WO2021234405A1

WO2021234405A1 - Identification of a target agent in a sample by nasba

Info

Publication number: WO2021234405A1
Application number: PCT/GB2021/051237
Authority: WO
Inventors: Sarah Amalia POLONIUS-TEICHMANN; Qianxin WU; Andrew Roger BASSETT; Chenqu SUO
Original assignee: Genome Research Limited
Priority date: 2020-05-22
Filing date: 2021-05-21
Publication date: 2021-11-25
Also published as: GB202007724D0

Abstract

The present invention relates to a method of identifying the presence of a target agent in a sample comprising an isothermal nucleic acid sequence-based amplification (NASBA) stage. In particular, the method comprises obtaining a NASBA product and independently detecting the binding of nucleic acid probe sequences comprising molecular labels to the NASBA product. The method may additionally comprise detecting the presence of labelled NTP in the NASBA product, wherein the presence of labelled NTP identifies the presence of the target agent in the sample. Detection may be performed using a lateral flow assay. Also provided is a two-stage method comprising sequencing the NASBA product to identify and/or confirm the presence of the target agent in the sample and/or provide additional data for the target agent (e.g. to identify or monitor mutations).

Description

IDENTIFICATION OF A TARGET AGENT IN A SAMPLE BY NAS BA

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

Coronavirus disease 2019 (COVID-19) is an infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The disease was first identified in December 2019 in Wuhan, the capital of China's Hubei province, and spread globally, resulting in a pandemic. Common symptoms include fever, cough, and shortness of breath. Other symptoms may include fatigue, muscle pain, diarrhoea, sore throat, loss of smell, and abdominal pain. The time from exposure to onset of symptoms is typically around five days but may range from two to fourteen days. While the majority of cases result in mild symptoms, some progress to viral pneumonia and multi-organ failure. As of 3 August 2020, more than 18.2 million cases have been reported across 213 countries and territories, resulting in more than 690,000 deaths.

The virus is primarily spread between people during close contact, often via droplets produced by coughing, sneezing, or talking. While these droplets are produced when breathing out, they usually fall to the ground or onto surfaces rather than being infectious over long distances. People may also become infected by touching a contaminated surface and then their face. The virus can survive on surfaces for up to 72 hours. It is most contagious during the first three days after the onset of symptoms, although spread may be possible before symptoms appear and in later stages of the disease.

The World Health Organization (WHO) declared the 2019-2020 coronavirus outbreak a Public Health Emergency of International Concern (PHEIC) on 30 January 2020 and a pandemic on 11 March 2020. Local transmission of the disease has been recorded in many countries across all six WHO regions.

Currently, there is no vaccine or specific antiviral treatment for SARS-CoV-2 or COVID-19 patients. Management involves the treatment of symptoms, supportive care, isolation, and experimental measures.

There is therefore a critical need to provide an effective method for identifying those individuals who are infected, especially as some infected individuals capable of spreading the virus may show no clinical signs or symptoms. Such methods will be critical in the management of the pandemic and essential for the return of people to normal day-to-day life.

SUMMARY OF THE INVENTION

According to a first aspect of the invention, there is provided a method of identifying the presence of a target agent in a sample comprising an isothermal nucleic acid sequence-based amplification (NASBA) stage, said method comprising the steps:

(a) obtaining a biological sample from an individual;

(b) incubating the biological sample with a lysis solution to obtain a lysate; and

(c) incubating the lysate obtained in step (b) with a NASBA reaction mix comprising reverse transcriptase, RNA polymerase, RNase, nucleic acid primer sequences and nucleic acid probe sequences comprising independent molecular labels to obtain a NASBA product; and

(d) independently detecting the binding of the nucleic acid probe sequences comprising molecular labels to the NASBA product, wherein the binding of the nucleic acid probe sequences to the NASBA product identifies the presence of the target agent in the sample, and wherein said NASBA product corresponds to a region of the target agent genome and said nucleic acid primer sequences are complementary to regions of the target agent genome flanking said region of the target agent genome corresponding to the NASBA product.

BRIEF DESCRIPTION OF FIGURES

Figure 1 : (a) Overview of a two-stage testing strategy comprising a decentralised

NASBA test and centralised sequencing of the NASBA product (b) Schematic of the NASBA reaction.

Figure 2: (a) Optimisation of amount/concentration of reverse transcriptase in the

NASBA reaction mix. (b) Confirmation of presence of NASBA product (c) and (d) Schematic showing binding of nucleic acid probe sequence to NASBA product and detection by fluorescence and comparison of ‘conventional’ with ‘toehold’ nucleic acid probe sequences (e) Real-time detection of binding of nucleic acid probe sequence to NASBA product (f) Schematic diagrams of the lateral flow assay utilising the detection of incorporated labelled NTP (top panel) or two nucleic acid probe sequences comprising independent molecular labels (bottom panel) (g) and (h) Effect of concentration of biotinylated UTP on amount and detection of NASBA product, and detection of NASBA product by lateral flow assay.

Figure 3: (a) and (b) Schematic of the NASBA product comprising nucleic acid primer sequences including barcode and sequencing adapter sequences, and of the second stage sequencing of the NASBA product (c) and (d) Real-time and end-point detection of the NASBA product further amplified using primers which are complementary to sequencing adapter/T7 RNA polymerase promoter sequences.

Figure 4: Schematic of the NASBA product comprising nucleic acid primer sequences including barcode and sequencing adapter sequences (top panel), and of the second stage sequencing of the NASBA product, wherein the preparation of the sample/library for sequencing comprises circular inverse PCR as well as linear PCR of the NASBA product (lower panels).

Figure 5: (a) Schematic of the first stage NASBA reaction including a denaturing step at 65°C. (b) and (c) Real-time detection of binding of nucleic acid probe sequence to NASBA product produced from saliva sample (d) Schematic of the first stage NASBA reaction without a denaturing step (e) Real-time detection of binding of nucleic acid probe sequence to NASBA product produced from saliva sample without a denaturing step.

Figure 6: (a) and (b) Selection of nucleic acid primers sequences for use in the

NASBA reaction (c) Effect of concentration of nucleic acid primers sequences on amount of NASBA product (d) and (e) Effect of reverse transcriptase and pH of NASBA reaction mix on amount of NASBA product (f) Effect of concentration of nucleic acid probe sequence on amount of NASBA product in real-time.

DETAILED DESCRIPTION OF THE INVENTION

(a) obtaining a biological sample from an individual; (b) incubating the biological sample with a lysis solution to obtain a lysate; and

References herein to “target agent” include any infectious agent which may be detected by the presence of a nucleic acid sequence which is unique to said agent, such as the genome or part (i.e. a “region”) of the genome of said agent. For example, the target agent may be a bacteria or a virus, such as human immunodeficiency virus (HIV), human papilloma virus (HPV), zika virus, SARS-associated coronavirus (SARS-CoV), SARS-CoV-2, influenza virus, E. coli, a water-borne pathogen or a species of the gut microbiota. In one embodiment, the target agent is a virus. In a further embodiment, the target agent is a coronavirus. In a particular embodiment, the target agent is SARS-CoV-2.

SARS-CoV-2 is an enveloped virus with a positive-sense, single-stranded RNA genome approx. 30 kb in length, similar to other coronaviruses such as the order Nidovirales, family Coronaviridae and subfamily Coronavirinae (Kim et al. 2020 Cell 181:1-8; https://doi.org/ 1Q.1Q16/j-celi.2Q2Q.Q4.Q11). It belongs to the genus betacoronavirus, together with SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV). A mature SARS-CoV-2 has four structural proteins: envelope (E), membrane (M), nucleocapsid (N) and spike (S) which is a critical glycoprotein responsible for virus binding and entry. The gene encoding S has one of the highest gene expressions (Kim et al. 2020) and is a particularly promising and interesting target for SARS-CoV-2 vaccines (Shang et al. 2020 NPJ Vaccines 5:18; https://dol.org/10.1038/s41541 -020-0170-0).

Thus, the nucleic acid sequence unique to the target agent may also comprise a DNA or an RNA sequence such as the genome (or a part/region thereof) of the target agent, a gene (or a part/region thereof) or an expression product of a gene. For example, the nucleic acid sequence unique to the target agent may include mitochondrial DNA or RNA (mtDNA or mtRNA). In a particular example, wherein the target agent is a virus, the unique nucleic acid sequence may be the RNA genome or part (i.e. a “region”) of the RNA genome of the virus. In one embodiment, wherein the target agent is a virus such as SARS-CoV-2, the unique nucleic acid sequence is the spike (S) gene. In another embodiment, the unique nucleic acid sequence is the product of the spike (S) gene. In a further embodiment, the target agent is SARS-CoV-2 and the unique nucleic acid sequence is the spike (S) gene of SARS-CoV-2.

The spike protein (S protein) is a large type I transmembrane protein of SARS-CoV-2. This protein is highly glycosylated as it contains 21 to 35 N-glycosylation sites. Spike proteins assemble into trimers on the virion surface to form the distinctive “corona”, or crown-like appearance. The ectodomain of all CoV spike proteins share the same organization in two domains: a N-terminal domain named S1 that is responsible for receptor binding and a C-terminal S2 domain responsible for fusion. CoV diversity is reflected in the variable spike proteins (S proteins), which have evolved into forms differing in their receptor interactions and their response to various environmental triggers of virus-cell membrane fusion.

Thus, in one embodiment, the unique nucleic acid sequence is the part/region of the spike (S) gene which encodes either the S1 or S2 domain of the spike protein (S protein). In a further embodiment, the unique nucleic acid sequence is the part/region of the spike (S) gene which encodes the S1 domain of the spike protein (S1 protein). In a yet further embodiment, the unique nucleic acid sequence is the part/region of the spike (S) gene which encodes the S2 domain of the spike protein (S2 protein).

References herein to “individual” and “subject” refer to an individual known or suspected to be infected with the target agent. Such individuals include “asymptomatic” individuals, i.e. those with symptoms or suspected symptoms of COVID-19 or those who are infected with the virus but show no clinical signs or symptoms of the disease. They may also include those who show no signs of the disease and are not infected with the virus but who have had contact with an infected individual. Such contact with an infected individual may have occurred within 2 days, 5 days, 7 days or 14 days preceding the individual being identified as infected. Alternatively, such contact may have occurred within 1 week or within 2 weeks preceding the individual being identified as infected.

It will therefore be appreciated that references herein to “identifying the presence” of a target agent refer to the presence of infection. Such references also include the diagnosis of the disease or infection, such as the diagnosis of SARS-CoV-2 infection and COVID-19. In one embodiment, the method of the invention comprises an isothermal nucleic acid sequence-based amplification (NASBA) stage. NASBA (similar to reverse-transcription loop- mediated isothermal amplification (RT-LAMP)) is a one-step nucleic acid amplification method which, unlike PCR, does not require thermal cycling. Thus, it is an isothermal technique which does not require specialist equipment and is usually performed at a constant temperature of 41 °C. By utilising reverse transcriptase the technique is effective in detecting viruses with an RNA genome (e.g. group II, IV and V viruses (based on the Baltimore Virus Classification system)). NASBA was originally developed by J. Compton in 1991 (Compton J. 1991 Nature 350(6313):91-2; hte//dO org/10,1038%2F350091a0) and may be briefly described as follows:

1. a first nucleic acid primer sequence, with a T7 RNA polymerase promoter region at its 5’ end, binds to a complementary site at the 3' end of an RNA template;

2. reverse transcriptase synthesises an opposite, complementary DNA (cDNA) strand (antisense), extending the 3' end of the first nucleic acid primer;

3. RNase destroys the RNA template from the double-stranded cDNA-RNA hybrid (e.g. RNase H only destroys RNA in RNA-DNA hybrids, but not single-stranded RNA);

4. a second nucleic acid primer sequence binds to the 5' end of the now single- stranded antisense cDNA strand;

5. reverse transcriptase again synthesises another cDNA strand from the attached primer resulting in a double-stranded cDNA product;

6. T7 RNA polymerase binds to the promoter region on the double-stranded cDNA product and produces an antisense RNA strand (since T7 RNA polymerase transcribes in the 3' to 5' direction the sense cDNA is transcribed and an antisense RNA is produced). This is repeated, and the polymerase continuously produces complementary RNA strands from the double-stranded cDNA product which results in amplification;

7. a cyclic phase begins similar to 1-6, however, the second nucleic acid primer first binds to the antisense RNA;

8. reverse transcriptase now produces a sense cDNA/antisense RNA hybrid;

9. RNase again degrades the RNA and the first nucleic acid primer with the T7 RNA polymerase promoter region binds to the now single stranded sense cDNA;

10. reverse transcriptase now produces the complementary antisense cDNA, creating a double-stranded cDNA duplex; and

11. like in step 6, T7 RNA polymerase binds to the promoter region, producing an antisense RNA strand. NASBA has been used for the detection of various viruses, including HIV-1, influenza, and SARS-CoV (Kievits etal. 1991 J. Virol. Methods 35(3):273-286; ht†ps://doi.org/10.1016/0166- 0934(91 ;90069-C, Collins et al. 2002 J. Virol. Methods 103(2):213-225; https://doi.org/ 10.1016/80166-0934(02)00034-4, and Keightley et al. 2005 J. Med. Virol. 77(4):602-608; 0s:/^oi._.o[g/i0._.i002/!my.20498) and RT-LAMP has been used to detect SARS-CoV-2 (Zhang et al. 2020 bioRxiv https://doi.org/10.1101/2Q20.04.06.Q25e35). However, all detection methods known to date either only detect the production of the NASBA product in real-time or utilise NASBA solely to produce a product which is subsequently used in downstream assays to identify the presence of a target agent. For example, in Zhang et al. 2020 bioRxiv an RT-LAMP product (comprising a single barcode sequence) is utilised in sequencing to identify the presence of the virus and Keightley et al. 2005 J. Med. Virol detect the production of a NASBA product in real-time to identify the presence of the virus. By contrast, the method of the present invention utilises end-point detection of the NASBA product itself by independently detecting the binding of nucleic acid probe sequences comprising molecular labels to identify the presence of a target agent, such as a virus (e.g. SARS-CoV-2). Furthermore, the method of the present invention may additionally utilise NASBA to optionally incorporate two barcode sequences into the NASBA product which enables the pooling or multiplexing of large numbers of samples for sequencing to identify and/or confirm the presence of the test agent. A second sequencing stage improves accuracy in a highly scalable way and may also be used to provide insight into viral evolution, such as by monitoring a mutation and/or mutation rate.

Therefore, the method of the invention provides an improved test in the form of an optionally two-stage method which is accurate, cheap, scalable, portable and fast, for identifying the presence of a target agent, such as a virus, in a sample. Such two-stage methods allow decentralised and frequent testing of a large proportion of a population to quickly isolate individuals infected with the target agent, even in countries with limited medical resources. The isolation of infected individuals can then be complemented with the tracing and identification of those with whom the individual has had contact to limit any local spread of infection at the earliest possible stage. A second sequencing stage of the method may then be used to identify and/or confirm the presence of the target agent in the sample and thus whether the individual is infected with the target agent and can also be used to provide additional data for the target agent, such as mutation rate which provides an insight into viral evolution, relevant for the monitoring of viral strains, their spread and their transmission patterns. Isothermal Nucleic Acid Sequence-Based Amplification (NASBA)

In one embodiment, the method comprises incubating the biological sample or a lysate obtained from the biological sample with a NASBA reaction mix comprising reverse transcriptase, RNA polymerase, RNase, nucleic acid primer sequences and nucleic acid probe sequences comprising independent molecular labels. Such incubating with a NASBA reaction mix results in a NASBA product being obtained. In one embodiment, the biological sample or lysate is incubated with a NASBA reaction mix for between 40 minutes and 2 hours. In particular embodiments, incubation is for 1 hour, 1.5 hour or 2 hours. In a further embodiment, incubation is for 1 hour.

Reverse transcriptases are enzymes used to generate complementary DNA (cDNA) from an RNA template and are used in nature by retroviruses to replicate their genomes. They are able to convert a single-stranded RNA genome (or a part/region of an RNA genome) of a virus, such as SARS-CoV-2, into cDNA. Thus, in one embodiment, the NASBA reaction mix used in the method comprises a reverse transcriptase for converting the RNA genome of a target agent, such as a virus (e.g. SARS-CoV-2), into cDNA. The reverse transcriptase may be selected from, without limitation: avian myeloblastosis virus (AMV) reverse transcriptase, ProtoScript reverse transcriptase and ProtoScript II reverse transcriptase. In a particular embodiment, the reverse transcriptase is ProtoScript II reverse transcriptase.

It will be appreciated that the concentration or amount of reverse transcriptase present in the NASBA reaction mix may be varied or altered in order to optimise the production of NASBA product, for example to increase the amount of cDNA produced from an RNA template. In one embodiment, the concentration of reverse transcriptase, such as the amount of ProtoScript II, in the NASBA reaction mix is between 10 U/ml and 5,000 U/ml, such as between 100 U/ml and 3,000 U/ml. In a further embodiment, the concentration of reverse transcriptase is 250 U/ml. In an alternative embodiment, the concentration of reverse transcriptase is 2,500 U/ml.

RNases (ribonucleases) catalyse the degradation of RNA strands. In one embodiment, the NASBA reaction mix comprises RNase to degrade the original template RNA genome (or part/region of the RNA genome) from which cDNA has been generated. It will be appreciated that various RNases may be used in NASBA reaction mix to perform the method of the invention. In one embodiment, the RNase is RNase H. In an alternative embodiment, the RNase is RNase III. RNA polymerases synthesise RNA from a double-stranded DNA or cDNA template. Therefore, in one embodiment, the NASBA reaction mix used in the method of the invention comprises RNA polymerase to produce an RNA strand from a double-stranded cDNA. In a further embodiment, the RNA polymerase comprised in the NASBA reaction mix produces multiple RNA strands from a double-stranded cDNA, resulting in amplification. In one embodiment, the RNA polymerase is T7 RNA polymerase. Therefore, in certain embodiments, the T7 RNA polymerase promoter sequence is incorporated into the NASBA product, such as by being present in a nucleic acid primer sequence.

Nucleic acid primer sequences utilise sequence complementarity to bind template RNA or DNA and allow the synthesis of further RNA or DNA strands by reverse transcriptase. Reverse transcriptase uses the nucleic acid primer sequence as a starting point or ‘primer’ to synthesise an opposite, complementary strand to the template. The sequences of said nucleic acid primers determine the locations of binding in the template and the identity/sequence of the resulting synthesised strand (e.g. the NASBA product). Therefore, in some embodiments, the sequences of the nucleic acid primers are complementary to sequences in the genome of the target agent. In such embodiments, the nucleic acid sequences provide the specific amplification of a particular region of the target agent genome. In a further embodiment, the sequences in the target agent genome to which the nucleic acid primers bind are unique to the target agent. For example, wherein the target agent is a virus (e.g. SARS-CoV-2), the sequences in the target agent genome to which the nucleic acid primers bind are present in the gene encoding spike (S). In a further embodiment, the nucleic acid primer sequences specifically bind to sequences unique to the SARS-CoV-2 genome. In a yet further embodiment, the nucleic acid primer sequences specifically bind to unique sequences in the SARS-CoV-2 spike (S) gene. In one embodiment, the nucleic acid primer sequences specifically bind to unique sequences in the part/region of the spike (S) gene which encodes either the S1 or S2 domain of the spike protein (S protein). In a further embodiment, the nucleic acid primer sequences specifically bind to unique sequences in the part/region of the spike (S) gene which encodes the S1 domain of the spike protein (S1 protein). In a yet further embodiment, the nucleic acid primer sequences specifically bind to unique sequences in the part/region of the spike (S) gene which encodes the S2 domain of the spike protein (S2 protein).

In one embodiment, the nucleic acid primer sequences are selected from:

In a particular embodiment, the primer sequences are TGACTGGAGTTCAGACGTGTGCTC TTCCG AT CTCCAGCAACT GTTT GTGGACCT A (SEQ ID NO: 23); and AATTCTAATACG ACTCACT AT AGGGAGAAGGACACCT GTGCCT GTT AAACCAT (SEQ ID NO: 12).

In a yet further embodiment, the concentration of the nucleic acid primer sequences in the NASBA reaction mix is 0.025mM. For example, the concentration of the nucleic acid primer sequences are 0.025mM each. This concentration of the nucleic acid primer sequences was found to provide good yield of the NASBA product (see Figure 6c).

In certain embodiments, the method comprises the step: (d) independently detecting the binding of nucleic acid probe sequences comprising molecular labels to the NASBA product, wherein the binding of the nucleic acid probe sequences to the NASBA product identifies the presence of the target agent in the sample, and wherein said NASBA product corresponds to a region of the target agent genome and the nucleic acid primer sequences are complementary to regions of the target agent genome flanking said region of the target agent genome corresponding to the NASBA product. Therefore, in one embodiment, the NASBA reaction mix comprises nucleic acid probe sequences comprising independent molecular labels which are used for detecting the binding of said nucleic acid probe sequences. Nucleic acid probe sequences are complementary to unique sequences in the genome of the target agent which are amplified by NASBA. Thus, the nucleic acid probe sequences bind to the NASBA product which corresponds to a region of the target agent genome and detection of binding of the nucleic acid probe sequence indicates the presence of the NASBA product. It will therefore be appreciated that in combination with nucleic acid primer sequences which bind to unique sequences in the target agent genome and lead to the amplification by NASBA of a region of the target agent genome, the nucleic acid probe sequences which bind to unique sequences in the NASBA product provide additional specificity.

It will further be appreciated that the NASBA reaction mix may comprise one, two or more nucleic acid probe sequences, each comprising an independent molecular label. In one embodiment, the NASBA reaction mix comprises two nucleic acid probe sequences, wherein each of the two nucleic acid probe sequences bind to different regions of the NASBA product. References herein to “independent molecular labels” refer to molecular labels which are different in their identity or differ in their method of detection. For example, wherein the NASBA reaction mix comprises two nucleic acid probe sequences, the first may comprise a molecular label selected from a fluorophore or a fluorophore and a quencher, and the second may comprise digoxigenin (DIG) or biotin. According to this example, detection of binding of the first nucleic acid probe sequence is by fluorescence and detection of the second nucleic acid probe sequence is by an anti-DIG or anti-biotin moiety. In an alternative example, the first nucleic acid probe sequence may comprise a molecular label selected from a first fluorophore or a first fluorophore and a quencher, and the second may comprise a second fluorophore or second fluorophore and quencher, wherein the second fluorophore or fluorophore and quencher differs from the first. According to this alternative example, detection of binding of the first nucleic acid probe sequence is by fluorescence of the first fluorophore and detection of the second nucleic acid probe sequence is by fluorescence of the second fluorophore. Thus, in one embodiment, binding of each nucleic acid probe sequence may be independently detected. In a further embodiment, two nucleic acid probe sequences each comprise independent molecular labels, such that binding of each nucleic acid probe sequence may be independently detected. In a yet further embodiment, the independent molecular labels of the nucleic acid probe sequences are selected from the group consisting of: a fluorophore and a quencher, such as 6-carboxyfluorescein (FAM) and BHQIdT, respectively; digoxigenin (DIG); and biotin (Bio). In a particular embodiment, the independent molecular probes are 6-carboxyfluorescein (FAM) and biotin (Bio). Thus, in one embodiment, independently detecting the binding of the nucleic acid probe sequences in step (d) is performed using both an anti-FAM antibody and an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle. In an alternative embodiment, the independent molecular probes are digoxigenin (DIG) and biotin (Bio). Therefore, in a further embodiment, independently detecting the binding of the nucleic acid probe sequences in step (d) is performed using both an anti-DIG antibody and an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle. In particular embodiments, the anti-biotin nanoparticle is a neutravidin complex streptavidin-carbon nanoparticle allowing the detection/visualisation of the presence of the NASBA product with the naked eye.

Thus, in some embodiments, detection of the binding of the nucleic acid probe sequences to the NASBA product using the independent molecular labels specifically identifies the presence of the target agent. Wherein the target agent is a virus, such as SARS-CoV-2, detecting the binding of the nucleic acid probe sequences to the NASBA product identifies the presence of the virus. In one embodiment, the nucleic acid probe sequences specifically bind sequences in the NASBA product corresponding to the spike (S) gene. In a further embodiment, the nucleic acid probe sequences specifically bind sequences in the NASBA product which correspond to sequences unique to the SARS-CoV-2 genome. In a yet further embodiment, the nucleic acid probe sequences specifically bind to sequences in the NASBA product which correspond to sequences in the SARS-CoV-2 spike (S) gene. In one embodiment, the nucleic acid probe sequences specifically bind to unique sequences in the NASBA product which correspond to parts/regions of the spike (S) gene which encode either the S1 or S2 domain of the spike protein (S protein). In a further embodiment, the nucleic acid probe sequences specifically bind to unique sequences in the NASBA product which correspond to the parts/regions of the spike (S) gene which encode the S1 domain of the spike protein (S1 protein). In a yet further embodiment, the nucleic acid probe sequences specifically bind to unique sequences in the NASBA product which correspond to the parts/regions of the spike (S) gene which encode the S2 domain of the spike protein (S2 protein).

In one embodiment, the nucleic acid probe sequences are selected from: FAM- AUUGACAGUCUACUAAUUUGGUUAAAAACAAAUGUGUCAA-BHQIdT-UUCAACUUCAA UG-propyl (SEQ ID NO: 34), FAM-AAAAGTCT ACT AATTTGGTT AAAAACAAAT GT GTCAA TTTCAACTTC (SEQ ID NO: 35), FAM-AAAAGTCT ACT AATTT GGTT AAAA (SEQ ID NO: 36) and ACAAATGTGTCAATTTCAACTTCA-Bio (SEQ ID NO: 37), wherein FAM represents 6- carboxyfluorescein, BHQIdT represents Black Hole Quencher 1 dT and Bio represents biotin. In a further embodiment, the two nucleic acid probe sequences are: FAM- AUUGACAGUCUACUAAUUUGGUUAAAAACAAAUGUGUCAA-BHQIdT-UUCAACUUCAA UG-propyl (SEQ ID NO: 34) and FAM-AAAAGTCT ACT AATTTGGTT AAAAACAAAT GT GTCAATTTCAACTTC (SEQ ID NO: 35) or the two nucleic acid probe sequences are: FAM- AAAAGTCT ACT AATTTGGTT AAAA (SEQ ID NO: 36) and ACAAATGTGTCAATTTCAACTT CA-Bio (SEQ ID NO: 37). In a particular embodiment, at least one of the nucleic acid probe sequences is: FAM-AAAAGTCT ACT AATTTGGTT AAAAACAAAT GT GTCAATTT CAACTT C (SEQ ID NO: 35).

Thus, in certain embodiments, the independent molecular label of the nucleic acid probe sequence is a fluorophore and a quencher. For example, the fluorophore may be 6-carboxyfluorescein (FAM) and the quencher may be BHQIdT. In one embodiment, the fluorophore and quencher are each located at different ends of the nucleic acid probe sequences (e.g. the fluorophore may be located at the 5’ end and the quencher located at the 3’ end or vice versa). In another embodiment, the fluorophore and quencher are located at different locations within the nucleic acid probe sequences (e.g. wherein the nucleic acid probe sequence comprises a ‘toehold’ sequence). Wherein the independent molecular label is a fluorophore and a quencher it will be appreciated that detecting the binding of the nucleic acid probe sequence may be performed by detecting and/or measuring the fluorescence of said fluorophore. Therefore, in one embodiment, detecting the binding of the nucleic acid probe sequences comprises detection of fluorescence emitted by the fluorophore when the fluorophore and quencher are separated by the binding of the nucleic acid probe sequences to the NASBA product (e.g. as shown in Figure 2c). Such detection may be performed in real time. Alternatively, detecting the binding of the nucleic acid probe sequences may be performed using an antibody directed against said fluorophore. Thus, in one embodiment, detecting the binding of the nucleic acid probe sequences in step (d) comprises using an anti- FAM antibody. In an alternative embodiment, the independent molecular label of the nucleic acid probe sequences is digoxigenin (DIG). Thus, in certain embodiments, detecting the binding of the nucleic acid probe sequences in step (d) comprises using an anti-DIG antibody. In another embodiment, the independent molecular label of the nucleic acid probe sequence in biotin (Bio). Thus, in a yet further embodiment, detecting the binding of the nucleic acid probe sequences in step (d) comprises using an anti-biotin moiety, such as streptavidin, neutravidin or avidin.

In a particular embodiment, the nucleic acid probe sequences are molecular beacons. Molecular beacons are hairpin-shaped molecules, such as nucleic acid molecules, with a fluorophore and a quencher covalently attached. The secondary structure formed by the hairpin structure brings the fluorophore and quencher into close proximity and no fluorescence is detected. Upon recognition of the target, for example through complementarity of the sequence of the molecular beacon with the target, the fluorophore and quencher are spatially separated due to hybridisation, resulting in fluorescence (e.g. as shown in Figure 2c). Wherein the molecular beacon is a ‘toehold’ molecular beacon, such as a toehold DNA beacon or a toehold RNA beacon, the toehold sequence provides an initial anchor point for the beacon to bind/hybridise to its target sequence and assists in the unwinding of the hairpin structure. Such ‘toehold’ molecular beacons may further comprise a 2’-0-methyl modification to increase target affinity and provide stability against degradation, and/or comprise a 3’-propyl group which prevents polymerase extension of the molecular beacon sequence. Thus, in one embodiment, the molecular beacon, such as a toehold RNA beacon, comprises a 2’-0-methyl modification and/or a 3’-propyl group.

In one embodiment, the concentration of the nucleic acid probe sequences in the NASBA reaction mix is between 0.016mM and 0.1mM. In a further embodiment, the concentration of the nucleic acid probe sequences is 0.02mM. This concentration of nucleic acid probe sequences was found to provide sensitive detection of the NASBA product (see Figure 6f).

In one embodiment, the lower limit of detection using the nucleic acid probe sequences is between 10 and 1,000 copies of NASBA product. In certain embodiments, the lower limit of detection is 10, 100 or 1 ,000 copies of NASBA product. In a particular embodiment, the lower limit of detection is 10 copies of NASBA product. In another embodiment, the lower limit of detection is 100 copies of NASBA product.

In a further embodiment, the nucleic acid primer sequences are complementary to regions of the target agent genome flanking the region of the target agent genome corresponding to the NASBA product. In a yet further embodiment, the nucleic acid probe sequences are complementary to and bind the NASBA product which corresponds to a region of the target agent genome located between the binding sites of the nucleic acid primer sequences.

In one embodiment, the pH of the NASBA reaction mix is pH 8.3 or pH 8.5, in particular pH 8.4. As can be seen in Figure 6, at pH 8.4 a good yield of NASBA product was achieved.

In one embodiment, the sample is a biological sample. The particular type of biological sample in which the presence of the target agent is identified will be appreciated to depend on the target agent and, for example wherein the target agent is a pathogen, the location of infection. For example, wherein the target agent is a virus which infects the respiratory tract (e.g. SARS-CoV-2), the biological sample may be such that it is collected from parts of the respiratory tract or is derived from the respiratory tract or throat. Therefore, in some embodiments, the biological sample is selected from: saliva, a nasopharyngeal swab, an oropharyngeal swab, a nasopharyngeal wash or aspirate, a nasal wash or aspirate, bronchoalveolar lavage, tracheal aspirate and sputum. In a further embodiment, the biological sample may be serum. As will be readily appreciated, wherein obtaining the biological sample does not require invasive techniques or specialist training is especially advantageous and will allow an individual to provide the sample themselves. In a particular embodiment, the sample is saliva.

It will be appreciated that, in some embodiments, a biological sample is incubated with a lysis solution to obtain a lysate. Said lysate will comprise components of the target agent, including a nucleic acid sequence unique to the target agent (e.g. its genome or parts/regions of its genome) as well as proteins of the target agent (e.g. structural proteins). Therefore, in one embodiment, the biological sample is incubated with a lysis solution to yield the nucleic acid sequence unique to the target agent from the target agent or, wherein the target agent is a virus, from host cells in the biological sample. Lysis solutions and the conditions for incubation with lysis solutions are well known in the art and may, for example, include incubation at 65°C and/or 95°C. However, it will further be appreciated that components of the target agent and a nucleic acid sequence unique to the target agent may be present and detectable in the biological sample without the need to lyse the sample. Therefore, in one embodiment, the biological sample is not incubated with a lysis solution.

In one embodiment, the NASBA reaction mix may additionally comprises labelled NTP. Such labelled NTPs are incorporated into the RNA or cDNA strands generated by the reverse transcriptase and/or RNA polymerase during NASBA. Therefore, in one embodiment, the labelled NTPs are incorporated into the NASBA product. It will be appreciated that labelled NTPs which may be used in the method of the invention include, but are not limited to, biotinylated NTP, fluorescently labelled NTP (e.g. 6-carboxyfluorescein-NTP (FAM-NTP)) and digoxigenin-NTP (DIG-NTP)). In a particular embodiment, the labelled NTP is specifically incorporated only into RNA strands generated during NASBA. Thus, in one embodiment, the labelled NTP is labelled-UTP, such as bitoin-UTP, in particular Bio-11-UTP. Such labelled- UTPs will be incorporated by RNA polymerase into the generated RNA strand during amplification. In one embodiment, the amount of labelled NTPs such as biotinylated NTPs (e.g. Bio-11-UTP) in the NASBA reaction mix is between 50% and 1% of the total amount of that NTP, such as between 35% and 10%. In a particular embodiment, the amount of labelled NTP, such as biotinylated-UTP (e.g. Bio-11-UTP), in the NASBA reaction mix is 12% of the total amount of UTP. In a further embodiment, the concentration of labelled NTP in the NASBA reaction mix is between 0.04mM and 2mM, such as 0.5mM. Labelled NTPs incorporated into RNA strands generated or amplified during NASBA (i.e. into the NASBA product), such as biotinylated NTPs (e.g. biotin-UTP/Bio-11-UTP) may be utilised to detect the NASBA product. Thus, in one embodiment, the NASBA stage additionally comprises the step: (e) detecting the presence of labelled NTP in the NASBA product, wherein the presence of labelled NTP identifies the presence of the target agent in the sample. In an alternative embodiment, step (d) of the NASBA stage is replaced by: (e) detecting the presence of labelled NTP in the NASBA product, wherein the presence of labelled NTP identifies the presence of the target agent in the sample. In one embodiment, the presence of biotinylated NTPs in the NASBA product is detected. Such detection may include the binding of anti-biotin moieties, such as anti-biotin antibodies and/or streptavidin, neutravidin or avidin. Therefore, in one embodiment, detecting the presence of biotinylated NTP in the NASBA product according to step (e) is performed using streptavidin, neutravidin or avidin. Anti-biotin moieties will additionally comprise a molecular label such as streptavidin or a gold or carbon nanoparticle or fluorophore allowing the visualisation or detection of binding. Thus, in a further embodiment, detecting the presence of labelled NTP in the NASBA product according to step (e) is performed using an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle. In a particular embodiment, the anti-biotin moiety is a neutravidin complex streptavidin-carbon nanoparticle allowing the detection/visualisation of the presence of the NASBA product with the naked eye. In a yet further embodiment, the presence of fluorescent NTPs in the NASBA product is detected. Such detection includes detecting the emission from a fluorophore such as 6-carboxyfluorescein (FAM). Therefore, in one embodiment, detecting the presence of labelled NTP in the NASBA product according to step (e) is performed by detecting and/or measuring fluorescence, such as real-time fluorescence. In a yet further embodiment, the presence of digoxigenin-labelled NTPs (DIG- NTPs) in the NASBA product is detected. Therefore, in one embodiment, detecting the presence of DIG-NTPs in the NASBA product according to step (e) is performed using an anti- DIG antibody.

In one embodiment, detecting the presence of the labelled NTP in the NASBA product and the binding of the nucleic acid probe sequences which bind to said NASBA product identifies the presence of a target agent in a sample. Therefore, in one embodiment, the NASBA stage of the present method comprises both steps: (d) detecting the binding of the nucleic acid probe sequences comprising independent molecular labels to the NASBA product and (e) detecting the presence of labelled NTP in the NASBA product.

In a further embodiment, detecting steps (d) and/or (e) are performed using a lateral flow assay. Thus, in one embodiment, detecting the binding of the nucleic acid probe sequences, such as two nucleic acid probe sequences, comprising independent molecular labels (i.e. detecting step (d)) is performed using a lateral flow assay. In an alternative embodiment, detecting the presence of the labelled NTPs in the NASBA product and the binding of the nucleic acid probe sequences to said NASBA product (i.e. detecting steps (d) and (e)) are performed using a lateral flow assay. Such lateral flow assays are known in the art and may provide a test line comprising a capture moiety, such as a capture antibody, and control line. Thus, in one embodiment, the lateral flow assay comprises a test line comprising a capture antibody which binds to a first independent molecular label comprised on a first nucleic acid probe sequence, and a control line comprising a second independent molecular label which is the same as the independent molecular label comprised on a second nucleic acid probe sequence. In an alternative embodiment, the lateral flow assay comprises a test line comprising a capture antibody which binds to a first independent molecular label comprised on a first nucleic acid probe sequence, and a control line comprising a second independent molecular label which is the same as the label comprised on a labelled NTP. In a particular embodiment, the test line comprises an anti-fluorophore antibody, such as an anti-FAM antibody, and the control line comprises biotin. In a further embodiment, the test line comprises an anti-DIG antibody and the control line comprises biotin.

In one embodiment, detecting steps (d) and/or (e) may be performed using a lateral flow assay without purification or dilution of the NASBA product.

Sequencing

In one embodiment, the method additionally comprises sequencing the NASBA product (e.g. by massively parallel next-generation sequencing (NGS)). Two-stage testing strategies provide confirmation of a result obtained from a first decentralised stage and can provide additional data for the target agent. For example, wherein the additional stage is sequencing, mutations of the target agent, its genome, a region of its genome or of an expression product may be identified and/or monitored. Such monitoring includes the monitoring of mutations and mutation rate in the target agent over time or over the course of infection. Therefore, in a further embodiment, sequencing of the NASBA product identifies and/or confirms the presence of the target agent in the sample. In a yet further embodiment, sequencing of the NASBA product identifies a mutation or is used to monitor a mutation and/or mutation rate in the genome of the target agent.

Thus, in a further aspect of the invention, there is provided a two-stage test or method for identifying the presence of a target agent in a sample, said two-stage test/method comprising: 1. performing NASBA on a sample as defined hereinbefore to obtain a NASBA product, and optionally detecting the binding of nucleic acid probe sequences to the NASBA product and/or optionally detecting the presence of labelled NTP in the NASBA product to identify the presence of the target agent in the sample; and

2. sequencing the NASBA product to identify and/or confirm the presence of the target agent in the sample and/or provide additional data for the target agent (e.g. to identify or monitor mutations).

References herein to “decentralised” refer to wherein the method or test is performed remotely from a central facility, such as at the point of care of the individual. Therefore, in one embodiment, the NASBA stage of the method is performed at the point of care for the individual. The point of care may comprise the individual’s home, a doctor’s surgery (e.g. a GP’s surgery) or a temporary testing site/facility (e.g. a ‘pop-up’ testing site/facility). In a further embodiment, the NASBA stage of the method is performed in the individual’s home or at a temporary testing site. A central facility is a location where further testing may be performed on the sample obtained from the individual or the product obtained by the method defined herein (e.g. the NASBA product), or a location where further analysis of the results obtained from the method defined herein may be performed. Such central facilities include hospital or research facilities and may provide sequencing facilities such as NGS and high throughput sequencing, including massively parallel NGS. Central facilities may be local to the individual and may also be the point of care or may be remote, such as in a different country to the point of care. Thus, in one embodiment, sequencing of the NASBA product is performed at a location separate from the point of care for the individual. In a further embodiment, sequencing of the NASBA product is performed at a sequencing facility, such as at a central sequencing facility.

It will be appreciated that references herein to “sequencing” are not limited to any particular technique for sequencing the NASBA product. For example, sequencing may be performed using a platform which comprises use of a polymerase chain reaction (PCR), such as a next generation sequencing (NGS) platform. Such platforms include sequencing-by-synthesis platforms such as lllumina’s TruSeq technology which supports massively parallel sequencing using a proprietary reversible terminator-based method that enables detection of single bases as they are incorporated into growing DNA strands. Further examples of suitable NGS platforms include, but are not limited to: the Roche 454 platform (i.e. Roche 454 GS FLX) which employs pyrosequencing, whereby a chemiluminescent signal indicates base incorporation and the intensity of signal correlates to the number of bases incorporated through homopolymer reads; Applied Biosystems’ SOLiD system (i.e. SOLiDv4); lllumina’s GAIIx, HiSeq 2000, NovaSeq, HiSeq4000 and MiSeq sequencers; Life Technologies’ Ion Torrent semiconductor-based sequencing instruments which use a strategy similar to sequencing-by-synthesis but detect signal by the release of hydrogen ions resulting from the activity of DNA polymerase during nucleotide incorporation; Pacific Biosciences’ PacBio RS; Sanger’s 3730x1; and nanopore-based sequencing platforms such as those in which the nanopore is constructed from a metal, polymer or plastic material or Oxford Nanopore Technologies’ organic-type nanopore-based system which mimics the situation of the cell membrane and protein channels in living cells.

Therefore, in certain embodiments, the nucleic acid primer sequences comprise adapter sequences for sequencing, such as for NGS. In one particular embodiment, the adapter sequence comprises the T7 RNA polymerase promoter. In a further embodiment, the adapter sequence comprises an lllumina sequencing adapter. Additionally, said nucleic acid primer sequences may comprise a barcode sequence. The presence of barcode sequences allow the multiplexing or pooling of samples from different individuals within the same sequencing ‘run’ whilst retaining the ability to identify data obtained from each individual. Thus, in a particular embodiment, the barcode sequence is unique to the individual. The length of the barcode sequence and whether the barcode sequence is present in one or both nucleic acid primer sequences determines the number of samples which can be pooled together. For example, with 5 variable nucleotides of barcode present in both nucleic acid primer sequences (resulting in 5 nucleotides of barcode at both the 5’ and 3’ ends of the NASBA product), up to a million samples can be labelled with 2,048 unique nucleic acid primer sequence pairs. Thus, in one embodiment, the nucleic acid primer sequences comprise a barcode sequence and an adapter sequence for sequencing. In one embodiment, the barcode sequence is a 4 to 30 nucleotide barcode sequence, such as an approximately 5 nucleotide barcode sequence. In a further embodiment, the barcode sequence is a 5 nucleotide barcode sequence. In a yet further embodiment, the barcode sequence is present in both nucleic acid primer sequences comprised in the NASBA reaction mix. In a still further embodiment, the NASBA product comprises barcode sequences located at both the 5’ and 3’ ends. Barcoded NASBA product can be further indexed with sequencing barcodes located in the primers used for preparing the NASBA product for sequencing (so called ‘indexing’). Therefore, in one embodiment, the NASBA product is further indexed. Said indexing increases the scale of sequencing and may be included during preparation of the sample/library for sequencing and may be in addition to individual- and/or sample-specific barcode sequences. Therefore, in a further embodiment, the NASBA product which comprises barcode sequences is further indexed. In one embodiment, the primers used for preparing the NASBA product for sequencing by linear PCR or for sequencing comprise a sequence selected from: AGCCAGCTCTGGAGAA TT CT AAT ACG ACT CACT AT AGGGAG AAGG (SEQ ID NO: 38), AATGATACGG CGACCACCGAGATCTACACNN N N N N N NAGCCAGCTCTGGAGAATTCTAATACGACTCA CT AT AGGGAGAAGG (SEQ ID NO: 39) and CAAGCAGAAGACGGCAT ACGAGATN N N N N N NNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 40), wherein NNNNNNNN represents an 8 nucleotide indexing barcode. In a further embodiment, the primers used for preparing (i.e. indexing) the NASBA product for sequencing by linear PCR are AAT GAT ACGGCGACCACCGAG AT CTACAC N N N N N N N N AGCCAGCTCTGGAGAATT CT AAT ACGACTCACT AT AGGGAGAAGG (SEQ ID NO: 39) and CAAGCAGAAGACG GCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 40). In a yet further embodiment, the primer used for sequencing is AGCCAGC T CTGG AG AATT CT AAT ACG ACT CACT AT AGGGAGAAGG (SEQ ID NO: 38). Furthermore, a total of 163 randomly selected unique pairs have been tested. No barcodes combination has shown to influence the NASBA amplification efficacy (data not shown).

In a yet further embodiment, preparation of the NASBA product (i.e. the sample/library) for sequencing comprises circular inverse PCR of the NASBA product. Such circular inverse PCR comprises three steps: (i) self-circularisation, (ii) inverse PCR and (iii) indexing PCR. Steps (i) and (iii) are known in the art and may comprise phosphorylation of the ends of the NASBA product, T4 ligase-mediated self-ligation and the addition of sequencing indexes, barcodes and/or adapter sequences as described hereinbefore. Inverse PCR according to step (ii) comprises inverse PCR primers which bind specifically to the NASBA product in opposite directions relative to one another. Therefore, in some embodiments, the inverse PCR primers are complementary to and bind to sequences in the NASBA product which correspond to a region of the target agent genome. In one embodiment, the sequences in the NASBA product to which the inverse PCR primers bind are unique to the target agent. For example, wherein the target agent is a virus (e.g. SARS-CoV-2), the sequences in the NASBA product to which the inverse PCR primers bind are present in the gene encoding spike (S). In a further embodiment, the inverse PCR primers specifically bind to sequences unique to the SARS-CoV-2 genome. In a yet further embodiment, the inverse PCR primers specifically bind to unique sequences in the SARS-CoV-2 spike (S) gene. In one embodiment, the inverse PCR primers specifically bind to unique sequences in the part/region of the spike (S) gene which encodes either the S1 or S2 domain of the spike protein (S protein). In a further embodiment, the inverse PCR primers specifically bind to unique sequences in the part/region of the spike (S) gene which encodes the S1 domain of the spike protein (S1 protein). In a yet further embodiment, the inverse PCR primers specifically bind to unique sequences in the part/region of the spike (S) gene which encodes the S2 domain of the spike protein (S2 protein). Thus, it will be appreciated that by performing circular inverse PCR as described herein, the specificity and sensitivity of the sequencing stage of the present method will be increased.

In one embodiment, the inverse PCR primers comprise a sequence selected from: TCGT CGGCAGCGTCAGAT GT GT AT AAGAGACAGCATTT GTTTTT AACCAAATT AGT AGACTTTT (SEQ ID NO: 41), GTCTCGTGGGCTCGG AG AT GTGTAT AAG AGACAGTT AAAAACAAA TGTGT CAATTT CAACTT CA (SEQ ID NO: 42), AAT GAT ACGGCGACCACCGAGATCT A CACNNNNNNNNTCGTCGGCAGCGTC (SEQ ID NO: 43) and CAAGCAGAAGACGGCAT ACGAGATNNNNNNNNGTCTCGTGGGCTCGG (SEQ ID NO: 44), wherein NNNNNNNN represents an 8 nucleotide indexing barcode. In a further embodiment, the inverse PCR primers are TCGTCGGCAGCGTCAGAT GT GT AT AAGAGACAGCATTT GTTTTT AACCAAAT TAGT AGACTTTT (SEQ ID NO: 41) and GTCTCGTGGGCTCGGAGATGTGTATAAGAG ACAGTT AAAAACAAAT GT GTCAATTT CAACTT CA (SEQ ID NO: 42) or the inverse PCR primers are AAT GAT ACGGCGACCACCGAGATCT ACACN N N N N N N NTCGTCGGCAGCGT C (SEQ ID NO: 43) and CAAGCAGAAGACGGCAT ACGAGATN N N N N N N NGTCTCGTGG GCTCGG (SEQ ID NO: 44).

The invention is further described below with reference to the following examples. EXAMPLES

Materials and Reagents

Buffer for NASBA Reaction Mix With DMSO:

Wthout DMSO:

*T ris-HCI pH 8.4 is made by titrating T ris-HCI pH 8.0 with NaOH pellet and pH determined by pH meter. Nucleotide Mix

Enzyme Mix

Diluted RNase H

Primer Selection

A batch of 13 pairs of primers were initially screened, and one pair (P8) was selected based on total RNA quantification with RNA HS Qubit and DNA quantification post-NASBA with qPCR (Figure 6a) as NASBA product includes both RNA and DNA. 40 additional pairs of primers were also designed based on NASBA primers selection criteria reported in literature (Pardee et al. 2016 Cell 165(5): 1255-1266; https://doi.Org/10.1016/i.cell 2016.04.059 and Deiman et al. 2002 Mol. Biotechnol. 20(2):163-179; httPs://do org/10J385/MB_:20_;2:163). The principle of primer selection is listed below. These 40 primer pairs were screened and 4 pairs were selected based on total RNA quantification (Figure 6a) and denaturing RNA gel (Figure 6b). Primer pair P8 was mainly used (left primer without lllumina handle and right primer with

T7 handle) in further NASBA optimisation and subsequent reactions and figures shown herein use primer pair P8. NASBA Primer Selection Rules

1. GC content between 40-60%;

2. Template hybridization regions of 20 to 24 nucleotides and with DNA melting temperatures above 41 °C;

3. No consecutive runs of four or more nucleotides;

4. An A base at the final 3’ nucleotide;

5. Minimal DNA primer internal secondary structure, including the T7 promoter region;

6. Minimal DNA primer dimer formation probability;

7. Higher GC content in the 6 nucleotides at the 5’ end of the primer that hybridized to the template;

8. Higher AT content in the 6 nucleotides at the 3’ end of the primer; and

9. Minimise secondary structure of NASBA product (amplicon).

Lysis of Samples

Mix sample (e.g. saliva) at 1 :1 ratio with QuickExtract DNA Extraction Solution. Incubate at 95°C for 5 min to ensure complete lysis of virus.

NASBA Reaction Protocol

1 pi of lysate was added to the NASBA reaction mix to make a total volume of 20mI. NASBA reaction mix can either be prepared in-house or from the Life Sciences NASBA liquid kit (see tables above).

NASBA reaction mix without the enzyme mix is incubated at 65°C for 2 min followed by a 10 min incubation at 41 °C. 5mI enzyme mix is then added into the reaction and incubated at 41 °C for a further 90-120 min.

Alternatively, NASBA reaction mix including the enzyme mix is prepared and incubated directly at 41 °C for a total of 90-120 min.

A fluorescence plate reader can be used to monitor the reaction in real-time.

In-House NASBA Reaction Mix

*see tables above for detailed composition.

Life Sciences NASBA Reaction Mix

Detection with Lateral Flow Dipstick

For detection with lateral flow assay, lyophilized NASBA mix is reconstituted as shown in the following table:

*see tables above for detailed composition. Crude saliva is mixed at a 1:1 ratio with QuickExtract DNA Extraction Solution at room temperature. 4mI of the saliva lysate is the added to the NASBA reaction mix (without the enzyme mix) to make a total volume of 60mI. This is incubated at 95°C for 5 min followed by a 10 min incubation at 41 °C. 20mI enzyme mix is then added into the NASBA reaction mix and incubated at 41 °C for a further of 90-120 min. The reaction product is transferred to the sample well of a PCRD/lateral flow assay test cassette. Results are shown within 10 min.

Alternatively, Bio-11-UTP can be added into the NASBA reaction mix at a final concentration of 0.5mM. At the end of the NASBA reaction, RNA is purified from the end-product using Direct-zol RNA Miniprep kit, and eluted with 30mI of RNase free water. After purification, 4.2mI of purified RNA is mixed with 1.8mI of FAM-labelled probe and 84mI of PCRD extraction buffer (see table below). 75mI of mix is then added to the sample well of a PCRD test cassette. Results will be shown within 10 min. Labelled Probe and PCRD Extraction Buffer Mix

Claims

1. A method of identifying the presence of a target agent in a sample comprising an isothermal nucleic acid sequence-based amplification (NASBA) stage, said method comprising the steps:

(a) obtaining a biological sample from an individual;

2. The two-stage method according to claim 1 , wherein the target agent is a virus, such as SARS-CoV-2.

3. The method according to claim 1 or claim 2, wherein the biological sample is selected from: saliva, a nasopharyngeal swab, an oropharyngeal swab, a nasopharyngeal wash or aspirate, a nasal wash or aspirate, bronchoalveolar lavage, tracheal aspirate and sputum, in particular wherein the biological sample is saliva.

4. The method according to any one of claims 1 to 3, wherein the reverse transcriptase is selected from: avian myeloblastosis virus (AMV) reverse transcriptase, ProtoScript reverse transcriptase and ProtoScript II reverse transcriptase.

5. The method according to any one of claims 1 to 4, wherein the concentration of the reverse transcriptase in the NASBA reaction mix is between 10 U/ml and 5,000 U/ml, such as 250 U/ml or 2,500 U/ml.

6. The method according to any one of claims 1 to 5, wherein the RNA polymerase is T7 RNA polymerase.

7. The two-stage method according to any one of claims 1 to 6, wherein the RNase is RNase H or RNase III.

8. The method according to any one of claims 1 to 7, wherein the nucleic acid primer sequences comprise a barcode sequence and an adapter sequence for sequencing.

9. The method according to claim 8, wherein the barcode sequence is a 4 to 30 nucleotide barcode sequence, such as a 5 nucleotide barcode sequence.

10. The method according to any one of claims 1 to 9, wherein the NASBA reaction mix comprises two nucleic acid probe sequences, wherein each of the two nucleic acid probe sequences bind to different regions of the NASBA product.

11. The method according to claim 10, wherein the two nucleic acid probe sequences each comprise independent molecular labels, such that binding of each nucleic acid probe sequence may be independently detected.

12. The method according to any one of claims 1 to 11 , wherein the independent molecular labels of the nucleic acid probe sequences are selected from the group consisting of: a fluorophore and a quencher, such as 6-carboxyfluorescein (FAM) and BHQIdT, respectively; digoxigenin (DIG); and biotin (Bio).

13. The method according to claim 12, wherein the independent molecular probes are 6-carboxyfluorescein (FAM) and biotin (Bio).

14. The method according to claim 13, wherein independently detecting the binding of the nucleic acid probe sequences in step (d) is performed using both an anti-FAM antibody and an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle.

15. The method according to claim 12, wherein the independent molecular probes are digoxigenin (DIG) and biotin (Bio).

16. The method according to claim 13, wherein independently detecting the binding of the nucleic acid probe sequences in step (d) is performed using both an anti-DIG antibody and an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle.

17. The method according to any one of claims 1 to 12, wherein the NASBA reaction mix additionally comprises labelled NTP, such as biotin-UTP, in particular Bio-11-UTP.

18. The method according to claim 17, wherein the amount of labelled NTP in the NASBA reaction mix is 12% of the total amount of UTP.

19. The method according to claim 17 or claim 18, wherein the method additionally comprises the step: (e) detecting the presence of labelled NTP in the NASBA product, and wherein the presence of labelled NTP identifies the presence of the target agent in the sample.

20. The method according to claim 19, wherein detecting the presence of labelled NTP in the NASBA product according to step (e) is performed using an anti-biotin nanoparticle, such as a streptavidin, neutravidin or avidin nanoparticle.

21. The method of any one of claims 1 to 12 or claim 19, wherein detecting steps (d) and/or (e) are performed by detecting and/or measuring fluorescence, such as real-time fluorescence.

22. The method according to any one of claims 1 to 20, wherein detecting steps (d) and/or (e) are performed using a lateral flow assay.

23. The method according to any one of claims 1 to 22, wherein the NASBA stage is performed at the point of care for the individual, such as in the individual’s home or at a temporary testing site.

24. The method according to any one of claims 1 to 23, wherein the method additionally comprises sequencing the NASBA product, such as by massively parallel next-generation sequencing (NGS).

25. The method according to claim 24, wherein sequencing of the NASBA product confirms the presence of the target agent in the sample, and optionally identifies a mutation or is used to monitor a mutation and/or mutation rate in the genome of the target agent.