 1-23, wherein the compound consists of the modified oligonucleotide.
Embodiment 25. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments 1-24.
Embodiment 26. The compound of embodiment 25, wherein the pharmaceutically acceptable salt is a sodium salt.
Embodiment 27. The compound of embodiment 25, wherein the pharmaceutically acceptable salt is a potassium salt.
Embodiment 28. A composition comprising the compound of any one of embodiments 1-27 and a pharmaceutically acceptable diluent or carrier.
Embodiment 29. A composition comprising the compound of any one of embodiments 1-27 and water.
Embodiment 30. A composition comprising a compound of any one of embodiments 1-27, for use in therapy.
Embodiment 31. A method of inhibiting or reducing ACE2 or TMPRSS2 levels in lung cells or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells, comprising contacting the lung cells with the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in the lung cells or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the lung cells.
Embodiment 32. A method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual comprising administering to the individual the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby inhibiting or reducing SARS- CoV-2 replication, infectivity, viral titer, or viral load in the individual. Embodiment 33. A method of preventing or treating COVID-19 in an individual comprising administering to the individual the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30, thereby preventing or treating COVID-19 in the individual.
Embodiment 34. The method of any of embodiments 31-33, wherein contacting or administering the compound of any one of embodiments 1-27 or composition of any one of embodiments 28- 30 prevents or improves a COVID-19 symptom.
Embodiment 35. The method of embodiment 34, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
Embodiment 36. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
Embodiment 37. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
Embodiment 38. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for preventing or treating COVID-19 in an individual.
Embodiment 39. The use of any of embodiments 36-38, for preventing or improving a COVID-
19 symptom.
Embodiment 40. The use of embodiment 39, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
Embodiment 41. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
Embodiment 42. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
Embodiment 43. Use of the compound of any one of embodiments 1-27 or composition of any one of embodiments 28-30 for the preparation or manufacture of a medicament for preventing or treating COVID-19 in an individual.
Embodiment 44. The use of any of embodiments 41-43, for the preparation or manufacture of a medicament for preventing or improving a COVID-19 symptom. Embodiment 45. The use of embodiment 44, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
Certain Combinations
In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
In certain embodiments, one or more compounds or compositions provided herein are co administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent can be one or more of the following: remdesivir, azithromycin, and/or ivermectin.
Certain Compounds
In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
In certain embodiments, a compound or antisense compound is single -stranded. Such a single- stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.
In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 12-30 linked nucleosides in length and the second modified oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 13-2493.
In certain embodiments, antisense compounds are double -stranded. Such double -stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double -stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double -stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double -stranded antisense compounds may include non-complementary overhanging nucleosides.
Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.
In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
In certain embodiments, a compound described herein comprises an oligonucleotide 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a eompound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50,
18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75
76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.
In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.
In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated compound targeted to an ACE2 or TMPRSS2 R A may have two subunits deleted from the 5’ end, or alternatively may have two subunits deleted from the 3 ’ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.
When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5’ or 3’ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.
It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305- 7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).
In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double -stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post- transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to an ACE2 or TMPRSS2 RNA described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 13- 2493 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 13-2493. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on SARS-CoV-2 RNA to which any of SEQ ID NOs: 13-2493 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000
In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.
In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to SARS-CoV-2 RNA described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 13-2493. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 13-2493. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 13-2493. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on SARS- CoV-2 RNA to which any of SEQ ID NOs: 13-2493 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group. In certain embodiments, compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or b such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.
The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of ¾ 13C or 14C in place of 12C, 15N in place of 14N, 170 or 180 in place of 160, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.
Certain Mechanisms
In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.
In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA- like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to an ACE2 or TMPRSS2 RNA sequence.
In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a human ACE2 mRNA having the sequence set forth in GENBANK Accession No. NM_021804.1 (designated herein as SEQ ID NO: 1). In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human ACE2 RNA having the sequence of the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102 (designated herein as SEQ ID NO: 2). In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human ACE2 mRNA having the sequence set forth in GENBANK Accession No. NM_021804.3 (designated herein as SEQ ID NO: 3) or ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 4).
In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human TMPRSS2 mRNA having the sequence set forth in ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020 (designated herein as SEQ ID NO: 5). In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to human TMPRSS2 RNA having the sequence set forth in ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl 3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 (designated herein as SEQ ID NO: 6). In certain embodiments, compounds described herein complementary to ACE2 or TMPRSS2 are capable of inhibiting SARS-CoV-2. SARS-CoV-2 RNA sequences include, without limitation, the following Genbank Accession NOs, each of which is incorporated by reference in its entirety: NC_045512.2 (designated herein as SEQ ID NO: 1); the complement ofNC_045512.2 (designated herein as SEQ ID NO: 2); NC_045512,
MT350234, MT350236, MT350237, MT350238, MT350239, MT350240, MT350241, MT350242,
MT350243, MT350244, MT350245, MT350246, MT350247, MT350248, MT350249, MT350250,
MT350251, MT350252, MT350253, MT350254, MT350255, MT350256, MT350257, MT350263,
MT350264, MT350265, MT350266, MT350267, MT350268, MT350269, MT350270, MT350271,
MT350272, MT350273, MT350274, MT350275, MT350276, MT350277, MT350278, MT350279,
MT350280, MT350282, MT344135, MT344944, MT344945, MT344946, MT344947, MT344948,
MT344949, MT344950, MT344951, MT344952, MT344953, MT344954, MT344955, MT344956,
MT344957, MT344958, MT344959, MT344960, MT344961, MT344962, MT344963, MT345798,
MT345799, MT345800, MT345801, MT345802, MT345803, MT345804, MT345805, MT345806,
MT345807, MT345808, MT345809, MT345810, MT345811, MT345812, MT345813, MT345814,
MT345815, MT345816, MT345817, MT345818, MT345819, MT345820, MT345821, MT345822,
MT345823, MT345824, MT345825, MT345826, MT345827, MT345828, MT345829, MT345830,
MT345831, MT345832, MT345833, MT345834, MT345835, MT345836, MT345837, MT345838,
MT345839, MT345840, MT345841, MT345842, MT345843, MT345844, MT345845, MT345846,
MT345847, MT345848, MT345849, MT345850, MT345851, MT345852, MT345853, MT345854,
MT345855, MT345856, MT345857, MT345858, MT345859, MT345860, MT345861, MT345862,
MT345863, MT345864, MT345865, MT345866, MT345867, MT345868, MT345869, MT345870,
MT345871, MT345872, MT345873, MT345874, MT345875, MT345876, MT345877, MT345878,
MT345879, MT345880, MT345881, MT345882, MT345883, MT345884, MT345885, MT345886,
MT345887, MT345888, MT339039, MT339040, MT339041, MT334522, MT334523, MT334524,
MT334525, MT334526, MT334527, MT334528, MT334529, MT334530, MT334531, MT334532,
MT334533, MT334534, MT334535, MT334536, MT334537, MT334538, MT334539, MT334540,
MT334541, MT334542, MT334543, MT334544, MT334545, MT334546, MT334547, MT334548,
MT334549, MT334550, MT334551, MT334552, MT334553, MT334554, MT334555, MT334556,
MT334557, MT334558, MT334559, MT334560, MT334561, MT334562, MT334563, MT334564,
MT334565, MT334566, MT334567, MT334568, MT334569, MT334570, MT334571, MT334572,
MT334573, MT324062, MT324679, MT324680, MT324681, MT324682, MT324683, MT324684,
MT325561, MT325562, MT325563, MT325564, MT325565, MT325566, MT325567, MT325568,
MT325569, MT325570, MT325571, MT325572, MT325573, MT325574, MT325575, MT325576,
MT325577, MT325578, MT325579, MT325580, MT325581, MT325582, MT325583, MT325584,
MT325585, MT325586, MT325587, MT325588, MT325589, MT325590, MT325591, MT325592,
MT325593, MT325594, MT325595, MT325596, MT325597, MT325598, MT325599, MT325600, MT325601, MT325602, MT325603, MT325604, MT325605, MT325606, MT325607, MT325608, MT325609, MT325610, MT325611, MT325612, MT325613, MT325614, MT325615, MT325616, MT325617, MT325618, MT325619, MT325620, MT325621, MT325622, MT325623, MT325624, MT325625, MT325626, MT325627, MT325628, MT325629, MT325630, MT325631, MT325632, MT325633, MT325634, MT325635, MT325636, MT325637, MT325638, MT325639, MT325640, MT326023, MT326024, MT326025, MT326026, MT326027, MT326028, MT326029, MT326030, MT326031, MT326032, MT326033, MT326034, MT326035, MT326036, MT326037, MT326038, MT326039, MT326040, MT326041, MT326042, MT326043, MT326044, MT326045, MT326046, MT326047, MT326048, MT326049, MT326050, MT326051, MT326052, MT326053, MT326054, MT326055, MT326056, MT326057, MT326058, MT326059, MT326060, MT326061, MT326062, MT326063, MT326064, MT326065, MT326066, MT326067, MT326068, MT326069, MT326070, MT326071, MT326072, MT326073, MT326074, MT326075, MT326076, MT326077, MT326078, MT326079, MT326080, MT326081, MT326082, MT326083, MT326084, MT326085, MT326086, MT326087, MT326088, MT326089, MT326090, MT326091, MT326092, MT326093, MT326094, MT326095, MT326096, MT326097, MT326098, MT326099, MT326100, MT326101, MT326102, MT326103, MT326104, MT326105, MT326106, MT326107, MT326108, MT326109, MT326110, MT326111, MT326112, MT326113, MT326114, MT326115, MT326116, MT326117, MT326118, MT326119, MT326120, MT326121, MT326122, MT326123, MT326124, MT326125, MT326126, MT326127, MT326128, MT326129, MT326130, MT326131, MT326132, MT326133, MT326134, MT326135, MT326136, MT326137, MT326138, MT326139, MT326140, MT326141, MT326142, MT326143, MT326144, MT326145, MT326146, MT326147, MT326148, MT326149, MT326150, MT326151, MT326152, MT326153, MT326154, MT326155, MT326156, MT326157, MT326158, MT326159, MT326160, MT326161, MT326162, MT326163, MT326164, MT326165, MT326166, MT326167, MT326168, MT326169, MT326170, MT326171, MT326172, MT326173, MT326174, MT326175, MT326176, MT326177, MT326178, MT326179, MT326180, MT326181, MT326182, MT326183, MT326184, MT326185, MT326186, MT326187, MT326188, MT326189, MT326190, MT326191, MT327745, MT328032, MT328033, MT328034, MT328035, MT039874, MT077125, MT322394, MT322395, MT322396, MT322397, MT322398, MT322399, MT322400, MT322401, MT322402, MT322403, MT322404, MT322405, MT322406, MT322407, MT322408, MT322409, MT322410, MT322411, MT322412, MT322413, MT322414, MT322415, MT322416, MT322417, MT322418, MT322419, MT322420, MT322421, MT322422, MT322423, MT322424, MT320538, MT320891, MT308692, MT308693, MT308694, MT308695, MT308696, MT308697, MT308698, MT308699, MT308700, MT308701, MT308702, MT308703, MT308704, MT293547, MT300186, MT304474, MT304475, MT304476, MT304477, MT304478, MT304479, MT304480, MT304481, MT304482, MT304483, MT304484, MT304485, MT304486, MT304487, MT304488, MT304489, MT304490, MT304491, MT273658, MT281530, MT281577, MT291826, MT291827, MT291828, MT291829 MT291830, MT291831, MT291832, MT291833, MT291834, MT291835, MT291836 MT292569 MT292570, MT292571, MT292572, MT292573, MT292574, MT292575, MT292576 MT292577 MT292578, MT292579, MT292580, MT292581, MT292582, MT293156, MT293157 MT293158 MT293159, MT293160, MT293161, MT293162, MT293163, MT293164, MT293165 MT293166 MT293167, MT293168, MT293169, MT293170, MT293171, MT293172, MT293173 MT293174 MT293175, MT293176, MT293177, MT293178, MT293179, MT293180, MT293181 MT293182 MT293183, MT293184, MT293185, MT293186, MT293187, MT293188, MT293189 MT293190 MT293191, MT293192, MT293193, MT293194, MT293195, MT293196, MT293197 MT293198 MT293199, MT293200, MT293201, MT293202, MT293203, MT293204, MT293205 MT293206 MT293207, MT293208, MT293209, MT293210, MT293211, MT293212, MT293213 MT293214 MT293215, MT293216, MT293217, MT293218, MT293219, MT293220, MT293221 MT293222 MT293223, MT293224, MT293225, MT295464, MT295465, MT276323, MT276324 MT276325 MT276326, MT276327, MT276328, MT276329, MT276330, MT276331, MT276597 MT276598 MT262896, MT262897, MT262898, MT262899, MT262900, MT262901, MT262902 MT262903 MT262904, MT262905, MT262906, MT262907, MT262908, MT262909, MT262910 MT262911 MT262912, MT262913, MT262914, MT262915, MT262916, MT262993, MT263074 MT263381 MT263382, MT263383, MT263384, MT263385, MT263386, MT263387, MT263388 MT263389 MT263390, MT263391, MT263392, MT263393, MT263394, MT263395, MT263396 MT263397 MT263398, MT263399, MT263400, MT263401, MT263402, MT263403, MT263404 MT263405 MT263406, MT263407, MT263408, MT263409, MT263410, MT263411, MT263412 MT263413 MT263414, MT263415, MT263416, MT263417, MT263418, MT263419, MT263420 MT263421 MT263422, MT263423, MT263424, MT263425, MT263426, MT263427, MT263428 MT263429 MT263430, MT263431, MT263432, MT263433, MT263434, MT263435, MT263436 MT263437 MT263438, MT263439, MT263440, MT263441, MT263442, MT263443, MT263444 MT263445 MT263446, MT263447, MT263448, MT263449, MT263450, MT263451, MT263452 MT263453 MT263454, MT263455, MT263456, MT263457, MT263458, MT263459, MT263460 MT263461 MT263462, MT263463, MT263464, MT263465, MT263466, MT263467, MT263468 MT263469 MT256917, MT256918, MT256924, MT258377, MT258378, MT258379, MT258380 MT258381 MT258382, MT258383, MT259226, MT259227, MT259228, MT259229, MT259230 MT259231 MT259235, MT259236, MT259237, MT259238, MT259239, MT259240, MT259241 MT259242 MT259243, MT259244, MT259245, MT259246, MT259247, MT259248, MT259249 MT259250 MT259251, MT259252, MT259253, MT259254, MT259255, MT259256, MT259257 MT259258 MT259259, MT259260, MT259261, MT259262, MT259263, MT259264, MT259265 MT259266 MT259267, MT259268, MT259269, MT259270, MT259271, MT259272, MT259273 MT259274 MT259275, MT259276, MT259277, MT259278, MT259279, MT259280, MT259281 MT259282 MT259283, MT259284, MT259285, MT259286, MT259287, LC534418, LC534419, MT251972 MT251973, MT251974, MT251975, MT251976, MT251977, MT251978, MT251979, MT251980
MT253696, MT253697, MT253698, MT253699, MT253700, MT253701, MT253702, MT253703
MT253704, MT253705, MT253706, MT253707, MT253708, MT253709, MT253710, MT233526
MT246449, MT246450, MT246451, MT246452, MT246453, MT246454, MT246455, MT246456
MT246457, MT246458, MT246459, MT246460, MT246461, MT246462, MT246463, MT246464
MT246465, MT246466, MT246467, MT246468, MT246469, MT246470, MT246471, MT246472
MT246473, MT246474, MT246475, MT246476, MT246477, MT246478, MT246479, MT246480
MT246481, MT246482, MT246483, MT246484, MT246485, MT246486, MT246487, MT246488
MT246489, MT246490, MT246667, MT240479, MT232869, MT232870, MT232871, MT232872
MT233519, MT233520, MT233521, MT233522, MT233523, MT226610, MT198651, MT198652
MT198653, MT192758, MT192759, MT192765, MT192772, MT192773, MT186676, MT186677
MT186678, MT186679, MT186680, MT186681, MT186682, MT187977, MT188339, MT188340
MT188341, CADDYA000000000, MT184907, MT184908, MT184909, MT184910, MT184911, MT184912 MT184913, MT163712, MT163714, MT163715, MT163716, MT163717, MT163718, MT163719
MT163720, MT163721, MT163737, MT163738, MT066156, MT121215, MT159705, MT159706
MT159707, MT159708, MT159709, MT159710, MT159711, MT159712, MT159713, MT159714
MT159715, MT159716, MT159717, MT159718, MT159719, MT159720, MT159721, MT159722
MT159778, MT161607, LC529905, MT012098, MT050493, MT152824, MT152900, MT135041, MT135042 MT135043, MT135044, MT126808, MT127113, MT127114, MT127115, MT127116, LC528232, LC528233 MT123290, MT123291, MT123292, MT123293, MT118835, MT111895, MT111896, MT106052
MT106053, MT106054, MT093571, MT093631, MT081059, MT081060, MT081061, MT081062
MT081063, MT081064, MT081065, MT081066, MT081067, MT081068, MT072667, MT072668
MT072688, MT066157, MT066158, MT066159, MT066175, MT066176, LC523807, LC523808, LC523809 MT042773, MT042774, MT042775, MT042776, MT042777, MT042778, MT044257, MT044258
MT049951, MT050414, MT050415, MT050416, MT050417, MT039873, MT039887, MT039888
MT039890, LC522350, MT027062, MT027063, MT027064, MT019529, MT019530, MT019531, MT019532 MT019533, MT020781, MT020880, MT020881, LR757995, LR757996, LR757997, LR757998, MT007544 MT008022, MT008023, MN996527, MN996528, MN996529, MN996530, MN996531, MN988668
MN988669, MN994467, MN994468, MN997409, MN988713, MN938384, MN938385, MN938386
MN938387, MN938388, MN938389, MN938390, MN975262, MN975263, MN975264, MN975265
MN975266, MN975267, MN975268, MN985325, MN970003, MN970004, or MN908947.
Hybridization
In some embodiments, hybridization occurs between a compound disclosed herein and an ACE2 or TMPRSS2 RNA. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with an ACE2 or TMPRSS2 RNA.
Complementarity
An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5 -methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and an ACE2 or TMPRSS2 RNA may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of ACE2 or TMPRSS2 RNA such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an ACE2 or TMPRSS2 RNA, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to an ACE2 or TMPRSS2 RNA, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.
For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to an ACE2 or TMPRSS2 RNA, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.
In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5 ’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.
The location of a non-complementary nucleobase may be at the 5 ’ end or 3 ’ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.
In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an ACE2 or TMPRSS2 RNA, or specified portion thereof.
In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an ACE2 or TMPRSS2 RNA, or specified portion thereof.
In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the— compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
Identity
The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.
In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Certain Modified Compounds
In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage).
A. Modified Nucleosides
Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase. 1. Modified Sugar Moieties
In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2 ’ , 4 ’ , and/or 5 ’ positions . In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-0O¾ (“OMe” or “O-methyl”), and 2'-0(CEb)20CE[3 (“MOE”). In certain embodiments, 2 ’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, ( CEEESCEE, 0(CEh)20N(Rm)(Rn) or OCEbC(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2 ’-substituent groups described in Cook et ah, U.S. 6,531,584; Cook et ah, U.S. 5,859,221; and Cook et ah, U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4’- substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy ( e.g ., methoxy), alkyl, and those described in Manoharan et ah, WO 2015/106128. Examples of 5’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 ’-methyl (R or S), 5'-vinyl, and 5 ’-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ah, US2010/190837 and Rajeev et ah, US2013/0203836.
In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, NEE, N3, OCF3, OCH3, 0(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, 0(CH2)2SCH3, 0(CH2)20N(Rm)(Rn),
0(CH2)20(CH2)2N(CH3)2, and N-substituted acetamide (OCEbC(=C))-N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.
In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, 0(CH2)2SCH3, 0(CH2)20N(CH3)2, 0(CH2)20(CH2)2N(CH3)2, and 0CH2C(=0)-N(H)CH3 (“NMA”). In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2 ’-substituted or 2-modified sugar moieties are referred to as 2 ’-substituted nucleosides or 2-modified nucleosides.
Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-0-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-0-2' (“ENA”), 4'-CH(CH3)-0-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CFb- O-CFb-2’, 4’-CFb-N(R)-2’, 4'-CH(CH20CH3)-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4'-C(CH3)(CH3)-0-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH2- N(0O¾)-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH2-0-N(CH3)-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al, J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see e.g.,, Seth et al., U.S. 8,278,426), 4’-C(RaRb)-N(R)-0-2’, 4’-C(RaR¾)-0-N(R)-2’, 4'-CH2-0-N(R)-2', and 4'-CH2-N(R)-0-2', wherein each R, Ra, and R, is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -|C(Ra)(Rb)|n-. -|C(Ra)(Rb)|n-0-. -C(Ra)=C(Rb)-. -C(Ra)=N-, -C(=NRa)-, -C(=0)- , -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and R¾ is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al, J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al, Chem. Biol., 2001, 8, 1-7; Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al.,U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499, Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133, Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al.,WO 2007/134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.
In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an UNA nucleoside (described herein) may be in the a-U configuration or in the b-D configuration.
Figure imgf000041_0001
LNA (b-D-configuration) a-L-LNA (a-U-configuration) bridge = 4'-CH2-0-2' bridge = 4'-CH2-0-2' a-U-methyleneoxy (4’-CH2-0-2’) or a-U-UNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., FNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.
In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, CJ. Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:
Figure imgf000042_0001
F-HNA
(“F-HNA”, see e.g., Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; and Swayze et al., U.S. 9,005,906, F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
Figure imgf000042_0002
wherein, independently, for each of said modified THP nucleoside:
Bx is a nucleobase moiety;
T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q3, q4, qs, qr, and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJJ2, SJi, N3, OC(=X)Ji, 0C(=X)NJJ2, NT AX^NJiT, and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or C 1 -G, alkyl. In certain embodiments, modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
Figure imgf000043_0001
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as “modifed morpholinos.”
In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.
Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.
2. Modified Nucleobases
Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.
In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
In certain embodiments, modified nucleobases are selected from: 5 -substituted pyrimidines, 6- azapy rim iodines alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine,
5 -hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine,
6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (CºC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch etal., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.
Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler etal., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., U.S. 6,166,199; and Matteucci et al., U.S. 6,005,096.
In certain embodiments, compounds targeted to an ACE2 or TMPRSS2 RNA comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
3. Modified Internucleoside Linkages
The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkageln certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et ak, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (.S'p) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (i¾>) configuration. In certain embodiments, modified oligonucleotides comprising (i?p) and/or (.S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates anucleobase:
Figure imgf000045_0001
Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration. In certain embodiments, compounds targeted to an ACE2 or TMPRSS2 RNA comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.
In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphoms atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous- containing and non-phosphorous-containing linkages are well known.
In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom. Representative phosphoms-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=0”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphoms containing intemucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester, thionocarbamate (-0-C(=0)(NH)-S-); siloxane (-0-SiH2-0-); and N,N'-dimethylhydrazine (-CH2- N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral intemucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl, and thioformacetal (3'-S-CH2-0-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
In certain embodiments, oligonucleotides comprise modified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified intemucleoside linkage motif. In certain embodiments, intemucleoside linkages are arranged in a gapped motif. In such embodiments, the intemucleoside linkages in each of two wing regions are different from the intemucleoside linkages in the gap region. In certain embodiments the intemucleoside linkages in the wings are phosphodiester and the intemucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped intemucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.
In certain embodiments, oligonucleotides comprise a region having an alternating intemucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified intemucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.
In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide.
In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.
In certain embodiments, it is desirable to arrange the number of phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate intemucleoside linkages and the number and position of phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate intemucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester intemucleoside linkages while retaining nuclease resistance.
Certain Motifs
In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). a. Certain Sugar Motifs
In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3 ’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides. In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.
In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2 ’-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.
In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2’- modification.
In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated by reference in its entirety herein.
Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting target nucleic acid expression, which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any intemucleoside linkage motif to form potent antisense oligonucleotides. b. Certain Nucleobase Motifs
In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at the 5 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2- thiopyrimidine and a 5-propynepyrimidine. c. Certain Internucleoside Linkage Motifs
In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=0). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal intemucleoside linkages are modified.
4. Certain Modified Oligonucleotides
In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6- 10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, intemucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
Certain Conjugated Compounds
In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (orterminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (orterminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a sense transcript.
Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
Compositions and Methods for Formulating Pharmaceutical Compositions Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
A compound described herein targeted to an ACE2 or TMPRSS2 RNA can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to an ACE2 or TMPRSS2 RNA and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.
Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
EXAMPLES
Non-limiting disclosure and incorporation by reference
Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2 ’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2 ’-OH for the natural 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5 -position.
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same . Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1: Antisense inhibition of human ACE2 in A-431 cells by 3-10-3 cEt gapmers
Modified oligonucleotides complementary to an ACE2 nucleic acid were synthesized and tested for their effect on ACE2 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below.
The modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides). The intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.
“Start site” indicates the 5 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either the human ACE2 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_021804.1) or to the human ACE2 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011757.13 truncated from positions 11545321 to 11586102) or to both. In some cases, where the modified oligonucleotide is not complementary to either SEQ ID NO: l or SEQ ID NO:2, they are designed to be complementary to either the human ACE2 mRNA, designated herein as SEQ ID NO: 3 (GENBANKAccessionNo. NM_021804.3) ortothe humanACE2 mRNA, designated herein as SEQ ID NO: 4 (ENSEMBL Accession ID ENST00000427411.1 from ENSEMBL version 100, April 2020). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.
Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with 2000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and ACE2 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS52383 (forward sequence GCCACTGCTCAACTACTTTG, designated herein as SEQ ID NO: 7; reverse sequence GCTTATCCTCACTTTGATGCTTTG, designated herein as SEQ ID NO: 8; probe sequence ACTCCAGTCGGTACTCCATCCCA, designated herein as SEQ ID NO: 9) was used to measure RNA levels. ACE2 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent change of ACE2 RNA, relative to PBS control. The symbol “i” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.
Table 1
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Table 2
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000056_0002
Figure imgf000057_0001
Figure imgf000058_0001
Table 3
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000058_0002
Figure imgf000059_0001
Figure imgf000060_0001
Table 4
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000060_0002
Figure imgf000061_0001
Figure imgf000062_0001
Table 5
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000062_0002
Figure imgf000063_0001
Figure imgf000064_0001
Table 6
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000064_0002
Figure imgf000065_0001
Table 7
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000066_0001
Figure imgf000067_0001
Table 8
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000068_0001
Figure imgf000069_0001
Table 9
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000070_0001
Figure imgf000071_0001
Table 10
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000072_0001
Figure imgf000073_0001
Table 11
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000074_0001
Figure imgf000075_0001
Table 12
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000076_0001
Figure imgf000077_0001
Table 13
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000078_0001
Figure imgf000079_0001
Table 14
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000080_0001
Figure imgf000081_0001
Table 15
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000082_0001
Figure imgf000083_0001
Table 16
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000084_0001
Figure imgf000085_0001
Table 17
Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000086_0001
Table 17 Reduction of ACE2 RNA by 3-10-3 gapmers with in A431 cells
Figure imgf000086_0002
Example 2: Antisense inhibition of human TMPRSS2 in C4-2 cells by 3-10-3 cEt gapmers
Modified oligonucleotides complementary to an TMPRSS2 nucleic acid were synthesized and tested for their effect on TMPRSS2 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below.
The modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides). The intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.
“Start site” indicates the 5 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either the human TMPRSS2 mRNA, designated herein as SEQ ID NO: 5 (ENSEMBL Accession ID ENST00000332149.10 from ENSEMBL version 100, April 2020) or to the human TMPRSS2 genomic sequence, designated herein as SEQ ID NO: 6 (ENSEMBL Accession ID ENSG00000184012.12 from ENSEMBL version 100, April 2020, human reference assembly version GRCh38.pl 3 located on the reverse strand of Chromosome 21, from positions 41464305 to 41531116 ) orto both. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.
Cultured C4-2 cells at a density of 30,000 cells per well were transfected using electroporation with 3000 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and TMPRSS2 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS52381 (forward sequence CTGCATCAACCCCTCTAACTG, designated herein as SEQ ID NO: 10; reverse sequence GACTTCCTCTGAGATGAGTACA, designated herein as SEQ ID NO: 11; probe sequence ACACACCGATTCTCGTCCTCCC, designated herein as SEQ ID NO: 12) was used to measure RNA levels. TMPRSS2 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent change of TMPRSS2 RNA, relative to PBS control. The symbol “1” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.
Table 18 Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000087_0001
Figure imgf000088_0001
Figure imgf000089_0001
Table 19
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000089_0002
Figure imgf000090_0001
Figure imgf000091_0001
Table 20
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000091_0002
Figure imgf000092_0001
Figure imgf000093_0001
Table 21
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000093_0002
Figure imgf000094_0001
Figure imgf000095_0001
Table 22
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000095_0002
Figure imgf000096_0001
Figure imgf000097_0001
Table 23
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000097_0002
Figure imgf000098_0001
Figure imgf000099_0001
Table 24
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000099_0002
Figure imgf000100_0001
Figure imgf000101_0001
Table 25
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000101_0002
Figure imgf000102_0001
Table 26
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000103_0001
Figure imgf000104_0001
Table 27
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000105_0001
Figure imgf000106_0001
Table 28
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000107_0001
Figure imgf000108_0001
Table 29
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000109_0001
Figure imgf000110_0001
Table 30
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000111_0001
Figure imgf000112_0001
Table 31
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000113_0001
Figure imgf000114_0001
Table 32
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000115_0001
Figure imgf000116_0001
Table 33
Reduction of TMPRSS2 RNA by 3-10-3 gapmers with in C4-2 cells
Figure imgf000117_0001
Figure imgf000118_0001
Example 3: Activity of modified oligonucleotides complementary to a ACE2 RNA against SARS-CoV-2 infection, in vitro, dose response
Modified oligonucleotides described in the examples above were tested in vitro for activity against SARS-CoV-
2
H1437 cells were seeded at a density of 3000 cells/well in 384-well plates and treated with modified oligonucleotide by free uptake for 24 hours at doses indicated in the table below. After the 24 hour incubation, the modified oligonucleotide was rinsed off the cells, and the cells were infected with SARS-CoV-2 WA1/2020 strain (BEI resources Catalog # NR-52281) at an MOI of 1 for 48 hours. Two days post infection, the cells were fixed with 4% paraformaldehyde (PFA), permeabilized with 0.03% Triton X-100, and blocked with antibody buffer (1.5% BSA, 1% goat semm, and 0.0025% Tween 20). Following blocking, cells were stained overnight with SARS-CoV-2 nucleoprotein primary antibody (ProSci Catalog #35-579, 1:2000) and then stained with anti-mouse IgGAlexaFluor 647 secondary (Invitrogen Catalog #A21235, 1:1000), and Hoechst 33342 (Invitrogen Catalog #H3570, 1:2000). The stained cells were imaged to determine infection levels in cells treated with modified oligonucleotides.
Compound No. 792169, a control modified oligonucleotide with a sequence (from 5’ to 3’) of CGCCGATAAGGTACAC (SEQ ID NO: 2495), was designed to not target SARS-CoV-2, and was added to the experiment as a negative control. The sugar motif for Compound No. 792169 is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2 -(i-D-dcoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for Compound No. 792169 is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Results are presented in the tables below as percent of the amount of infection of SARS-COV-2 in cells treated with modified oligonucleotide complementary to ACE2.
Table 34
Reduction of SARS-COV-2 infection by modified oligonucleotides complementary to ACE2 in H1437 cells
Figure imgf000119_0001
Figure imgf000120_0001

Claims

WHAT IS CLAIMED:
1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
2. A compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
3. A compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
4. A compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
5. A compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-2493.
6. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
7. A compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
8. A compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
9. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-2493.
10. The compound of any one of claims 1-9, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
11. The compound of claim 10, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
12. The compound of claim 10 or 11, wherein the modified sugar is a bicyclic sugar.
13. The compound of claim 12, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH2)-0-2' (LNA); 4'-(CH2)2-0-2' (ENA); and 4'-CH(CH3)-0-2' (cEt).
14. The compound of claim 10 or 11, wherein the modified sugar is 2’-0-methoxyethyl.
15. The compound of any one of claims 10-14, wherein the modified nucleobase is a 5- methylcytosine.
16. The compound of any one of claims 1-15, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
17. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2493, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
18. The compound of any one of claims 1-17, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1-6.
19. The compound of any one of claims 1-18, wherein the compound is single-stranded.
20. The compound of any one of claims 1-18, wherein the compound is double-stranded.
21. The compound of any one of claims 1-20, wherein the compound comprises ribonucleotides.
22. The compound of any one of claims 1-20, wherein the compound comprises deoxyribonucleotides .
23. The compound of any one of claims 1-22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.
24. The compound of any one of claims 1-23, wherein the compound consists of the modified oligonucleotide.
25. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of claims 1-24.
26. The compound of claim 25, wherein the pharmaceutically acceptable salt is a sodium salt.
27. The compound of claim 25, wherein the pharmaceutically acceptable salt is a potassium salt.
28. A composition comprising the compound of any one of claims 1-27 and a pharmaceutically acceptable diluent or carrier.
29. A composition comprising the compound of any one of claims 1-27 and water.
30. A composition comprising a compound of any one of claims 1-27, for use in therapy.
31. A method of inhibiting or reducing ACE2 or TMPRSS2 levels in a lung cell or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in a lung cell, comprising contacting the lung cell with the compound of any one of claims 1-27 or composition of any one of claims 28-30, thereby inhibiting or reducing ACE2 or TMPRSS2 levels in the lung cell or inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the lung cell.
32. A method of inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual comprising administering to the individual the compound of any one of claims 1-27 or composition of any one of claims 28-30, thereby inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in the individual.
33. A method of preventing or treating COVID-19 in an individual comprising administering to the individual the compound of any one of claims 1-27 or composition of any one of claims 28-30, thereby preventing or treating COVID-19 in the individual.
34. The method of any of claims 31-33, wherein contacting or administering the compound of any one of claims 1-27 or composition of any one of claims 28-30 prevents or improves a COVID-19 symptom.
35. The method of claim 34, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
36. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
37. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
38. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for preventing or treating COVID-19 in an individual.
39. The use of any of claims 36-38, for preventing or improving a COVID-19 symptom.
40. The use of claim 39, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
41. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in lung cells.
42. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for the preparation or manufacture of a medicament for inhibiting or reducing SARS-CoV-2 replication, infectivity, viral titer, or viral load in an individual.
43. Use of the compound of any one of claims 1-27 or composition of any one of claims 28-30 for the preparation or manufacture of a medicament for preventing or treating COVID-19 in an individual.
44. The use of any of claims 41-43, for the preparation or manufacture of a medicament for preventing or improving a COVID-19 symptom.
45. The use of claim 44, wherein the COVID symptom is respiratory illness, difficulty breathing, fever, cough, fatigue, aches and pains, sore throat, runny nose, diarrhea, loss of taste or smell, or nasal congestion.
PCT/US2021/035944 2020-06-05 2021-06-04 Compositions and methods of inhibiting angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2) WO2021248027A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063035516P 2020-06-05 2020-06-05
US63/035,516 2020-06-05

Publications (1)

Publication Number Publication Date
WO2021248027A1 true WO2021248027A1 (en) 2021-12-09

Family

ID=78829945

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/035944 WO2021248027A1 (en) 2020-06-05 2021-06-04 Compositions and methods of inhibiting angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2)

Country Status (1)

Country Link
WO (1) WO2021248027A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022144441A1 (en) * 2020-12-31 2022-07-07 The First Affiliated Hospital Of Sun Yat-Sen University Oligonucleotide for reducing the expression of angiotensin-converting enzyme 2 (ace2) and its use for treating viral infection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050203038A1 (en) * 2004-03-10 2005-09-15 Isis Pharmaceuticals Inc. Modulation of ACE2 expression
US20190233827A1 (en) * 2013-08-28 2019-08-01 Ionis Pharmaceuticals, Inc. Modulation of prekallikrein (pkk) expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050203038A1 (en) * 2004-03-10 2005-09-15 Isis Pharmaceuticals Inc. Modulation of ACE2 expression
US20190233827A1 (en) * 2013-08-28 2019-08-01 Ionis Pharmaceuticals, Inc. Modulation of prekallikrein (pkk) expression

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022144441A1 (en) * 2020-12-31 2022-07-07 The First Affiliated Hospital Of Sun Yat-Sen University Oligonucleotide for reducing the expression of angiotensin-converting enzyme 2 (ace2) and its use for treating viral infection

Similar Documents

Publication Publication Date Title
US11981897B2 (en) Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression
AU2019345031B2 (en) Modulators of PNPLA3 expression
US20140378533A1 (en) Modulation of rna by repeat targeting
WO2016112132A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
EP3055414A2 (en) Compositions for modulating c9orf72 expression
AU2019403447B2 (en) Modulators of HSD17B13 expression
WO2016167780A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
CA3093547A1 (en) Modulation of hsd17b13 expression
AU2018237306B2 (en) Modulators of PCSK9 expression
EP3429690A1 (en) Methods of modulating keap1
AU2019274461A1 (en) Modulators of APOL1 expression
WO2020102630A1 (en) Modulators of irf5 expression
WO2021248027A1 (en) Compositions and methods of inhibiting angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2)
WO2021211928A1 (en) Compositions and methods of inhibiting severe acute respiratory syndrome coronavirus 2 (sars-cov-2)
WO2019089692A1 (en) MODULATORS OF ENaC EXPRESSION
WO2022246107A1 (en) Modulation of coasy expression
US20210290653A1 (en) Modulation of lnc05 expression
WO2017161168A1 (en) Modulation of dyrk1b expression
EP4363563A1 (en) Modulation of nox4 expression
WO2020053142A1 (en) Novel target to treat a metabolic disease in an individual
WO2022183065A1 (en) Modulation of marc1 expression
WO2011133923A1 (en) Modulation of lactosylceramide synthase (lcs) expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21818403

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21818403

Country of ref document: EP

Kind code of ref document: A1