WO2021244255A1

WO2021244255A1 - Method for preparing rbd glycoprotein of coronavirus spike protein, and use thereof

Info

Publication number: WO2021244255A1
Application number: PCT/CN2021/093757
Authority: WO
Inventors: 刘波; 吴军; 孙鹏; 王甜甜; 巩新; 侯旭宸; 徐俊杰; 殷瑛; 张军
Original assignee: 中国人民解放军军事科学院军事医学研究院
Priority date: 2020-06-03
Filing date: 2021-05-14
Publication date: 2021-12-09
Also published as: CN113754739A

Abstract

Provided are a method for preparing an RBD glycoprotein of a coronavirus spike protein and the use thereof. Further provided is a method for preparing a coronavirus spike protein RBD having a mammalian glycoform structure N-glycan modification, the method comprising: expressing a coronavirus spike protein RBD in Pichia pastoris (Pichia pastoris cell mutants that are defective in a mannosylation modification pathway and reconstruct the N-glycosylation modification pathway in mammalian cells) which is genetically modified by means of a glycosylation modification pathway, thereby obtaining recombinant yeast cells; and cultivating the recombinant yeast cells, and purifying the culture supernatant to acquire a target protein. The coronavirus spike protein RBD having a mammalian glycoform structure N-glycan modification is successfully expressed, and after mice are immunized with same, high-titer antibodies can be produced, and thus, SARS-CoV-2 can be neutralized. The efficient research and development and large-scale production of novel coronavirus vaccines are facilitated.

Description

Preparation method and application of coronavirus S protein RBD glycoprotein

Technical field

The invention relates to the field of biomedicine, in particular to a preparation method and application of coronavirus S protein RBD glycoprotein.

Background technique

In the past 20 years, a variety of coronaviruses have broken through species boundaries and spread to humans, causing about 30% of respiratory infections (Coronaviruses: drug discovery and therapeutic options) and causing huge losses. This reminds us that the coronavirus is increasingly threatening human health, and the research of related vaccines is the most urgent task.

The S protein is the only protein on the surface of the coronavirus. It is a type I membrane protein and is modified by N-glycosylation. Its monomer is composed of about 1300 amino acids. The monomer is folded and polymerized to form a homotrimer. The S protein monomer is composed of the N-terminal S1 subunit and the C-terminal S2 subunit. The S1 subunit is responsible for binding to the host cell receptor. After the virus is taken up by the host cell, the S2 subunit is close to the S2 site of the fusion peptide. Host protease cleavage triggers the conformational change of the S protein, and the S2 subunit mediates membrane fusion (Reference: Alexandra C Walls, et al. Glycan shield and epitope masking of a coronavirus spike protein observed by cryo-electron microscopy. Nat Struct Mol Biol .2016, Oct; 23(10):899-905.).

Vaccine studies based on the full-length SARS-CoV S protein have found that although the S protein has high immunogenicity and can induce the body to produce neutralizing antibodies against SARS-CoV, the full-length S protein as an antigen can induce tropism. The safety of acid cell immunopathology or antibody-mediated immune enhancement ADE and other adverse reactions has been widely questioned.

The new coronavirus SARS-CoV-2 S protein and SARS-CoV S protein have high homology, and the high-level structures of the two also have a certain degree of similarity, and SARS-CoV-2 also invades human cells through the receptor ACE2 (cryo -EM structure of the 2019-nCoV spike in the precusion conformation), which reminds us that the development experience of the SARS-CoV vaccine can provide clues for the development of the SARS-CoV-2 vaccine.

As an independent domain, the RBD region of SARS-CoV S protein can form the correct conformation and contains multiple spatial structure-dependent epitopes. It is one of the main antigens investigated in several subunit vaccines, that is, RBD is in addition to the Spike protein. S1 area, S2 area, full-length S area, nucleoprotein is one of several antigens to be investigated. However, the SARS-CoV-2 S protein RBD has two potential N-glycosylation sites, and the correct glycoform structure plays an important role in maintaining the natural conformation and immunogenicity of RBD. Yeast, as a microorganism that has been used in industrial scale production for a long time, has been successfully used in the production of non-glycoprotein subunit vaccines such as hepatitis B (HBV) vaccine and papilloma virus (HPV) vaccine. It has high safety , Engineering strains have short construction period, fast growth, and easy mass production, making them very suitable as an expression system for high-efficiency and large-scale vaccine production under sudden infectious diseases and other emergency conditions. However, yeast has the phenomenon of excessive glycosylation (excess mannosylation), and the masking of important epitopes by excessive glycosylation will reduce the protective effect of the vaccine. The research and modification of yeast glycosylation modification system makes the glycosylation modification close to, or even better than, the natural glycosyl structure of the antigen, which is expected to allow the genetically modified yeast to replace chicken embryos and mammalian cells with For the rapid and efficient production of genetic engineering subunit vaccines.

Invention Disclosure

The purpose of the present invention is to provide a method and application for preparing a coronavirus S protein RBD with mammalian glycoform structure N-sugar chain modification by using Pichia pastoris genetically modified by glycosylation modification pathway.

In the first aspect, the present invention claims a method for preparing a coronavirus S protein receptor binding domain (RBD) with a mammalian glycoform structure N-sugar chain modification.

The method for preparing the N-sugar chain modified coronavirus S protein receptor binding domain (RBD) with mammalian glycoform structure as claimed in the present invention may include the following steps:

(1) Reengineering the Pichia pastoris genetically modified through the glycosylation modification pathway so that it can express the coronavirus S protein receptor binding domain (RBD) to obtain recombinant yeast cells;

The Pichia pastoris genetically modified through the glycosylation modification pathway is a Pichia pastoris cell mutant that is defective in the mannosylation modification pathway and reconstructs the N-glycosylation modification pathway of mammalian cells .

(2) Culturing the recombinant yeast cell, and obtaining the N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform structure from the culture supernatant.

Wherein, the Pichia pastoris genetically modified through the glycosylation modification pathway can be prepared according to a method including the following steps:

(A1) Endogenous α-1,6-mannose transferase, phosphate mannose transferase, phosphate mannose synthase, β mannose transferase I, β mannose transferase endogenous in Pichia pastoris Enzyme II, β-mannose transferase III and β-mannose transferase IV to obtain recombinant yeast 1;

(A2) Express at least one of the following exogenous proteins in the recombinant yeast 1: exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, exogenous mannosidase II, exogenous N- Acetyl glucosamine transferase II, exogenous galactose isomerase, and exogenous galactose transferase to obtain recombinant yeast 2; the recombinant yeast 2 is the genetically modified Pichia pastoris through the glycosylation modification pathway yeast.

When α-1,6-mannose transferase, phosphate mannose transferase, phosphate mannose synthase, β-mannose transferase I-IV are inactivated, the N glycosylation modification is significantly reduced, and the glycosylation environment is more inclined Compared with being relatively "clean", the new question is: How to reduce O glycosylation modification? There are many members of the O glycosylation family. Which enzyme can be used to inactivate the present invention and achieve the desired effect? We all know that N-glycosylation modification will occur at its conservative N-glycosylation modification site (NXS/T), but because O-glycosylation modification does not have a conservative glycosylation site, it is generally considered O-glycosylation can occur on amino acids that are enriched in serine or threonine. Whether O-glycosylation occurs in different proteins, and on which amino acid, the degree of O-glycosylation is different. Protein serine or threonine may be a potential site for O-glycosylation, but not every serine or threonine will undergo O-glycosylation modification, and not every serine or threonine containing serine or threonine Proteins will undergo O-glycosylation modification, and different proteins have different glycosylation modifications in different expression systems. If O-glycosylation is modified, most of the sugar groups on the sugar chains are mannose. Although the sugar chains are relatively short, due to the large number of sugar chains, there may be a large amount of exposed mannose on the surface of the yeast expressed protein. This glycoprotein with mannosylation has a short half-life, high immunogenicity, and is easy to be eliminated in the human body. Due to this defect, the application of Pichia pastoris in the production of most protein drugs is limited.

According to the homology of O-glycosyltransferase family members, they are divided into three subfamilies: PMT1 subfamily, PMT2 subfamily and PMT4 subfamily. The number of members of PMT1 subfamily and PMT2 subfamily may be different in different species. There are 7 family members: PMT1\PMT2\PMT3\PMT4\PMT5\PMT6\PMT7. The PMT1 subfamily of Saccharomyces cerevisiae includes PMT1\PMT5\PMT7, and the PMT2 subfamily includes PMT2\PMT3\PMT638. Members of Pmt1p subfamily (Pmt1p, Pmt5p) and Pmt2p subfamily (Pmt2p, Pmt3p) form heteroduplexes with each other, Pmt4p will form homoduplexes, and Pmt6p can neither form heteroduplexes with other members of the Pmtp family, nor can it It forms a homologous duplex with itself. In wild-type yeast, the complexes formed by members of the Pmt1p subfamily and Pmt2p subfamily are mainly Pmt1p–Pmt2p and Pmt5p–Pmt3p complexes, and there are also a small amount of Pmt1p–Pmt3p and Pmt2p–Pmt5p complexes. However, in the present invention, we found that based on the inactivation of α-1,6-mannose transferase, the inactivation of phosphomannose transferase, the inactivation of phosphate mannose synthase and the inactivation of β-mannose transferase I-IV , Further inactivate O-mannosyltransferase I, and simultaneously express a certain type of exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, exogenous mannosidase II, and exogenous N-acetyl glucose from a specific source Aminotransferase II, exogenous galactose isomerase GalE and exogenous galactose transferase GalT, this combination can significantly reduce the O-glycosylation modification of proteins expressed by engineered yeast, and obtain specific mammalian cell sugars type.

Correspondingly, the following step (A3) may be included after step (A2):

(A3) Inactivate the endogenous Omannosyltransferase I of the recombinant yeast 2 to obtain the recombinant yeast 3; the recombinant yeast 3 is also the Pichia pastoris genetically modified through the glycosylation modification pathway.

Step (A3) further reduces the yeast O glycosylation modification.

Wherein, the N-sugar chain of the mammalian glycoform structure can be Gal ₂ GlcNAc ₂ Man ₃ GlcNAc ₂ , GalGlcNAcMan ₅ GlcNAc ₂ or Man ₅ GlcNAc ₂ . Gal: galactose, GlcNAc: N-acetylglucosamine; Man: mannose.

When the mammalian glycoform N-sugar chain is Gal ₂ GlcNAc ₂ Man ₃ GlcNAc ₂ , GalGlcNAcMan ₅ GlcNAc ₂ or Man ₅ GlcNAc ₂ , the foreign protein expressed in the recombinant yeast 1 in step (A2) All can be exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, exogenous galactose isomerase and exogenous galactose transferase, exogenous mannosidase II, and exogenous N-acetyl glucose Aminotransferase II.

When the mammalian glycosyl structure N-sugar chain is GalGlcNAcMan ₅ GlcNAc ₂ , the exogenous protein expressed in the recombinant yeast 1 in step (A2) may also be exogenous mannosidase I, exogenous N- Acetyl glucosamine transferase I, as well as exogenous galactose isomerase and exogenous galactose transferase.

When the mammalian glycoform N-sugar chain is Man ₅ GlcNAc ₂ , the exogenous protein expressed in the recombinant yeast 1 in step (A2) may also be exogenous mannosidase I.

In steps (A1) and (A3), the inactivation of the aforementioned glycosyl-modifying enzyme can be achieved by mutating one or more nucleotide sequences of the gene, or by deleting part or the entire gene sequence, or by inserting nucleotides Destroy the original reading frame and terminate protein synthesis in advance to inactivate the gene or the activity of the protein encoded by the gene. The above-mentioned mutations, deletions, and insertion inactivation can be obtained by conventional methods such as mutagenesis and knockout. These methods have been reported in many literatures, such as J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995. Other methods known in the art can also be used to construct genetically inactivated yeast strains. The better strain was obtained by knocking out part of the sequence of the mannose transferase gene. The partial sequence is at least more than three bases, preferably more than 100 bases, and more preferably includes more than 50% of the coding sequence. The strain obtained by knocking out part of the sequence of the glycosyl-modifying enzyme gene is not easy to produce back mutations, and the stability of the strain is higher than that constructed by methods such as point mutation, and is more conducive to application in the medical and industrial fields.

The method of knocking out part of the sequence of the glycosylation modifying enzyme gene may include: first constructing a plasmid for knocking out the gene: the plasmid contains the sequence of homology arms on both sides of the gene to be knocked out, and the two homology arms should be selected in the target gene On both sides, the length of the homology arms is at least greater than 200 bp, and the optimal size is 500 bp-2000 bp. It is also possible to use the method of insertion inactivation to obtain an amino acid sequence after one or several amino acid residue substitutions and/or deletions and/or additions, resulting in a nucleotide sequence with no functional activity, and construct it into a plasmid. The plasmid also carries URA3 (orotidine-5'-phosphate decarboxylase) gene, or bleomycin, or hygromycin B, or blasticidin or G418 as selection markers. The polynucleotide sequence encoding the homologous arm fragment of the flanking region and the nucleotide sequence of the protein whose function is to be disrupted can be obtained from the publicly available National Center for Biotechnology Information (NCBI). Using the PCR method, using the Pichia pastoris host genome as a template, a certain length of flanking homology regions required for inactivating genes are obtained, respectively including the upstream and downstream flanking homology of the gene coding region of the target gene (the sequence of which has been published in NCBI) Region, and add a suitable restriction site in the primer part. According to the sequence, polynucleotides can be obtained by methods well known in the art, such as PCR (J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995.), RT-PCR method, artificial The method of synthesis, genomic DNA and the method of constructing and screening cDNA library are obtained. If necessary, polynucleotides can be mutated, deleted, inserted, linked to other polynucleotides, etc., using methods known in the art. The respectively obtained upstream (5') and downstream (3') flanking regions homologous arm fragments are fused, and various methods known in the art can be used, such as by overlapping PCR, while keeping the size of the respective fragments unchanged. For the method, the standard molecular cloning process used is described in J. Sambrook et al. (J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995.). The nucleic acid containing the fusion fragment of the homologous arm sequence of the gene to be inactivated can be cloned into various vectors suitable for yeast by methods well known in the art. Alternatively, the restriction sites on the respective homology arms can be inserted into specific regions of the vector. The standard molecular cloning process used is described by J. Sambrook et al. (J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995.). Construct a recombinant knockout plasmid. The original plasmid can be an expression vector suitable for yeast, a shuttle vector, with replication sites, selection markers, auxotrophic markers (URA3, HIS, ADE1, LEU2, ARG4), etc. The construction methods of these vectors have been published in many documents Public (e.g. J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995), can also be purchased from various companies (e.g. Invitrogen Life Technologies, Carlsbad, California 92008, USA), priority The vectors include pPICZαA and pYES2 yeast expression vectors. Inactivated vectors are shuttle plasmids, which are first replicated and amplified in E. coli, and then introduced into host yeast cells. The vectors should carry resistance marker genes or auxotrophic marker genes to facilitate the selection of later transformants.

The homologous regions on both sides of the gene to be inactivated (the upstream is called the 5'arm, and the downstream is called the 3'arm) are respectively constructed into the yeast vector to form a recombinant knockout vector. Furthermore, the linearization site of the homology arm is used to linearize the knockout vector, and the vector is transformed into Pichia pastoris or one of its modified variants by an electrotransformation method for culture. The required nucleic acid for transformation into host cells can be obtained by usual methods, such as preparing competent cells, electroporation, lithium acetate method, etc. (A. Adams et al., "Yeast Genetics Method Experimental Guide", Science Press, 2000). Successfully transformed cells, that is, cells containing the homologous region of the gene to be knocked out, can be identified by well-known techniques, such as collecting and lysing the cells, extracting DNA, and then PCR to identify the genotype; and selecting the correct table before Type can be achieved by screening for auxotrophs or resistance markers. The transformants that are recombined correctly once are cultured in yeast minimal medium, and then spread on a 5-fluoroorotic acid plate containing uracil and other secondary recombination screening plates. The clones that grow out are then further subjected to the PCR identification of the genotype. . The correct transformants lacking the coding region of the expected gene were screened separately.

In a specific embodiment of the present invention, in step (A1), the endogenous α-1,6-mannose transferase, phosphomannose transferase, and mannose phosphate of the receptor Pichia pastoris Synthetase, β-mannose transferase I, β-mannose transferase II, β-mannose transferase III and β-mannose transferase IV are all knocked out by homologous recombination.

In a specific embodiment of the present invention, in step (A2), the expression of the foreign protein in the recombinant yeast 1 is achieved by introducing the gene encoding the foreign protein into the recombinant yeast 1.

Further, the gene encoding the foreign protein is introduced into the recombinant yeast 1 in the form of a recombinant vector.

Further, the encoding gene of the exogenous mannosidase I and the encoding gene of the exogenous mannosidase II are both introduced into the recombinant yeast 1 twice.

In a specific embodiment of the present invention, in step (A3), the endogenous Omannose transferase I of the recombinant yeast 2 is inactivated. The gene encoding Omannose transferase I in the genomic DNA of the recombinant yeast 2 is inserted and inactivated (disrupting its corresponding nucleotide sequence by inserting inactivation).

In the present invention, specifically, the front end and the end of the target fragment of the Omannosyltransferase I encoding gene in the genomic DNA of the recombinant yeast 2 are each equipped with a different combination of stop codons, and the stop codon at the end Then install a terminator (such as the CYC1TT terminator). The target fragments with different combinations of stop codons installed on the front and end are specifically obtained by PCR amplification using the genomic DNA of Pichia pastoris JC308 as a template and using primers PMT1-IN-5 and PMT1-IN-3 Fragment.

PMT1-IN-5:

5’-tctatgcattaatgatagttaatgactaatagagtaaaacaagtcctcaagaggt-3’ (SEQ ID No.99);

PMT1-IN-3:

5’-tgacataactaattacatgatctattagtcattaactatcattagatcagagtggggacgacta agaaa gc-3’ (SEQ ID No. 100).

The next technical problem is to construct an engineered Pichia strain with mammalian cell glycoform modification ability in yeast chassis cells. There are many and complicated glycosyl modification enzymes involved in the glycosyl modification of mammalian cells. What kind of enzyme modification will be obtained? What kind of sugar type? As well as the ratio and combination of sugar types obtained are not known before research. The present invention is realized by the following technical methods:

In step (A2), the exogenous mannosidase I is localized in the endoplasmic reticulum after expression.

The exogenous mannosidase I is derived from Trichoderma viride, and the C-terminus is fused with the endoplasmic reticulum retention signal HDEL.

In step (A2), the exogenous N-acetylglucosamine transferase I is localized in the endoplasmic reticulum or medial Golgi after expression.

The exogenous N-acetylglucosamine transferase I can be N-acetylglucosamine transferase I derived from mammals, etc., such as human N-acetylglucosamine transferase I (GenBank NO NM 002406), Candida albicans N -Acetyl glucosamine transferase I (GenBank NO NW_139513.1), Dictyostelium discoideum N-acetylglucosamine transferase I (GenBank NO NC_007088.5), etc., can be fused to the N-terminus or C-terminus Net or medial Golgi positioning signal, such as ScGLS, ScMNS1, PpSEC12, ScMNN9, etc.; preferably it is derived from humans and contains mnn9 positioning signal.

In step (A2), the exogenous mannosidase II is expressed and localized in the endoplasmic reticulum or medial Golgi apparatus.

The exogenous mannosidase II may be mannosidase II derived from filamentous fungi, plants, insects, Java, mammals, etc., Drosophila mannosidase II (GenBank NOX77652), nematode mannosidase II (GenBank NO NM 0735941), human mannosidase II (GenBank NO U31520), etc.; the expressed mannosidase II can be fused with the endoplasmic reticulum or medial Golgi localization signal at the N-terminus or C-terminus, such as ScGLS, ScMNS1, PpSEC12, ScMNN9, etc., are preferably derived from nematodes and contain mnn2 localization signal.

In step (A2), the exogenous N-acetylglucosamine transferase II is localized in the endoplasmic reticulum or medial Golgi after expression.

The exogenous N-acetylglucosamine transferase II may be N-acetylglucosamine transferase II derived from mammals, etc., such as human N-acetylglucosamine transferase II (GenBank NO Q10469), mouse N-acetyl Glucosamine transferase II (GenBank NO Q09326), etc.; the expressed N-acetylglucosamine transferase II can be fused with the endoplasmic reticulum or medial Golgi localization signal at the N-terminus or C-terminus, such as ScGLS, ScMNS1, PpSEC12, ScMNN9, etc., are preferably derived from humans and contain mnn2 positioning signals.

The exogenous mannosidase II is derived from nematodes and contains mnn2 localization signal.

In step (A2), the exogenous galactose isomerase and the exogenous galactose transferase are localized in the endoplasmic reticulum or the medial Golgi after being expressed.

The exogenous galactose isomerase and the exogenous galactose transferase are both derived from mammals, and are fused with an endoplasmic reticulum or medial Golgi localization signal at the N-terminal or C-terminal.

The exogenous galactose isomerase and the exogenous galactose transferase are fusion proteins, both of which are selected from humans, and share a kre2 localization signal.

Galactosyltransferase can be a galactosyltransferase derived from mammals, such as human β-1,4-galactosyltransferase (GenBank NO gi:13929461), murine β-1,4-galactosyltransferase GenBank NO NC_000081.6) and so on. The expressed galactosyltransferase can be fused with the endoplasmic reticulum or medial Golgi localization signal at the N-terminal or C-terminal, such as ScKRE2, ScGLS, ScMNS1, PpSEC12, ScMNN9, etc. The galactosyltransferase in the embodiment of the present invention is derived from human , And there is a kre2 positioning signal.

The α-1,6-mannose transferase can be the following B1) or B2):

B1) The amino acid sequence is the protein of SEQ ID No. 1;

B2) The amino acid sequence shown in SEQ ID No. 1 has been substituted and/or deleted and/or added by one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 1 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The phosphomannose transferase can be the following B3) or B4):

B3) The amino acid sequence is the protein of SEQ ID No. 2;

B4) The amino acid sequence shown in SEQ ID No. 2 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 2 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The mannose phosphate synthase can be the following B5) or B6):

B5) The amino acid sequence is the protein of SEQ ID No. 3;

B6) The amino acid sequence shown in SEQ ID No. 3 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 3 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The β-mannose transferase I can be the following B7) or B8):

B7) The amino acid sequence is the protein of SEQ ID No. 4;

B8) The amino acid sequence shown in SEQ ID No. 4 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 4 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The β-mannose transferase II can be the following B9) or B10):

B9) The amino acid sequence is the protein of SEQ ID No. 5;

B10) The amino acid sequence shown in SEQ ID No. 5 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 5 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The β-mannose transferase III may be B11) or B12) as follows:

B11) The amino acid sequence is the protein of SEQ ID No. 6;

B12) The amino acid sequence shown in SEQ ID No. 6 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 6 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The β-mannose transferase IV may be B13) or B14) as follows:

B13) The amino acid sequence is the protein of SEQ ID No. 7;

B14) The amino acid sequence shown in SEQ ID No. 7 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 7 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The Omannose transferase I can be the following B15) or B16):

B15) The amino acid sequence is the protein of SEQ ID No. 8;

B16) The amino acid sequence shown in SEQ ID No. 8 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 8 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The exogenous mannosidase I can be the following B17) or B18):

B17) The amino acid sequence is the protein of SEQ ID No. 9;

B18) A protein with the same function after substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 9, or the amino acid sequence shown in SEQ ID No. 9 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The exogenous N-acetylglucosamine transferase I can be the following B19) or B20):

B19) The amino acid sequence is the protein of SEQ ID No. 10;

B20) The amino acid sequence shown in SEQ ID No. 10 has been substituted and/or deleted and/or added by one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 10 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The fusion protein composed of the galactose isomerase and the galactose transferase may be the following B21) or B22):

B21) The amino acid sequence is the protein of SEQ ID No. 11;

B22) The amino acid sequence shown in SEQ ID No. 11 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 11 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The mannosidase II can be the following B23) or B24):

B23) The amino acid sequence is the protein of SEQ ID No. 12;

B24) The amino acid sequence shown in SEQ ID No. 12 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 12 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The N-acetylglucosamine transferase II can be the following B25) or B26):

B25) The amino acid sequence is the protein of SEQ ID No. 13;

B26) The amino acid sequence shown in SEQ ID No. 13 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 13 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.

The gene encoding exogenous mannosidase I can be the following C1) or C2):

C1) The nucleotide sequence is the DNA molecule of SEQ ID No. 14;

C2) DNA that has more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 14 and encodes the exogenous mannosidase I A molecule, or a DNA molecule that hybridizes to a DNA molecule defined by C1) under stringent conditions and encodes the exogenous mannosidase I.

The encoding gene of the exogenous N-acetylglucosamine transferase I can be the following C3) or C4):

C3) The nucleotide sequence is the DNA molecule of SEQ ID No. 15;

C4) It has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 15 and encodes the exogenous N-acetylglucosamine transfer The DNA molecule of enzyme I, or the DNA molecule that hybridizes with the DNA molecule defined by C3) under stringent conditions and encodes the exogenous N-acetylglucosamine transferase I.

The coding gene of the fusion protein composed of the galactose isomerase and the galactose transferase may be the following C5) or C6):

C5) The nucleotide sequence is the DNA molecule of SEQ ID No. 16;

C6) DNA molecules that have more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 16, and encode the fusion protein, or Under stringent conditions, the DNA molecule hybridizes with the DNA molecule defined by C5) and encodes the fusion protein.

The mannosidase II coding gene can be the following C7) or C8):

C7) The nucleotide sequence is the DNA molecule of SEQ ID No. 17;

C8) A DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 17, and encodes the mannosidase II, Or under stringent conditions, it hybridizes with the DNA molecule defined by C7) and encodes the mannosidase II DNA molecule.

The N-acetylglucosamine transferase II coding gene can be the following C9) or C10):

C9) The nucleotide sequence is the DNA molecule of SEQ ID No. 18;

C10) It has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 18 and encodes the N-acetylglucosamine transferase II DNA molecules, or DNA molecules that hybridize with the DNA molecules defined by C9) under stringent conditions and encode the N-acetylglucosamine transferase II.

All relevant information about glycosyl-modifying enzymes of the present invention can be obtained from the National Center for Biotechnology Information (NCBI) or published documents, and the functions and definitions of related enzymes can also be obtained from the documents. Even if it is the same bacteria or species, due to different sources, the amino acids of various enzymes will be slightly different, but their functions are basically the same. Therefore, the enzymes of the present invention may also include these variants.

Further, the Pichia pastoris genetically modified through the glycosylation modification pathway is a strain with the deposit number CGMCC No. 19488 deposited in the General Microbiology Center of the China Microbial Species Collection and Management Committee.

In step (1), the recombinant yeast cell can introduce the coding gene of the coronavirus S protein receptor binding region (RBD) into the genetically modified Pichia pastoris through the glycosylation modification pathway After getting.

Further, the coding gene of the coronavirus S protein receptor binding region (RBD) is introduced into the Pichia pastoris genetically modified through the glycosylation modification pathway in the form of a recombinant vector.

In the present invention, the recombinant vector is specifically a recombinant vector obtained by cloning the coding gene of the coronavirus S protein receptor binding region (RBD) into a pPICZαA vector (such as restriction sites XhoI and NotI).

Wherein, the coronavirus S protein receptor binding domain (RBD) can be any of the following:

(a1) The protein shown in SEQ ID No. 21 (corresponding to RBD223) or its truncated body;

(a2) The protein shown in SEQ ID No. 22 (corresponding to RBD219) or its truncated body;

(a3) The protein shown in SEQ ID No. 23 (corresponding to RBD216) or its truncated body;

(a4) The protein shown in SEQ ID No. 24 (corresponding to RBD210) or its truncated body;

(a5) A protein with the same function after substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence defined in (a1)-(a4), or with (a1)- (a4) The amino acid sequence defined in any one of the proteins has 99% or more, 95% or more, 90% or more, 85% or more than 80% homology and has the same function.

Correspondingly, the coding gene of the coronavirus S protein receptor binding region (RBD) may be the one encoding the coronavirus S protein receptor binding region shown in any one of (a1) to (a5). DNA molecule.

Further, the coding gene of the coronavirus S protein receptor binding region (RBD) can be any of the following:

(b1) The DNA molecule shown in SEQ ID No. 25 (corresponding to RBD223);

(b2) The DNA molecule shown in SEQ ID No. 26 (corresponding to RBD219);

(b3) The DNA molecule shown in SEQ ID No. 27 (corresponding to RBD216);

(b4) The DNA molecule shown in SEQ ID No. 28 (corresponding to RBD210);

(b5) It has 99% or more, 95% or more, 90% or more, 85% or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 25 to SEQ ID No. 28 and encodes The DNA molecule of the coronavirus S protein receptor binding region (RBD) may hybridize with any of the DNA molecules shown in SEQ ID No. 25 to SEQ ID No. 28 under stringent conditions and encode the coronavirus S Protein receptor binding domain (RBD) DNA molecule.

Among them, the 4 amino acid sequences shown in SEQ ID No. 21 to SEQ ID No. 24 are all part of the S protein of the SARS-CoV-2 "Wuhan-Hu-1" isolate with GenBank number MN908947.3. Specifically, SEQ ID No. 21 is the R319-F541 region (RBD223) of the S protein; SEQ ID No. 22 is the R319-K537 region (RBD219) of the S protein; SEQ ID No. 23 is the R319-V534 region of the S protein (RBD216); SEQ ID No. 24 is the R319-K528 region of the S protein (RBD210).

The nucleotide sequences of SEQ ID No. 25 to SEQ ID No. 28 are obtained by codon optimization according to the amino acid sequences of SEQ ID No. 21 to SEQ ID No. 24, and DNA fragments of corresponding sequences are obtained by whole gene synthesis.

In the above-mentioned protein, homology refers to the identity of amino acid sequence. The homology search site on the Internet can be used to determine the identity of the amino acid sequence, such as the BLAST page of the NCBI homepage. For example, in advanced BLAST 2.1, by using blastp as the program, set the Expect value to 10, set all Filters to OFF, use BLOSUM62 as the Matrix, and set Gap existence cost, Per resistance gap cost and Lambda ratio to 11, 1 and 0.85 (default value) and perform a search for the identity of a pair of amino acid sequences to calculate, and then the identity value (%) can be obtained.

In the above-mentioned genes, homology refers to the identity of the nucleotide sequence. The homology search site on the Internet can be used to determine the identity of the nucleotide sequence, such as the BLAST page of the NCBI homepage. For example, in advanced BLAST 2.1, by using blastp as the program, set the Expect value to 10, set all Filters to OFF, use BLOSUM62 as the Matrix, and set Gap existence cost, Per resistance gap cost and Lambda ratio to 11, 1 and 0.85 (default value) and search for the identity of a pair of nucleotide sequences to calculate, and then the identity value (%) can be obtained.

In the above-mentioned proteins and genes, the homology of more than 95% can be at least 96%, 97%, or 98% identity. The homology of more than 90% can be at least 91%, 92%, 93%, 94% identity. The homology of more than 85% can be at least 86%, 87%, 88%, 89% identity. The above 80% homology can be at least 81%, 82%, 83%, 84% identity.

In the above gene, the stringent conditions can be as follows: 50°C, _{hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO 4} and 1 mM EDTA, at 50°C, 2×SSC, 0.1 Rinse in %SDS; it can also be: 50℃, _{hybridize in a mixed solution of 7% SDS, 0.5M NaPO 4} and 1mM EDTA, rinse in 50℃, 1×SSC, 0.1% SDS; it can also be: 50℃ , Hybridize in a mixed solution of 7% SDS, 0.5M NaPO ₄ and 1 mM EDTA, and rinse at 50°C, 0.5×SSC, 0.1% SDS; also: 50°C, in 7% SDS, 0.5M NaPO ₄ and Hybridize in a mixed solution of 1mM EDTA, rinse at 50℃, 0.1×SSC, 0.1% SDS; also: 50℃, _{hybridize in a mixed solution of 7% SDS, 0.5M NaPO 4} and 1mM EDTA, at 65℃ Rinse in 0.1×SSC, 0.1% SDS; also: in 6×SSC, 0.5% SDS solution, hybridize at 65℃, then use 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS Wash the membrane once each.

Further, in step (2), the N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform structure can be purified from the culture supernatant according to a method including the following steps: The culture supernatant is sequentially subjected to cation exchange chromatography, hydrophobic chromatography, G25 desalting, and anion exchange chromatography to obtain the N-sugar chain modified coronavirus S protein receptor binding region with a mammalian glycoform structure.

Further, in step (2), the mammalian glycoform structure N-sugar chain modified coronavirus S protein receptor binding region is purified from the culture supernatant according to a method including the following steps: The culture supernatant is passed through a CaptoMMC chromatography column to capture the target protein, and then eluted with a buffer containing 1M NaCl to obtain a crude sample containing the target protein; then the crude sample is purified by a hydrophobic chromatography column Phenyl HP , The elution peak sample containing the target protein is desalted with a G25 chromatography column, and then anion exchange chromatography column Source30Q is used to adsorb the impurity protein. The flow-through fluid is the target protein; the target protein is the Coronavirus S protein receptor binding region modified by N-sugar chain with mammalian glycoform structure.

In the second aspect, the present invention claims any of the following products:

D1) The coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification prepared by the method described in the first aspect above.

D2) The recombinant yeast cell prepared by step (1) in the method described in the first aspect above.

D3) A drug used to prevent and/or treat diseases caused by coronavirus infection, the active ingredient of which is D1) the mammalian glycoform structure N-sugar chain modified coronavirus S protein receptor binding region.

D4) A drug capable of inhibiting coronavirus, the active ingredient of which is D1) the N-sugar chain modified coronavirus S protein receptor binding domain with mammalian glycoform structure.

D5) Reagents or kits for diagnosing coronavirus infection, containing D1) the N-sugar chain modified coronavirus S protein receptor binding domain with mammalian glycoform structure.

D6) Coronavirus vaccine, the active ingredient of which is D1) Coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification;

Further, the coronavirus vaccine contains an antigen and an adjuvant; the antigen is D1) the N-sugar chain modified coronavirus S protein receptor binding region with a mammalian glycoform structure; the adjuvant may be aluminum Adjuvant.

In a specific embodiment of the present invention, the adjuvant is specifically aluminum hydroxide. The coronavirus vaccine is prepared by mixing the N-sugar chain-modified coronavirus S protein receptor binding region with the mammalian glycoform structure described in D1) and aluminum hydroxide in a mass ratio of 1:10.

D7) A product that can cause the production of specific antibodies against the coronavirus S protein receptor binding region in animals, the active ingredient of which is D1) The mammalian glycoform structure N-sugar chain modified coronavirus S protein receptor binds Area.

In the third aspect, the present invention claims any of the following applications:

D8) D2) Application of the recombinant yeast cell in preparing D1) the N-sugar chain modified coronavirus S protein receptor binding region with mammalian glycoform structure.

D9) D1) The N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform structure is prepared in D3) or D4) the drug, D5) the reagent or kit, D6) the Coronavirus vaccine or D7) application in the product.

In the fourth aspect, the present invention claims a method for preparing the drugs described in D3) or D4), the reagents or kits described in D5), the coronavirus vaccine described in D6), or the products described in D7). The above-mentioned coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification is used as a raw material for preparation.

In the above aspects, the coronaviruses are all SARS-CoV-2.

In a specific embodiment of the present invention, the coronavirus is specifically SARS-CoV-2

"Wuhan-Hu-1" isolate.

Preservation instructions

Latin name of strain: Pichia pastoris

Participating biological material: GJK30

Suggested classification name: Pichia pastoris

Depository institution: General Microbiology Center of China Microbial Culture Collection Management Committee

Abbreviation of depository institution: CGMCC

Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

Date of Preservation: March 18, 2020

The collection center registration number: CGMCC No. 19488

Description of the drawings

Figure 1 shows the identification of och1 gene in GJK01 strain and the result of glycoform analysis. A is the result of och1 gene identification. M stands for Marker; 1: GJK01 bacteria (och1 has been knocked out); 2: X33 bacteria (och1 has not been knocked out). B is the result of DSA-FACE glycotype analysis of the antibody expressed by GJK01 bacteria (knockout och1).

Figure 2 shows the results of pno1 gene identification. M stands for Marker; 1: GJK02 bacteria (pno1 has been knocked out); 2: X33 bacteria (pno1 has not been knocked out).

Figure 3 shows the results of mnn4b gene identification. M stands for Marker; 1: GJK03 bacteria (mnn4b has been knocked out); 2: X33 bacteria (mnn4b has not been knocked out).

Figure 4 shows the results of DSA-FACE glycoform analysis of GJK01, GJK02, and GJK03 strains (och1, pno1, mnn4b have been knocked out).

Figure 5 shows the results of ARM2 gene identification. M stands for Marker; 1: GJK04 bacteria (ARM2 has been knocked out); 2: X33 bacteria (ARM2 has not been knocked out).

Figure 6 shows the results of ARM1 gene identification. M stands for Marker; 1: GJK05 strain (ARM1 has been knocked out); 2: X33 strain (ARM1 has not been knocked out).

Figure 7 shows the results of ARM3 gene identification. M stands for Marker; 1: GJK07 bacteria (ARM3 has been knocked out); 2: X33 bacteria (ARM3 has not been knocked out).

Figure 8 shows the results of ARM4 gene identification. M stands for Marker; 1: GJK18 bacteria (ARM4 has been knocked out); 2: X33 bacteria (ARM4 has not been knocked out).

Figure 9 shows the results of DSA-FACE glycoform analysis of GJK18 bacteria.

Figure 10 shows the TrmdsI gene identification results and DSA-FACE glycotype analysis results of W10 bacteria. A is the result of TrmdsI gene identification. M stands for Marker; 1: TrmdsI is introduced into W10 strain; TrmdsI is not present in X33 strain. B is the result of DSA-FACE glycoform analysis of W10 bacteria.

Figure 11 shows the GnTI gene identification results and DSA-FACE glycotype analysis results of bacteria 1-8. A is the result of GnTI gene identification. M stands for Marker; 1: 1-8 bacteria introduced GnTI; 2: X33 bacteria have no GnTI. B is the result of DSA-FACE glycoform analysis of 1-8 bacteria.

Figure 12 shows the GalE-GalT gene identification results and DSA-FACE glycotype analysis results of 1-8-4 bacteria. GalE-GalT gene identification results. M stands for Marker; 1: GalE-GalT is introduced into bacteria 1-8-4; 2: GalE-GalT is not introduced into bacteria X33. B is the DSA-FACE glycoform analysis result of 1-8-4 bacteria.

Figure 13 shows the mdsII gene and GnTII gene identification results of 52-60 and 150L2 bacteria, and the results of DSA-FACE glycoform analysis. A is the result of MdsII gene identification. M stands for Marker; 1: MdsII is introduced in 52-60 bacteria; 2: MdsII is not in X33 bacteria. B is the result of GnTII gene identification. M stands for Marker; 1: GnTII is introduced in 150L2 bacteria; 2: GnTII is not in X33 bacteria. C is the result of DSA-FACE glycoform analysis of 52-60 bacteria.

Figure 14 shows the identification results of PMT1 insertion and inactivation genes. M stands for Marker; 1: X33 bacteria PMT1 is not inactivated; 2: GJK30 (PMT1 is inactivated).

Figure 15 shows the glycoform structure analysis results of GJK30 engineering bacteria. A is that the structure of Gal2GlcNAc2Man3GlcNAc2 in the early stage is less than 50%; B is that the structure of Gal2GlcNAc2Man3GlcNAc2 obtained by GJK30 engineering bacteria accounts for more than 60% of the glycoform; C is the glycosidase analysis of the glycoform by glycosidase (New England Biolabs, Beijing).

Figure 16 is a WB verification image of CGMCC19488/pPICZα-SARS2 S-RBD (RBD223) positive clone screening. The upper part is SDS-PAGE electrophoresis analysis, and the lower part is Western Blotting analysis; lanes 1-7 are different expression clones.

Figure 17 shows the electrophoresis detection diagram of CGMCC19488/pPICZα-S-RBD (RBD223) at different induction times.

Figure 18 is an SDS-PAGE chart of SARS-CoV-2 S-RBD (RBD223) purified sample.

Figure 19 is a WB comparison diagram of CGMCC19488/pPICZα-S-RBD (RBD223) and X33/pPICZα-S-RBD (RBD223) expressing RBD (RBD223) glycoprotein. The upper part is SDS-PAGE electrophoresis analysis, and the lower part is Western Blotting analysis; 1-3 are 3 different X33/pPICZα-S-RBD clones.

Figure 20 shows the electrophoresis diagram of SARS-CoV-2 S-RBD (RBD223) digested by PNGF and Endo H.

Figure 21 is the DSA-FACE sugar chain analysis result of SARS-CoV-2 S-RBD (RBD223) glycoprotein expressed by CGMCC19488.

Figure 22 shows the mouse serum anti-RBD antibody titer (RBD223 glycoprotein) 14 days after the second immunization.

Figure 23 shows the results of virus neutralization test (RBD223 glycoprotein).

Figure 24 is an SDS-PAGE analysis of SARS-CoV-2 S-RBD (RBD210, RBD216, RBD219, and RBD223) expressed by CGMCC19488.

Figure 25 shows the glycotype analysis results of SARS-CoV-2 S-RBD (RBD210, RBD216 and RBD219) glycoproteins expressed by CGMCC19488.

Figure 26 shows mouse serum anti-RBD antibody titers (RBD210, RBD216, RBD219 and RBD223 glycoprotein) 14 days after the second immunization.

Figure 27 shows the results of virus neutralization test (RBD210, RBD216, RBD219 and RBD223 glycoprotein).

The best way to implement the invention

The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples, unless otherwise specified, are all purchased from conventional biochemical reagent stores. The quantitative experiments in the following examples are all set to repeat the experiment three times, and the results are averaged.

Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used to implement the present invention, which is obvious to those skilled in the art. All publications and other references mentioned in this article are incorporated in their full text by citation. In case of inconsistency, the specification, including definitions, shall prevail. The materials, methods and examples are only illustrative and not restrictive.

pPICZαA, pYES2 vector, X33, GS115 Pichia pastoris are products of Invitrogen.

Pichia pastoris GJK01CGMCC No. 1853 (in the invention patent ZL200610164912.8, the publication number is CN101195809, which is Pichia pastoris with inactivated α-1,6-mannose transferase).

The Pyrobest enzyme, LA Taq enzyme, dNTPs, restriction enzymes, T4 ligase, etc. used in the experiment were purchased from Dalian Bao Bioengineering Co., Ltd., and the pfu enzyme, kit, and DH5α competent cells were from Beijing Quanshijin Co., Ltd. product. Whole gene synthesis, nucleotide synthesis, primer synthesis, sequencing, etc. are provided by Shanghai Shenggong Biological Engineering Technology Service Co., Ltd.

SARS-CoV-2 (2019-nCoV) Spike RBD-Fc Recombinant Protein (40592-V02H) is a product of Beijing Yiqiao Shenzhou Biotechnology Co., Ltd.; goat anti-rabbit IgG secondary antibody (SAB3700885) is a product of Sigma; goat anti-mouse IgG The secondary antibody (ab205719) is a product of abcam; BglII restriction endonuclease is a product of NEB; PNGaseF (P0708) and Endo H (P0702) are products of NEB.

The Capto MMC chromatography media, Phenyl HP, G25, and Source30Q used in the experiment were all purchased from GE Healthcare.

The sequence information of the related modified enzymes involved in the following examples is shown in Table 1.

Table 1 Related modified enzymes involved in the present invention

Example 1. Construction of Pichia pastoris genetically modified through glycosylation modification pathway

1. Construction of yeast strain with inactivated phosphomannose transferase gene

The basic strain used in the present invention is the GJK01 strain constructed by us in the previous period, the preservation number is CGMCC No. 1853, and the strain authorized patent number is ZL200610164912.8. The strain is a Pichia strain inactivated by α-1,6-mannosyltransferase. The amino acid sequence of α-1,6-mannose transferase (OCH1) is shown in SEQ ID No. 1.

The yeast strain GJK02 with inactivated phosphomannose transferase gene was obtained by knocking out part of the DNA molecule encoding the phosphomannose transferase shown in SEQ ID No. 2 in Pichia pastoris GJK01, that is, knocking out the phosphate in the GJK01 yeast genome Mannose transferase gene, obtained from recombinant yeast.

1. Construction of inactivation vector of phosphomannose transferase gene

The knockout plasmid pYES2-pno1 used to knock out the mannose transferase (PNO1) gene is to insert the gene fragment (SEQ ID No.20) corresponding to the mannose transferase (PNO1) into the KpnI and XbaI restriction sites of the vector pYES2 The vector obtained in time. Wherein SEQ ID No. 20 is from the 5'end of nucleotides 7-1006, the upstream homology arm of the knockout mannose transferase (PNO1) gene fragment; SEQ ID No. 20 is from the 5'end of 1015 to 2017 The nucleotide is the downstream homology arm of the knock-out mannose transferase (PNO1) gene fragment.

details as follows:

The genomic DNA of Pichia pastoris X33 was extracted by the glass bead preparation method (A. Adams et al., "Yeast Genetics Method Experimental Guide", Science Press, 2000), and the genomic DNA was used as a template to amplify mannose transferase (PNO1) The homology arms on both sides of the gene and the homology arms on both sides of PNO1 are about 1 kb respectively, and about 1.4 kb of the coding gene is deleted in the middle.

The primers used to amplify the homology arm (PNO1 5'homology arm) of the upstream flanking region of pno1 are PNO-5-5 and PNO-5-3, and the primer sequences are:

5'-AGT GGTACC GCAGTTTAATCATAGCCCACTGC-3' (SEQ ID No. 29, the underlined part is the Kpn I recognition site);

5'-ATTCCAATACCAAGAAAGTAAAGT gcggccgc AAGTGGAACTGGCGCACCGGT-3' (SEQ ID No. 30, the underlined part is the Not I recognition site).

The primers used to amplify the homology arm (PNO13' homology arm) in the downstream flanking region of PNO1 are PNO-3-5 and PNO-3-3, and the primer sequences are:

5'-ACCGGTGCGCCAGTTCCACTT gcggccgc ACTTTACTTTCTTGGTATTGGAAT-3' (SEQ ID No. 31, the underlined part is the Not I recognition site);

5'-TGT TCTAGA TCCGAGATTTTGCGCTATGGAGC-3' (SEQ ID No. 32, the underlined part is the Xba I recognition site).

The PCR amplification conditions for the two homology arms are as follows: after denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 94°C for 30sec, 55°C renaturation for 30sec, 72°C extension for 1min30sec, and finally 72°C for 10min; the target fragment size is 1kb about. The PCR product was purified and recovered with a PCR product recovery and purification kit (purchased from Dingguo Biotechnology Co., Ltd., Beijing). Use overlap extension PCR method to fuse PNO1 5'homology arm and 3'homology arm (see J. Sambrook et al., "Molecular Cloning Experiment Guide" Second Edition, Science Press, 1995), using PNO1 5'homology The PCR products of the source arm and the 3'homology arm were used as templates, and PNO-5-5/PNO-3-3 was used as primers. The PCR amplification conditions were as follows: after denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute and renaturation at 55°C Extend at 72°C for 1min for 3min30sec for 30 cycles, and finally extend at 72°C for 10min; the size of the target fragment is about 2kb. The PCR product is purified and recovered with a PCR product recovery and purification kit.

Kpn I/Xba I double enzyme digestion (the restriction enzymes used in this experiment are from Bao Bioengineering Co., Ltd., Dalian) PCR product, the product after digestion is inserted into the vector pYES2 (Invitrogen Corp.USA) treated with the same double enzyme digestion In, T4 ligase was ligated overnight at 16°C, transformed into Escherichia coli DH5α, and positive clones were screened on LB plates containing ampicillin (100 μg/ml). The plasmid of the positive clone was identified by Kpn I/Xba I double enzyme digestion, and the recombinant vector with fragments of about 4200bp and about 2000bp was named pYES2-pno1, which is a knockout plasmid for knocking out the mannose transferase (PNO1) gene. The upstream and downstream homology arms of the pno1 gene were verified by final sequencing to be correct.

2. Transformation of Pichia pastoris by knockout plasmid

The knockout plasmid pYES2-pno1 was transformed into Pichia pastoris GJK01 (documented in the invention patent ZL200610164912.8, publication number CN101195809) by electrotransformation. The electrotransformation method is well known in the art (such as A. Adams et al. , "Yeast Genetics Method Experimental Guide", Science Press, 2000). Before electrotransformation, linearize the knock-out plasmid with the BamH I restriction site upstream of the 5'homology arm, then electrotransform it into the prepared competent cells, and spread it on MD containing arginine and histidine. Medium (YNB1.34g/100mL, biotin 4×10 ^-5 g/100mL, glucose 2g/100mL, agar 1.5g/100mL, arginine 100mg/ml, histidine 100mg/ml). After the clones are grown on the medium, several clones are randomly selected to extract the genome, and the PCR method is used to identify whether the knockout plasmid is correctly integrated into the target site on the chromosome. The two pairs of primers used in the PCR reaction are: PNO1 gene 5 The primer sequence outside the homology arm PNO-5-5OUT: 5'-GCAGTTTAATCATAGCCCACTGCTA-3' (SEQ ID No. 33) and the primer sequence on the carrier inner01: 5'-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID No. 34) . The enzyme used in the PCR reaction is rTaq (Bao Biological Engineering Co., Ltd.), and the PCR amplification conditions are as follows: after denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 94°C for 30sec, renaturation at 55°C for 30sec, and extension at 72°C for 3 minutes, and finally 72 Extend for 10 minutes. The size of the PCR product band was analyzed by gel electrophoresis, and the band amplified by the primer was about 2.3kb as a positive clone.

3. PCR identification of positive engineering strains

Inoculate one of the positive clones in YPD medium (10g/L yeast extract, 20g/L peptone, 20g/L glucose), culture in a shaker at 25°C for 12 hours, and spread the bacterial solution on the adenine-deficient 5 -FOA medium (YNB 1.34g/100mL, biotin 4×10-5g/100mL, glucose 2g/100mL, agar 1.5g/100mL, arginine 100mg/ml, histidine 100mg/ml, uracil 100mg/ ml, 5-FOA 0.1%) (Among them, YNB, is a non-amino acid yeast nitrogen source, is a product of Beijing Xinjingke Biotechnology Co., Ltd., and 5-FOA is 5-fluorouracil, from Sigma-aldrich POBOX14508, St. Louis , MO63178USA), cultured at 25°C.

After the clones grow on the 5-FOA medium, extract the genomes of these clones and perform PCR identification: use the genome as a template to identify the primers as the sequences PNO1-ORF01 and PNO1-ORF02 outside the homology arm of the pno1 gene on the chromosome, and the primer sequence They are:

PNO1-ORF01: 5′-GGGAAAGAAAACCTTCAATTT-3′ (SEQ ID No. 35);

PNO1-ORF02: 5'-TACAAGCCAGTTTCGCAATAA-3' (SEQ ID No. 36).

At the same time, a PCR reaction system using the genome of wild-type X33 strain (Invitrogen) as a template was set as a control. The enzyme used in the PCR reaction is LA Taq (Bao Biological Engineering Co., Ltd.), and the PCR amplification conditions are as follows: after denaturation at 94°C for 5 minutes, denaturation at 94°C for 30sec, renaturation at 55°C for 30sec, and extension at 72°C for 30 cycles, and finally 72 extended for 10 minutes.

In order to identify whether the α-1,6-mannose transferase is knocked out, the present invention introduces a reporter protein after obtaining the GJK01 engineered bacteria. The present invention uses anti-Her2 antibody as the reporter protein. The vector transformation method has been disclosed in the patent application (publication number: CN101748145A). Using this method, the anti-Her2 antibody expression vector was transferred to the GJK01 host strain, and the GJK01-HL engineered strain expressing the anti-Her2 antibody was obtained. The DSA-FACE glycoform analysis method has been publicly reported in the article "Liu Bo et al. A method for analyzing oligosaccharide chains using DSA-FACE. Biotechnology Communications. 2008.19(6).885-888".

The product was subjected to agarose gel electrophoresis. Fig. 1 A is the identification result of GJK01 host strain; Fig. 1 B is the DSA-FACE glycotype analysis result of GJK01-HL strain (knockout och1). In Figure 2, lane 1 is PON1 deficient, and lane 2 is wild-type; the size of the PCR product using wild-type X33 strain genome as template is about 490bp, and the PON1 deficient engineered bacteria has no amplified band, which also proves the loss of PNO1 gene , The phosphomannose transferase knockout strain was constructed correctly and named GJK02, which is a recombinant Pichia pastoris with phosphomannose transferase knockout.

2. Construction of yeast strain with inactivated mannose phosphate synthase gene

The yeast strain GJK03 with inactivated mannose phosphate synthase gene was obtained by knocking out part of the DNA molecule encoding the mannose phosphate synthase shown in SEQ ID No. 3 in Pichia pastoris GJK02, that is, knocking out the phosphate in the GJK02 yeast genome Mannose synthetase gene, the recombinant yeast obtained; that is, the yeast α-1,6-mannose transferase, phosphomannose phosphate transferase and phosphomannose phosphate synthase are inactivated.

The method of constructing the vector is the same as step one.

1. Construction of inactivation vector of mannose phosphate synthase gene

The knockout plasmid pYES2-MNN4B used to knock out the phosphomannose synthase gene is to insert the upstream and downstream homology arms of the gene fragment to be knocked out corresponding to the phosphomannose synthase into the Stu I and Spe I digestion positions of the vector pYES2 The vector obtained between the points.

Using the same method as the above one, the genomic DNA of Pichia pastoris X33 was extracted by glass bead preparation, and the genomic DNA was used as a template to amplify the knock-out mannose synthase (MNN4B) gene fragment. The homology arms on both sides of MNN4B were approximately approximately It is 1 kb, and about 1 kb of the coding gene is deleted in the middle.

The primers used to amplify the homology arm (ARM25' homology arm) of the upstream flanking region of MNN4B are MNN4B-5-5 and MNN4B-5-3, and the primer sequences are:

5'-AGT AGGCCT TTCAACGAGTGACCAATGTAGA-3' (SEQ ID No. 37, the underlined part is the Stu I recognition site);

5'-TATCTCCATAGTTTCTAAGCAGG GCGGCCGC AATATGTGCGGTGTAGGGAGAAA-3' (SEQ ID No. 38, the underlined part is the Not I recognition site).

The primers used to amplify the homology arm (MNN4B 3'homology arm) of the downstream flanking region of MNN4B are MNN4B-3-5 and MNN4B-3-3, and the primer sequences are:

5'-TTTCTCCCTACACCGCACATATT GCGGCCGC CCTGCTTAGAAACTATGGAGATA-3' (SEQ ID No. 39, the underlined part is the Not I recognition site);

5'-TGT ACTAGT TGAAGACGTCCCCTTTGAACA-3' (SEQ ID No. 40, the underlined part is the Spe I recognition site).

The PCR amplification conditions, recovery methods, and enzyme digestion methods of the two homology arms are the same as in step 1. The pYES2-MNN4B knockout vector was finally constructed and verified by final sequencing.

2. Transformation of Pichia pastoris by knockout plasmid

Knockout plasmid is transformed into the Pichia pastoris engineering strain GJK02 constructed by the electrotransformation method. The electrotransformation method and identification method are the same as step 1.

The two pairs of primers used in the PCR reaction are: the primer sequence outside the 5'homology arm of the mnn4b gene: MNN4B-5-5OUT: 5'-TAGTCCAAGTACGAAACGACACTA-3' (SEQ ID No. 41) and the primer sequence inner01: 5 on the vector '-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID No. 34), the band amplified by the primer is a positive clone of about 2kb.

3. PCR identification of positive engineering strains

After inoculating one of the positive clones on 5-FOA medium (the formula is the same as before) to grow clones, extract the genomes of these clones and perform PCR identification: use the genome as a template to identify the primers outside the homology arm of the mnn4b gene on the chromosome Sequence MNN4B-ORF01 and MNN4B-ORF02, primer sequence:

MNN4B-ORF01: 5'-AAAACTATCCAATGAGGGTCTC-3' (SEQ ID No. 42);

MNN4B-ORF02: 5'-TCTTCAATGTCTTTAACGGTGT-3' (SEQ ID No. 43).

The positive cloned genomic DNA was used as a template, and the primers MNN4B-ORF01 and MNN4B-ORF02 were used for PCR amplification. The results are shown in Figure 3. Lane 1 is MNN4B-deficient, and lane 2 is wild-type; the PCR product with wild-type X33 strain genome as template is about 912bp, and the MNN4-deficient engineered bacteria has no amplified band, which also proves The knockout of mannose phosphate synthase, named GJK03, is a recombinant Pichia pastoris knocked out of mannose phosphate transferase and mannose phosphate synthase.

The DSA-FACE glycoform analysis results of GJK02 and GJK03 (och1, pno1, mnn4b have been knocked out) (the method is the same as that described in Example 1) are shown in Figure 4. It can be seen that the phosphoric acid in the glycoform after pno1, mnn4b is knocked out The mannose is partially removed.

3. Construction of yeast strain with inactivated β-mannose transferase gene ARM2

The yeast strain GJK04 in which phosphomannose transferase, phosphate mannose synthase and β mannose transferase ARM2 (i.e. β mannose transferase II) genes are inactivated is the β mannose shown in Pichia pastoris GJK03 encoding SEQ ID No.5 The DNA molecule of glycotransferase ARM2 was partially knocked out, that is, the β-mannose transferase ARM2 gene in the GJK03 yeast genome was knocked out to obtain recombinant yeast; that is, the α-1,6-mannose transferase in the yeast genome, The phosphomannose phosphate transferase gene, phosphomannose phosphate synthase gene and β mannose transferase ARM2 have been inactivated.

1. Construction of β-mannose transferase ARM2 gene inactivation vector

The vector construction method is the same as step 1, and the details are as follows:

Using the same method as the above one, the genomic DNA of Pichia pastoris X33 was extracted by glass bead preparation, and the genomic DNA was used as a template to amplify the homology arms on both sides of the β-mannose transferase (ARM2) gene. The source arms were about 0.6 kb respectively, and about 0.6 kb of coding gene was deleted in the middle.

The primers used to amplify the homology arm (ARM2 5'homology arm) of the upstream flanking region of ARM2 are ARM2-5-5 and ARM2-5-3, and the primer sequences are:

5'-ActT GGTACC ACACGACTCAACTTCCTGCTGCTC-3' (SEQ ID No. 44, the underlined part is the Kpn I recognition site);

5'-act GCGGCCGC CACGAAACTTCTTACCTTTGACAA-3' (SEQ ID No. 45, the underlined part is the Not I recognition site).

The primers used to amplify the homology arms (ARM23' homology arms) in the downstream flanking region of ARM2 are ARM2-3-5 and ARM2-3-3, and the primer sequences are as follows:

5'-TTGTCAAAGGTAAGAAGTTTCGT GGCGGCCGC TATCTTGACATTGTCATTCAGTGA-3' (SEQ ID No. 46, the underlined part is the Not I recognition site);

5'-caa TCTAGA GCCTCCTTCTTTTCCGCCT-3' (SEQ ID No. 47, the underlined part is the Xba I recognition site).

2. Transformation of Pichia pastoris by knockout plasmid

Knockout plasmids are transformed into the Pichia engineering strain GJK03 constructed in the above-mentioned construction by the electro-transformation method, and the electro-transformation method and identification method are the same as those in the above-mentioned one.

The two pairs of primers used in the PCR reaction are: the primer sequence ARM2-5-5OUT outside the 5'homology arm of the ARM2 gene: 5'-TTTTCCTCAAGCCTTCAAAGACAG-3' (SEQ ID No. 48) and the primer sequence inner01: 5 on the vector '-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID No. 34), the band amplified by the primer is a positive clone of about 0.8kb.

3. PCR identification of positive engineering strains

After inoculating one of the positive clones on 5-FOA medium (the formula is the same as before) to grow clones, extract the genomes of these clones and perform PCR identification: use the genome as a template to identify the primers outside the homology arm of the ARM2 gene on the chromosome Sequence Arm-ORF01 and Arm-ORF02, primer sequence:

Arm2-ORF-09: 5'-gggcagaagatcctagag-3' (SEQ ID No.49);

Arm2-ORF-10: 5'-tcgtctccattgctatctacgact-3' (SEQ ID No. 50).

Using the positive cloned genomic DNA as a template, PCR amplification was performed with primers Arm2-ORF-09 and Arm2-ORF-10. The results are shown in Figure 5. Lane 1 is ARM2-deficient, and Lane 2 is wild-type; the result is wild-type The PCR product size of the X33 strain genome as a template is about 600bp, and the ARM2-deficient engineered bacteria has no amplified bands. It also proves that the β-mannose transferase (ARM2) knocked out, named GJK04, is a phosphomannose transferase, Recombinant Pichia pastoris with knockout of mannose phosphate synthase and β-mannose transferase II (ARM2) genes.

4. Construction of yeast strains with inactivated β-mannose transferase ARM1, ARM3, and ARM4 genes

According to the above steps 1 to 3, the design method and construction process of the yeast strain constructed with the β-mannose transferase gene ARM2 inactivated, on the basis of the GJK04 engineered bacteria, the β-mannose transferase ARM1, ARM3, ARM4 (ie β Mannosyltransferases I, III and IV, with amino acid sequences of SEQ ID No. 4, SEQ ID No. 6, and SEQ ID No. 7), were constructed to obtain GJK05, GJK07, and GJK18 engineering strains, respectively.

1. Construction of β-mannose transferase ARM1, ARM3, ARM4 gene inactivation vector

The vector construction method is the same as step three, the differences are:

The primers used to amplify the homology arm (ARM1 5'homology arm) of the upstream flanking region of ARM1 are ARM1-5-5 and ARM1-5-3, and the primer sequences are:

ARM1-5-5: 5'-TCA ACGCGT TGGCTCTGGATCGTTCTAATA-3' (SEQ ID No. 51, the underlined part is the recognition site of MluI);

ARM1-5-3:

5'-ttctccgttctcctttctccgt GCGGCCGC cagcagcaaggaagataccaa-3' (SEQ ID No. 52, the underlined part is the NotI recognition site).

The primers used to amplify the homology arm (ARM1 3'homology arm) of the downstream flanking region of ARM1 are ARM1-3-5 and ARM1-3-3, and the primer sequences are:

ARM1-3-5: 5'-ttggtatcttccttgctgctg GCGGCCGC acggagaaaggagaacggagaa-3' (SEQ ID No. 53, underlined part is NotI recognition site);

ARM1-3-3: 5'-TCA ACGCGT TGGCTGGAGGTGACAGAGGAA-3' (SEQ ID No. 54, underlined part is MluI recognition site).

The primers used to amplify the homology arm (ARM3 5'homology arm) of the upstream flanking region of ARM3 are ARM3-5-5 and ARM3-5-3, and the primer sequences are:

ARM3-5-5: 5'-TCAACGCGTTAGTAGTGCCGTGCCAAGTAGCG-3' (SEQ ID No. 55, the underlined part is the MluI recognition site);

ARM3-5-3: 5'-tcctactttgcttatcatctgcc GCGGCCGC ggtcaggccctcttatggttgtg-3' (SEQ ID No. 56, underlined part is NotI recognition site).

The primers used to amplify the homology arm (ARM3 3'homology arm) of the downstream flanking region of ARM3 are ARM3-3-5 and ARM3-3-3, and the primer sequences are:

ARM3-3-5: 5'-cacaaccataagagggcctgacc GCGGCCGC ggcagatgataagcaaagtagga-3' (SEQ ID No. 57, the underlined part is the NotI recognition site);

ARM3-3-3: 5'-TCA ACGCGT CATAGGTAATGGCACAGGGATAG-3' (SEQ ID No. 58, underlined part is MluI recognition site).

The primers used to amplify the homology arm (ARM4 5'homology arm) of the upstream flanking region of ARM4 are ARM4-5-5 and ARM4-5-3, and the primer sequences are:

ARM4-5-5: 5'-TCA ACGCGT GCAGCGTTTACGAATAGTGTCC-3' (SEQ ID No. 59, the underlined part is the recognition site of MluI);

ARM4-5-3: 5'-gcatagggctgaagcatactgt GCGGCCGC aatgatatgtacgttcccaaga-3' (SEQ ID No. 60, the underlined part is the NotI recognition site).

The primers used to amplify the homology arm (ARM4 3'homology arm) of the downstream flanking region of ARM4 are ARM4-3-5 and ARM4-3-3, and the primer sequences are:

ARM4-3-5:

5'-tcttgggaacgtacatatcatt GCGGCCGC acagtatgcttcagccctatgc-3' (SEQ ID No. 61, the underlined part is the NotI recognition site);

ARM4-3-3: 5'-TCA ACGCGT GAGGTGGACAAGAGTTCAACAAAG-3' (SEQ ID No. 62, the underlined part is the recognition site of MluI).

2. Transformation of Pichia pastoris by knockout plasmid

Same as step 3, the difference is that the two pairs of primers used in the PCR reaction are:

The primer sequence outside the 5'homology arm of the ARM1 gene ARM1-5-5OUT: 5'-GTTCTGGTATGCGTTCTATTCTTC-3' (SEQ ID No. 63) and the primer sequence on the vector inner01: 5'-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID No) .34), the band amplified by the primers is about 3.5kb as a positive clone.

The primer sequence outside the 5'homology arm of the ARM3 gene ARM3-5-5OUT: 5'-TATTTGCCTTCTTCACCGT TAT-3' (SEQ ID No. 64) and the primer sequence on the vector inner01: 5'-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID No. 34), the band amplified by the primer is about 3.7kb as a positive clone.

The primer sequence outside the 5'homology arm of the ARM4 gene ARM4-5-5OUT: 5'-TCCGTTGAGGGTGCTAAT GGTA-3' (SEQ ID No. 65) and the primer sequence on the vector inner01: 5'-AGCGTCGATTTTTGTGATGCTCGTCA-3' (SEQ ID) No. 34), the band amplified by the primer is about 3.7kb as a positive clone.

3. PCR identification of positive engineering strains

Same as step 3, the difference is that the following primers are used to identify the engineered bacteria, and it can be found that the gene has been knocked out (Figure 6, Figure 7 and Figure 8):

Arm1-ORF-09: 5'-TAGTCTGGTTTGCGGTAGTGT-3' (SEQ ID No.66);

Arm1-ORF-10: 5'-AGATTGAGCATAGGAGTGGC-3' (SEQ ID No. 67).

Arm3-ORF-09: 5'-AAACGGAGTCCAGTTCTTCT-3' (SEQ ID No. 68);

Arm3-ORF-10: 5'-CAACTTTGCCTGTCATTTCC-3' (SEQ ID No. 69).

Arm4-ORF-09: 5'-CGCTTCAGTTCACGGACATA-3' (SEQ ID No. 70);

Arm4-ORF-10: 5'-GCAACCCAGACCTCCTTACC-3' (SEQ ID No. 71).

The results of DSA-FACE glycoform analysis of GJK18 bacteria are shown in Fig. 9. Because the modification of β-mannose is only added to individual ends of mannose, although the results of glycoform analysis did not change substantially, β-mannose is a potential sugar that causes immunogenicity. Therefore, for the source of drugs used in humans, There is a potential risk. The present invention inactivates all β mannose, so the problem of β mannose is fundamentally solved, and the glycoform structure is not changed.

5. Construction of glyco-engineered yeast strain with mammalian Man5GlcNAc2 and non-fucose glycosylation structure

First of all, in order to identify whether exogenous mannosidase I (MDSI) plays a role correctly, the present invention introduces a reporter protein into the GJK18 engineered bacteria in advance. The present invention uses anti-Her2 antibody as the reporter protein, so an anti-Her2 antibody is constructed. Expression vector. The vector construction method and vector transformation method have been disclosed in the patent application (publication number: CN101748145A). Using this method, the anti-Her2 antibody expression vector was transferred to the GJK18 host strain, and the W2 engineered strain expressing the anti-Her2 antibody was obtained.

Secondly, the glyco-engineered yeast strain W10 with mammalian Man5GlcNAc2 and no fucosylation structure is MDSI (TrmdsI) with the C-terminal fusion HDEL sequence. The nucleotide sequence is shown in SEQ ID No. 14, which encodes SEQ ID No. The MDSI protein shown in .9) is inserted into the genome of the host strain W2 to obtain an engineered strain.

1. Construction of exogenous mannosidase I (MDSI) expression vector

The recombinant vector pPIC9-TrmdsI for expressing exogenous mannosidase I is a recombinant vector obtained by inserting the DNA molecule shown in SEQ ID No. 14 between the Xho I and EcoR I restriction sites of the pPIC9 vector.

Among them, the nucleotides 1-1524 from the 5'end of SEQ ID No. 14 are the optimized mannosidase I coding gene, and the nucleotides 1525 to 1536 from the 5'end are the endoplasmic reticulum retention signal—— HDEL encoding gene.

(1) Mannosidase I (MDSI) gene

Exogenous mannosidase I can be mannosidase I derived from filamentous fungi, plants, insects, Java, mammals, etc. In this example, mannosidase I of Trichoderma viride (Zhan Jie. Trichoderma viride α- Cloning, expression and activity identification of 1,2-mannosidase in Pichia pastoris [Degree Theory Master's Article].), and the endoplasmic reticulum retention signal-HDEL was fused to the C-terminus of mannosidase I.

According to Zhan Jie. The cloning expression and activity identification of Trichoderma viride α-1,2-mannosidase in Pichia pastoris [Degree Theory Master's Article]. The published sequence of Mannosidase I of Trichoderma viride, according to the yeast preference code The principle of high expression of genes and genes optimizes the coding gene, and the HDEL sequence is fused at the C-terminal to obtain the gene fragment (SEQ ID No. 14).

(2) Design and synthesize the following primers:

TrmdsI-5: 5'-TCT CTCGAG AAAAGAGAGGCTGAAGCTTATCCAAAGCCGGGCGCCA C-3' (SEQ ID No. 72); the underlined sequence is the Xho I restriction recognition site.

TrmdsI-3: 5'-AGG GAATTC TTACAACTCGTCGTGAGCAAGGTGGCCGCCCCGTCGTG ATG-3' (SEQ ID No. 73); the underlined sequence is the EcoR I restriction recognition site.

(3) Using the gene fragment obtained in (1) above as a template, using TrmdsI-5 and TrmdsI-3 as primers, PCR amplification is performed to obtain a PCR amplification product, named TrmdsI, which contains SEQ ID No.14.

(4) Xho I and EcoR I double digestion of the PCR product obtained in (3) above to obtain gene fragments; Xho I and EcoR I double digestion of pPIC9 vector to obtain a large vector fragment; connect the gene fragment to the large vector fragment to obtain a recombination Plasmid, named pPIC9-TrmdsI. Sequencing pPIC9-TrmdsI, the result is correct.

2. Construction of recombinant yeast expressing exogenous mannosidase I

About 10 μg of pPIC9-TrmdsI plasmid was linearized with Sal I, and the linearized plasmid was precipitated with 1/10 volume of 3M sodium acetate and 3 times volume of absolute alcohol. Wash twice with a 70% ethanol aqueous solution by volume to remove the salt therein, dry, and add about 30 μL of water to resuspend the precipitate to obtain the pPIC9-TrmdsI linearized plasmid for transformation.

For the method of preparing yeast electrotransformation competent cells in the following steps, refer to the relevant manuals of Invitrogen and "Molecular Cloning, A Laboratory Manual (Fourth Edition)", 2012 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. The selected host strain is the W2 engineered strain constructed above.

details as follows:

Pichia pastoris W2 was isolated on a YPD plate (yeast extract 10g/L, tryptone 20g/L, glucose 20g/L, agar 15g/L) by streaking and cultured in a 28°C incubator for 2 days. Inoculate a single clone into a 50mL Erlenmeyer flask containing 10mL YPD liquid medium (yeast extract 10g/L, tryptone 20g/L, glucose 20g/L), and incubate at 28°C overnight until the OD ₆₀₀ is about 2. Bacteria. Then inoculate 0.1-0.5mL bacterial solution into a 3.5L shake flask containing 500mL YPD liquid medium, and cultivate overnight until OD _{600 is} between 1.3-1.5. Transfer the bacterial solution to a sterile centrifuge bottle and centrifuge at 1500g for 10 minutes at 4°C. The cells were resuspended in 500 mL of pre-cooled sterile water, centrifuged at 1500 g for 10 minutes at 4° C. to harvest the cells, and washed again with 250 mL of pre-cooled sterile water. The cells were resuspended in 20 mL of pre-cooled sterile 1M sorbitol, and the cells were harvested by centrifugation at 1500 g for 10 minutes at 4°C, and the cells were resuspended in pre-cooled 1M sorbitol to a final volume of 1.5 mL to obtain a bacterial suspension.

Take 80 μL of bacterial suspension and 10 μL of the pPIC9-TrmdsI linearized plasmid used for transformation, mix them in a microcentrifuge tube to obtain a mixture, place it on ice for 5 minutes, transfer the mixture to an ice-cold 0.2 cm electrorotor. Puncture the cells (Bio-Rad Gene Pulser, 2000V, 25μF, 200Ω), and immediately add 1 mL of ice-cold 1M sorbitol to the electro-rotor cup, and carefully transfer the mixture (transformed cells) to a 15 mL culture tube.

Incubate the culture tube in a 28°C incubator for 1 hour without shaking. Then add 1mL YPD liquid medium and incubate in a shaker at 28°C and 250rpm for 3h. Take 200 μL of transformed cells and spread them on a plate containing MD (1.34g/100ml YNB, 4×10 ^-5 g/100ml Biotin, 2g/100ml glucose). Incubate in a 28°C incubator for 2-5 days, until a single colony is formed, namely W2-Tr, named W10.

The genomic DNA of W10 was extracted by the glass bead preparation method. The genomic DNA was used as a template, and TrMDSI-1.3kb-01 and TrMDSI-1.3kb-02 were used as primers to carry out PCR amplification, and the PCR amplification product was about 1.3kb, which proved MDSI It has been inserted into the genome and is a positive engineered bacteria (A in Figure 10).

TrMDSI-1.3kb-01: 5’-GAACACGATCCTTCAGTATGTA-3’ (SEQ ID No. 74);

TrMDSI-1.3kb-02: 5'-TGATGATGAACGGATGCTAAAG-3' (SEQ ID No. 75).

The DSA-FACE glycoform analysis result of W10 bacteria (the method is the same as that described in Example 1) is shown in Figure 10 B. It can be seen that the glycoform structure of the protein expressed by W10 bacteria is Man5GlcNAc2, Man6GlcNAc2 after being transformed into TrmdsI. Mainly Man5GlcNAc2.

6. Construction of glyco-engineered yeast strain with mammalian GlcNAcMan5GlcNAc2 and no fucosylation structure

Glyco-engineered yeast strains 1-8 with mammalian GlcNAcMan5GlcNAc2 and no fucose glycosylation structure are N-acetylglucosamine transferase I (GnTI) containing mnn9 localization signal (nucleotide sequence as SEQ ID No. As shown in 15, the DNA fragment encoding the protein shown in SEQ ID No. 10) is inserted into the genome of the host bacteria W10 to obtain the engineered bacteria.

Among them, SEQ ID No. 15 is the mnn9 location signal from nucleotides 1-114 from the 5'end, and nucleotides 115-1335 from the 5'end is the N-acetylglucosamine transferase I encoding gene.

1. Construction of N-acetylglucosamine transferase I (GnTI) expression vector containing mnn9 localization signal (1) Transfer human gnt1 gene

Use human gnt1 gene upstream primer (mnn9-GnTI-01: 5'-tcagtcagcgctctcgatggcgaccccg-3', SEQ ID No. 76) and downstream primer GnTI-02: 5'-GC GAATTC TTAGTGCTAATTCCAGCTAGGATCATAG-3' (SEQ ID No. 77, underlined Is the EcoR I restriction site), the full-length fragment of human gnt1 gene was obtained from the human liver-fetal cDNA library (purchased from Clontech Laboratories Inc. 1290 Terra Bella Ave. Mountain View, CA94043, USA) by PCR. PCR reaction conditions: 94 Pre-denaturation at °C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, and 30 cycles; finally, extension at 72°C for 10 minutes. The PCR amplified products were separated by 0.8% agarose gel electrophoresis, and recovered with a DNA recovery kit.

(2) GnTI DNA fragment containing localization signal mnn9

S.cere MNN9 Golgi localization signal: ScMNN9-03: tatAAT attATGTCACTTTCTCTTGTATCGTACCGCCTAAGAAAGAACCCGTGGGTTAACATTTTTCTACCTGTTTTGGCCATATTTCTAATATATATAATTTTTTTCCAGAGAGAGATCAATCTtcagtcagcgctctcgatggc78)

Use the upstream primer ScMNN9-03 (tat AAT attATGTCACTTTCTCTTGTATCGTACCGCCTAAGAAAGAACCCGTGGGTTAACATTTTTCTACCTGTTTTTTGGCCATATTTCTAATATATATAATTTTTTTCCAGAGAGATCAATCTtcagtcagtcagcgctgatcatctcagtcagtcagcaGAGATCAATCTtcagtcagtcagcaGAGATCAATCTtcagtcagtcagcaGAGATCAATCTtcagtcagtcagcaGAGATCAATCTtcagtcagtcagcaGAGATCAATCTtcagtcagtcagcaGAGAGATCAATCTtcagtcagtcagcaGAGATCTAAGAAAGAACCCGTGGGTTAACATTTTTCTACCTGTTTTTTGGCCATATTTCTAATATATCTtcagtcagcg , Connect the recovered and purified 1.2 kb GnTI fragment with the S.cere MNN9 Golgi localization signal coding sequence through PCR reaction, and use Pyrobest DNA polymerase to amplify the mnn9-gnt1 gene fragment (SEQ ID No. 15).

PCR reaction conditions: denaturation at 94°C for 2 minutes, annealing at 52°C for 30 seconds, extension at 72°C for 5 minutes, then denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, and 30 cycles; finally 72°C Extend for 10 minutes.

The PCR amplified products were separated by 0.8% agarose gel electrophoresis (8V/cm, 15 minutes), and the 1.3 kb band of interest was cut with a clean blade under ultraviolet light, and the DNA recovery kit was used for recovery, the method is the same as above.

(3) Construction of PGE-URA3-GAP1-mnn9-GnTI expression vector

Ssp I and EcoR I double digestion of the mnn9-gnt1 gene fragment PCR product obtained in (2) above to obtain the gene fragment; Ssp I and EcoR I double digestion of PGE-URA3-GAP1 (Yang Xiaopeng, Liu Bo, Song Miao, Gong Xin, Sing Shaohong, Xue Kuijing, Wu Jun. Construction of Pichia pastoris expression system for Man5GlcNAc2 mammalian mannose glycoprotein. Journal of Bioengineering. 2011; 27: 108-17. Connected to obtain a recombinant plasmid, named PGE-URA3-GAP1-mnn9-GnTI. Sequencing, the result is correct.

PGE-URA3-GAP1-mnn9-GnTI is a recombinant vector obtained by inserting the DNA molecule shown in SEQ ID No. 15 between the restriction sites Ssp I and EcoR I of the PGE-URA3-GAP1 vector.

2. Construction of recombinant yeast expressing exogenous mannosidase I

About 10μg of PGE-URA3-GAP1-mnn9-GnTI plasmid was linearized with Nhe I to obtain the PGE-URA3-GAP1-mnn9-GnTI linearized plasmid for transformation, and the method for preparing yeast electrotransformation competent cells. Step 5 above .

The selected host strain is the W10 engineered strain constructed in step five above. The single clone formed on the MD plate after transformation is named 1-8.

Extract 1-8 genomic DNA using glass bead preparation method, use genomic DNA as a template, HuGnTI-0.9k-01 and HuGnTI-0.9k-02 as primers, perform PCR amplification, and obtain a PCR amplification product of about 0.9kb. It proves that GnTI has been inserted into the genome, which is a positive engineering bacteria (Figure 11, A).

HuGnTI-0.9k-01: 5’-TGGACAAGCTGCTGCATTATC-3’ (SEQ ID No.79);

HuGnTI-0.9k-02: 5'-CGGAACTGGAAGGTGACAATA-3' (SEQ ID No. 80).

The DSA-FACE glycoform analysis results of bacteria 1-8 (the method is the same as that described in Example 1) is shown in Figure 11 B. It can be seen that after GnTI is transferred, the main glycoform structure of the protein expressed by the host bacteria is GlcNAcMan5GlcNAc2.

7. Construction of glycosyl engineering yeast with mammalian GalGlcNAcMan5GlcNAc2 and no fucose glycosylation structure

The glyco-engineered yeast strain 1-8-4 with mammalian GalGlcNAcMan5GlcNAc2 and no fucose glycosylation structure is the kre2-GalE-GalT gene fragment (nucleotide sequence shown in SEQ ID No. 16, encoding SEQ ID The protein shown in No. 11) is inserted into the genome of the host strain 1-8 to obtain the engineered strain 1-8-4.

Among them, SEQ ID No. 16 is the kre2 localization signal from nucleotides 1-294 from the 5'end, and nucleotides 29-1317 from the 5'end is the gene encoding the galactose isomerase GalE, from the 5'end Nucleotides 1325-2394 are the gene encoding the galactosyltransferase GalT.

1. The construction of galactosyltransferase (GalE+T) expression vector containing kre2 localization signal

(1) Transfer human GalE and GalT genes

Using the upstream primer GalE5' and downstream primer GalE3' of the human GalE gene, the upstream primer GalT5' and the downstream primer GalT3' of the human GalT gene were used respectively from the human liver fetal cDNA library (purchased from Clontech Laboratories Inc. 1290 Terra Bella Ave. Mountain View , CA94043, USA) to obtain full-length fragments of human GalE and GalT genes. PCR reaction conditions: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30 seconds, 52°C annealing for 30 seconds, 72°C extension for 1 minute and 30 seconds, and 30 cycles; Finally, it was extended at 72°C for 10 minutes. The PCR amplified products were separated by 0.8% agarose gel electrophoresis, and recovered with a DNA recovery kit.

GalE5’: 5’-ATGAGAGTTCTGGTTACCGGTGGTA-3’ (SEQ ID No.81);

GalE3': 5'-AG GGTACC ATCGGGATATCCCTGTGGATGGC-3' (SEQ ID No. 82, the underlined part is the recognition sequence of KpnI);

GalT5': 5'-AT GGTACC GGTGGTGGACGTGACCTTTCTCGTCTGCCA-3' (SEQ ID No. 83, the underlined part is the recognition sequence of KpnI).

GalT3': 5'-GC atttaaat ttaGCTCGGTGTCCCGATGTCCACTGTGAT-3' (SEQ ID No. 84, the underlined part is the recognition sequence of SwaI).

(2) GalE-GalT DNA fragment containing the positioning signal kre2

Kre2 5': 5'-AT AATatt AAACGATGGCCCTCTTTCTCAGTAAGAG-3' (SEQ ID No. 85, underlined SspI I site);

Kre2 3’+GalE5’: 5’-CACCGGtAACCAGaACTctCatGATCGGGGCAtctgccttttcagcggcagctttcagagccttggattc-3’ (SEQ ID No. 86).

The kre2 localization signal fragment was extracted from the S. cere genomic DNA of Saccharomyces cerevisiae by PCR. The PCR conditions are the same as above.

Using the upstream primer Kre2 containing the coding sequence of the S.cere kre2 Golgi localization signal and the downstream primer GalT3' of the GalE+GalT catalytic domain coding region, the purified GalE, GalT fragments and the S.cere kre2 Golgi localization signal will be recovered by PCR reaction. The coding sequences are connected, and the kre2-GalE-GalT gene fragment is amplified using Pyrobest DNA polymerase.

PCR reaction conditions: denaturation at 94°C for 2 minutes, annealing at 52°C for 30 seconds, extension at 72°C for 5 minutes, then denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 4 minutes and 30 seconds, and 30 cycles; finally 72°C Extend for 10 minutes.

The PCR amplified products were separated by 0.8% agarose gel electrophoresis (8V/cm, 15 minutes), the 2.4kb band of interest was cut with a clean blade under ultraviolet light, and the DNA recovery kit was used for recovery, the method is the same as above.

(3) Construction of PGE-URA3-GAP1-kre2-GalE-GalT vector

First cut the above-mentioned kre2-GalE-GalT DNA molecule with SwaI, and then phosphorylate the gene fragment with T4PNK enzyme (Dalian Bao Biological Co., Ltd.); Ssp I and SwaI double digestion with PGE-URA3-GAP1 vector to obtain a large vector fragment; The gene fragment was connected with the large vector fragment to obtain a recombinant plasmid, which was named PGE-URA3-GAP1-kre2-GalE-GalT. Sequencing, the result is correct.

PGE-URA3-GAP1-kre2-GalE-GalT is a recombinant vector obtained by inserting the DNA molecule of kre2-GalE-GalT shown in SEQ ID No. 16 into the Ssp I and SwaI restriction sites of the PGE-URA3-GAP1 vector.

2. Construction of recombinant yeast expressing exogenous UDP-Gal and lactose transferase

About 10 μg of PGE-URA3-GAP1-kre2-GalE-GalT plasmid was linearized with Nhe I to obtain the PGE-URA3-GAP1-kre2-GalE-GalT linearized plasmid for transformation to prepare yeast electrotransformation competent cells The method is the same as the above step 5.

The selected host strain is the engineered strain 1-8 constructed in step six. The single clone formed on the MD plate after transformation was named 1-8-4.

The genomic DNA of 1-8-4 was extracted by the glass bead preparation method, and the genomic DNA was used as the template, and GalE-T(1.5k)-01(5'-TGATAACCTCTGTAACAGTAAGCGC-3', SEQ ID No.87) and GalE- T(1.5k)-02 (5'-GGAGCTTAGC ACGATTGAATATAGT-3', SEQ ID No. 88) was used as primers, and PCR amplification was performed, and the PCR amplification products were 1.5kb, which proves that GalE-T has been inserted into the genome , Which is the positive engineering bacteria (A in Figure 12).

The result of DSA-FACE glycoform analysis of 1-8-4 bacteria (the method is the same as that described in Example 1) is shown in Figure 12, B. It can be seen that after the transfer of galactose isomerase and galactose transferase, the host bacteria The main glycoform structure of the expressed protein is GalGlcNAcMan5GlcNAc2.

8. Construction of glycosyl engineered yeast strain with mammalian GalGlcNAcMan3GlcNAc2 and fucose-free glycosylation structure

The glyco-engineered yeast strain 52-60 with mammalian GalGlcNAcMan3GlcNAc2 and no fucose glycosylation structure is an MDSII DNA molecule (nucleotide sequence is shown in SEQ ID No. 17, which encodes the protein shown in SEQ ID No. 12 ) Inserted into the genome of host strain 1-8-4 to obtain engineered strain 52-60.

Among them, the nucleotides 1-108 from the 5'end of SEQ ID No. 17 are the mnn2 localization signal of the mannosidase II encoding gene, and the nucleotides 109-3303 from the 5'end are the mannosidase II encoding gene. .

1. Construction of Mannosidase II (MDSII) expression vector containing mnn2 localization signal

(1) Synthesis of MDSII gene containing mnn2 localization signal by whole gene synthesis method

According to the sequence, the MDSII gene containing mnn2 (SEQ ID No. 17) was synthesized by a full-gene synthesis method, synthesized by Nanjing Jinrui Si Company and cloned into the pUC57 cloning vector to obtain pUC57-MDSII.

Design the upstream primer of MDSII gene (mnn2-MDSII-01: 5'-AT AATatt AAACCatgctgcttaccaaaaggttttcaa agctgttc-3', SEQ ID No. 89) (the underline is the SspI restriction site) and the downstream primer (MDSII-02: 5'-GCT) ATTTAAAT ctattaCCT CAACTGGATTCGGAATGTGCTGATTTCCATTG-3 ', SEQ ID No.90) ( SwaI restriction site underlined), to obtain the full-length human MDSII gene fragment from pUC57-MDSII PCR product by PCR, PCR reaction conditions: 94 ℃ denaturation 5 Minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 4 minutes and 30 seconds, and 30 cycles; finally, extension at 72°C for 10 minutes. The PCR amplified product (SEQ ID No. 17) was separated by 0.8% agarose gel electrophoresis, and recovered with a DNA recovery kit.

(2) Construction of PGE-URA3-arm3-GAP-mnn2-MDSII expression vector

Firstly digest the above PCR product with SwaI, and then phosphorylate the gene fragment with T4PNK enzyme (Dalian Bao Biological Co., Ltd.); Ssp I and SwaI double digestion of the PGE-URA3-GAP1 vector to obtain a large vector fragment; combine the gene fragment with the vector The fragments were ligated to obtain a recombinant plasmid, which was named PGE-URA3-arm3-GAP-mnn2-MDSII. Sequencing, the result is correct.

PGE-URA3-arm3-GAP-mnn2-MDSII is a recombinant vector obtained by inserting the DNA molecule shown in SEQ ID No. 17 into the Ssp I and Swa I restriction sites of the PGE-URA3-GAP1 vector.

2. Construction of recombinant yeast expressing exogenous mannosidase II

About 10 μg of PGE-URA3-arm3--GAP-mnn2-MDSII plasmid was linearized with Msc I to obtain the PGE-URA3-arm3-GAP-mnn2-MDSII linearized plasmid for transformation to prepare yeast electrotransformation competent cells The method is the same as the above step 5.

The selected host strain is the 1-8-4 engineered strain constructed in step seven. The single clone formed on the MD plate after transformation was named 52-60.

The genomic DNA of 52-60 was extracted by the glass bead preparation method. The genomic DNA was used as a template, and CeMNSII-1.2k-01 and CeMNSII-1.2k-02 were used as primers to carry out PCR amplification. The PCR amplification products were 1.2 kb, it proves that MDSII has been inserted into the genome, that is, it is a positive engineered bacteria (A in Figure 13).

CeMNSII-1.2k-01: 5’-CAGATGGATGAGCATAGAGTTA-3’ (SEQ ID No.91);

CeMNSII-1.2k-02: 5'-GACAAGAGGATAATGAAGAGAC-3' (SEQ ID No. 92).

The result of DSA-FACE glycoform analysis of 52-60 bacteria is shown in C in Fig. 13. It can be seen that after the transfer of exogenous mannosidase II, the main glycoform structure of the host bacteria expressed protein is GalGlcNAcMan3GlcNAc2.

IX. Construction of glycosyl engineered yeast strain with mammalian Gal2GlcNAc2Man3GlcNAc2 and no fucose glycosylation structure

The glyco-engineered yeast strain 150L2 with mammalian Gal2GlcNAc2Man3GlcNAc2 and a fucose-free glycosylation structure is a GnT II DNA molecule (the nucleotide sequence is shown in SEQ ID No. 18, which encodes the protein shown in SEQ ID No. 13) Inserted into the genome of the host strain 52-60, the engineered strain 150L2 was obtained.

Among them, SEQ ID No. 18 is the mnn2 localization signal of the gene encoding N-acetylglucosamine transferase II from nucleotides 1-108 from the 5'end, and nucleotides 109-1185 from the 5'end are N- Acetyl Glucosamine Transferase II.

1. Construction of N-acetylglucosamine transferase II (GnTII) expression vector for mnn2 localization signal

(1) Synthesis of GnTII gene in a full gene synthesis method

According to the sequence, the GnTII gene containing mnn2 (SEQ ID No. 18) was synthesized by full gene synthesis method, synthesized by Nanjing Jinrui Si Company and cloned into the pUC57 cloning vector to obtain pUC57-GnTII.

Design the upstream primer of GnTII gene (mnn2-GnTII-01: 5'-AT AATatt AAACCatgctgcttaccaaaa ggttttcaaagctgttc-3', SEQ ID No. 93) (the underline is the SspI restriction site) and the downstream primer (GnTII-02: 5'-GCT atttaaat TTAtcactgcagtcttctataacttttac-3', SEQ ID No.94) (the underline is the SwaI restriction site), the DNA molecule of N-acetylglucosamine transferase II (GnTII) containing mnn2 localization signal was obtained from pUC57-GnTII by PCR, PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 2 minutes and 30 seconds, 30 cycles; finally extension at 72°C for 10 minutes. The PCR amplified products were separated by 0.8% agarose gel electrophoresis, and recovered with a DNA recovery kit.

(2) Construction of PGE-URA3-arm3-GAP-mnn2-GnTII expression vector

The restriction enzyme digestion and construction method are consistent with the construction method of PGE-URA3-arm3-GAP-mnn2-MDSII, and the recombinant plasmid is obtained, which is named PGE-URA3-arm3-GAP-mnn2-GnTII. Sequencing, the result is correct.

PGE-URA3-arm3-GAP-mnn2-GnTII is a recombinant vector obtained by inserting the DNA molecule shown in SEQ ID No. 18 into the Ssp I and Swa I restriction sites of the PGE-URA3-GAP1 vector.

2. Construction of recombinant yeast expressing exogenous N-acetylglucosamine transferase II

About 10 μg of PGE-URA3-arm3-GAP-mnn2-GnTII plasmid was linearized with Msc I to obtain the PGE-URA3-arm3-GAP-mnn2-GnTII linearized plasmid for transformation to prepare yeast electrotransformation competent cells The method is the same as the above step 5.

The selected host strain is the 52-60 engineered strain constructed in step 8. The single clone formed on the MD plate after transformation was named 150L2.

Extract 150L2 of genomic DNA using glass bead preparation method, use genomic DNA as template, and use RnGnTII-0.8k-01 and RnGnTII-0.8k-02 as primers to perform PCR amplification. The PCR amplification product is 0.8kb, which proves that GnTII It has been inserted into the genome and is a positive engineered bacteria (Figure 13 B).

RnGnTII-0.8k-01: 5’-ATCAACAGTCTGATCTCTAGTG-3’ (SEQ ID No. 95);

RnGnTII-0.8k-02: 5'-AGTTCATGGTCCCTAATATCTC-3' (SEQ ID No. 96).

10. Knockout of anti-her2 antibody gene in engineered strains

Yeast strain 3-5-11 with inactivated anti-her2 antibody gene introduced the DNA molecule shown in SEQ ID No. 19 (anti-her2 antibody light and heavy chain gene knockout sequence) into Pichia pastoris 150L2, which is the same as the 150L2 genome. The source sequence undergoes homologous recombination, knocking out the light and heavy chain genes of the anti-her2 antibody in the yeast genome to obtain recombinant yeast.

Construction of the anti-her2 antibody light and heavy chain gene inactivation vector, knockout plasmid transformation of Pichia pastoris, and PCR identification of positive engineering strains are the same as the previous steps, and the yeast strain with anti-her2 antibody gene inactivation is named 3-5-11.

11. Inactivated O-mannose transferase I gene in engineered strains

Because the host bacteria are found to be unstable and easy to lose MDSI and MDSII genes, before the O-mannose transferase I gene is inactivated, follow the same technical method as Step 8 and Step 5 of this example, in 3-5-11 The medium host bacteria were successively transferred to SEQ ID No. 17 (MDSII) and SEQ ID No. 14 (MDSI), ensuring double copies of these two genes in the engineered bacteria, and 670 host bacteria were constructed.

Yeast strain 7b with inactivated O-mannose transferase I gene is a yeast obtained by inserting and inactivating a DNA molecule encoding O-mannose transferase I shown in SEQ ID No. 8 in Pichia pastoris 670, Named 7b, which is GJK30. GJK30 has been deposited at the China Common Microbial Species Collection and Management Center on March 18, 2020, and its deposit number is CGMCC No. 19488.

1. Construction of O-mannose transferase gene inactivation vector

Using plasmid pPIC9 (invitrogen) as a template, the terminator AOXTT sequence was obtained by PCR. The PCR used terminator primers AOXTT-5 and AOXTT-3 (5'-AOX1TT-5tctacgcgtccttag acatgactgttcctcagt-3' (SEQ ID No. 97); AOX1TT-3: 5'-tctacgcgtaagcttgcacaaacgaacttc-3' (SEQ ID No. 98) )). The obtained PCR product was purified and recovered with a PCR product recovery and purification kit (Dingguo Biotechnology Co., Ltd., Beijing) to obtain an AOX1TT terminator fragment.

The vector pYES2 (invitrogen company) used in the present invention has a yeast URA3 selection marker and can be used for subsequent screening. In order to prevent the URA3 gene promoter on the vector from affecting other genes on the vector, the present invention adds an AOX1TT terminator at the end of the URA3 gene. The specific construction method is as follows: the AOX1TT terminator fragment obtained above is recovered and then digested with MluI to obtain the digested fragment; the digested fragment is ligated with the vector pYES2 that has also been treated with Mlu1, and the ligated product is transformed into E. coli competent Cell Trans5α (Beijing Quanshijin Biotechnology Co., Ltd., catalog number CD201) was amplified, the clone with the correct sequence was named Trans5α-pYES2-URA3-AOX1TT, the plasmid was extracted, and the recombinant vector with AOX1TT terminator added to the end of URA3 gene was obtained. It is pYES2-URA3-AOX1TT.

In order to enable the constructed vector to be integrated into the Pichia yeast PMT1 gene, the present invention uses PCR to catch a fragment of the ORF region of the PMT1 gene as a homologous recombination fragment. To ensure inactivation vector is integrated into the gene capable of causing inactivation of the PMT1 gene PMT1, this study at both the primer plus the stop codon of different combinations, at the 3 ^'end of the gene fragment PMT1 fished plus CYCTT terminator.

Using the genome of Pichia pastoris JC308 (Invitrogen) as a template, the genomic DNA of Pichia pastoris JC308 was extracted by the glass bead preparation method (A. Adams et al., "Yeast Genetics Method Experimental Guide", Science Press, 2000). Genomic DNA was used as a template, and primers PMT1-IN-5 and PMT1-IN-3 were used for PCR amplification to catch the PMT1 gene fragment.

PMT1-IN-5: 5’-tctatgcattaatgatagttaatgactaatagagtaaaacaagtcctcaagaggt-3’ (SEQ ID No.99);

PMT1-IN-3: 5'-tgacataactaattacatgatctattagtcattaactatcattagatcagagtggggacgacta agaaa gc-3' (SEQ ID No. 100).

A different combination of stop codons was added to the two ends of the PMT1 gene fragment that was fished, and it was named PMT1-IN.

The reaction conditions for PCR to catch the PMT1 gene fragment were 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30s, 55°C annealing for 30s, and 72°C extension for 1min40s. A total of 25 cycles were performed, and the final extension was at 72°C for 10 minutes. The recovered PCR product is the PMT1 gene fragment.

Using the plasmid pYES2 containing the CYCTT terminator as a template, using primers CYC1TT-5 and CYC1TT-3 (CYC1TT-5: 5'-gctttcttagtcgtccccactctgatctaatgatagttaatgactaatagatcatgtaattagttatgtca-3' (SEQ ID No.101); CYC1TT-3' (SEQ ID No.101); CYC1TT-3'(SEQ ID No.101); '(SEQ ID No.102)) PCR amplification was performed to catch the CYC1TT terminator fragment. The PCR reaction conditions were pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute. A total of 25 cycles were performed, and the final extension was at 72°C for 10 minutes. The recovered PCR product is the CYC1TT terminator fragment.

Then use the recovered PCR product CYC1TT terminator fragment and PMT1-IN fragment (fished PMT1 gene fragment) as templates, use primers PMT1-IN-5 and CYC1TT-3 for PCR amplification, connect PMT1-IN and CYC1TT fragments, Construct PMT1-IN-CYC1TT fusion fragment. The PCR reaction conditions were pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 2.4 minutes. A total of 25 cycles were performed, and the final extension was at 72°C for 10 minutes. The recovered PCR product is the fusion fragment of PMT1-IN and CYC1TT terminator-PMT1-IN-CYC1TT. The recovered product was digested with Nsi1 and phosphorylated, and then ligated with the vector backbone of pYES2-URA3-AOX1TT digested with Nsi1 and Stu1. The resulting recombinant vector with the correct sequence is PMT1 inserted into the inactivated vector PMT1-IN-pYES2.

A different combination of stop codons are installed at the front and end of the PMT1 gene fragments, and a CYC1TT terminator is installed after the end stop codon to ensure that the PMT1 gene will not be expressed if the genome is integrated correctly. The pYES2 vector contains the URA3 gene of Pichia pastoris. In order to prevent the URA3 gene promoter from starting the PMT1 gene, the AOX1TT terminator is inserted after the URA3 gene. According to the designed primers, a CYC1TT terminator (272bp) fragment and a PMT1 (907bp) fragment were obtained, which were consistent with the theoretical size. The size of the fusion fragment between the PMT1-IN fragment and CYC1TT is 1135bp. The successful construction of the vector PMT1-IN-pYES2 is proved by the above PCR identification and sequencing.

2. Construction of PMT1 gene inactivated strain

To prepare yeast 670 competent cells, the preparation method is as follows:

Pick 670 single colonies and inoculate them in 2mL YPD+U medium (this medium is a medium with a uracil concentration of 100μg/mL obtained by adding uracil to YPD medium), and shake it at 25℃ at 170r/min Cultivate for 48h; then take 500μL of culture, inoculate it in 100mL YPD+U medium, incubate at 170r/min for 24h at 25℃, and OD _{600 will} reach 1.0; then centrifuge at 6000r/min for 6min at 4℃, and use 15mL of cold Resuspend the bacteria in bacterial water; centrifuge again under the same conditions, and resuspend the bacteria in 15mL of cold sterile water; centrifuge at 6000r/min for 6min at 4℃, and resuspend the bacteria in 15mL of cold 1mol/L sorbitol; the same Centrifuge again under the conditions; discard the supernatant, resuspend the bacteria with 1mL of cold 1mol/L sorbitol, the volume is about 1.5mL, that is, yeast 670 competent cells, placed on ice for later use.

Electric shock transformation of inserting PMT1 into the inactivating vector PMT1-IN-pYES2: inserting PMT1 into the inactivating vector PMT1-IN-pYES2, linearized by EcoRV digestion, and then recovered. The final product is dissolved in 20 μL ddH ₂ O, which is the linearized plasmid; Mix 85 μL of 670 competent cells and linearized plasmid in an electrorotor cup, place on ice for 5 minutes, perform electrotransformation (2kV) according to the conditions in the Pichia pastoris electrotransformation manual, immediately add 700ul of 1M sorbitol after electroporation, and transfer Place it in a 1.5mL centrifuge tube, place it at 25°C for 1 hour, and spread it on an MD+RH plate (this plate is the concentration of histidine and arginine obtained by adding histidine and arginine to MD medium to 100μg, respectively) /mL and 100μg/mL solid medium), cultured at 25°C, and extract genomic DNA from clones grown on the plate, using PMT1 genome peripheral primers PMT1-ORF-OUT-5 and PMT1-ORF-OUT-3 After PCR identification, the clone with the correct genome identification was named 7b, namely GJK30.

PMT1-ORF-OUT-5: 5’-aagacccatgccgaacacgac-3’ (SEQ ID No.103);

PMT1-ORF-OUT-3: 5'-gctctgaggcaccttgggtaa-3' (SEQ ID No. 104).

It is integrated into the Pichia pastoris chromosome by inserting an inactivated vector. Since the vector contains homologous fragments of the PMT1 gene, theoretically the integration of the vector is a site-directed integration, that is, insertion into the PMT1 gene, which can be carried out by designing specific primers. Identification and screening. Using the URA3 selection marker of Pichia pastoris, through pressure screening, the clones grown on the MD+RH plate were identified. The peripheral primers PMT1-ORF-OUT-5 and PMT1-ORF-OUT-3 of the PMT1 gene were used for PCR identification. If the PMT1-IN-pYES2 vector is correctly integrated into the PMT1 gene, the above primers can be used to obtain a 8.6kb fragment; the control (ie yeast X33) is a 3kb fragment (Figure 14); it can be seen that this PMT1-IN- The pYES2 vector was correctly integrated into the PMT1 gene and was named 7b, namely GJK30. Since different stop codons and terminators are designed on the insert vector, the PMT1 gene will not be expressed if the gene is integrated correctly.

12. Analysis of glycoform structure of GJK30 engineering bacteria

In order to observe whether the glycoform structure of the finally obtained GJK30 is correct, the present invention introduces a reporter protein after obtaining the GJK30 engineered bacteria. The method is the same as the method in Example 1. The anti-Her2 antibody is used as the reporter protein, and the expression vector of the anti-Her2 antibody is constructed The method and vector transformation method have been disclosed in the patent application (see Example 1). Using this method, the anti-Her2 antibody expression vector was transferred to the GJK30 host strain, and the GJK30-HL engineered strain expressing the anti-Her2 antibody was obtained. The glycotype and the glycotype obtained in the previous stage (the Her2 antibody expression vector is transferred to the control recombinant engineered strain obtained from the GJK08 strain constructed in Example 1 of Chinese Patent Application 201410668305.X, that is, compared with the GJK30-HL engineered strain of the present invention There are three differences: the β-mannose transferase knocked out in the present invention is I-IV, and the control recombinant engineered bacteria only knocks out β-mannose transferase II; the present invention also inactivates O-mannose transferase I, and the control recombination Engineering bacteria do not have; the present invention introduces exogenous MDSI and MDSII is introduced twice, and the control recombinant engineering bacteria is introduced once) Although both contain the structure of Gal2GlcNAc2Man3GlcNAc2, the ratio of the two is obviously different. The structure of Gal2GlcNAc2Man3GlcNAc2 in the early stage is less than 50% (Figure 15) A), while the Gal2GlcNAc2Man3GlcNAc2 structure obtained by the GJK30 engineered bacteria occupies more than 60% of the glycoform, and the overall glycoform is simpler and more uniform (Figure 15 B). According to numerous reports in the literature, this Gal2GlcNAc2Man3GlcNAc2 glycoform structure will affect the biological activity of the protein, such as the ADCC and CDC activities of the antibody, so its proportion directly affects many characteristics of the protein. The glycosylase was digested and analyzed by commercial glycosidase (New England Biolabs, Beijing), as shown in Figure 15 C. Since Gal2GlcNAc2Man3GlcNAc2(G2) does not have N-acetylglucosamine at the end, it is in β-N-acetyl Under the action of glucosaminidase, the structure of Gal2GlcNAc2Man3GlcNAc2 will not change, but the exonuclease β1,4-galactosidase can cut and remove two galactoses to form the structure of GlcNAc2Man3GlcNAc2 (G0); and at the same time Under the action of these two exonucleases, the galactose Gal and N-acetylglucosamine GlcNAc were sheared and removed successively, so the glycosyl structure was changed to the Man3GlcNAc2 structure, which proved that the expressed glycotype was correct.

Example 2: Construction of SARS-CoV-2 S-RBD (RBD223) recombinant yeast strain

1. Acquisition of SARS-CoV-2 S protein RBD gene and construction of yeast expression vector

According to the published sequence of the "Wuhan-Hu-1" isolate (GenBank: MN908947.3), the amino acids from the 319th to the 541th (R319-F541) of the S protein were selected, and the Beijing Nuosai Genome Research Center Co., Ltd. was commissioned to follow Pichia pastoris prefers codon-optimized DNA sequence and inserts it between the XhoI and NotI restriction sites of pPICZαA vector to obtain the recombinant expression vector pPICZα-S-RBD, namely RBD223 expression vector.

The structure of the recombinant expression vector pPICZα-S-RBD is described as: a recombinant plasmid with the DNA fragment shown in SEQ ID No. 25 inserted between the XhoI and NotI restriction sites of the pPICZαA vector. SEQ ID No. 25 is the coding gene sequence obtained by codon-optimizing amino acids 319 to 541 (R319-F541) of the S protein of SARS-CoV-2 "Wuhan-Hu-1" isolate, encoding SEQ The SARS-CoV-2 S-RBD (RBD223) protein indicated by ID No.21.

2. Recombinant expression vector pPICZα-S-RBD transforms yeast CGMCC No. 19488

Streak the yeast on the YPD plate for recovery, and isolate the single clone. Pick the recovered single clone and inoculate it into YPD liquid medium. After the test tube is cultured to its logarithmic phase, take 1ml and transfer to a 100ml YPD shake flask to culture at OD ₆₀₀ to 1.3-1.5, 1500g 4°C on a 200rpm shaker at 25°C Centrifuge for 5 minutes to discard the supernatant, resuspend in an equal volume of pre-cooled distilled water and centrifuge at 1500g at 4°C for 5 minutes, discard the supernatant, repeat this step 3 times; then resuspend with an equal volume of pre-cooled 1M sorbitol and resuspend at 1500g at 4°C Centrifuge for 5 min, discard the supernatant, and repeat this step 3 times. The above bacterial pellets washed with 3 times of distilled water and 3 times of sorbitol were suspended by adding 1ml of 1M sorbitol, and 100μl each was aliquoted into sterile centrifuge tubes and stored at -80°C.

About 10μg of the constructed expression plasmid pPICZα-S-RBD was linearized with restriction enzyme BglII. The restriction enzyme digestion system (50μL) is as follows: expression plasmid pPICZα-S-RBD 43μL, BglII2μL, 10×NEB3.1buffer 5μL, digested at 37°C for 1h, sampled, separated by 1% agarose gel electrophoresis, and analyzed whether the plasmid is linearized completely. The separation results showed that the linearized complete digestion product was recovered with a spin column-type DNA fragment recovery kit, and the linearized plasmid was eluted with 30μL of pure water when the linearized plasmid was finally eluted.

Take 15 μl of the linearized expression plasmid pPICZα-S-RBD and add it to 100 μl of the genetically modified Pichia pastoris (preservation number CGMCC No.19488) obtained in Example 1 through the glycosylation modification pathway to transform competent cells by electric shock. Mix gently, transfer to a pre-cooled 0.2cm electro-rotor cup, and place on ice for 5 minutes. According to the requirements of the yeast electroporation manual, immediately add 900μL of pre-cooled 1M sorbitol after the 2kV voltage shock, transfer it into a clean test tube, and place it in a 25°C incubator for 2 hours. Then add 1ml of YPD liquid medium without antibiotics, and incubate for 3-4 hours in a shaker at 25°C and 200 rpm. Take 300 μL of the bacterial solution cultured on the above shaker and spread it on a YPD plate with Zeocin resistance, and invert it in an incubator at 25°C for 60-72h.

3. Screening of recombinant expression strains

After the coated plate has grown out of single clones, randomly pick 8 single clones and inoculate them on a new YPD/Zeocin plate, and invert them in a 25°C incubator. After the colony grows, it is inoculated into 3ml YPD/Zeocin liquid medium, cultured on a shaker at 25°C and 200rpm. After the bacterial solution grows thick, transfer to 3ml BMGY according to the inoculation volume of 5% (volume percentage). The culture medium was cultured in a shaker at 200 rpm at 25°C, and induced with 0.5% (V/V) methanol every 12 hours after 48 hours. After 48 hours of induction, the culture supernatant was collected at 12000 rpm for 3 minutes.

The above culture supernatant collected after 48 hours of methanol induction was screened by WB, and the Western Blot steps are roughly as follows: (1) Separate the sample with 12% SDS-PAGE gel; (2) Transfer the sample on the SDS-PAGE gel Onto the PVDF membrane; (3) 5% milk blocking solution to seal the PVDF membrane transferred with the target protein, and block for 1 hour at room temperature; (4) switch to diluting the primary antibody with 5% milk at a dilution of 1:1000 ( Anti-CoV spike Antibody, Yiqiao Shenzhou 40150-T62) incubate for 2 hours; (5) Wash with PBST for 5 minutes and wash 5 times; (6) Switch to diluting the secondary antibody (Sigma) with 5% milk at a dilution of 1:4000 SAB3700885) incubate for 1 hour; (7) wash with PBST for 5 minutes and wash 5 times; (8) develop color with Pro-light HRP Chemiluminescent chromogenic solution (Tiangen Biochemical, PA112-02).

The result is shown in Figure 16. It can be seen from the figure that Western Blotting analysis of 1-7# clones all have different levels of protein expression. Among them, 7# has a higher expression level. It was selected as the next experimental clone strain and named CGMCC19488/pPICZα-S-RBD.

Example 3. Expression and purification of recombinant SARS-CoV-2 S-RBD glycoprotein

1. Recombinant strain CGMCC19488/pPICZα-S-RBD culture

Pick the positive clone identified in Example 2 (ie the recombinant strain CGMCC19488/pPICZα-S-RBD) and inoculate it into YPD/Zeocin liquid medium, culture it at 25°C and 200 rpm until the OD ₆₀₀ is 15-20, with 5% (V /V) was transferred to BMGY medium, cultured at 25°C, 200rpm for 24 hours, and 0.5% methanol was added to induce the expression of S-RBD. Induced every 12 hours, and samples were taken to detect the expression. 48 After hours, the culture supernatant was collected by centrifugation.

SDS-PAGE detection of different induction time is shown in Figure 17. It can be seen from the figure that as the induction time increases, the expression level of the target protein also increases.

2. SARS-CoV-2 S-RBD purification

1. Cation exchange chromatography

Dilute the culture supernatant that has been induced for 48 hours in step 1 by 2 times with water, adjust the pH to 6.5, and purify with Capto MMC chromatographic media. The mobile phase components are:

A: 20mM pH6.5 PB (phosphate buffer solution);

B: 100mM pH8.5 Tris-HCl+1M NaCl.

At the end of sample loading, equilibrate with A, and then elute with B.

2. Hydrophobic chromatography

Purify the sample purified by Capto MMC with Phenyl HP. First use 40% (volume percentage) B to elute the impurity protein, and then use 20% (volume percentage) B to elute the target protein. The mobile phase components are:

A: 20mM pH7.5Tris-HCl+1M AS (ammonium sulfate);

B: 20mM pH7.5 Tris-HCl

3. G25 desalination

The purified Phenyl HP sample was desalted with G25fine chromatographic medium, and the protein sample was collected. The mobile phase composition was: 20mM pH8.5 Tris-HCl.

4. Anion exchange chromatography

Purify the desalted sample with SOURCE30Q chromatography medium. The mobile phase components are:

A: 20mM pH8.5 Tris-HCl;

B: 20mM pH8.5 Tris-HCl+1M NaCl.

At the end of sample loading, equilibrate with A, and then elute with B.

The results of SDS-PAGE detection are shown in Figure 18.

SDS-PAGE electrophoresis found that SARS-CoV-2 S-RBD protein can be captured by Capto MMC; after desalting, the sample is purified with SOURCE30Q, and the target protein flows through, and almost all the contaminant protein is adsorbed on the SOURCE30Q chromatography medium.

Example 4 Glycotype analysis of SARS-CoV-2 S-RBD glycoprotein

1. Wild-type Pichia pastoris expresses SARS-CoV-2 S-RBD

According to the method of Example 2, the expression plasmid pPICZα-S-RBD was click-transformed into wild Pichia pastoris X33. After cloning and screening, it was verified by SDS-PAGE and WB (for the method, see Example 2), the results are as follows Shown in Figure 19.

The N-sugar chain of wild yeast is an excessively mannose glycoform. It can be seen from the figure that the SARS-CoV-2 S-RBD electrophoresis band expressed by X33 is a diffuse area, while the genetically modified CGMCC19488 expressed by the glycosylation modification pathway is expressed The SARS-CoV-2 S-RBD is a single stripe.

2. PNGase F and Endo H digestion analysis of CGMCC19488 expressing SARS-CoV-2 S-RBD glycoprotein

PNGase F can cleave high-mannose, hybrid and complex N-sugar chains. The cutting site is the glycosidic bond between the innermost N-acetylglucosamine (GlcNAc) of the sugar chain and asparagine. Endo H only cuts high mannose and hybrid N-sugar chains, and the cutting site is the glycosidic bond between the first and second N-acetylglucosamine (GlcNAc) on the innermost side of the sugar chain. The glycoform structure of SARS-CoV-2 S-RBD glycoprotein can be preliminarily judged by PNGase F and Endo H digestion.

The SARS-CoV-2 S-RBD glycoprotein expressed by the purified CGMCC19488 was digested according to the method described in the manual, and the digestion was performed by SDS-PAGE electrophoresis. The result is shown in Figure 20.

Endo H digestion results proved that the SARS-CoV-2 S-RBD glycoprotein expressed with CGMCC19488 has a complex and heterozygous N-sugar chain.

3. DSA-FACE analysis SARS-CoV-2 S-RBD glycoprotein glycoform structure

1. Preparation of SARS-CoV-2 S-RBD glycoprotein N-sugar chain sample

For the method, please refer to the literature "A method for analyzing oligosaccharide chains using DSA-FACE. Biotechnology Communications, 2008,19(6):885-888." The sugar chain samples digested with PNGaseF were purified on a Carbograph column. Carbograph column is activated with mobile phase A (80% acetonitrile, 0.1% TFA,% means volume percentage), washed with water and loaded, then washed with water after loading, and then used mobile phase B (25% acetonitrile, 0.05% TFA, % Means volume percentage) elution, collect the elution peaks, freeze and drain the sample, and store the precipitate at -20°C for later use.

2. APTS labeling of N-sugar chain samples

Take sugar chain precipitate and add 1μL of 20mM APTS solution and 1μL of 1M NaBH ₃ CN solution (dissolved in DMSO), mix well, seal the tube, and place it in a 37°C water bath for 18 hours.

3. Sephadex G10 purification of APTS-labeled sugar chains

It is reported in the literature that this method can retain more than 70% of the labeled complex, can remove 90% of the monomer APTS, and can remove a certain amount of salt at the same time. The labeled sample was purified twice by Sephadex G10, and each time was _{eluted with 30 μL of ddH 2} O, vacuum freeze-dried. The labeled sugar chains were analyzed by 3100 DNA sequencer-assisted capillary electrophoresis (DSA-FACE), and five standard N-glycotype structures of commercial bovine ribonuclease B (RNaseB) Man _5-9 GlcNAc _{2 were used} as the standard. The sugar chain structure of SARS-CoV-2 S-RBD glycoprotein expressed by CGMCC19488 was analyzed, and the results are shown in Figure 21.

It can be seen from the figure that the RBD glycoform is Gal ₂ GlcNAc ₂ Man ₃ GlcNAc ₂ , GalGlcNAcMan ₅ GlcNAc ₂ or Man ₅ GlcNAc ₂ .

Example 5. Mouse Immunization Experiment

Immunization methods have been published in many documents, such as "Reproduction of Animal Models of Human Diseases, edited by Li Cai, published by People's Medical Publishing House". The details are as follows: Take 20 female Balb/c mice aged 6-8 weeks and randomly divide them into the following two groups: a normal saline group and an immunization group, where the immunization group is 10 μg RBD+100 μg Al(OH) ₃ . Among them, RBD is the SARS-CoV-2 S-RBD glycoprotein expressed by CGMCC19488 prepared above, and contains 10 μg RBD and 100 μg Al(OH) ₃ in a volume of 100 μl as a vaccine compatible with physiological saline. Each group was immunized with 100 μl muscle on the 0th and 14th day, and blood was taken on the 28th day.

The indirect ELISA method was used to measure the anti-RBD antibody titers in the serum of each group of mice. Use the SARS-CoV-2 S-RBD cladding plate expressed by CGMCC19488 prepared above. For other operation steps, please refer to the refined molecular biology experiment guide [M]. Science Press, 2008.

The result is shown in Figure 22. It can be seen from the figure that the antibody titer of the immune group can reach 1:10000, while that of the control group is only 1:10.

Example 6. Virus neutralization test

In Example 5, the two groups of mice were taken serum 14 days after the second immunization, incubated at 56°C for 30 minutes, and diluted with normal saline at a certain dilution. Virus neutralization test was performed according to conventional methods (reference: Feng Cai Zhu, et al. Safety, tolerance, and immunogenicity of a recombinant adenovirus type-5 vectored COVID-19 vaccine: a dose-escalation, open-label, non-randomised, first -in-human trial.Lancet.2020May 22; S0140-6736(20)31208-3.doi:10.1016/S0140-6736(20)31208-3.). Proceed as follows:

1. Cell preparation: Digest 293T-ACE2 cells (Sino Biological, Beijing, Product No.: OEC001), dilute to 3×10 ⁴ /mL, and inoculate 100 μl/well of each 96-well plate.

2. Serum dilution: Dilute with normal saline according to a certain dilution, set up 3-5 multiple holes.

3. Virus dilution: Dilute the virus (virus strain SARS-CoV-2/human/CHN/Wuhan_IME-BJ01/2020, described in the above reference) to 1×10 ⁴ TCID50/ml.

4. Neutralization: Generally, the serum diluent and the virus diluent are mixed in equal volume, and incubated for 1 hour at 37°C _{in a 5% CO 2 incubator.}

5. Infection: add 100μl/well of the mixed solution after incubation to the cells.

6. Detection: Place it in a 5% CO ₂ incubator at 37°C for 60 hours for detection. Calculate the dilution corresponding to 50% protection effect.

_{As shown in Figure 23, the neutralizing antibody titer of the 3} group of 10 μg RBD + 100 μg Al(OH) was 1:25, which was significantly higher than that of the negative control group.

Example 7. Expression and purification of RBD210, RBD216, RBD219

According to the construction of the SARS-CoV-2 S-RBD (RBD223) recombinant yeast strain in Example 2, the expression and purification of the recombinant SARS-CoV-2 S-RBD glycoprotein in Example 3, the SARS-CoV-S-RBD glycoprotein in Example 4 Glycotype analysis of 2S-RBD glycoprotein, mouse immunization experiment in Example 5 and virus neutralization experiment in Example 6, respectively construct RBD210, RBD216, RBD219 expression vectors, construct RBD210, RBD216, RBD219 yeast expression Strains were expressed and purified to obtain RBD210, RBD216, and RBD219 glycoproteins, and were subjected to glycotype analysis, mouse immune test and virus neutralization test.

Among them, the amino acid sequence of RBD219 is shown in SEQ ID No. 22, which is the R319-K537 region of the S protein of the SARS-CoV-2 "Wuhan-Hu-1" isolate (the corresponding coding gene sequence used in this example is shown in SEQ ID No. 26). The amino acid sequence of RBD216 is shown in SEQ ID No. 23, which is the R319-V534 region of the S protein of SARS-CoV-2 "Wuhan-Hu-1" isolate (the corresponding coding gene sequence used in this example is shown in SEQ ID No. .27). The amino acid sequence of RBD210 is shown in SEQ ID No. 24 (the corresponding coding gene sequence used in this example is shown in SEQ ID No. 28), which is the S protein of SARS-CoV-2 "Wuhan-Hu-1" isolate The R319-K528 area. SEQ ID No. 26 to SEQ ID No. 28 are also codon-optimized nucleotide sequences.

The SDS-PAGE analysis of RBD210, RBD216, RBD219 and RBD223 glycoproteins is shown in Figure 24. Shown in the figure are the purified RBD210, RBD216, RBD219 and RBD223 proteins.

The glycoform analysis results of RBD210, RBD216, RBD219, and RBD223 glycoproteins are shown in Figure 25. It can be seen that the main glycoforms _{are: Gal 2} _{GlcNAc 2} Man ₃ GlcNAc ₂ , GalGlcNAcMan ₅ GlcNAc ₂ or Man ₅ GlcNAc ₂ .

The immune experiment of mice showed that the antibody titers produced by RBD210, RBD216, RBD219 and RBD223 proteins induced by mice could reach about 1:10000, and there was no difference between the groups, which was significantly higher than the negative control group (Figure 26).

The results of the neutralization experiment showed that the neutralizing antibodies induced by the RBD210, RBD216, RBD219, and RBD223 proteins in mice were about 1:25, and there was no difference between the groups, which was significantly higher than the negative control group (Figure 27).

The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention has given specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principles of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes that deviate from the scope disclosed in this application and use conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.

Industrial application

The present invention utilizes the coronavirus S protein RBD expressed by Pichia pastoris genetically modified through glycosylation modification pathway to have mammalian glycoform structure N-sugar chain modification, which avoids problems such as fungal glycosylation modification that may cause allergies. . The coronavirus S protein RBD expressed in the present invention can produce high-titer anti-RBD antibodies after immunizing mice, and can neutralize SARS-CoV-2 virus. In addition, the engineered Pichia pastoris strain of the present invention has the characteristics of short construction period, fast growth, easy large-scale production, and high safety, which is beneficial to the efficient research and development of new coronavirus vaccines under emergency conditions such as sudden new coronavirus infection. And mass production.

Claims

The method for preparing the receptor binding region of the coronavirus S protein with mammalian glycoform structure N-sugar chain modification includes the following steps:

(1) Re-engineering the Pichia pastoris genetically modified through the glycosylation modification pathway so that it can express the coronavirus S protein receptor binding region to obtain recombinant yeast cells;

The Pichia pastoris genetically modified through the glycosylation modification pathway is a Pichia pastoris cell mutant that is defective in the mannosylation modification pathway and reconstructs the N-glycosylation modification pathway of mammalian cells ；

(2) Culturing the recombinant yeast cell, and obtaining the N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform structure from the culture supernatant.
The method according to claim 1, wherein the Pichia pastoris genetically modified through the glycosylation modification pathway is prepared according to a method comprising the following steps:

(A1) Endogenous α-1,6-mannose transferase, phosphate mannose transferase, phosphate mannose synthase, β mannose transferase I, β mannose transferase endogenous in Pichia pastoris Enzyme II, β-mannose transferase III and β-mannose transferase IV to obtain recombinant yeast 1;

(A2) Express at least one of the following exogenous proteins in the recombinant yeast 1: exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, exogenous mannosidase II, exogenous N- Acetyl glucosamine transferase II, exogenous galactose isomerase, and exogenous galactose transferase to obtain recombinant yeast 2; the recombinant yeast 2 is the genetically modified Pichia pastoris through the glycosylation modification pathway yeast.
The method according to claim 2, characterized in that it further comprises the following step (A3):

(A3) Inactivate the endogenous Omannosyltransferase I of the recombinant yeast 2 to obtain the recombinant yeast 3; the recombinant yeast 3 is also the Pichia pastoris genetically modified through the glycosylation modification pathway.
The method according to any one of claims 1 to 3, wherein the N-sugar chain of the mammalian glycoform structure is Gal 2 GlcNAc 2 Man 3 GlcNAc 2 , GalGlcNAcMan 5 GlcNAc 2 or Man 5 GlcNAc 2 .
The method according to claim 4, characterized in that: when the mammalian glycoform N-sugar chain is Gal 2 GlcNAc 2 Man 3 GlcNAc 2 , GalGlcNAcMan 5 GlcNAc 2 or Man 5 GlcNAc 2 , step (A2) The exogenous proteins expressed in the recombinant yeast 1 are exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, exogenous galactose isomerase and exogenous galactose transferase, exogenous mannose Glycosidase II, and exogenous N-acetylglucosamine transferase II.
The method according to claim 4, wherein when the mammalian glycoform N-sugar chain is GalGlcNAcMan 5 GlcNAc 2 , the foreign protein expressed in the recombinant yeast 1 in step (A2) is Exogenous mannosidase I, exogenous N-acetylglucosamine transferase I, and exogenous galactose isomerase and exogenous galactose transferase.
The method according to claim 4, wherein when the mammalian glycoform N-sugar chain is Man 5 GlcNAc 2 , the foreign protein expressed in the recombinant yeast 1 in step (A2) is Exogenous Mannosidase I.
The method according to any one of claims 2-7, characterized in that: in step (A1), the endogenous α-1,6-mannose transferase of the inactivated receptor Pichia pastoris, Phosphate mannose transferase, phosphate mannose synthase, β mannose transferase I, β mannose transferase II, β mannose transferase III and β mannose transferase IV are all knocked out by homologous recombination. remove.
The method according to any one of claims 2-8, wherein in step (A2), the expression of the foreign protein in the recombinant yeast 1 is performed by introducing the foreign protein into the recombinant yeast 1. The gene encoding the source protein is realized.
The method according to claim 9, wherein the gene encoding the foreign protein is introduced into the recombinant yeast 1 in the form of a recombinant vector.
The method according to claim 9 or 10, wherein the encoding gene of the exogenous mannosidase I and the encoding gene of the exogenous mannosidase II are both introduced into the recombinant yeast 1 twice.
The method according to any one of claims 3-11, wherein: in step (A3), the endogenous Omannose transferase I of the recombinant yeast 2 is inactivated by treating the recombinant yeast 2 The gene encoding Omannose transferase I in genomic DNA was inserted and inactivated.
The method according to any one of claims 2-12, wherein in step (A2), the exogenous mannosidase I is expressed and localized in the endoplasmic reticulum.
The method according to claim 13, wherein the exogenous mannosidase I is derived from Trichoderma viride, and the C-terminus is fused with the endoplasmic reticulum retention signal HDEL.
The method according to any one of claims 2-14, characterized in that: in step (A2), the exogenous N-acetylglucosamine transferase I is localized in the endoplasmic reticulum or the medial Golgi after expression.
The method according to claim 15, wherein the exogenous N-acetylglucosamine transferase I is derived from a mammal, and is fused with an endoplasmic reticulum or medial Golgi localization signal at the N-terminus or C-terminus.
The method according to claim 16, wherein the exogenous N-acetylglucosamine transferase I is derived from humans and contains mnn9 localization signal.
The method according to any one of claims 2-17, characterized in that: in step (A2), the exogenous mannosidase II is expressed and localized in the endoplasmic reticulum or the medial Golgi.
The method of claim 18, wherein the exogenous mannosidase II is derived from filamentous fungi, plants, insects, Java, or mammals, and is fused to the endoplasmic reticulum or the inner side at the N-terminal or C-terminal Golgi positioning signal.
The method according to any one of claims 2-19, characterized in that: in step (A2), the exogenous N-acetylglucosamine transferase II is localized in the endoplasmic reticulum or the medial Golgi after expression.
The method according to claim 20, wherein the exogenous N-acetylglucosamine transferase II is derived from a mammal, and is fused with an endoplasmic reticulum or medial Golgi localization signal at the N-terminus or C-terminus.
The method of claim 21, wherein the exogenous N-acetylglucosamine transferase II is derived from humans, and all contain mnn2 localization signal.
The method according to any one of claims 2-19, wherein in step (A2), the exogenous mannosidase II is expressed and localized in the endoplasmic reticulum or the medial Golgi.
The method according to any one of claims 2-23, wherein the exogenous mannosidase II is derived from nematodes and contains mnn2 localization signal.
The method according to any one of claims 2-24, wherein in step (A2), the exogenous galactose isomerase and the exogenous galactose transferase are expressed and localized in the endoplasmic reticulum or Medial Golgi.
The method according to claim 25, wherein the exogenous galactose isomerase and the exogenous galactose transferase are both derived from mammals and are fused to the endoplasmic reticulum at the N-terminus or the C-terminus or Positioning signal of the medial Golgi.
The method of claim 26, wherein the exogenous galactose isomerase and the exogenous galactose transferase are fusion proteins, both of which are derived from humans, and share a kre2 localization signal.
The method according to any one of claims 2-27, wherein the α-1,6-mannose transferase is the following B1) or B2):

B1) The amino acid sequence is the protein of SEQ ID No. 1;

B2) The amino acid sequence shown in SEQ ID No. 1 has been substituted and/or deleted and/or added by one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 1 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-28, wherein the phosphomannose transferase is the following B3) or B4):

B3) The amino acid sequence is the protein of SEQ ID No. 2;

B4) The amino acid sequence shown in SEQ ID No. 2 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 2 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-29, wherein the mannose phosphate synthase is the following B5) or B6):

B5) The amino acid sequence is the protein of SEQ ID No. 3;

B6) The amino acid sequence shown in SEQ ID No. 3 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 3 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-30, wherein the β-mannosyltransferase I is the following B7) or B8):

B7) The amino acid sequence is the protein of SEQ ID No. 4;

B8) The amino acid sequence shown in SEQ ID No. 4 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 4 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-31, wherein the β-mannose transferase II is the following B9) or B10):

B9) The amino acid sequence is the protein of SEQ ID No. 5;

B10) The amino acid sequence shown in SEQ ID No. 5 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 5 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-32, wherein the β-mannosyltransferase III is the following B11) or B12):

B11) The amino acid sequence is the protein of SEQ ID No. 6;

B12) The amino acid sequence shown in SEQ ID No. 6 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 6 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-33, wherein the β-mannose transferase IV is the following B13) or B14):

B13) The amino acid sequence is the protein of SEQ ID No. 7;

B14) The amino acid sequence shown in SEQ ID No. 7 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 7 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-34, wherein the Omannose transferase I is the following B15) or B16):

B15) The amino acid sequence is the protein of SEQ ID No. 8;

B16) The amino acid sequence shown in SEQ ID No. 8 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 8 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-35, wherein the exogenous mannosidase I is the following B17) or B18):

B17) The amino acid sequence is the protein of SEQ ID No. 9;

B18) A protein with the same function after substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 9, or the amino acid sequence shown in SEQ ID No. 9 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-36, wherein the exogenous N-acetylglucosamine transferase I is the following B19) or B20):

B19) The amino acid sequence is the protein of SEQ ID No. 10;

B20) The amino acid sequence shown in SEQ ID No. 10 has been substituted and/or deleted and/or added by one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 10 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-37, wherein the fusion protein composed of the galactose isomerase and the galactose transferase is the following B21) or B22):

B21) The amino acid sequence is the protein of SEQ ID No. 11;

B22) The amino acid sequence shown in SEQ ID No. 11 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 11 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-38, wherein the mannosidase II is the following B23) or B24):

B23) The amino acid sequence is the protein of SEQ ID No. 12;

B24) The amino acid sequence shown in SEQ ID No. 12 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 12 A protein that has a homology of more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% and has the same function.
The method according to any one of claims 2-39, wherein the N-acetylglucosamine transferase II is the following B25) or B26):

B25) The amino acid sequence is the protein of SEQ ID No. 13;

B26) The amino acid sequence shown in SEQ ID No. 13 has been substituted and/or deleted and/or added with one or several amino acid residues and has the same function, or the amino acid sequence shown in SEQ ID No. 13 Proteins that have homology of 99% or more, 95% or more, 90% or more, 85% or more or 80% or more, and have the same function.
The method according to any one of claims 2-40, wherein the encoding gene of the exogenous mannosidase I is the following C1) or C2):

C1) The nucleotide sequence is the DNA molecule of SEQ ID No. 14;

C2) DNA that has more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 14 and encodes the exogenous mannosidase I A molecule, or a DNA molecule that hybridizes to a DNA molecule defined by C1) under stringent conditions and encodes the exogenous mannosidase I.
The method according to any one of claims 2-41, wherein the encoding gene of the exogenous N-acetylglucosamine transferase I is the following C3) or C4):

C3) The nucleotide sequence is the DNA molecule of SEQ ID No. 15;

C4) It has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 15 and encodes the exogenous N-acetylglucosamine transfer The DNA molecule of enzyme I, or the DNA molecule that hybridizes with the DNA molecule defined by C3) under stringent conditions and encodes the exogenous N-acetylglucosamine transferase I.
The method according to any one of claims 2-42, wherein the coding gene of the fusion protein composed of the galactose isomerase and the galactose transferase is the following C5) or C6):

C5) The nucleotide sequence is the DNA molecule of SEQ ID No. 16;

C6) DNA molecules that have more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 16, and encode the fusion protein, or Under stringent conditions, the DNA molecule hybridizes with the DNA molecule defined by C5) and encodes the fusion protein.
The method according to any one of claims 2-43, wherein the gene encoding mannosidase II is the following C7) or C8):

C7) The nucleotide sequence is the DNA molecule of SEQ ID No. 17;

C8) A DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 17, and encodes the mannosidase II, Or under stringent conditions, it hybridizes with the DNA molecule defined by C7) and encodes the mannosidase II DNA molecule.
The method according to any one of claims 2-44, wherein the N-acetylglucosamine transferase II coding gene is the following C9) or C10):

C9) The nucleotide sequence is the DNA molecule of SEQ ID No. 18;

C10) It has more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 18 and encodes the N-acetylglucosamine transferase II DNA molecules, or DNA molecules that hybridize with the DNA molecules defined by C9) under stringent conditions and encode the N-acetylglucosamine transferase II.
The method according to any one of claims 1-45, characterized in that: the Pichia pastoris genetically modified through glycosylation modification pathway is a collection deposited in the General Microbiology Center of the China Microbial Culture Collection Management Committee Strain numbered CGMCC No. 19488.
The method according to any one of claims 1-46, characterized in that: in step (1), the recombinant yeast cell introduces the coding gene of the coronavirus S protein receptor binding region into the glycosylated It is obtained from the genetically modified Pichia pastoris through the chemical modification pathway.
The method according to any one of claims 1-47, wherein the coronavirus S protein receptor binding region is any one of the following:

(a1) The protein shown in SEQ ID No. 21 or its truncated body;

(a2) The protein shown in SEQ ID No. 22 or its truncated body;

(a3) The protein shown in SEQ ID No. 23 or its truncated body;

(a4) The protein shown in SEQ ID No. 24 or its truncated body;

(a5) The amino acid sequence defined in any one of (a1)-(a4) has been substituted and/or deleted and/or added by one or several amino acid residues and has the same function, or it is the same as (a1)- (a4) The amino acid sequence defined in any one of the proteins has 99% or more, 95% or more, 90% or more, 85% or more than 80% homology and has the same function.
The method according to any one of claims 1-48, wherein the gene encoding the receptor binding region of the coronavirus S protein is encoding any one of (a1) to (a5) in claim 48 A DNA molecule of the receptor binding region of the coronavirus S protein is shown.
The method according to claim 49, wherein the coding gene of the receptor binding region of the coronavirus S protein is any one of the following:

(b1) The DNA molecule shown in SEQ ID No. 25;

(b2) The DNA molecule shown in SEQ ID No. 26;

(b3) The DNA molecule shown in SEQ ID No. 27;

(b4) The DNA molecule shown in SEQ ID No. 28;

(b5) It has 99% or more, 95% or more, 90% or more, 85% or more than 80% homology with the nucleotide sequence shown in SEQ ID No. 25 to SEQ ID No. 28 and encodes The DNA molecule of the coronavirus S protein receptor binding region, or hybridize with any one of SEQ ID No. 25 to SEQ ID No. 28 under stringent conditions and encode the coronavirus S protein receptor DNA molecules in the binding zone.
The method according to any one of claims 1-50, characterized in that: in step (2), the method comprising the following steps is purified from the culture supernatant to obtain the mammalian glycoform structure N- Sugar chain modified coronavirus S protein receptor binding region: The culture supernatant is sequentially subjected to cation exchange chromatography, hydrophobic chromatography, G25 desalination, and anion exchange chromatography to obtain the mammalian glycoform structure N- Sugar chain modified coronavirus S protein receptor binding region.
The method according to any one of claims 1-51, wherein in step (2), the method comprising the following steps is purified from the culture supernatant to obtain the mammalian glycoform structure N- Sugar chain modified coronavirus S protein receptor binding region: Pass the culture supernatant through a CaptoMMC chromatography column to capture the target protein, and then eluted with a buffer containing 1M NaCl to obtain a crude sample containing the target protein ; Afterwards, the crude sample is purified with a hydrophobic chromatography column Phenyl HP, the elution peak sample containing the target protein is desalted with a G25 chromatography column, and then anion exchange chromatography column Source30Q is used to adsorb the impurity protein and flow through the liquid It is the target protein; the target protein is the receptor binding region of the coronavirus S protein with mammalian glycoform structure N-sugar chain modification.
The method according to any one of claims 1-52, wherein the coronavirus is SARS-CoV-2.
The coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification prepared by the method according to any one of claims 1-52.
The recombinant yeast cell prepared by step (1) in the method of any one of claims 1-52.
A medicine for preventing and/or treating diseases caused by coronavirus infection, the active ingredient of which is the coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification as described in claim 54.
A drug capable of inhibiting coronavirus, the active ingredient of which is the S protein receptor binding region of the coronavirus having a mammalian glycoform structure N-sugar chain modification as described in claim 54.
The medicine according to claim 56 or 57, wherein the coronavirus is SARS-CoV-2.
A reagent or kit for diagnosing coronavirus infection, which contains the N-sugar chain modified coronavirus S protein receptor binding domain with mammalian glycoform structure according to claim 54.
The reagent or kit according to claim 59, wherein the coronavirus is SARS-CoV-2.
A coronavirus vaccine, the active ingredient of which is the S protein receptor binding region of the coronavirus with mammalian glycoform structure N-sugar chain modification as described in claim 54.
The coronavirus vaccine according to claim 61, characterized in that: the coronavirus vaccine contains an antigen and an adjuvant; the antigen is the coronavirus S with mammalian glycoform structure N-sugar chain modification according to claim 54 Protein receptor binding region.
The coronavirus vaccine according to claim 62, wherein the adjuvant is an aluminum adjuvant.
The coronavirus vaccine according to any one of claims 61-63, wherein the coronavirus is SARS-CoV-2.
A product capable of causing the production of specific antibodies against the S protein receptor binding region of the coronavirus in animals, the active ingredient of which is the N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform according to claim 54 .
The product according to claim 65, wherein the coronavirus is SARS-CoV-2.
Any of the following applications:

P1. Use of the recombinant yeast cell of claim 55 in the preparation of the N-sugar chain modified coronavirus S protein receptor binding region of the mammalian glycoform structure of claim 54;

P2. The coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification according to claim 54 is used in the preparation of the drug according to claim 56 or 57, the reagent or kit according to claim 59, and claims The use of the coronavirus vaccine according to any one of 61-63 or the product according to claim 65.
The application according to claim 67, wherein the coronavirus is SARS-CoV-2.
A method for preparing the medicine of claim 56 or 57, the reagent or kit of claim 59, the coronavirus vaccine of any one of claims 61-63 or the product of claim 65 is based on claim 54 The coronavirus S protein receptor binding region with mammalian glycoform structure N-sugar chain modification is used as a raw material for preparation.
The application according to claim 69, wherein the coronavirus is SARS-CoV-2.