WO2021237124A1 - Particules de vsv-delta g pseudotypé de protéine de spicule de sars-cov-2 et leurs utilisations - Google Patents

Particules de vsv-delta g pseudotypé de protéine de spicule de sars-cov-2 et leurs utilisations Download PDF

Info

Publication number
WO2021237124A1
WO2021237124A1 PCT/US2021/033713 US2021033713W WO2021237124A1 WO 2021237124 A1 WO2021237124 A1 WO 2021237124A1 US 2021033713 W US2021033713 W US 2021033713W WO 2021237124 A1 WO2021237124 A1 WO 2021237124A1
Authority
WO
WIPO (PCT)
Prior art keywords
vsv
cov
sars
protein
pseudotyped
Prior art date
Application number
PCT/US2021/033713
Other languages
English (en)
Inventor
Benhur Lee
Kasopefoluwa OGUNTUYO
Satoshi IKEGAME
Christian Stevens
Original Assignee
Icahn School Of Medicine At Mount Sinai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icahn School Of Medicine At Mount Sinai filed Critical Icahn School Of Medicine At Mount Sinai
Publication of WO2021237124A1 publication Critical patent/WO2021237124A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08—RNA viruses
    • C07K14/165—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20241—Use of virus, viral particle or viral elements as a vector
    • C12N2760/20243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • VNA virus neutralization assay
  • a SARS-CoV-2 spike protein pseudotyped vesicular stomatitis virus (VSV) particle comprising an encapsidated negative sense, single-stranded RNA genome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, and a nucleotide sequence encoding luciferase, wherein genome does not express VSV glycoprotein (G).
  • VSV VSV glycoprotein
  • the luciferase is renilla luciferase or nanoluciferase.
  • the SARS-CoV-2 spike protein comprises the amino acid sequence of SEQ ID NO:2. In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleotide sequence set forth in SEQ ID NO:l.
  • the genome does not comprise a nucleotide sequence sequence encoding VSV glycoprotein (G). In some embodiments, the genome further comprises a nucleotide sequence encoding a fluorescent protein. In some embodiments, the fluorescent protein is red fluorescent protein or enhanced green fluorescent protein.
  • the SARS-CoV-2 spike protein pseudotyped VSV particle has been treated with trypsin. In some embodiments, the SARS-CoV-2 spike protein pseudotyped VSV particle has been treated with trypsin and soybean inhibitor.
  • composition comprising a SARS-CoV-2 spike protein pseudotyped VSV particle described herein and a carrier.
  • the carrier is serum free media.
  • the carrier is phosphate buffered saline.
  • composition comprising a SARS-CoV-2 spike protein pseudotyped VSV particle disclosed herein and trypsin. Also provided is a composition comprising a SARS-CoV-2 spike protein pseudotyped VSV particle disclosed herein and trypsin and soybean inhibitor.
  • a method for generating SARS-CoV-2 spike protein pseudotyped VSV particles comprising:
  • N nucleotide sequence encoding for VSV nucleoprotein
  • M nucleotide sequence encoding for VSV matrix
  • L nucleotide
  • the cells are cultured in optiMEM containing anti-VSV-G antibody.
  • the SARS-CoV-2 spike protein pseudotyped VSV particles are purified from the supernatant by low speed centrifugation.
  • the SARS-CoV-2 spike protein comprises the amino acid sequence of SEQ ID NO:2.
  • the SARS-CoV-2 spike protein is encoded by the nucleotide sequence set forth in SEQ ID NO:l.
  • the luciferase is renilla luciferase.
  • step (a) farther comprises contacting the particle with soybean inhibitor.
  • the certain period of time is 15 minutes.
  • a method for detecting sera that neutralizes SARS-CoV- 2 comprising:
  • step (c) measuring the luciferase activity after a third period of time, wherein a lower level of luciferase activity is detected if the sera neutralizes SARS-CoV-2 spike protein pseudotyped VSV particle than if steps (b) to (c) are performed without performing step (a), and the lower level of luciferase activity indicates that the sera neutralizes SARS-CoV-2.
  • the first period of time is about 30 minutes. In some embodiments, the second period of time is about 1 hour. In some embodiments, the third period of time is about 18 to 22 hours.
  • the subject is a human subject.
  • the sera is heat inactivated.
  • the sera is diluted in plain DMEM or DMEM and 10% heat inactivated fetal bovine serum.
  • the method for detecting sera that neutralizes SARS-CoV-2 comprises concurrently repeating steps (a) to (c) with a positive control antibody or sera that does neutralize SARS-CoV-2. In some embodiments, the method further comprises concurrently repeating steps (a) to (c) with a negative control antibody or sera that does not neutralize SARS-CoV-2.
  • a method for assessing the ability of an antibody to neutralize SARS-CoV-2 comprising:
  • the first period of time is about 30 minutes.
  • the second period of time is about 1 hour.
  • the third period of time is about 18 to 22 hours.
  • the cells overexpress human ACE-2, TMPRSS2, or both.
  • kits comprising the SARS-CoV-2 spike protein pseudotyped VSV particle disclosed herein, and optionally instructions for performing a neutralization assay using the SARS-CoV-2 spike protein pseudotyped VSV particle.
  • a nucleic acid sequence comprising a VSV antigenome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding for luciferase, and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G).
  • the nucleic acid further comprises a T7 promoter, autocatalytic hammerhead ribozyme sequences, and a T7 terminator, optionally wherein the hammerhead ribozyme sequences is immediately upstream of the 3 ’ leader sequence.
  • the luciferase is renilla luciferase or nanoluciferase.
  • the fluorescent protein is red fluorescent protein or enhanced green fluorescent protein.
  • a recombinant VSV particle pseudotyped with VSV glycoprotein comprising an encapsidated genome comprising a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding for luciferase, and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G).
  • the luciferase is renilla luciferase or nanoluciferase.
  • the fluorescent protein is red fluorescent protein or enhanced green fluorescent protein.
  • a method for generating the recombinant VSV particle pseudotyped with VSV glycoprotein disclosed herein comprising:
  • nucleic acid sequence comprises a VSV antigenome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding for luciferase, and a nucleotide sequence encoding a fluorescent protein, wherein the nucleic acid sequence comprises a VSV antigenome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding for luciferase,
  • the method farther comprising transfecting the cells with a sixth vector comprising a codon-optimized sequence encoding a T7 polymerase.
  • a method for generating pseudotyped VSV particle comprising:
  • the cells are 293T-ACE2 clone 5-7 or 293T-ACE2- TMPRSS2 clone F8-2.
  • FIGs. 1A, IB, 1C, ID, and IE illustrate the production of VSV ⁇ G-rLuc bearing SARS-CoV-2 spike glycoprotein.
  • FIG. 1A Overview of VSV ⁇ G-rLuc pseudotyped particles bearing CoV-2 spike (top panel) with annotated spike glycoprotein domains and cleavage sites (bottom panel). SARS-CoV is referred to as SARS-CoV-1 for greater clarity.
  • FIG. IB Overview of VSV ⁇ G-rLuc pseudotyped particles bearing CoV-2 spike (top panel) with annotated spike glycoprotein domains and cleavage sites.
  • SARS-CoV is referred to as SARS-CoV-1 for greater clarity.
  • FIG. IB Overview of VSV ⁇ G-rLuc pseudotyped particles bearing CoV-2 spike (top panel) with annotated spike glycoprotein domains and cleavage sites.
  • FIG. IB is referred to as SARS-CoV-1 for greater clarity.
  • pseudotyped particles bearing the Nipah virus receptor binding protein alone (NiV- RBPpp), SARS-CoV-2-S (CoV2pp), or VSV-G (VSV-Gpp) were titered on Vero-CCL81 cells using a 10-fold serial dilution. Symbols represent the mean +/- SEM (error bars) of each titration performed in technical triplicates.
  • FIG. 1C Genome copy number and particle to infectivity ratio. Genome copy number was assessed using primers against the VSV-L protein as previously described (Pryce R, Azarm K et al Life Sci Alliance 2020 Jan; 3(1): e201900578).
  • FIG. ID Expression of the indicated viral glycoproteins on producer cells and their incorporation into VSVpp. Western blots performed using anti-Sl or anti-S2 specific antibodies.
  • FIG. IE CoV2pp entry is inhibited by soluble receptor binding domain (sRBD) derived from SARS-CoV-2-S. CoV2pp and VSV-Gpp infection of Vero-CCL81 cells was performed as in FIG. IB in the presence of the indicated amounts of sRBD. Neutralization curves were generated by fitting data points using a variable slope, 4- parameter logistics regression curve (robust fitting method). The last point (no sRBD) was fixed to represent 100% maximal infection.
  • FIGs. 2A, 2B, 2C, 2D, and 2E illustrate that CoV2pp entry is enhanced by trypsin treatment.
  • FIG. 2A Optimizing trypsin treatment conditions. Supernatant containing CoV2pp were trypsin-treated at the indicated concentrations for 15 min. at room temperature prior to the addition of 625 pg/mL of soybean trypsin inhibitor (SBTI). These particles were then titered on Vero-CCL81 cells in technical triplicates. Data shown as mean +/- SEM.
  • FIG. 2B Optimizing trypsin treatment conditions. Supernatant containing CoV2pp were trypsin-treated at the indicated concentrations for 15 min. at room temperature prior to the addition of 625 pg/mL of soybean trypsin inhibitor (SBTI). These particles were then titered on Vero-CCL81 cells in technical triplicates. Data shown as mean +/- SEM.
  • FIG. 2B The calculated IC50 for sRBD neutralization
  • FIG. 2C Dilution in serum free media (SEM, DMEM only) provides the highest signalmoise ratio for trypsin-treated CoV2pp entry. Particles were diluted 1:10 in Opti-MEM, SFM, or DMEM + 10%FBS prior to infection of Vero-CCL81 cells and spinoculation as described in Fig. IE. Cells infected without spinoculation show approximately 3x less signalmoise ratios.
  • FIG. 2C Dilution of CoV2pp in the absence of serum free media produces the highest signalmoise for trypsin treated CoV2pp. Presented are the results from an experiment in technical triplicate and error bars show the SEM.
  • FIG. 2D Dilution in serum free media
  • FIG. 2E Effect of different trypsin concentration on CoV2pp activation. Supernatant containing CoV2pp were treated with different concentrations of trypsin for 15 minutes, then used to infect Vero-CCL81 cells.
  • FIG. 3 illustrates that trypsin- treated CoV2pp depend on ACE2 and TMPRSS2 for entry. Parental and TMPRSS2 or ACE2 transduced VeroCCL81 cells were infected with the indicated pseudotyped viruses.
  • FIGs. 4A, 4B, and 4C illustrate sera neutralization in the absence of 10% FBS and optimization of neutralizations.
  • FIG. 4A Negative sera potently inhibit trypsin treated CoV2pp. CoV2pp were diluted in serum free media (SFM), then pooled negative sera and a positive serum were used to neutralize entry. An aliquot was heat inactivated (HI) for lhr in a 56°C water bath prior to use. Data are presented on a linear (top panel) and log scale (bottom panel). Each replicate from one experiment in technical duplicates are shown and neutralization curves were generated as done in Fig. ID. FIG. 4B.
  • SFM serum free media
  • Sera neutralizations were performed with untreated CoV2pp (top panel) or CoV2pp treated with trypsin (middle panel). Both particles were diluted in DMEM + 10% FBS and neutralization curves are presented as described above. VSV-G was not neutralized by the negative or positive sera (bottom panel).
  • FIG. 4C sRBD neutralizes CoV2pp equivalently across all conditions tested. Data presented in Fig. IE (i.e. the untreated CoV2pp) is duplicated here.
  • FIG. 5 shows CoV2pp viral neutralization assay and absIC50/80 versus Spike binding of patient sera.
  • CoV2pp were used to infect Vero-CCF81 cells in the presence of a 4-fold serial dilution of patient sera. Samples in light grey do not neutralize CoV2pp.
  • Neutralization curves were fit using a variable slope, 4-parameter logistics regression curve with a robust fitting method.
  • FIG. 6 shows a comparison of CoV2pp Absolute IC values across all 4 groups. Shown are the CoV2pp absolute IC50 (top panel), IC80 (middle panel) and IC90 (bottom panel) from all four groups with error bars showing the median and interquartile range. The dotted line presents the median from the aggregated positive neutralization samples as reported in Table 1. The dashed line indicates neat serum and the shaded gray region highlights samples that fall below this value. An ordinary one-way ANOVA with Dunnett’s correction for multiple comparisons was performed for statistical analysis. This analysis revealed no statistically significant difference between the Absolute IC values obtained across the 4 groups. There were notable outliers in this data set, including individuals that show poor neutralization (i.e.
  • FIGs. 7A, 7B, 7C, and 7D illustrate that 293T stably transduced with ACE2 and TMPRSS2 (293T-ACE2+TMPRSS2) are ultra-permissive for SARS-CoV-2pp infection.
  • FIG. 7A Infection of 293T cells lines transduced to stably express, TMPRSS2, ACE2, or both. A single dilution of particles was used to infect cells prior to spinoculation. Infections were done in technical triplicates. Presented are the aggregated results from two independent replicates and error bars show SEM.
  • FIG. 7B Normalized CoV2pp entry into single cell clones. Entry was normalized to the wild type parental cell line and further normalized to VSV-G entry. Presented are the average of one experiment in technical triplicates. Error bars show the median and interquartile range.
  • FIG. 7C CoV2pp were titered on Vero-CCL81 cells, 293T-ACE2 clone 5-7, and 293T-ACE2-TMPRSS2 clone F8-2. Titrations were performed with untreated CoV2pp and without spinoculation. Presented are the results from technical triplicates and bars show the SEM.
  • FIG. 7D Entry inhibition of CoV2pp by Nafamostat mesylate, a serine protease inhibitor.
  • Nafamostat was mixed with CoV2pp (top panel) or VSV-Gpp (bottom panel) prior addition to cells. Shown are the results from one experiment in technical triplicates. Error bars show SEM.
  • FIGs. 8A and 8B illustrate that ultra-permissive 293T-ACE2+TMPRSS2 cell clones retain the same phenotypic sensitivity to convalescent COVID-19 sera.
  • FIG. 8A Selection of pooled sera samples. Presented are the subset of samples that were pooled for use in viral neutralization assays (VNAs).
  • FIG. 8B Vero CCL81 and transduced 293T cells were used for VNAs. Sera previously shown to be negative, weakly positive, or strongly positive for CoV2pp neutralizations were selected to be pooled in equal volumes. These were subsequently used for VNAs. Notably, these VNAs were performed in the absence of exogenous trypsin or spinoculation.
  • FIGs. 9A and 9B illustrate the robust and efficient generation of an EGFP-reporter replication-competent VSV bearing SARS-CoV-2 spike (rcVSV-CoV2-S).
  • FIG. 9A Schematic of the rcVSV-CoV2-S genomic coding construct and the virus rescue procedure.
  • the maximal T7 promoter (T7prom) followed by a hammer-head ribozyme (HhRbz) and the HDV ribozyme (HDVRbz) plus T7 terminator (T7term) are positioned at the 3’ and 5’ ends of the viral cDNA, respectively.
  • An EGFP(E) transcriptional unit is placed at the 3’ terminus to allow for high level transcription.
  • SARS-CoV-2-S is cloned in place of VSV-G using the indicated restriction sites designed to facilitate easy exchange of spike variant or mutants.
  • FIG. 9B For virus rescue, highly permissive 293T cells stably expressing human ACE2 and TMPRSS2 (293T- [ACE2+TMPRSS2], F8-2 clone) cells were transfected with the genome coding plasmid, helper plasmids encoding CMV-driven N, P, M, and L genes, and pCAGS encoding codon-optimized T7-RNA polymerase(T7opt). 48-72 hpi, transfected cells turn EGFP+ and start forming syncytia. Supernatant containing rcVSV-CoV2-S are then amplified in Vero-TMPRSS2 cells at the scale shown. The blue arrowsat the bottom indicate the timeline for production of each sequence verified stock.
  • FIGs. 10A and 10B illustrate the generation of replication-competent VSV bearing SARS-CoV-2 spike (rcVSV- CoV2-S).
  • FIG. 10A Representative images of de novo generation of rcVSV-CoV2-S, carrying an EGFP reporter, in transfected 293T- ACE2+TMPRSS2 (F8-2) cells as described in FIG. 9. Single GFP+ cells detected at 2-3 days post-transfection (dpt) form a foci of syncytia by 4 dpt. Images are taken by Celigo imaging cytometer (Nexcelom) and are computational composites from the identical number of fields in each well. White bar is equal to 1 millimeter.
  • FIG. 10B illustrates the generation of replication-competent VSV bearing SARS-CoV-2 spike
  • FIGS. 11A and 11B illustrate the results of a neutralization activity of antibody responses elicited by the Sputnik V vaccine.
  • FIG. 11B For each serum sample, the fold-change in IC50 (reciprocal inhibitory dilution factor) against the indicated variant and mutant spike proteins relative to its IC50 against wild- type (WT) spike (set at 1) is plotted. Adjusted p values were calculated as in FIG. 11 A. Medians are represented by the bars and whi skersdem arcate the 95 % Cl. Neutralization dose- response curves were performed in triplicates, and the mean values from each triplicate experiment are shown as the single data points for each sera sample.
  • VNA Standardized virus neutralization assay
  • VNT virus neutralization titers
  • SARS-CoV-2 spike glycoprotein is embedded in the viral envelope and facilitates bothreceptor recognition and membrane fusion.
  • SARS-CoV-2-S is 1273 amino acids in length and, like other coronaviruses, is a trimeric class I fusion protein.
  • the S glycoprotein contains two subunits, the N-terminal, SI subunit and the C-terminal, S2 subunit.
  • the SI subunit contains the receptor-binding domain (RBD), which is responsible for host receptor binding.
  • RBD receptor-binding domain
  • the S2 subunit contains the transmembrane domain, cytoplasmic tails, and machinery necessary for fusion, notably the fusion peptide and heptad repeats.
  • Angiotensin-converting enzyme 2 (ACE2), a cell surface enzyme found in a variety of tissues, facilitates binding and entry of SARS-CoV-2.
  • ACE2 angiotensin-converting enzyme 2
  • ACE2 alone is not sufficient for efficient entry into cells.
  • entry depends on the SI subunit binding ACE2, entry is further enhanced by proteolytic cleavage between the S1/S2 and S2’ subunits.
  • proteolytic cleavage between the S1/S2 and S2’ subunits For both SARS-CoV-1 and SARS-CoV-2, this cleavage-mediated activation of S-mediated entry is supported by the expression of cell-associated proteases, like cathepsins or transmembrane serine protease 2 (TMPRSS2), or the addition of exogenous proteases that mimic the various trypsin-like proteases present in the extracellular lung milieu.
  • TMPRSS2 transmembrane serine protease 2
  • VNA viral neutralization assay
  • Antibody titers appear to be durable at greater than 40 days post infection, but in the case of SARS-CoV-1, reductions in IgG positive titers begin around 4-5 months post infection and show a significant drop by 36 months. Although there are reports of SARS- CoV-2 infected individuals testing positive by RT-PCR weeks after being confirmed as recovered by two consecutive negative tests, these are more likely the result of false negatives than of reinfection. A better understanding of the durability and efficacy of the neutralizing antibody response in patients previously infected with SARS-CoV-2 is of paramount importance.
  • HCVs human coronaviruses
  • Humoral immune responses to the SARS-CoV-2 S protein are typically evaluated by enzyme-linked immunosorbent assays (ELISAs) and its many variants (CLIA, LFA, etc.). These serological binding assays rightfully play a central role in determining patient antibody responses and can complement diagnostics and sero-epidemiological studies, especially when combined with antibody subclass determination (IgM, IgA and IgG). Nonetheless, as many antibodies generated to the spike protein bind but do not block virus entry, ELISA-based assays that detect titers of spike-binding antibodies cannot always correlate perfectly with neutralizing antibody titers as measured by plaque reduction neutralization or microneutralization tests.
  • ELISAs enzyme-linked immunosorbent assays
  • compositions and methods utilizing a SARS-CoV-2 pseudotyped viral particle by using vesicular stomatitis virus bearing e fluorescent report egene (e.g., the Renilla luciferase gene) in place of its G glycoprotein (VSV ⁇ G-rLuc).
  • egene e.g., the Renilla luciferase gene
  • G glycoprotein VSV ⁇ G-rLuc
  • This assay can provide robust metrics (absIC50, absIC80, absIC90) for meaningful comparisons between labs.
  • ultra-permissive 293T cell clones that stably express either ACE2 alone or ACE2+TMPRSS2 and methods of using these clones. These isogenic cell lines support either the late (293 T-ACE2) or early (293 T-ACE2/TMPRSS2) entry pathways that SARS-CoV-2 uses. These ultra-permissive 293T clones allow for the use of unpurified virus supernatant from the standard vims production batch, which can now provide for -150,000 infections per week (96-well format) with no further scale-up.
  • VSV vesicular stomatitis virus
  • SARS-CoV-2 spike protein pseudotyped vesicular stomatitis virus (VSV) particles comprising an encapsidated negative sense, single- stranded RNA genome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, and a nucleotide sequence encoding a reporter protein, wherein genome does not express VSV glycoprotein (G).
  • N VSV nucleoprotein
  • M VSV matrix
  • L nucleotide sequence encoding for VSV large (L) protein
  • P VSV phosphoprotein
  • G nucleotide sequence encoding a reporter protein
  • the reporter protein is luciferase.
  • SARS-CoV-2 spike protein refers to a SARS-CoV-2 spike protein known to those of skill in the art.
  • the spike protein comprises the amino acid or nucleic acid sequence found at GenBank Accession No. MN908947.3, MT291835.2, MT358639.1, MT079851, MT079848.1, or MT079845.1.
  • a typical spike protein comprises domains known to those of skill in the art including an S 1 domain, a receptor binding domain, an S2 domain, a transmembrane domain and a cytoplasmic domain.
  • the spike protein may be characterized has having a signal peptide (e.g., a signal peptide of 1-14 amino acid residues of the amino acid sequence of GenBank Accession No. MN908947.3), a receptor binding domain (e.g., a receptor binding domain of 319-541 amino acid residues of GenBank Accession No. MN908947.3), an ectodomain (e.g., an ectodomain of 15-1213 amino acid residues of GenBank Accession No.
  • a signal peptide e.g., a signal peptide of 1-14 amino acid residues of the amino acid sequence of GenBank Accession No. MN908947.3
  • a receptor binding domain e.g., a receptor binding domain of 319-541 amino acid residues of GenBank Accession No. MN908947.3
  • an ectodomain e.g., an ectodomain of 15-1213 amino acid residues of GenBank Accession No.
  • the spike protein may also be characterized as having an SI subunit and S2 subunit.
  • the SARS-CoV-2 spike protein is full length.
  • a SARS-CoV-2 spike protein comprises the amino acid sequence of SEQ ID NO:2. Due to the degeneracy of the code, any nucleotide sequence that encodes a SARS-CoV-2 spike protein (e.g., any nucleotide sequence encoding SEQ ID NO:2) may be used as described herein. In another specific embodiment, a nucleotide sequence encoding the SARS-CoV-2 spike protein is codon optimized for humans. In another specific embodiment, a SARS-CoV-2 spike protein is encoded by the nucleotide sequence set forth in SEQ ID NO:l.
  • VSV strains and genomic sequences are known in the art.
  • the ATCC offers VSV (ATCC VR-1238).
  • nucleotide sequences for VSV and the proteins encoded by VSV may be found on, e.g., GenBank. See, e.g., GenBank Accession Nos. NC_001560.1 (GI: 9627229) and J02428.1 (GI: 335873).
  • the genome of the SARS-CoV-2 spike protein pseudotyped VSV particle further comprises a nucleotide sequence encoding a fluorescent protein.
  • the nucleotide sequence encoding the reporter protein and the nucleotide sequence encoding fluorescent protein are separated by a nucleotide sequence encoding a self-cleaving peptide (e.g., a 2 A self-cleaving peptide) such that a single polypeptide comprising the reporter protein, the self-cleaving peptide, and fluorescent protein is generated and may be cleaved to produce the reporter protein and the fluorescent protein.
  • a self-cleaving peptide e.g., a 2 A self-cleaving peptide
  • the fluorescent protein is a red fluorescent protein or green fluorescent protein.
  • Additional examples of fluorescent proteins compatible with the compositions and methods disclosed herein include, include, but are not limited to, (3-F)Tyr- EGFP, A44-KR, aacuGFPl, aacuGFP2, aceGFP, aceGFP-G222E-Y220L, aceGFP-h, AcGFPl, AdRed, AdRed-C148S, aeurGFP, afraGFP, alajGFPl, alajGFP2, alajGFP3, amCyanl, amFP486, amFP495, amFP506, amFP515, amilFP484, amilFP490, amilFP497, amilFP504, amilFP512, amilFP513, amilFP593, amilFP597, anmlGFPl, anmlGFP2, anm2CP, anobCFPl, anobCFP2, ano
  • the reporter protein is luciferase.
  • the luciferase is renilla luciferase, firefly luciferase or nano luciferase. See, e.g., England et al., 2016, Bioconjug. Chem 27(5): 1175-1187 for examples of luciferases, including nanoluciferase.
  • the genome of the SARS-CoV-2 spike protein pseudotyped VSV particles does not comprise a nucleotide sequence encoding VSV glycoprotein (G). In some embodiments, the genome of the SARS-CoV-2 spike protein pseudotyped VSV particles only comprises a fragment of the nucleotide sequence sequence encoding VSV glycoprotein (G) (e.g., 10, 15, 20, 25, 30 or so nucleotides of the sequence that would encode VSV glycoprotein). In another embodiment, the SARS-CoV-2 spike protein is one described in the Examples. In another specific embodiment, provided herein are SARS-CoV-2 spike protein pseudotyped VSV particles such as described in in the Examples.
  • the SARS-CoV-2 spike protein pseudotyped VSV particles are treated with trypsin. In some embodiments, the SARS-CoV-2 spike protein pseudotyped VSV particles are treated with trypsin and soybean inhibitor.
  • the SARS-CoV-2 spike protein pseudotyped VSV particles are unable to undergo multiple rounds of replication. In a particular embodiment, the SARS- CoV-2 spike protein pseudotyped VSV particles are only able to undergo a single round of replication. [0062] Compositions
  • compositions comprising a SARS-CoV-2 spike protein pseudotyped VSV particle disclosed herein.
  • a composition comprising a SARS-CoV-2 spike protein pseudotyped VSV particle described herein and a carrier.
  • the carrier is phosphate buffered saline or another buffered saline solution.
  • the carrier is media (e.g., serum free media).
  • compositions comprising a SARS-CoV-2 spike protein pseudotyped VSV particle described herein and trypsin, soybean inhibitor or both.
  • a composition comprising supernatant containing SARS-CoV-2 spike protein pseudotyped VSV particles described herein and trypsin, soybean inhibitor or both.
  • composition comprising (1) SARS- CoV-2 spike protein pseudotyped VSV particles described herein (2) trypsin and (3) dextran (e.g., DEAE-dextran).
  • composition comprising (1) supernatant containing SARS-CoV-2 spike protein pseudotyped VSV particles described herein, (2) trypsin and (3) dextran (e.g., DEAE-dextran).
  • the trypsin concentration is between 5 and 1000, between 2 and 20, between 5 and 15, or between 6.25 and 12.5 pg/ml. In some embodiments the trypsin concentration is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 pg/ml.
  • the soybean inhibitor concentration is about 5, 10, 50,
  • soybean inhibitor concentration is about 625 pg/ml.
  • kits for generating SARS-CoV-2 spike protein pseudotyped VSV particles are, for example, described in the Examples.
  • a method for generating SARS-CoV- 2 spike protein pseudotyped VSV particle comprising: (a) infecting cells (e.g., HEK293T cells) overexpressing SARS-CoV-2 spike protein with a recombinant VSV particle, wherein the recombinant VSV particle comprises an encapsidated genome comprising a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding for a reporter protein (e.g., luciferase), wherein the genome does not express VSV glycoprotein (G), wherein the VSV particle is pseudotyped with VSV glycoprotein; and (b) purifying SARS-
  • the genome of the recombinant VSV particles further comprise a nucleotide sequence encoding a fluorescent protein.
  • the nucleotide sequence encoding the reporter protein (e.g., luciferase) and the nucleotide sequence encoding fluorescent protein are separated by a nucleotide sequence encoding a self-cleaving peptide (e.g., a 2 A self-cleaving peptide) such that a single polypeptide comprising the reporter protein (e.g., luciferase), the self-cleaving peptide, and fluorescent protein is generated and may be cleaved to produce comprising the reporter protein (e.g., luciferase) and the fluorescent protein.
  • a self-cleaving peptide e.g., a 2 A self-cleaving peptide
  • the cells are cultured in optiMEM containing anti-VSV-G antibody.
  • anti-VSV G neutralizing antibody may minimize the background sometimes seen with “bald” VSV pseudotypes.
  • optiMEM media for production of SARS-CoV-2 spike protein pseudotyped VSV particles may be preferred over DMEM + 10% FBS because an increase of CoV-2 spike cleavage relative to DMEM + 10%FBS.
  • chemically defined serum free media is used to culture the cells.
  • Cells may be transiently or stably transfected with vector (e.g., plasmid) comprising a nucleotide sequence encoding SARS-CoV-2 spike protein.
  • vector e.g., plasmid
  • the cells do not express ACE-2 and do not support SARS-CoV-2 entry.
  • the SARS-CoV-2 spike protein pseudotyped VSV particles are purified from the supernatant by low speed centrifugation. In some embodiments, the SARS-CoV-2 spike protein pseudotyped VSV particles are purified from the supernatant by low speed centrifugation to remove cell debris and concentrated via ultracentrifugation through a sucrose cushion, and/or Amicon and PEG concentration. [0076] Methods for infecting cells with SARS-CoV-2 spike protein pseudotyped VSV particles
  • kits for infecting cells with SARS-CoV- 2 spike protein pseudotyped VSV particles described herein are described, for example, in the Examples.
  • a method for infecting cells with SARS- CoV-2 spike protein pseudotyped VSV particles described herein comprising: (a) contacting the SARS-CoV-2 spike protein pseudotyped VSV particles with trypsin for a certain period of time; and (b) infecting cells with the SARS-CoV-2 spike protein pseudotyped VSV particles.
  • a method for infecting cells with s SARS- CoV-2 spike protein pseudotyped VSV particle comprising: (a) contacting the SARS-CoV-2 spike protein pseudotyped VSV particles with trypsin and soybean inhibitor for a certain period of time; and (b) infecting cells with the SARS-CoV-2 spike protein pseudotyped VSV particles.
  • step (a) further comprises contacting the particles with soybean inhibitor.
  • step (a) further comprises contacting the particles with dextran (e.g., DEAE-dextran).
  • dextran e.g., DEAE-dextran
  • Trypsin can be used to induce entry enhancement of SARS-CoV-2 spike protein pseudotyped VSV particles.
  • the trypsin concentration is between 5 and 1000, between 2 and 20, between 5 and 15, or between 6.25 and 12.5 pg/ml. In some embodiments the trypsin concentration is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 pg/ml.
  • the soybean inhibitor concentration is about 5, 10, 50,
  • soybean inhibitor concentration is about 625 pg/ml.
  • the certain period of time is 15 minutes.
  • low concentrations of trypsin and soybean inhibitor can be used to achieve maximal SAS-CoV-2 spike protein pseudotyped VSV particles entry with limited toxicity.
  • methods for detecting blood, sera or plasma that neutralizes SARS-CoV-2 are provided, for example, in the Examples.
  • the SARS-CoV-2 spike protein pseudotyped VSV particles provide a surrogate for SARS-CoV-2 and allow neutralization assays to be conducted without the need for a biosafety level higher than level 2.
  • a method for detecting sera that neutralizes SARS-CoV-2 comprising: (a) incubating with the SARS-CoV-2 spike protein pseudotyped VSV particles described herein with sera from a subject for a first period of time; (b) spinoculating cells expressing human ACE-2, TMPRSS2 or both with the sera-treated SARS-CoV-2 spike protein pseudotyped VSV particle for a second period of time; and (c) measuring the reporter protein (e.g., luciferase) activity after a third period of time, wherein a lower level of reporter protein (e.g., luciferase) activity is detected if the sera neutralizes SARS-CoV-2 spike protein pseudotyped VSV particle than if steps (b) to (c) are performed without performing step (a) or a negative control (e.g., an antibody that is known not neutralize SARS-CoV-2) is used in step (a) when performing steps (a) to (c), and
  • a negative control
  • reporter protein e.g., luciferase
  • SARS-CoV-2 spike protein pseudotyped VSV particles further express fluorescent protein, it may also be detected using techniques known in the art (e.g., cytometry).
  • the first period of time is about 10 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour or more. In certain embodiments, the first period of time is 10 to 45 minutes, 15 to 45 minutes, 15 to 60 minutes, or 30 to 60 minutes.
  • the second period of time is about 30 minutes, 45 minutes,
  • the second period of time is 30 minutes to 1 hour, 45 minutes to 1.5 hours, or 1 hour to 2 hours.
  • the third period of time is about 16 to 24 hours, about 18 to 20 hours, about 18 to 22 hours, or about 18 to 24 hours.
  • the subject is a human subject.
  • the serum is heat inactivated (e.g., the serum is incubated at 56° C for 30-60 minutes).
  • the serum is diluted in plain DMEM.
  • the serum is diluted in DMEM containing heat inactivated 10% heat inactivated FBS.
  • the method further comprises concurrently repeating steps (a) to (c) with a positive control antibody or sera that does not neutralize SARS-CoV-2. In some embodiments, the method comprises concurrently repeating steps (a) to (c) with a negative control antibody or sera that does not neutralize SARS-CoV-2.
  • the cells overexpress human angiotensin-converting enzyme 2 (ACE-2), Transmembrane protease serine 2 (TMPRSS2), or both. Cells may be engineered to overexpress human ACE-2, TMPRSS2, or both using sequences and techniques known to one of skill in the art.
  • the cells may be transiently or stably transfected with vectors (e.g., plasmids) comprising nucleotide sequences encoding human ACE-2, TMPRSS2, or both.
  • vectors e.g., plasmids
  • the neutralization assay is carried out in a high-throughput manner (e.g., using a 96 well microtiter plate).
  • the sera is serially diluted. In some embodiments, between 1:4 and 1:10 dilution of the SARS-CoV-2 spike protein pseudotyped VSV particles (e.g., the dilution may be done in plain DMEM or DMEM containing 10% heat inactivated FBS) is used in the method.
  • the cells are Vero-CCL81 cells, 293T cells, or human ACE2, primary HAECs.
  • Methods for assessing the ability of an antibody to neutralize SARS-CoV-2 [0092] In another aspect, provided herein are methods for assessing the ability of an antibody to neutralize SARS-CoV-2. Methods for assessing the ability of an antibody to neutralize SARS-CoV-2 are provided, for example, in the Examples.
  • a method for assessing the ability of an antibody to neutralize SARS-CoV-2 comprising: (a) incubating with the SARS-CoV-2 spike protein pseudotyped VSV particles described herein with an antibody of interest for a first period of time; (b) spinoculating cells expressing human ACE-2, TMPRSS2 or both with the antibody-treated SARS-CoV-2 spike protein pseudotyped VSV particle for a second period of time; and (c) measuring the reporter protein (e.g., luciferase) activity after a third period of time, wherein a lower level of reporter protein (e.g., luciferase) activity is detected if the antibody neutralizes SARS-CoV-2 spike protein pseudotyped VSV particle than if steps (b) to (c) are performed without performing step (a) or a negative control (e.g., an antibody that is known not neutralize SARS-CoV-2) is used in step (a) when performing steps (a)
  • the cells are spinoculated in the presence of serum free media (e.g., DMEM only).
  • serum free media e.g., DMEM only.
  • reporter protein e.g., luciferase
  • the SARS-CoV-2 spike protein pseudotyped VSV particles further express fluorescent protein, it may also be detected using techniques known in the art (e.g., cytometry).
  • the first period of time is about 10 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour or more. In certain embodiments, the first period of time is 10 to 45 minutes, 15 to 45 minutes, 15 to 60 minutes, or 30 to 60 minutes.
  • the second period of time is about 30 minutes, 45 minutes,
  • the second period of time is 30 minutes to 1 hour, 45 minutes to 1.5 hours, or 1 hour to 2 hours.
  • the third period of time is about 16 to 24 hours, about 18 to 20 hours, about 18 to 22 hours, or about 18 to 24 hours.
  • the method farther comprises concurrently repeating steps (a) to (c) with a positive control antibody or sera that does neutralize SARS-CoV-2. In some embodiments, the method comprises concurrently repeating steps (a) to (c) with a negative control antibody or sera that does not neutralize SARS-CoV-2.
  • the cells overexpress human angiotensin-converting enzyme 2 (ACE-2), Transmembrane protease serine 2 (TMPRSS2), or both. Cells may be engineered to overexpress human ACE-2, TMPRSS2, or both using sequences and techniques known to one of skill in the art.
  • the cells may be transiently or stably transfected with vectors (e.g., plasmids) comprising nucleotide sequences encoding human ACE-2, TMPRSS2, or both.
  • vectors e.g., plasmids
  • plasmids comprising nucleotide sequences encoding human ACE-2, TMPRSS2, or both.
  • the neutralization assay is carried out in a high-throughput manner (e.g., using a 96 well microtiter plate).
  • the antibody is serially diluted. In some embodiments, between 1:4 and 1:10 dilution of the SARS-CoV-2 spike protein pseudotyped VSV particles (e.g., the dilution may be done in plain DMEM or DMEM ontaining 10% heat inactivated FBS) is used in the method.
  • the cells are Vero-CCL81 cells, 293T cells, or human ACE2, primary HAECs. In certain embodiments, RLUs >10 5 are achieved with a 1:10 dilution in SFM and spinoculation.
  • the particlednfectivity ratio may be calculated as A:B, where A is genome copies/ml and B is TCID50/ml.
  • the SARS-CoV-2 SI incorporation may be determined by SI subunit of SARS-CoV-2 spike protein/VS V matrix ratio on Western blot.
  • the percent cleavage of incorporated SI may be determined by SI subunit of SARS-CoV-2 spike protein/SARS-CoV-2 spike protein ratio on Western blot.
  • cells e.g., 293T cells
  • the cells may be used in a neutralization assay described herein, including cell lines Vero-CCL81 TMPRSS2, HEK 293T-hACE2 (clone 5-7), and 293T-hACE2-TMPRSS2 (clone F8-2).
  • kits comprising SARS-CoV-2 spike protein pseudotyped VSV particles described herein in a container.
  • a kit comprising SARS-CoV-2 spike protein pseudotyped VSV particles in a container, and optionally instructions for performing a neutralization assay using the SARS- CoV-2 spike protein pseudotyped VSV particle.
  • the kit may further comprise a positive control antibody (e.g., an antibody known to neutralize SARS- CoV-2), a negative control antibody (e.g., an antibody known not to neutralize SARS-CoV- 2), or both.
  • the kit may further comprise one or more reagents need to detect reporter protein (e.g., lucif erase) activity.
  • a nucleic acid sequence comprising a VSV antigenome that comprises a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding a reporter protein (e.g., luciferase), and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G).
  • the nucleic acid sequence further comprises a T7 promoter, autocatalytic hammerhead ribozyme sequences, and a T7 terminator ⁇ See, e.g., Beaty et a , 2017, mSphere 2(2):e00376-16 for a description of the structure of the nucleic acid sequence (in particular, see, e.g., FIG. 4A of Beaty et ak).
  • the nucleic acid sequence comprises an optimized T7 promoter and hammerhead ribozyme (HhRbz) just before the 5 ’ end of the viral genome.
  • the optimized T7 promoter comprises the sequence TAATACGACTCACTATAGGGAGA (SEQ ID NO:9).
  • the HhRbz sequence comprises the sequence
  • the use of a codon-optimized T7 polymerase may alleviate the use of a vaccinia-driven T7 polymerase, resulting in higher rescue efficiency.
  • a nucleic acid comprising the sequence of the codon-optimized T7 RNA polymerase comprises SEQ ID NO: 11.
  • the T7 RNA polymerase encoding sequence is provided by a helper plasmid. The sequence of a codon optimized T7 RNA polymerase has been deposited to Addgene (Cat no. 65974).
  • nucleotide sequence encoding the reporter protein e.g., luciferase
  • nucleotide sequence encoding the fluorescent protein are separated by a nucleotide sequence encoding a self-cleaving peptide (e.g., a P2A self-cleaving peptide) so that a single polypeptide is produced that is cleaved into the reporter protein (e.g., luciferase) and fluorescent protein.
  • a self-cleaving peptide e.g., a P2A self-cleaving peptide
  • the nucleotide sequence encoding the fluorescent protein and the nucleotide sequence encoding the reporter protein are separated by a nucleotide sequence encoding a self-cleaving peptide (e.g., a P2A self-cleaving peptide) so that a single polypeptide is produced that is cleaved into fluorescent protein and the reporter protein (e.g., luciferase).
  • the nucleic acid sequence is in a plasmid.
  • the reporter protein is a luciferase such as a renilla luciferase, firefly luciferase or nano luciferase.
  • the fluorescent protein is a fluorescent protein disclosed herein.
  • vectors comprising the nucleic acids disclosed herein.
  • kits comprising the nucleic acid sequence in a container and optionally instructions for generating pseudotyped VSV particles.
  • the kit further comprises a one, two, three or all of the following: (1) a first vector (e.g., a plasmid) comprising a nucleotide sequence encoding VSV M protein in a container, (2) a second vector (e.g., a plasmid) comprising a nucleotide sequence encoding VSV L protein in a container, (3) a third vector (e.g., a plasmid) encoding VSV N protein in a container, (4) a fourth vector (e.g., a plasmid) comprising a nucleotide sequence encoding VSV G protein in a container; (5) a fifth vector (e.g.
  • kits comprising a nucleotide sequence encoding VSV P protein; (6) a sixth vector (e.g., a plasmid comprising a codon- optimized gene encoding T7 RNA polymerase.
  • the kit may further comprise one or more ingredients to transfect cells with a plasmid.
  • VSV particles pseudotyped with VSV glycoprotein comprising an encapsidated genome comprising a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding a reporter protein (e.g., luciferase), and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G).
  • the reporter protein is a luciferase such as renilla luciferase, firefly luciferase or nano luciferase.
  • the fluorescent protein fluorescent protein disclosed herein in one embodiment, the fluorescent protein fluorescent protein disclosed herein.
  • a method for generating pseudotyped VSV particles comprising:
  • the viral surface protein is the SARS-CoV-2 spike protein.
  • a method for generating recombinant VSV particles pseudotyped with VSV glycoprotein comprising an encapsidated genome comprising a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding a reporter protein (e.g., luciferase), and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G), the method comprising techniques similar to those described in Beaty et al.
  • a method for generating recombinant VSV particles pseudotyped with VSV glycoprotein comprising an encapsidated genome comprising a nucleotide sequence encoding for VSV nucleoprotein (N), a nucleotide sequence encoding for VSV matrix (M) protein, a nucleotide sequence encoding for VSV large (L) protein, a nucleotide sequence encoding for VSV phosphoprotein (P) proteins, a nucleotide sequence encoding a reporter protein (e.g., luciferase), and a nucleotide sequence encoding a fluorescent protein, wherein genome does not express VSV glycoprotein (G), the method comprising: (a) transfecting cells with a nucleic acid sequence described herein that comprises a VSV antigenome, a first vector (e.g., a plasmid) comprising a nucleotide sequence encoding VSV M
  • the method further comprises transfecting the cells with a sixth vector comprising a codon-optimized sequence encoding a T7 polymerase.
  • the cells are 293T-ACE2 clone 5-7 or 293T-ACE2-TMPRSS2 clone F8-2.
  • SARS-CoV-2 Spike nucleotide sequence [0108] ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGA
  • Example 1 Material and Methods for Examples 3-10 [0113] Plasmids
  • SARS-CoV-2 spike is in a pCAGG backbone and expresses the codon optimized Wuhan-Hu-1 isolate (NCBI ref. seq. NC_045512.2).
  • SARS-CoV-2 sRBD (NCBI GenBank MT380724.1 from Krammer lab) is in a pCAGG backbone and expresses the codon optimized sequence from the Wuhan-Hu-1 isolate. sRBD-His used for neutralization studies was generated from this construct.
  • VSV-G is in a pCAGG backbone and expresses wild type Indiana strain VSV-G (Genbank: ACK77583.1).
  • ACE2 packaging construct (GeneCopoeia, cat no EX-U1285-Lvl05) uses a CMV promoter to express TMPRSS2 and bears a puromycin selection marker in the integrating cassette.
  • TMPRSS2 packaging construct (GeneCopoeia, cat no EX-Z7591-Lvl97) uses a CMV promoter to express TMPRSS2 and bears a blasticidin selection marker in the integrating cassette.
  • psPAX22nd generation lentiviral packaging plasmid (Addgene #12259) expresses HIV-1 Gag, Pol, and Pro proteins.
  • NiV-RBP is in a pCAGG backbone and expresses the HA-tagged codon optimized NiV receptor binding protein.
  • Vero-CCL81 and 293T cells were cultured in DMEM with 10% heat inactivated FBS at 37 °C with 5% C02.
  • VSV-G pseudotyped lentiviruses packaging ACE2 or TMPRSS2 expression constructs were generated by using Bio-T (Bioland; BOl-01) to transfect 293T cells with the second-generation lentiviral packaging plasmid (Addgene; 12259), pCAGG- VSV-G, and the desired expression construct (i.e. ACE2 or TMPRSS2). The media was changed the next morning.
  • Vero-CCL81 and 293T cells were transduced in a 6-well plate with the prepared lentiviral constructs. Two days after transduction, these cells were expanded into a 10cm plate and placed under selection with puromycin (for ACE2 transduced cells) or blasticidin (for TMPRSS2 transduced cells). 293T and Vero-CCL81 cells were selected with 2 or 10pg/mL of puromycin, respectively.
  • 293T were selected with 5pg/mL and Vero- CCL81 cells were selected with 15pg/ml.
  • 293T-ACE2 cells were transduced with the VSV-G with 5pg/mL blasticidin.
  • Low passage stock of each cell line generated were immediately frozen down using BamBanker (Fisher Scientific; NC9582225).
  • Single cell, isogenic clones were isolated via serial dilution in a 96 well plate. Wells with only a single cell were grown up and eventually expanded while under selection.
  • 293T producer cells were transfected to overexpress SARS-CoV-2 or VS V-G glycoproteins.
  • pCAGG empty vector was transfected into 293T cells.
  • cells were infected with the VSV ⁇ G-rLuc reporter virus for 2 hours, then washed with DPBS.
  • supernatants were collected and clarified by centrifugation at 1250 rpm for 5 mins.
  • VSVAG-rLuc particles bearing the CoV2pp were then treated with TPCK-treated trypsin (Sigma- Aldrich; T1426-1G ) at room temperature for 15 minutes prior to inhibition with soybean trypsin inhibitor (SBTI) (Fisher Scientific; 17075029). Particles were aliquoted prior to storage in - 80 °C to avoid multiple freeze-thaws.
  • SBTI soybean trypsin inhibitor
  • VSV ⁇ G reporter backbone is from the Indiana lab-adapted strain which is cleared for use at BSL-2 (reviewed in PMID: 20709108). Bona fide recombination amongst negative sense RNA viruses (as opposed to positive sense RNA viruses) is exceedingly rare if not absent (reviewed in PMID: 21994784). Finally, the VSV-G provided in trans lacks the VSV-G gene start and gene stop signals present in the VSV ⁇ G backbone, making even the possibility of a productive homologous recombination event vanishingly small.
  • the media was (optionally) replaced with 5 mL DMEM + 10% FBSi.
  • the purpose of this media exchange is to reduce the volume that the transfection reagents are added to i.e. 5 mLs instead of 10 mLs.
  • 24 pg total DNA (glycoprotein expression plasmid) were transfect per plate.
  • 120 uL PEI reagent were diluted in 500 uL PBS.
  • a total of 24 ug of DNA was diluted in a separate tube of 500 uL PBS.
  • the PEI mix was added to the DNA mix and incubated at room temperature for 30 mins. The mixture was added drop wise to cells.
  • VSV-AG-G infection can be varied depending on the cell surface expression kinetics of the specific envelope protein. For example, 6, 8, 12, and 24 hpt can be used. optiMEM may be used for CoV2pp production, as this leads to an increase of CoV-2 spike cleavage relative to DMEM + 10% FBS.
  • ⁇ 8 hpt see comment above, cells were infected with a VSV[Rluc]- AG-G* stock ( ⁇ 1 X 10 8 TCID50 units) in an inoculum volume of 5 mL per plate. The inoculum was incubated for 1-2 hours at 37 °C to permit infection. The inoculum was removed. The plates were washed 2x with dPBS to remove excess VSV-G particles that did not infect.
  • the incubation medium opti-MEM (modification of Eagle's Minimum Essential Medium, buffered with HEPES and sodium bicarbonate, and supplemented with hypoxanthine, thymidine, sodium pyruvate, L-glutamine, trace elements, and growth factors) containing a 1:20,000 dilution of anti- VSV-G antibody (8G5F11 from Kerafast), was prepared.
  • This potently neutralizing antibody minimizes the background sometimes seen with “bald” VSV pseudotypes (293T cells transfected with 24pg empty vector, then infected as normal).
  • 10 mL incubation medium was added to each plate of washed 293T cells. At 48 hpi the supernatant into a 50 mL conical tube was collected — roughly 10 mL per plate.
  • CoV2pp were clarified, but not concentrated through a sucrose cushion. If desired, other concentration methods such as Amicon and Peg concentration may be used.
  • the pseudotype-containing supernatant of cell debris was clarified by centrifugation in a standard benchtop centrifuge at 1,250 rpm (approximately. 450 x g) for 5 min.
  • the clarified supernatant was transferred to Seton Open-Top Polyclear Centrifuge Tubes for SW28 rotor. 15 mL serum- free media was added.
  • a pipette containing 10.5 mL 20% sucrose was inserted to the bottom of the tube. 10 mL 20% sucrose were getnly added to the bottom of the tube to create cushion. The pipette was removed without disrupting the sucrose-media interface.
  • DMEM + 10% FBS for Vero or 293T cells were prepared such that one was able to transfer a final volume of 100 uL inoculum per well. This dilution series was performed in 6 replicates in order to generate a TCID50 value.
  • Promega Renilla or Passive Lysis buffer was prepared by diluting the stock 1/5 in ddH20. The culture media/inoculum was removed. Each well was washed with 100 pL of DPBS.
  • the cells were lysed by adding 25 pL prepared lysis buffer to each well. From this point on, all samples can be handled safely outside the biosafety cabinet, as all living and infectious material has been inactivated. It is recommended that, in addition to using the passive lysis buffer provided in the kit, one freeze-thaw cycle is performed to release the rLuc. Alternatively, incubation on an orbital shaker for 15 mins at 500 rpm can be performed. [0152] After lysis the same plate was assayed for Renilla luciferase production on a plate reader using the Promega rLuc kit.
  • the assay buffer 1:1 was diluted with DPBS and a 1:200 dilution of assay substrate was used.
  • the following procedure was used: (1) delay of 5 seconds between each well, (2) dispense 40pL of assay reagent, (3) shake for 2 seconds, (4) delay for 2 seconds, (5) read luminescence, (6) quench the reaction by dispensing 50pL of 70% ethanol, (7), shake for 5 seconds and (8) proceed to the next well.
  • the limit of detection for the Cytation3 is -300 RLUs.
  • the Spearman & Karber algorithm was used. Positive wells are those with >2x the average background signal i.e. for the Cytation3, this would be >600 RLUs. For other instruments, uninfected wells were assayed to determine the background signal.
  • trypsin For two separate batches of trypsin, the following conditions were used: 1st batch: 625 pg/mL of trypsin with 625 pg/mL of soybean inhibitor; 2nd batch: 475 pg/mL of trypsin with 600 pg/mL of soybean inhibitor.
  • 1st batch 625 pg/mL of trypsin with 625 pg/mL of soybean inhibitor
  • 2nd batch 475 pg/mL of trypsin with 600 pg/mL of soybean inhibitor.
  • certain trypsin might be particularly useful, such as concentrations between 6.25 pg/mL and 12.5 pg/mL, to induce this entry enhancement.
  • drastically lower concentrations of trypsin and soybean inhibitor can be used to achieve maximal CoV2pp entry with limited toxicity.
  • Day -1 pre-infection: PLL coating of 10 cm dishes, seeding of 293T cells.
  • Day 0 Transfection of 293T cells; infection of transfected cells with parental VSV[Rluc]- AG-G* stock.
  • Day 1 post-infection Seeding of susceptible cells in 96-well plates for titration (optional).
  • Day 2 post-infection Collection of supernatant from transfected/infected cells; clarification, and, if needed, concentration (i.e ultracentrifugation, Amicon filter, or PEG) of supernatant; if needed, trypsin-treatment of CoV2pp, aliquotting and freezing; tittering of new pseudotyped virus stocks on susceptible cells.
  • concentration i.e ultracentrifugation, Amicon filter, or PEG
  • Vero-CCL81 cells were seeded in a 96 well plate 20-24 hrs prior to infection.
  • a single aliquot of BALDpp, CoV2pp, and VSV-Gpp were used for infections and titrations were performed in technical triplicates.
  • the infected cells were washed with DPBS, lysed with passive lysis buffer, and processed for detection of Renilla luciferase.
  • the Cytation3 BioTek was used to read luminescence.
  • Vero CCL81 cells or isogenic cells (293T-ACE2 clone 5-7 or 293T- ACE2+TMPRSS2 clone F8), all maintained in DMEM + 10% FBS, DMEM with 10% FBS; Promega Renilla luciferase assay system (100 assays-E2810; 1000 assays-E2820); CoV2pp: VSV ⁇ G-Rluc bearing SARS-CoV-2 Spike glycoprotein; VSV-Gpp: VSV ⁇ G-Rluc bearing VSV-G entry glycoprotein; BALDpp: VSV-G-Rluc bearing no protein (produced in parallel with samples above)
  • the CoV2pp are a VSV pseudotyped particle (pp) system that do not encode any viral glycoprotein in the VSV genome and can be worked with under Bio-Safety Level 2 (BSL2) conditions.
  • the desired serial dilution of virus was prepared in Serum Free Media (SFM; DMEM only) such that one was able to transfer a final volume of 100 pL/well.
  • the media was removed from the Vero cells. Starting from the lowest dilution, 100 pL from the titration plate were carefully transferred to the cells, which were then incubated at 37 °C.
  • the Promega Renilla lysis buffer was prepared by diluting the stock 1 :5 in ddH20. The culture media/inoculum was removed. Each well was washed by adding 100 pL of DPBS, then removing this volume with a multichannel pipette.
  • the cells were lysed by adding 25 pL prepared lysis buffer to each well. It is recommended that, in addition to using the passive lysis buffer provided in the kit, one freeze-thaw cycle is performed to release the rLuc. Alternatively, incubation on an orbital shaker for 15 mins at 500 rpm can be performed.
  • the same plate was assayed for Renilla luciferase production on a plate reader using the Promega rLuc kit.
  • the assay buffer 1:1 was diluted with DPBS and a 1:200 dilution of assay substrate was used.
  • the following procedure was used: (1) delay of 5 seconds between each well, (2) dispense 40pL of assay reagent, (3) shake for 2 seconds, (4) delay for 2 seconds, (5) read luminescence, (6) quench the reaction by dispensing 50pL of 70% ethanol, (7), shake for 5 seconds and (8) proceed to the next well.
  • the limit of detection for the Cytation3 is -300 RLUs.
  • the Spearman & Karber algorithm was used for calculating TCID50. Positive wells are those with >3x the average background signal of uninfected wells *For the Cytation3, the limit of detection is 300 RLUs.
  • the limit of detection is 300 RLUs.
  • positive wells as those with >1000 RLUs were considered. For other instruments, multiple uninfected wells can be assayed to determine the background signal.
  • a dilution of the monoclonal antibody or sera in DMEM + 10%FBS in a V bottom 96 well plate was prepared as follows: If using a 4-fold serial dilution, 28.75 pL media were added to all wells except the top well. To the top well, 38.34 pL of the entry inhibitor were added to the well containing the starting dilution. Then 9.58 pL were transferred for a 4-fold serial dilution. This ensured that there were 28.7 5pL of the entry inhibitor (e.g. sera, monoclonal antibody or small molecule) in each well, which will be further diluted 1:4 after the addition of virus.
  • the entry inhibitor e.g. sera, monoclonal antibody or small molecule
  • the virus stock was diluted in DMEM + 10%FBS and, using a multichannel and a sterile basin, the desired amount of virus was transferred to each well of a V bottom 96 well plate. For example, between a 1:4 and 1:50 dilution of the CoV2pp can be used.
  • RLUs -105 > 100 x signalmoise
  • the same RLUs can be achieved with a 1:20-1:50 dilution.
  • All CoV2pp batches were tittered first prior to use for viral neutralization assays or entry inhibition assays. Each point of the neutralization curve was performed in triplicate.
  • Cell lysates were collected from producer cells with lOmM EDTA in DPBS. Cells were subsequently lysed with RIPA buffer (Thermo Scientific, 89900) containing protease inhibitor (Thermo Scientific, 87785) for 30 minutes on ice. Lysates were centrifuged at 25,000 x g for 30 minutes at 4°C, and the supernatants were collected and stored at -80°C. Total protein concentrations were determined by the Bradford assay.
  • ACE2 (66699-1-Ig from Proteintech and Rb abl08252 from abeam), VSV-G (A00199 from Genescript), VSV-M (EB0011 from Kerafast), anti-HA (NB600-363 from Novus), and CoX IV (926-42214 from LI-COR) were used.
  • membranes were washed and incubated with the appropriate Alexa Fluor 647-conjugated anti- mouse antibody or Alexa Fluor 647-conjugated anti-rabbit antibody. Alexa Fluor 647 was detected using the ChemiDoc MP imaging system (Bio-Rad).
  • Relative ACE2 or TMPRSS2 abundance was calculated by First normalizing abundance relative to GAPDH expression, then normalizing to wild type expression.
  • RNA extraction and qPCR for ACE2 and TMPRSS2 expression [0194] Total RNA was extracted from cells using Direct-zolTM RNA Miniprep kit (Zymol, R2051), and reverse transcription (RT) was performed with the TetroTM cDNA Synthesis kit (Bioline, BIO- 65043) and random hexamers. RT PCR was performed with the SensiFASTTM SYBR & Fluorescein Kit (Bioline, BIO-96005).
  • HPRT forward (5’- ATTGTAATGACCAGTCAACAGGG-3 ’ , SEQ ID NOG) and reverse (5’- GCATTGTTTTGCCAGTGTCAA- 3’, SEQ ID NO:4) primers
  • ACE2 forward (5’- GGCCGAGAAGTTCTTTGTATCT-3 ’ , SEQ ID NOG) and reverse (5’- CCCAACTATCTCTCGCTTCATC-3 ’ , SEQ ID NO:x6) primers
  • TMPRSS2 forward (5’- CCATGGATACCAACCGGAAA-3 ’ , SEQ ID NO:7) and reverse (5’- GGATGAAGTTTGGTCCGTAGAG-3’, SEQ ID NO:8) primers were utilized.
  • the protocol from Stadlbauer et all04 was modified slightly to start from a 1:300 and end at a 1:24300 dilution of sera.
  • IgG and IgM antibodies were detected with secondary antibodies conjugated to HRP (Millipore AP101P for anti- Human IgG and Invitrogen A18841 for anti-Human IgM).
  • a pre-titrated amount of pseudotyped particle dilution was mixed with the protein or compound and added to cells immediately after. Approximately 20 hours post infection, cells were processed for detection of luciferase activity as described above.
  • Raw luminometry data were obtained from labs that volunteered VNA results from at least 12 patient samples and analyzed as indicated below.
  • IC Relative inhibitory concentrations
  • the absIC50 would be the point at which the curve matches inhibition equal to exactly 50% of the 100% assay control relative to the assay minimum (0%).lll
  • sera samples that are non-neutralizing or minimally neutralizing may have lower plateaus indicating they cannot reach certain absolute inhibitory concentrations, such as an absIC90 or absIC99.
  • Example 2 Material and Methods for Example 11 [0208] Cell lines
  • Vero-CCL81 TMPRSS2, HEK 293T-hACE2 (clone 5-7), and 293T-hACE2- TMPRSS2 (clone F8-2) cells were maintained in DMEM + 10% FBS.
  • the HEK 293T- hACE2-TMPRSS2 cells were plated on collagen coated plates or dishes.
  • BSR-T7 cells 52, which stably express T7 -polymerase were maintained in DMEM with 10% FBS.
  • VSV-eGFP-CoV2 spike A21aa genomic clone and helper plasmids
  • the VSV-eGFP sequence was cloned into the pEMC vector (pEMC-VSV-eGFP), which includes an optimized T7 promoter having the sequence TAATACGACT CACTATAGGG AGA (SEQ ID NO: 9) and hammerhead ribozyme having the sequence CTGATGAGTC CGTGAGGACG AAACGGAGTC TAGACTCCGT C (SEQ ID NO: 10) just before the 5’ end of the viral genome (see FIG. 4A of Beaty et a , 2017, mSphere 2(2):e00376-16).
  • pEMC-VSV-eGFP-CoV2-S (Genbank Accession: MW816496) was generated as follows: the VSV-G open reading frame of pEMC-VSV-eGFP was replaced with the SARS- CoV-2 S, truncated to lack the final 21 amino acids 54.
  • a Pac-I restriction enzyme site was introduced just after the open reading frame of S transcriptional unit, such that the S transcriptional unit is flanked by Mlul / Pad sites.
  • SARS-CoV-2 S is from pCAGGS-CoV-2-
  • the B.1.1.7 Spike used carries the mutations found in GISAID Accession Number EPI_ISL 668152: del 69-70, del 145, N501Y, A570D, D614G, P681H, T716I, S982A, and D1118H.
  • the B.1.351 Spike carries the mutations D80A, D215G, del242-244, K417N, E484K, N501Y, D614G, and A701V (from EPI_ISL_745109).
  • the Spike sequences of WT, B.l.1.7, B.1.351, and E484K are available at Genbank (Accession Numbers: MW816497, MW816498, MW816499, and MW8 16500
  • the initial objective was to produce SARS-CoV-2 PsV sufficient for 10,000 infections/week at -1:100 signaknoise ratio when performed in a 96- well format.
  • a VSV- based rather than a lentiviral PsV system was used as lentiviruses are intrinsically limited by their replication kinetics particle production rate (10 4 -10 6 /ml for lentiviruses versus 10 7 -10 9 /ml for VSV without concentration).
  • the production of the VSVAG-rLuc pseudotyped viral particles (pp) bearing the SARS-CoV-2 spike glycoprotein was optimized as diagramed in FIG. 1A.
  • SARS-CoV-2 spike protein In the first step, cells overexpressing SARS-CoV-2 spike protein are infected with VSV[Rluc] AG-G* at a low MOI and grown in the presence of anti-VSV-G monoclonal antibody.
  • SARS-CoV-2 spike protein pseudotyped particles bud out from the infected cells. Those SARS-CoV-2 pseudotyped particles (at a certain concentration, e.g., genome copies/ml) may then be used infect target cells.
  • the purified pseudotyped particles may be trypsin treated and spinoculation may be performed to enhance entry of the pseudotyped particles.
  • the particle: infectivity ratio and SARS-CoV-2 spike protein incorporation may be determined as well as the percent cleavage of incorporated spike protein.
  • this protocol involves infecting producer cells at a low multiplicity of infection (MOI) of stock VSVAG-G*, incubating producer cells with an anti-VSV-G monoclonal antibody and generating the pseudotyped particles in Opti-MEM media.
  • MOI multiplicity of infection
  • the first two measures effectively eliminated the background signal from residual VSV-G while the last measure allowed for more cleavage of SARS-CoV-2pp in producer cells.
  • CT cytoplasmic tail
  • CT truncations in many other class I viral fusion proteins including other ACE2- using coronaviruses (HCoV-NL63 and SARS-CoV-1) can affect ectodomain conformation and lunction.
  • surrogate assay was developed that reflects the biology of the full-length virus spike.
  • BALDpp, NiV-RBPpp, CoV2pp, and VSV-Gpp were produced using the VSVAG- rLuc reporter backbone and titered them on Vero-CCL81 cells FIG. IB).
  • High background problems have resulted in low signahnoise ratios when using VSV-based PsV, especially for viral envelope proteins that do not mediate efficient entry.
  • BALDpp and NiV-RBP were used, to show that the background issue was resolved.
  • BALDpp lacks any surface glycoprotein while NiV-RBPpp incorporates the NiV receptor binding protein (RBP), which binds to the broadly expressed ephrin-B2 with sub-nanomolar affinity.
  • RBP NiV receptor binding protein
  • NiV- RBPpp without NiV-L should not fuse and effectively serves as a stricter and complementary negative control.
  • BALDpp nor NiV-RBPpp gives any background even at the highest concentration of virus particles used.
  • FIG. 1C shows the genome copy number and particle to infectivity ratio for BALDpp, NiV-G only, CoV2pp, or VAV-Gpp.
  • the genome copy number was assessed using primers against the VSV-L protein as previously described (Pryce, Azarm CedV-Bl usage).
  • the particle to infectivity ratio was calculated as a fraction of number of genomes to TCID50.
  • Example 4 CoV2pp entry is enhanced by trypsin treatment and spinoculation
  • the relative signal of CoV2pp infections was enhanced to effectively increase the number of infections one can provide or perform per batch of CoV2pp.
  • the effect of typsin treatment and spinoculation on CoV2pp entry into target cells was determined.
  • CoV2pp stocks were treated with the indicated range of trypsin concentrations for 15 min at room temperature (FIG. 2A).
  • 625 pg/mL of soybean trypsin inhibitor (SBTI) were added to all samples before titrating the trypsin-treated CoV2pp onto Vero-CCL81 cells.
  • SBTI soybean trypsin inhibitor
  • CoV2pp treated with the highest concentration of trypsin (625pg/mL) resulted in ⁇ 100-fold enhancement of entry (FIG. 2A), but this trypsin-dependent enhancement was only apparent when comparing entry of undiluted trypsin-treated CoV2pp.
  • the remaining uninhibited trypsin-dependent effect which must be present at the highest trypsin concentration, might have inadvertently been neutralized by diluting the trypsin-treated CoV2pp in Dulbecco’s modified Eagle Medium (DMEM) +10% fetal bovine serum (FBS), which is the standard infection media for titrating CoV2pp.
  • DMEM Dulbecco
  • FBS fetal bovine serum
  • CoV2pp and trypsin-treated CoV2pp were diluted 1:10 in three different media conditions before infecting Vero-CCL81 cells.
  • dilution in DMEM alone serum free media, SFM
  • SFM serum free media
  • CoV2pp treated with 62 5pg/mL of TPCK-treated trypsin was chosen, then 625 pg/mL of SBTI, diluted in SFM as the standard treatment condition.
  • spinoculation at 1,250 rpm for 1 hr enhanced entry 3-5 fold (compare signalmoise in FIG. 2B to FIG. 2C).
  • FIG. 2E shows that certain trypsin can improve CoV2pp activation. Supernatant containing CoV2pp were treated with different concentrations of trypsin for 15 minutes, then used to infect Vero-CCL81 cells.
  • Example 5 Entry of CoV2pp is independently enhanced by stable expression of ACE2 and TMPRSS2 in cells already permissive for SARS-CoV-2 entry and replication
  • Vero-CCL81 cell lines were generated stably expressing human ACE2 or human TMPRSS2.
  • Vero-CCL81 cells are already highly permissive for SARS-CoV-2 entry and replication.
  • the indicated cells were infected with CoV2pp or trypsin-treated CoV2pp diluted in serum-free media (standard treatment) and enhanced entry in both stable cell lines was observed (Fig. 3).
  • the entry enhancement of trypsin-treated CoV2pp in Vero-CCL81 + TMPRSS2 overexpressing cells was subdued relative to untreated CoV2pp.
  • Example 6 Standardizing the parameters that impact CoV2pp-based virus neutralization assay
  • This CoV2pp serum neutralizing factor was somewhat reduced but not completely diminished by heat inactivation for 1 hr at 56 °C. Notably, the effect of this neutralizing factor from negative sera was preempted by diluting the trypsin treated CoV2pp in DMEM containing 10% FBS (FIG. 4B). Importantly, recombinant sRBD neutralization was not affected by the dilution of CoV2pp in Serum Free Media or DMEM + 10% FBS (FIG. 4C). Regardless, for standardizing the CoV2pp-based VNA, all subsequent patient sera were heat inactivated for at least 30 mins prior to use an serially diluted in DMEM + 10% FBS, which also served as the infection media. Despite the data from FIG.
  • Example 7 Performance characteristics of the standardized CoV2pp virus neutralization assay
  • Example 8 Independent validation of CoV2pp VNA with geographically distinct and ethnically diverse COVID-19 patient cohorts
  • absIC80 Although absIC80 also generally follows this trend, differences in the ranked order of absIC50 and absIC80 values calculated for all sera samples were observed. This difference is more pronounced when comparing the absIC50 and absIC90 graphs further highlighting the need for a neutralization assay with a broad dynamic range. Additionally, the samples from each of the 4 groups show no statistical difference when absIC50, 80, or 90 calculations are compared (FIG. 6). Altogether, these data support the robustness of the CoV2pp VNA and suggest that absIC80 is a more stringent and meaningful measure of Nab titers.
  • Example 9 Ultra-permissive 293T-ACE2 and 293T-ACE/TMPRSS2 clones allow for use of CoV2pp in VNA at scale
  • the untreated CoV2pp was used to screen for ultrapermissive cell lines that would allow for CoV2pp VNA to be performed with dilutions of virus supernatant without any trypsin treatment, virus purification, or spinoculation.
  • TMPRSS2 can enhance ACE2 dependent virus entry in a non-linear fashion
  • BALDpp, CoV2pp, and VSV-Gpp were used to screen 19 single cell clones derived from 293T-ACE2 or 293T-ACE2+TMPRSS2 or Vero-ACE2 bulk transduced cells.
  • the latter (FIG. 3) served as an additional control in a naturally permissive cell line for SARS-CoV-2 entry and replication. All three bulk transduced cell lines resulted in significant increases in entry of CoV2pp relative to the parental 293T and Vero CCL81 cells (FIG. 7B). However, only a subset of the single cell clones performed better than bulk transduced cells.
  • TMPRSS2 was determined to be the main driver of this entry enhancement in the F8-2 cells as treatment with Nafamostat, a serine protease inhibitor, potently inhibited entry.
  • Nafamostat a serine protease inhibitor
  • this entry inhibition plateaued at 90% of maximal infection and the remaining 10% is nearly equivalent to the raw RLU values seen with bulk 293Ts stably expressing ACE2 alone (FIG 7D), suggesting a TMPRSS2-independent mechanism of entry. Entry into 293T-ACE2 cells was not inhibited by Nafamostat, once again highlighting that CoV2pp can enter by both the early and late entry pathways that have differential protease requirements.
  • Example 10 Diverse cell lines maintain similar kinetics in CoV2pp viral neutralization assays:
  • Sera samples were identified from 15 patients shown in FIG. 5 and tiered them into three groups: negative for CoV2pp neutralization (negative), weakly positive for CoV2pp neutralization (low positive), or strongly positive for CoV2pp neutralization (high positive) (FIG. 8A). Equal volumes of each set of samples were pooled and CoV2pp neutralization assays were performed on Vero-CCL81 WT, 293T-ACE2 clone 5-7, 293T- ACE2+TMPRSS2 bulk transduced, and the 293 T - ACE2+TMPRS S2 clone F8-2.
  • CoV2pp neutralization assays show consistent patterns of neutralization, exhibiting the robust nature of the assay in tandem with its sensitivity in detecting relative differences in neutralizing titer (FIG. 8B). Patterns of neutralization as well as the calculated absIC50 and absIC80 reveal a large dynamic range between low and high neutralizing patient sera across cell lines (FIG. 8B).
  • Example 11 A replication-competent EGFP-reporter vesicular stomatitis virus (VSV) system for virus neutralization assays (VNAs)
  • VSV-CoV2-S a replication-competent EGFP-reporter vesicular stomatitis virus (VSV) system uses rcVSV-CoV2-S, which encodes S from SARS coronavirus 2 in place of VSV-G, and coupled with a clonal HEK-293T ACE2 TMPRSS2 cell line optimized for highly efficient S-mediated infection.
  • VNAs BSL-2 compatible virus neutralization assays
  • the rcVSV-CoV2-S genomic coding construct comprises a hammerhead ribozyme immediately upstream of the 3’ leader sequence which cleaves in cis to give the exact 3’ termini (FIG. 9A).
  • the system further uses a codon-optimized T7 -polymerase which alleviates the use of vaccinia-driven T7 -polymerase, and a highly permissive and transfectable 293T-ACE2+TMPRSS2 clone (F8-2) (FIG. 9B).
  • a 6-plasmid transfection into F8-2 cells results in GFP+ cells 2-3 days post-transfection (dpt), which turn into foci of syncytia by 4-5 dpt indicating virus replication and cell-to-cell spread (Fig. 10A).
  • Transfer of F8-2 cell supernatant into interferon-defective Vero-TMPRSS2 cells allowed for rapid expansion of low-passage viral stocks that maintain only the engineered Spike mutations. Clarified viral supernatants from Vero-TMPRSS2 cells were aliquoted, sequenced verified, then titered on F8-2 cells to determine the linear range of response (Fig. 10B).
  • Example 12 Exemplary use of the replication-competent EGFP-reporter vesicular stomatitis virus (VSV) system
  • VOC SARS-CoV-2 ‘variants of concern’
  • S Spike
  • the S genes of B.1.351 and P.l viruses each carry a number of mutations, but include three in the receptor binding domain (RBD) that are particularly notable, the S: N501 Y substitution, found in B.1.1.7, alongside polymorphisms at positions 417 and 484, K417N/T and E484K.
  • the P.2 lineage originally detected in Rio de Janeiro, carries only the E484K mutation in the RBD and has spread to other parts of South America, including Argentina laboratories to confer escape from convalescent sera and monoclonal antibodies.
  • the assay described in Example 11, may, for example be used to neutralizing activity of vaccine sera.
  • isogenic rcVSV-CoV2-S were generated expressing the B.1.1.7 (UK SARS-CoV-2 lineage), B.1.351 or E484K S to evaluate the neutralizing activity of Sputnik V vaccine sera from Argentina.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Pulmonology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des particules de virus de la stomatite vésiculaire (VSV) pseudotypé de protéine de spicule de SARS-CoV-2 et des méthodes de génération de telles particules. L'invention concerne également des dosages de neutralisation faisant appel aux particules de virus de la stomatite vésiculaire (VSV) pseudotypé de protéine de spicule de SARS-CoV-2.
PCT/US2021/033713 2020-05-22 2021-05-21 Particules de vsv-delta g pseudotypé de protéine de spicule de sars-cov-2 et leurs utilisations WO2021237124A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063029217P 2020-05-22 2020-05-22
US63/029,217 2020-05-22
US202063063041P 2020-08-07 2020-08-07
US63/063,041 2020-08-07

Publications (1)

Publication Number Publication Date
WO2021237124A1 true WO2021237124A1 (fr) 2021-11-25

Family

ID=78707608

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/033713 WO2021237124A1 (fr) 2020-05-22 2021-05-21 Particules de vsv-delta g pseudotypé de protéine de spicule de sars-cov-2 et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2021237124A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060121580A1 (en) * 2003-07-22 2006-06-08 Crucell Binding molecules against SARS-coronavirus and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060121580A1 (en) * 2003-07-22 2006-06-08 Crucell Binding molecules against SARS-coronavirus and uses thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BERGER RENTSCH MARIANNE, ZIMMER GERT: "A Vesicular Stomatitis Virus Replicon-Based Bioassay for the Rapid and Sensitive Determination of Multi-Species Type I Interferon", PLOS ONE, vol. 6, no. 10, 5 October 2011 (2011-10-05), pages e25858, XP055881124, DOI: 10.1371/journal.pone.0025858 *
ENGLAND CHRISTOPHER G ET AL: "NanoLuc: A Small Luciferase Is Brightening Up the Field of Bioluminescence.", BIOCONJUGATE CHEMISTRY, vol. 27, no. 5, 18 May 2016 (2016-05-18), pages 1175 - 1187, XP002778324, ISSN: 1520-4812, DOI: 10.1021/acs.bioconjchem.6b00112 *
HOFFMANN MARKUS; KLEINE-WEBER HANNAH; SCHROEDER SIMON; KRüGER NADINE; HERRLER TANJA; ERICHSEN SANDRA; SCHIERGENS TOBIAS S.; H: "SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor", CELL, ELSEVIER, AMSTERDAM NL, vol. 181, no. 2, 5 March 2020 (2020-03-05), Amsterdam NL , pages 271, XP086136225, ISSN: 0092-8674, DOI: 10.1016/j.cell.2020.02.052 *
NIE ET AL.: "Establishment and validation of a pseudovirus neutralization assay for SARS-CoV-2", EMERG MICROBES INFECT, vol. 9, 24 March 2020 (2020-03-24), pages 680 - 686, XP055818011, DOI: 10.1080/22221751.2020.1743767 *
OGUNTUYO KASOPEFOLUWA Y., STEVENS CHRISTIAN S., HUNG CHUAN-TIEN, IKEGAME SATOSHI, ACKLIN JOSHUA A., KOWDLE SHREYAS S., CARMICHAEL : "Quantifying absolute neutralization titers against SARS-CoV-2 by a standardized virus neutralization assay allows for cross-cohort comparisons of COVID-19 sera", MEDRXIV, 27 August 2020 (2020-08-27), XP055881140, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7430605/pdf/nihpp-2020.08.13.20157222.pdf> [retrieved on 20220119], DOI: 10.1101/2020.08.13.20157222 *
SHANNON M. BEATY, ARNOLD PARK, SOHUI T. WON, PATRICK HONG, MICHAEL LYONS, FREDERIC VIGANT, ALEXANDER N. FREIBERG, BENJAMIN R. TENO: "Efficient and Robust Paramyxoviridae Reverse Genetics Systems", MSPHERE, vol. 2, no. 2, 26 April 2017 (2017-04-26), pages e00376 - 16, XP055468664, DOI: 10.1128/mSphere.00376-16 *
WHITT ET AL.: "Generation of VSV pseudotypes using recombinant AG-VSV for studies on virus entry, identification of entry inhibitors, and immune responses to vaccines", J VIROL METHODS, vol. 169, 13 August 2010 (2010-08-13), pages 365 - 74, XP027338746 *

Similar Documents

Publication Publication Date Title
Hu et al. D614G mutation of SARS-CoV-2 spike protein enhances viral infectivity
Neerukonda et al. Establishment of a well-characterized SARS-CoV-2 lentiviral pseudovirus neutralization assay using 293T cells with stable expression of ACE2 and TMPRSS2
Hu et al. Development of cell-based pseudovirus entry assay to identify potential viral entry inhibitors and neutralizing antibodies against SARS-CoV-2
Schmidt et al. Measuring SARS-CoV-2 neutralizing antibody activity using pseudotyped and chimeric viruses
Yu et al. Deletion of the SARS-CoV-2 spike cytoplasmic tail increases infectivity in pseudovirus neutralization assays
Le Tortorec et al. Antagonism to and intracellular sequestration of human tetherin by the human immunodeficiency virus type 2 envelope glycoprotein
Qi et al. Rab11-FIP1C and Rab14 direct plasma membrane sorting and particle incorporation of the HIV-1 envelope glycoprotein complex
Ao et al. Importin α3 interacts with HIV-1 integrase and contributes to HIV-1 nuclear import and replication
Yang et al. Second-site suppressors of HIV-1 capsid mutations: restoration of intracellular activities without correction of intrinsic capsid stability defects
Morozov et al. Single mutations in the transmembrane envelope protein abrogate the immunosuppressive property of HIV-1
Oguntuyo et al. In plain sight: the role of alpha-1-antitrypsin in COVID-19 pathogenesis and therapeutics.
Murray et al. A low-molecular-weight entry inhibitor of both CCR5-and CXCR4-tropic strains of human immunodeficiency virus type 1 targets a novel site on gp41
Mishra et al. SARS CoV-2 nucleoprotein enhances the infectivity of lentiviral spike particles
Sarute et al. Signal-regulatory protein alpha is an anti-viral entry factor targeting viruses using endocytic pathways
Wang et al. Selection with a peptide fusion inhibitor corresponding to the first heptad repeat of HIV-1 gp41 identifies two genetic pathways conferring cross-resistance to peptide fusion inhibitors corresponding to the first and second heptad repeats (HR1 and HR2) of gp41
Diehl et al. Identification of postentry restrictions to Mason-Pfizer monkey virus infection in New World monkey cells
CN112138160A (zh) griffithsin在制备新型冠状病毒感染药物中的用途
WO2021237124A1 (fr) Particules de vsv-delta g pseudotypé de protéine de spicule de sars-cov-2 et leurs utilisations
Moreno et al. A novel circulating tamiami mammarenavirus shows potential for zoonotic spillover
Ruiz et al. BST-2 mediated restriction of simian–human immunodeficiency virus
Afonso et al. Absence of accessory genes in a divergent simian T-lymphotropic virus type 1 isolated from a bonnet macaque (Macaca radiata)
WO2007122517A2 (fr) Virus h5 pseudotypés et leurs utilisations
Douglas et al. A comparative mutational analysis of HIV-1 Vpu subtypes B and C for the identification of determinants required to counteract BST-2/Tetherin and enhance viral egress
Wu et al. Development of an enzyme-linked immunosorbent assay based on the murine leukemia virus p30 capsid protein
Stevens et al. Alpha-1-antitrypsin and its variant-dependent role in COVID-19 pathogenesis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21808471

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21808471

Country of ref document: EP

Kind code of ref document: A1