WO2021231804A2

WO2021231804A2 - Methods and compositions for suppressing inflammation induced by gut microbes

Info

Publication number: WO2021231804A2
Application number: PCT/US2021/032349
Authority: WO
Inventors: Aaron BURBERRY; Kevin C. Eggan
Original assignee: President And Fellows Of Harvard College
Priority date: 2020-05-13
Filing date: 2021-05-13
Publication date: 2021-11-18
Also published as: WO2021231804A3

Abstract

Disclosed herein are methods and compositions for treating or inhibiting disorders resulting from a C9orf72 mutation. In some embodiments, the methods and compositions comprise administering an agent that alters the gut microbiome of an individual having a C9orf72 mutation.

Description

METHODS AND COMPOSITIONS FOR SUPPRESSING INFLAMMATION

INDUCED BY GUT MICROBES

RELATED APPLICATION (S )

This application claims the benefit of U.S. Provisional Application No. 63/024,461, filed on May 13, 2020, the entire teachings of which are incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

A hexanucleotide repeat expansion in C90RF72 is the most common genetic variant contributing to Amyotrophic lateral sclerosis (ALS) and Frontotemporal dementia (FTD).

The C90RF72 mutation acts through gain and loss of function mechanisms to induce pathways implicated in neural degeneration. The expansion is transcribed into a long repetitive RNA, which may negatively sequester RNA binding proteins prior to its non- canonical translation into neural-toxic di-peptide proteins. See Mori, et al. “The C9orf72 GGGGCC Repeat Is Translated into Aggregating Dipeptide-Repeat Proteins in FTLD/ALS.” Science 339, 1335-1338 (2013). Failure of RNA-polymerase to read through the mutation also reduces abundance of the endogenous C90RF72 gene product, which functions in endo- lysosomal pathways and suppresses systemic and neural inflammation. See, e.g., Shi, et al. “Haploinsufficiency leads to neurodegeneration in C90RF72 ALS/FTD human induced motor neurons.” Nat. Med. 24, 313-325 (2018). Notably, effects of the repeat expansion act with incomplete penetrance in ALS/FTD families, indicating that either genetic or environmental factors modify each individual’s risk of disease. Identifying disease modifiers is of significant translational interest, as it could suggest strategies that diminish the risk of developing ALS/FTD, or that slow progression.

SUMMARY OF THE INVENTION

As described herein, an environment with reduced abundance of immune-stimulating bacteria protects C9orf72 mutant mice from premature mortality and significantly ameliorates their underlying systemic inflammation and autoimmunity. Consistent with C9orf72 functioning to prevent microbiota from inducing a pathological inflammatory response, it was found that reducing microbial burden in mutants with broad spectrum antibiotics, as well as transplanting gut microflora from a protective environment attenuated inflammatory phenotypes, even after their onset. The studies described herein provide further evidence that the microbial constituency of a subject’s gut plays an important role in brain health and can interact in surprising ways with well-known genetic risk factors for nervous system disorders.

Disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with C9orf72 mutation in a subject. The methods comprise administering to the subject a first agent that alters gut microbiota in the subject.

Also disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with C9orf72 mutation in a subject. The methods comprise administering to the subject a first agent that reduces microbial burden in the subject.

In some embodiments, the disease or condition is a neurodegenerative or neurological disease, an inflammatory disease, and/or an autoimmune disease. In some embodiments, a neurodegenerative disease is amyotrophic lateral sclerosis (ALS) and/or frontotemporal dementia (FTD). In some embodiments, an autoimmune disease is selected from the group consisting of Ankylosing spondylitis, Asthma, chronic active hepatitis, Celiac disease, Crohn disease, dermatomyositis, insulin-dependent diabetes, idiopathic thrombocytopenic purpura, multiple sclerosis, myasthenia gravis, myxedema, pemphigoid, pernicious anemia, polymyositis, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, sarcoidosis and transverse myelitis, scleroderma, Sjogren syndrome, systemic lupus erythematosus, thyrotoxicosis, ulcerative colitis, and vitiligo. In some embodiments, an inflammatory disease is an autoimmune disease (e.g., Crohn’s disease and/or ulcerative colitis).

In some embodiments, the administration of the first agent to the subject has one or more effects selected from the group consisting of: reduces inflammation, reduces autoimmunity, improves motor function, reduces splenomegaly, reduces cytokine burden, reduces myeloid cell infiltration, and reduces microgliosis.

In some embodiments, the first agent comprises an antibiotic, bacteria, and/or a bacteriophage. In certain embodiments, an antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, and ceftriaxone. In certain embodiments, the bacteria is pro-survival gut microflora, and in more specific aspects is a synthetic pro-survival gut microflora. In certain embodiments, the bacteria is a probiotic. Disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with ALS or FTD. The methods comprise one or more administering to the subject a first agent that alters gut microbiota in the subject; administering to the subject a first agent that reduces Helicobacter spp. in the subject; administering to the subject a first agent that reduces the infiltration of peripheral immune cells into the spinal cord in the subject; administering to the subject a first agent that reduces microglia activation in the subject; and administering to the subject a first agent that reduces TNF-alpha release by bone marrow derived macrophages in the subject.

In some embodiments, the disease or condition comprises an inflammatory disease and/or an autoimmune disease.

In some embodiments, the first agent reduces gut microbiota in the subject. In some embodiments, the first agent comprises an antibiotic, bacteria, and/or a bacteriophage. In certain embodiments, an antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, and ceftriaxone. In certain embodiments, the bacteria is pro- survival gut microflora, and in more specific aspects is a synthetic pro survival gut microflora. In certain embodiments, the bacteria is a probiotic.

Also disclosed herein are pharmaceutical compositions, e.g., for altering the gut microbiota in a subject. The pharmaceutical compositions comprise an agent that alters gut microbiota in a subject.

In some embodiments, the agent reduces inflammation, reduces autoimmunity, improves motor function, reduces splenomegaly, reduces cytokine burden, reduces myeloid cell infiltration, and/or reduces microgliosis in a subject. In some embodiments, the agent reduces the infiltration of peripheral immune cells into the spinal cord of the subject. In some embodiments the agent comprises an antibiotic, bacteria, and/or a bacteriophage. In certain aspects, the agent comprises a synthetic pro-survival gut microflora. In some embodiments, the pharmaceutical composition further comprises a second agent (e.g., an antibiotic, bacteria, and/or a bacteriophage) In some embodiments, the second agent is a known medicament for treating a disease or condition associated with a C9orf72 mutation.

Also disclosed herein are methods of screening one or more test agents to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with loss of function of C9orf72 in a subject, comprising: providing a cell having a C9orf72 mutation in an environment having an increased microbial load; contacting the cell with one or more test agents; determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines; and identifying the test agent as a candidate agent if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines.

In some embodiments, the step of determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines comprises measuring cytokine and/or chemokine protein levels in the cell. The cytokine and/or chemokine protein levels may be measured using methods known to those of skill in the art including, but not limited to, an ELISA, dot blot, and/or Western blot. In some embodiments, the step of determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines comprises measuring RNA expression of the cytokines and/or chemokines. The RNA expression of the cytokines and/or chemokines may be measured using any methods known to those of skill in the art including, but not limited to, quantitative reverse transcriptase polymerase chain reaction and/or RNA sequencing.

BRIEF DESCRIPTION OF THE DRAWINGS

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

FIGS. 1A-1G demonstrate that the environment governs survival, inflammation, and autoimmunity in C9orf72 loss of function (LOF) mice. FIG. 1A shows aseptic embryo transfer of C9orf72 neo deleted allele from Harvard BRI to Broad Institute. Males and females were aged for survival or tissue harvest. FIG. IB shows the percent survival of mice from Harvard BRI ( C9orf72 +/+ n=55; +/- n=l 14; -/- n=62). FIG. 1C shows the percent survival of mice from Broad Institute ( C9orf72 +/+ n=22; +/- n=36; -/- n=23) (Gehan- Breslow-Wilcoxon) where “ns” means not significant. FIGS. 1D-1G shows age-matched (48- week-old) mice reared at Harvard BRI ( C9orf72 +/+ n=12; +/- n=13; -/- n=10) or Broad Institute ( C9orf72 +/+ n=12; +/- n=18; -/- n=ll) were assessed for spleen weight (FIG. ID), blood neutrophil count (FIG. IE), blood platelet count measured at 0° (FIG. IF), and plasma anti-double stranded (ds) DNA antibody activity (FIG. 1G) (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIGS. 2A-2F demonstrate the lifelong suppression of gut microflora prevents inflammation and autoimmunity in C9orf72 LOF mice. FIG. 2A shows male and female C9orf72^Harvard +/+ and -/- neo deleted mice of weaning age that were co-housed by treatment group, then administered vehicle (+/+ n=7; -/- n=ll) or antibiotics (+/+ n=7; -/- n=ll) daily for life. Mice were assessed for gut microbial composition (FIG. 2B, 4 weeks), blood measures (FIGS. 2C-2E, 8 weeks) and sacrificed for organ and CNS assessment (FIG. 2F, 28 weeks). FIG. 2B shows 16S rDNA sequencing of bacterial diversity in feces. Each dot represents total sequencing reads per cage (one-way ANOVA with Dunnett multiple comparison). FIGS. 2C-2F shows C9orf72^Harvard +/+ and -/- neo deleted mice were assessed for blood neutrophil count (FIG. 2C), blood platelet count measured at 0°C (FIG. 2D), plasma anti-dsDNA antibody activity (FIG. 2E), and spleen weight (FIG. 2F) (one-way ANOVA with Sidak multiple comparisons; each dot represents one animal).

FIGS. 3A-3K demonstrate that gut bacteria propagates inflammation and autoimmunity in C9orf72 LOF mice. FIG. 3A shows age matched (36-week-old) female C9orf72^Harvard +/+ and -/- neo deleted mice were co-housed by treatment group, then administered vehicle (+/+ n=12; -/- n=12) or antibiotics (+/+ n=13; -/- n=12) daily. FIGS. 3B-3D show the female C9orf72^Harvard +/+ and -/- neo deleted mice of FIG. 3A were assessed for plasma anti-dsDNA antibody activity (FIG. 3B), blood neutrophil count (FIG. 3C), and blood platelet count measured at 0°C (FIG. 3D) (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIG. 3E shows age matched (13-week-old) female C9orf72^Harvard +/+ and -/- neo deleted mice were co-housed by treatment group, administered antibiotics for two weeks, then gavaged Harvard BRI feces (+/+ n=13; -/- n=17) or Broad feces (+/+ n=14; -/- n=15). FIGS. 3F-3H show the female C9orf72^Harvard +/+ and -/- neo deleted mice of FIG. 3E were assessed for plasma anti-dsDNA antibody activity (FIG. 3F), blood neutrophil count (FIG. 3G), and blood platelet count measured at 0°C (FIG. 3H) (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIGS. 3I-3K shows fecal pellets (n=5 each) from two pro -inflammatory environments (Harvard BRI/Johns Hopkins) and two pro-survival environments (Broad Institute/Jackson Labs) that were subjected to 16S rDNA sequencing (FIG. 31) and assessed by principle component analysis (FIG. 3J) and Bray-Curtis dissimilarity matrix of beta diversity (FIG. 3K).

FIGS. 4A-4F demonstrates that gut microflora promotes myeloid cell infiltration and microgliosis in C9orf72 LOF spinal cord. FIG. 4A provides an orthogonal projection of CD45 and mouse immunoglobulin G (IgG) in 55-week-old C9orf72^Harvard neo deleted lumbar spinal cord (+/+ n=3; -/- n=3). FIG. 4B shows representative gating of CD45⁺ CD1 lb⁺ cells from spinal cord of the C9orf72^Harvard mice in FIG. 2. FIG. 4C shows CD45^hi CD1 lb⁺ Ly6C⁺ spinal cord infiltrating myeloid cells shown in FIG. 4B (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIG. 4D shows Ccr9 expression on CD45^mid CD1 lb⁺ CD39⁺ microglia from spinal cord of C9orf72^Harvard mice in FIG. 2 (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIG. 4E provides an orthogonal projection of Dectinl in Ibal⁺ microglia in 55-week-old C9orf72^Harvard neo deleted lumbar spinal cord (+/+ n=3; -/- n=3 mice). FIG. 4F shows Dectinl in CD45^mid CDllb⁺ CD39⁺ microglia from spinal cord of C9orf72^Harvard mice in FIG. 2 (one way ANOVA with Sidak multiple comparisons; each dot represents one animal).

FIGS. 5A-5E summarize C9orf72 LOF survival studies. FIGS. 5A-5B show mice harboring LOF mutations in C9orf72, generated by homologous recombination using a targeting vector in embryonic stem cells on a C57BL/6 background (KOMP) and those outcrossed with Sox2-cre-expressing mice to remove the neomycin cassette (Neo-deleted), were aged for survival studies. Kaplan-Meier survival curves were provided for KOMP (FIG. 5A) and Neo-deleted mice (FIG. 5B) (*P < 0.05, **P < 0.01, generalized Wilcoxon test). See Burberry et al. “Loss-of-function mutations in the C9orf72 mouse orthlog cause fatal autoimmune disease,” Science Translational Medicine 8(347): 347ra93 (2016). FIG. 5C shows survival analysis of C9orf72 -/-, C9orf72 +/-, and wild-type mice. Lifespans were monitored and plotted using Kaplan-Meyer curve and revealed a loss of C9orf72 causes a significant decrease in survival when compared with wild-type littermates (n = 74, C9orf72 - /-; n = 79, C9orf72 +/-; n = 31, wild-type, *p<0.005). See Ugolino et al., “Loss of C9orf72 Enhances Autophagic Activity via Deregulated mTOR and TFEB Signaling,” PLoS Genet 12(11): el006443 (2016). FIG. 5D shows a survival curve up to 600 days for C9orf72 +/+, C9orf72 +/-, and C9orf72 -/- mice. See Jiang et al., “Gain of Toxicity from ALS/FTD- Linked Repeat Expansions in C90RF72 Is Alleviated by Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs,” Neuron 90(3):535-50 (2016). FIG. 5E shows survival curve of hemizygous and homozygous C9orf72 null mice did not differ from wild- type mice out to 500 days. See O’Rourke et al., “ C9orf72 is required for proper macrophage and microglial function in mice,” Science 351(6279): 1324- 1329 (2016). FIGS. 6A-6G demonstrate causes of death, motor performance, plasma cytokines, and identification of pseudo thrombocytopenia in C9orf72 LOF mice. FIG. 6A shows causes of death or premature mortality of C9orf72^Harvard mice in FIG. IB. FIG. 6B shows accelerating rotarod performance of 37-week-old C9orf72^Harvard neo deleted mice (+/+ n=22; +/- n=50; -/- n=22) (one way ANOVA with Dunnett multiple comparisons; each point represents the average of three trials per animal). FIG. 6C shows accelerating rotarod performance of C9orf72^Broad neo deleted mice at 29-weeks of age (+/+ n=53; +/- n=52; -/- n=48) or 42- weeks of age (+/+ n=38; +/- n=48; -/- n=48) (one way ANOVA with Sidak multiple comparisons; each point represents the average of three trials per animal). FIG. 6D shows age at sacrifice of animals in FIGS. 1D-1G (one way ANOVA with Sidak multiple comparison). FIG. 6E shows plasma cytokines and chemokines at sacrifice from mice in FIGS. 1D-1G (mean ± s.d; two way ANOVA with Tukey multiple comparisons). FIG. 6F shows peripheral blood smear of 18-week-old C9orf72^Harvard neo deleted mice. Platelets from C9orf72^Harvard -/- mice were prone to aggregate (outlined by red dashed lines) in the presence of EDTA at 0°C. FIG. 6G shows pseudothrombocytopenia could be reversed by warming the blood to room temperature. Reduced platelet count in this model therefore represents an indirect measure of anti-platelet autoantibodies, rather than a reduction in platelet abundance (two-way ANOVA with Tukey multiple comparison) (each dot represents one animal).

FIGS. 7A-7I demonstrate cytokines and chemokines in lifelong antibiotics treated C9orf72 LOF mice and sex stratification of inflammatory phenotypes. FIG. 7A provides PCR analysis of Helicobacter spp. and Norovirus DNA in fecal pellets. Each dot represents feces from one cage (one way ANOVA with Dunnett multiple comparisons). FIG. 7B shows plasma cytokines and chemokines of mice in FIG. 2 (Mean ± s.d.; two-way ANOVA with Tukey multiple comparisons). FIG. 7C provides representative spleen size of mice in FIG. 2. FIGS. 7D-7E show total blood neutrophil count (FIG. 7D) and platelet count (FIG. 7E) from mice in FIG. 2 at 14 weeks stratified by sex (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIG. 7E shows spleen weight (FIG. 7E) from mice in FIG. 2 at 32 weeks stratified by sex (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIGS. 7G-7H show total blood neutrophil count (FIG. 7G) and platelet count (FIG. 7H) in 30-week-old C9orf72^Harvard neo deleted mice stratified by sex (+/+ n=9M, n=13F; +/- n=25M n=27F; -/- n=13M n=9F) (one way ANOVA with Sidak multiple comparisons; each dot represents one animal). FIG. 71 shows spleen weight in 40-week-old C9orf72^Harvard neo deleted mice stratified by sex (+/+ n=8M, n=l IF; +/- n=13M n=7F; -/- n=12M n=6F) (one way ANOVA with Sidak multiple comparisons; each dot represents one animal).

FIGS. 8A-8E demonstrate acute antibiotics treatment improves motor function and mitigates splenomegaly and cytokine burden in C9orf72 LOF mice. FIG. 8A shows accelerating rotarod performance of mice in FIG. 3A. Each point represents the average of three trials per animal (two-way ANOVA with Dunnett multiple comparisons). FIG. 8B shows plasma cytokines and chemokines of mice in FIGS. 3A-3D after 7 weeks of treatment (mean ± s.d.; two-way ANOVA with Tukey multiple comparisons). FIGS. 8C-8D provide representative spleen size (FIG. 8C) and spleen weight (FIG. 8D) of mice in FIG. 3A after 8 weeks of treatment (each dot represents one animal; one-way ANOVA with Sidak multiple comparisons). FIG. 8E shows plasma cytokines and chemokines of mice in FIGS. 3E-3H 10 weeks after fecal transplant (mean ± s.d.; two-way ANOVA with Tukey multiple comparisons).

FIGS. 9A-9I demonstrate bacteria and protozoa diversity across environments. FIGS. 9A-9B show phylum level (FIG. 9A) and species level (FIG. 9B) relative abundance of bacteria from 16S rDNA sequencing in FIG. 31. Each bar represents sequencing from one pellet per cage. FIGS. 9C-9D show relative abundance (FIG. 9C) and gram stain classification (FIG. 9D) of bacterial species whose abundance was significantly different between pro-inflammatory environments (Harvard BRI/JHU) and pro- survival environments (Broad Institute and Jackson Labs). (T test with Bonferroni multiple comparisons) 62/301 detected species had significance P < 0.0002. n=5 fecal pellets per environment. Mean ± s.d. FIG. 9E shows quantitative RT-PCR analysis of Tritrichomonas muris 28S rDNA relative to total Eubacteria 16S rDNA in feces. Each dot represents a fecal pellet from one cage (one way ANOVA with Tukey multiple comparisons). FIG. 9F provides Simpson index of fecal alpha diversity (one-way ANOVA with Tukey multiple comparisons). FIG. 9G shows relative abundance of epsilon proteobacteria {Helicobacter) (one-way ANOVA with Tukey multiple comparisons). FIG. 9H provides PCR analysis of Helicobacter spp.16S rDNA and total Eubacteria 16S rDNA in feces. FIG. 91 provides PCR analysis of Helicobacter spp.16S rDNA and total Eubacteria 16S rDNA in feces (6 weeks-post-transplant) from FIG. 3E.

FIGS. 10A-10F demonstrate environment enriched bacteria engraft fecal transplant recipients. An analysis of bacteria in feces 10-weeks-post-transplant from mice in FIG. 3E by 16S rDNA sequencing was performed. Each bar represents a fecal sample from an individual cage. FIGS. 10A-10B show phylum level (FIG. 10A) and species level (FIG. 10B) relative abundance. FIG. IOC shows relative abundance of bacterial species grouped as those only observed in cages from Harvard BRI (Harvard-only), those only observed in cages from the Broad Institute (Broad-only), those observed in cages from Harvard BRI and the Broad Institute (Harvard/Broad-shared) or those not observed in Harvard BRI or Broad Institute cages but detectable in transplant recipient cages (Emergent). FIG. 10D provides a Bray- Curtis dissimilarity matrix of feces beta diversity. FIG. 10E shows relative abundance of epsilon proteobacteria (. Helicobacter ). FIG. 10F shows putative pro-inflammatory species (n=27) enriched in pro-inflammatory environments (Harvard BRI/JHU) that were also enriched in Harvard— «-Harvard recipients and putative pro- survival species (n=12) enriched in pro- survival environments (Broad/Jackson Fabs) and enriched in Broad— «-Harvard recipients.

FIGS. 1 lA-1 ID demonstrate C9orf72 restricts myeloid cytokine release in response to foreign stimuli. An analysis of cytokines and chemokines in supernatant 24 hours after stimulation of bone marrow derived macrophages (BMDM) with activators of Toll-like receptor (Tlr) or NOD-like receptor (Nlr) agonists (FIGS. 1 lA-11C) or filtered Eubacteria- normalized fecal preparations (FIG. 1 ID). FIG. 11C shows the abundance of cytokine and chemokine in supernatant was normalized and color coded (Blue low; Red high) relative to the average level of each molecule in unstimulated +/+ BMDM wells. Fevels of each analyte were measured by Fuminex in multiplex. FIG. 1 ID shows the abundance of total Eubacteria in each fecal sample was measured by qPCR for 16S rDNA and this value was used to normalize fecal Eubacteria bacteria concentration prior to generation of the dilution curve. Each dot represents one well. Panels are presentative of n=2 replicate experiments (FIG. 11A), n=5 replicate experiments (FIG. 11B), one representative experiment with average of n=3 technical replicates per condition (FIG. 11C), n=2 replicate experiments (FIG. 11D).

Two way ANOVA with Sidak multiple comparison (FIG. 11 A); two way ANOVA with Dunnett multiple comparison (FIG. 11B); two way ANOVA with Sidak multiple comparison for each analyte tested (FIG. 11C); one way Anova with Sidak multiple comparison (FIG. 11D).

FIGS. 12A-12H demonstrate neutrophils and T cells infiltrate C9orf72 EOF spinal cord. Mass cytometry interrogation of single cell dissociated forebrain or spinal cord from 36-week-old C9orf72Harvard neo deleted male and female mice (+/+ n=7; +/- n=7; -/- n=8). One C9orf72 +/+ forebrain sample failed and was excluded from analysis. Populations were defined as CD45mid CX3CR1+ CD39+ Microglia (FIG. 12A); CD45hi Ly6C+ Ly6Ghi Neutrophils (FIG. 12B); CD45hi Ly6C+ Ly6Glo Monocytes (FIG. 12C); CD45hi CD3e+ CD4+ T cells (FIG. 12D); CD45hi CD3e+ CD4- T cells (FIG. 12E); and CD45hi CD19+ B cells (FIG. 12F). Quantitation of total cells per tissue was obtained by multiplying the percentage of each gated population by the total cells recovered from that mouse’s tissue. Each dot represents one mouse (two-way ANOVA with Dunnett multiple comparison). FIG. 12G shows quantitative RT-PCR of Ly6C expression in 47-week-old C9orf72 C9orf72Harvard neo deleted (+/+ n=8; -/- n=9) or C9orf72Broad neo deleted (+/+ n=10; -/- n=9) total cortex tissue. Each dot represents one animal (one-way ANOVA with Sidak multiple comparison). FIG. 12H shows an orthogonal projection of confocal imaging of CD1 lb and mouse immunoglobulin IgG in 43-week-old C9orf72Harvard lumbar spinal cord.

FIGS. 13A-13H demonstrate elevated lysosomal proteins and microgliosis in C9orf72 LOF spinal cord. FIGS. 13A-13B and FIGS. 13E-13G provide orthogonal projection and quantification of confocal imaging of Lampl (FIG. 13A), cathepsin (FIG. 13B), Ccr9 (FIG. 13E), Dectinl/Clec7a (FIG. 13F), and Lpl (FIG. 13G) in Ibal-i- microglia in 55-week-old C9orf72Harvard spinal cord (one way ANOVA with Sidak multiple comparisons). Each dot represents the average mean fluorescent intensity (MFI) of the antigen within microglia on a given spinal cord section. >100 microglia surveyed per section. Sections from n=3 C9orf72 +/+ and n=3 C9orf72 -/- mice surveyed. FIGS. 13C-13D provide flow cytometry quantification of Lampl (FIG. 13C) or Cathepsin B (FIG. 13D) in CD45mid CDllb+ CD39+ microglia from spinal cord of C9orf72Harvard neo deleted mice in FIG. 2 (one-way ANOVA with Sidak multiple comparisons). FIG. 13H provides a graphical illustration of C9orf72 functioning within the hematopoietic system to restrict the development of inflammation, autoimmunity, peripheral immune infiltration into the central nervous system (CNS) and microgliosis in response to hyper- stimulatory communities of gut microflora.

FIGS. 14A-14I demonstrate that the environment governs survival, inflammation and autoimmunity in C9orf72 LOF mice. FIG. 14A shows aseptic embryo transfer of C9orf72 neo deleted allele from Harvard FAS BRI to Broad Institute. Pups born from heterozygous intercrosses aged for survival or tissue harvest. FIG. 14B provides a survey of health monitoring reports from mice reared at each institution. FIG 14C shows survival at Harvard FAS BRI. (Grehan-Breslow-Wilcoxon) *P < 0.05; **P < 0.001. FIG. 14D shows survival at Broad Institute. (Grehan-Breslow-Wilcoxon) ns not significant. FIG. 14E provides a plasma cytokine array of age-matched animals. FIG. 14F provides spleen weight of age-matched animals. FIG. 14G provides total blood neutrophil count of age-matched animals. FIG. 14H provides total blood platelet count of age-matched animals measured at 0°. FIG. 141 shows anti-double- stranded (ds) DNA antibody activity in plasma of age-matched animals. Each dot represents one animal. Ns, not significant. *P <0.05; **P<0.01.

FIGS. 15A-15I demonstrate lifelong suppression of gut microflora prevents inflammation and autoimmunity in C9orf72 LOF mice. FIG. 15A provides an experimental schematic of C9orf72 +/+ and -/- mice co-housed and treated with vehicle or antibiotics.

FIG. 15B shows 16S sequences of feces. Each dot represents total sequencing reads per cage stratified by taxonomic order. FIG. 15C provides PCR analysis of Helicobacter spp. And Norovirus DNA in feces. Each dot represents one cage. FIG. 15D shows a plasma cytokine array. FIG. 15E provides total blood neutrophil count. FIG. 15F provides total blood platelet count measured at 0°C. FIG. 15G provides anti-dsDNA antibody activity. FIG. 15H provides representative spleen size. FIG. 151 provides spleen weight. Each dot represents one animal. *P < 0.05; **P < 0.01.

FIGS. 16A-16H demonstrate acute suppression of gut microflora mitigates inflammation and autoimmunity in C9orf72 LOF animals. FIG. 16A provides an experimental schematic of C9orf72 +/+ and -/- mice co-housed and treated with vehicle or antibiotics. FIG. 16B shows accelerating rotarod performance. Each point represents the average of three trials per animal. FIG. 16C provides total blood neutrophil count. FIG. 16D provides total blood platelet count measured at 0°C. FIG. 16E provides a plasma cytokine array. FIG. 16F provides anti-dsDNA antibody activity in plasma. FIG. 16G provides representative spleen size. FIG. 16H provides spleen weight. Each dot represents one animal. *P < 0.05; **P < 0.01.

FIGS. 17A-17H demonstrate that gut microflora promotes myeloid cell infiltration and microgliosis in C9orf72 LOF spinal cord. FIG. 17A provides an orthogonal projection of confocal imaging of CD45 and mouse immunoglobulin G (IgG) in 43-week-old C9orf72^Harvard spinal cord. FIG. 17B provides flow cytometry plot gated on CD45⁺ CD1 lb⁺ cells from spinal cord of C9orf72^Harvard mice in FIG. 15. FIG. 17C shows quantification of CD45^hl CDllb⁺ Lyc6C⁺ infiltrating myeloid cells in FIG. 17B. FIG. 17D shows quantification of Ccr9 expression on CD45^mid CD1 lb⁺ CD39⁺ microglia from spinal cord of C9orf72^Harvard mice in FIG. 15. FIG. 17E provides an orthogonal projection of confocal imaging of Lampl in Ibal⁺ microglia in 43-week-old C9orf72^Harvard spinal cord. FIG. 17F provides representative flow cytometry plot and quantification of Lampl in CD45^mid CD1 lb⁺ CD39⁺ microglia from spinal cord of C9orf72^Harvard mice in FIG. 15. FIG. 17G provides an orthogonal projection of confocal imaging of Cathepsin B in CD1 lb⁺ microglia in 43-week old C9orf72^Harvard spinal cord. FIG. 17H provides a flow cytometry plot and quantification of Cathepsin B in CD45^mid CD1 lb⁺ CD39⁺ microglia from spinal cord of C9orf72^Harvard mice in FIG. 15. Each dot represents one animal. *P < 0.05; **P < 0.01.

FIG. 18 provides a table summarizing the difference in microbiota between vivaria.

DETAILED DESCRIPTION OF THE INVENTION

A hexanucleotide repeat expansion in C9orf72 is the most common genetic variant contributing to Amyotrophic lateral sclerosis (ALS) and Frontotemporal dementia (FTD). Long term reduction in C9orf72 function has been shown to cause age-dependent inflammation, characterized by cytokine storm, neutrophilia, pseudo thrombocytopenia, autoimmunity, splenomegaly, and neuroinflammation. Effects of the mutation act with incomplete penetrance in ALS/FTD families indicating that either genetic or environmental factors modify each individual’s risk of disease.

Work described herein relates to methods and compositions for treating or reducing the likelihood of a disease or condition associated with the C9orf72 mutation by altering the gut microbiota of a subject. Environmental factors are shown herein to be modifiers of an individual’s risk of disease, specifically a disease associated with the C9orf72 mutation.

When C9orf72 function declines, the environment generally, and the gut microbiota specifically, become potent modifiers of whether autoimmunity, neural inflammation, motor deficits, and premature mortality occur. Thus, the microbial constituency of the gut is shown to play an important role in brain health and can interact in surprising ways with well-known genetic risk factors for nervous system disorders.

Methods of Treatment

[0001] The disclosure contemplates various methods of treatment utilizing compositions comprising an agent that alters microbiota in the gut. In some aspects, an agent reduces the microbial burden or the bacterial load in a subject, e.g., a subject having a C9orf72 mutation. In some aspects, the agent reduces the microbial burden of one or more microorganisms in the gut. In some embodiments, the agent reduces the microbial burden of one or more viruses, bacteria, and/or protozoa in the gut. In some aspects, the agent reduces a gram negative bacteria. In some aspects, the agent reduces a gram positive bacteria. For example, the agent may reduce the microbial burden of one or more bacteria identified as being present in pro-inflammatory environments in FIG. 10F (e.g., human gut bacterial correlates of the bacteria identified as present in pro-inflammatory environments in FIG. 10F). In some aspects, the agent may reduce the microbial burden of one or more of Bacteroides spp. (e.g., Bacteroides sartorii, Bacteroides helcogenes, Bacteroides faecichinchillae, and the like), Prevotellamassilia timonensis, Prevotella dentalis, Alloprevotella rava, Olsenella profuse, Chlamydia trachomatis, Lactobacillus vaginalis, Parabacteroides merdae, Massiliprevotella massiliensis, Parvibacter caecicola, Desulfovibrio desulfuricans, Helicobacter spp. (e.g., Helicobacter ganmani, Helicobacter mastomyrinus , Helicobacter hepaticus, and the like), Lachnotalea glycerini, Prevotella oryzae, Alistipes timonensis, Paraprevotella clara, Prevotella loescheii, Lactococcus garvieae, Desulfovibrio sp. FI , Alistipes obesi, Porphyromonas pogonae, Prevotella buccalis, Alistipes shahii, Desulfovibrio litoralis, Prevotella stercorea, Alistipes indistinctus, Mycoplasma sp., Olsenella scatoligenes, Mycoplasma penetrans, Rikenella microfusus, Gemella sanguinis, Pseudomonas aeruginosa, Staphylococcus aureus, and norovirus, in the gut.

In some aspects, the disclosure contemplates the treatment of any disease or condition in which the disease is associated with a mutation in C9orf72, i.e., a disease associated with a hexanucleotide repeat expansion in C9orf72. In some embodiments, the inventions disclosed herein relate to methods of treating autoimmune or inflammatory conditions associated with a mutation in C9orf72. In some embodiments, the inventions disclosed herein relate to methods of treating neurodegenerative or neurological disorders associated with a mutation in C9orf72 (e.g., ALS and/or FTD).

In some aspects, a mutation in C9orf72, e.g., a hexanucleotide repeat expansion in C9orf72, results in a loss of function of C9orf72. A reduction in C9orf72 activity or function may result in age-dependent inflammation characterized by changes in cytokine storm, neutrophilia, pseudothrombocytopenia, autoimmunity, splenomegaly, and neuroinflammation. In some aspects, a mutation in C9orf72 results in elevated levels of cytokines and/or chemokines (e.g., autoimmune and/or inflammatory phenotypes) in a subject. In some embodiments, a mutation in C9orf72 results in elevated levels of IL-23, IL- 10, IL-22, G-csf, IL-17a, Tnfa, IRNg, IL-Ib, IL-12p70, splenomegaly, neutrophilia, and pseudo thrombocytopenia, and the development of auto-antibodies. In some embodiments, a mutation in C9orf72 results in elevated levels of dipeptide repeat proteins that are translated from the repeat expansion containing RNA which accumulate in plasma and/or cerebral spinal fluid and/or aggregate in cells of the central nervous system.

In some embodiments, methods of treatment comprise administering an effective amount of an agent to a subject, wherein the agent reduces the microbiota in the gut of a subject. In some embodiments, methods of treatment comprise administering an effective amount of an agent to a subject, wherein the agent reduces microorganisms in the gut of a subject. In some aspects the agent is an antibiotic, a bacteria, a protein, a bacteriophage, or a small molecule. In some aspects, a bacteriophage is a virus that targets and destroys specific bacteria, e.g., a bacteria identified as being enriched in pro-inflammatory environments in FIG. 10F. In some aspects, an antibiotic is a full spectrum antibiotic. In certain aspects, an antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, ceftriaxone, and combinations thereof. In some aspects, a bacteria is a beneficial bacteria, e.g., a bacteria that will adjust the gut microbiome of a subject to reduce the microbial burden caused by one or more microbial organisms. Examples of bacteria that provide beneficial effects include, but are not limited to, those identified in FIG. 10F (e.g., human gut bacterial correlates of the bacteria identified as being enriched in pro-survival environments in FIG. 10F). In certain aspects, the bacteria is a probiotic. In certain aspects, the agent is a pro-survival gut microflora, and in some aspects is a synthetic pro-survival gut microflora (e.g., Clostridium butyricum MIYAIRI 588 (CBM588)). In certain embodiments, methods of treatment comprise administering an effective amount of an antibiotic to a subject. In certain embodiments, methods of treatment comprise administering an effective amount of a pro-survival gut microflora to a subject.

In some embodiments, methods of treating a disorder associated with C9orp2 loss of activity or function comprises administering to a subject an agent (e.g., an agent that modules the gut microbiome). In some embodiments, methods of treating a neurodegenerative or neurological disease or disorder (e.g., ALS and/or FTD) comprises administering to a subject an agent (e.g., an agent that modulates the gut microbiome). In some embodiments, methods of treating an inflammatory and/or autoimmune disease comprises administering to a subject an agent (e.g., an agent that modulates the gut microbiome). In some embodiments, the methods of treatment include administering a second agent. In some aspects, the second agent may be a known medicament for treating a disease or condition associated with C9orf72 mutations (e.g., a known medicament for treating ALS and/or FTD and/or autoimmune or inflammatory disorders associated with ALS).

In some embodiments, an agent is administered (e.g., in vitro or in vivo ) in an amount effective for reducing the microbial burden in a subject, e.g., in the gut of a subject.

In some aspects, a gut microbiome altering agent reduces the infiltration of peripheral immune cells into the spinal cord of a subject. In some aspects, a gut microbiome altering agent reduces microglia activation in a subject. In some aspects, a gut microbiome altering agent reduces TNF-alpha release by bone marrow derived macrophages. In some aspects, a gut microbiome altering agent has one or more effects including, but not limited to, reducing inflammation, reducing autoimmunity, improving motor function, reducing splenomegaly, reducing cytokine burden, reducing myeloid cell infiltration, and/or reducing microgliosis.

As used herein, “treat,” “treatment,” “treating,” or “amelioration” when used in reference to a disease, disorder or medical condition, refers to therapeutic treatments for a condition, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a symptom or condition. The term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a condition is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of the deficit, stabilized (i.e., not worsening) state of, for example, a neurodegenerative disorder, an autoimmune disorder, or an inflammatory disorder, delay or slowing progression of a neurodegenerative disorder, an autoimmune disorder, or an inflammatory disorder, and an increased lifespan as compared to that expected in the absence of treatment.

“Neurodegenerative disorder” refers to a disease condition involving neural loss mediated or characterized at least partially by at least one of deterioration of neural stem cells and/or progenitor cells. Non-limiting examples of neurodegenerative disorders include polyglutamine expansion disorders (e.g., HD, dentatorubropallidoluysian atrophy, Kennedy's disease (also referred to as spinobulbar muscular atrophy), and spinocerebellar ataxia (e.g., type 1, type 2, type 3 (also referred to as Machado-Joseph disease), type 6, type 7, and type 17)), other trinucleotide repeat expansion disorders (e.g., fragile X syndrome, fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy, spinocerebellar ataxia type 8, and spinocerebellar ataxia type 12), Alexander disease, Alper's disease, Alzheimer disease, amyotrophic lateral sclerosis (ALS), ataxia telangiectasia, Batten disease (also referred to as Spielmeyer-Vogt-Sjogren-Batten disease), Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt- Jakob disease, Guillain-Barre syndrome, ischemia stroke, Krabbe disease, kuru, Lewy body dementia, multiple sclerosis, multiple system atrophy, non-Huntingtonian type of Chorea, Parkinson's disease, Pelizaeus-Merzbacher disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum's disease, Sandhoff disease, Schilder's disease, spinal cord injury, spinal muscular atrophy (SMA), SteeleRichardson-Olszewski disease, frontotemperal dementia (FTD), and Tabes dorsalis. In some contexts neurodegenerative disorders encompass neurological injuries or damages to the CNS or PNS associated with physical injury (e.g., head trauma, mild to severe traumatic brain injury (TBI), diffuse axonal injury, cerebral contusion, acute brain swelling, and the like).

In some embodiments the neurodegenerative disorder is a disorder that is associated with a hexanucleotide repeat expansion in C9orf72. In some embodiments the neurodegenerative disorder is selected from the group consisting of amyotrophic lateral sclerosis (AFS), frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTFD), Alzheimer’s disease, Parkinson’s disease, Inclusion Body Myositis (IBM) and combinations thereof. In some aspects the neurodegenerative disorder is AFS. In some aspects the neurodegenerative disorder is AFS in combination with FTD and/or FTFD. In some aspects the neurodegenerative disorder is Alzheimer’s. In some aspects the neurodegenerative disorder is Parkinson’s.

“Inflammatory disease” or “inflammatory condition” refers to a disease or condition characterized, in whole or in part, by inflammation or an inflammatory response in the patient. Typically, one or more of the symptoms of the inflammatory disease or condition is caused or exacerbated by an inappropriate, misregulated, or overactive inflammatory response. Inflammatory diseases or conditions may be chronic or acute. In certain embodiments, the inflammatory disease or condition is an autoimmune disorder. In certain embodiments, compounds of the disclosure are used to decrease inflammation, to decrease expression of one or more inflammatory cytokines, and/or to decrease an overactive inflammatory response in a subject having an inflammatory condition. Thus, the disclosure provides a method of decreasing inflammation, a method of decreasing expression of one or more inflammatory cytokines, and/or a method of decreasing an overactive inflammatory response in a subject in need thereof.

In certain embodiments, examples of inflammatory conditions that may be treated include inflammation of the lungs, joints, connective tissue, eyes, nose, bowel, kidney, liver, skin, central nervous system, vascular system, heart, or adipose tissue. In certain embodiments, inflammatory conditions which may be treated include inflammation due to the infiltration of leukocytes or other immune effector cells into affected tissue. In certain embodiments, inflammatory conditions which may be treated include inflammation mediated by IgE antibodies. Other relevant examples of inflammatory conditions which may be treated by the present disclosure include inflammation caused by infectious agents, including but not limited to viruses, bacteria, fungi, and parasites. In certain embodiments, the inflammatory condition that is treated is an allergic reaction. In certain embodiments, the inflammatory condition is an autoimmune disease. The disclosure contemplates that some inflammatory conditions involve inflammation in multiple tissues. Moreover, the disclosure contemplates that some inflammatory conditions may fall into multiple categories. For example, a condition may be described and categorized as an autoimmune condition and/or it may also be described and categorized based on the primary tissue(s) affected (e.g., an inflammatory skin or joint condition). In certain embodiments, an inflammatory condition treatable according to the methods described herein falls into more than one category of condition. In certain embodiments, the inflammatory condition is selected from the group consisting of Crohn’s disease and ulcerative colitis.

“Autoimmune disease” or “autoimmune condition” refers to any disease or disorder in which the subject mounts a destructive immune response against its own tissues.

Autoimmune disorders can affect almost every organ system in the subject (e.g., human), including, but not limited to, diseases of the nervous, gastrointestinal, and endocrine systems, as well as skin and other connective tissues, eyes, blood and blood vessels. Examples of autoimmune diseases include, but are not limited to Hashimoto's thyroiditis, Systemic lupus erythematosus, Sjogren's syndrome, Graves' disease, Scleroderma, Rheumatoid arthritis, Multiple sclerosis, Myasthenia gravis and Diabetes. In some embodiments, the disorder is graft versus host disease (GVHD). In certain embodiments, the autoimmune disease is selected from the group consisting of asthma, celiac disease, insulin dependent diabetes, multiple sclerosis, myasthenia gravis, myxedema, polymyositis, Sjogren syndrome, systemic lupus erythematosus, ulcerative colitis, Ankylosing spondylitis, Chron’s disease, rheumatoid arthritis, sarcoidosis and transverse myelitis, ulcerative colitis vitiligo, lichen sclerosus, and psoriasis. See also Turner et al., “Autoimmune disease preceding amyotrophic lateral sclerosis,” Neurology , 81(14): 1222- 1225 (2013); Miller et al., “Increased prevalence of autoimmune disease within C9 and FTD/MND cohorts,” Neurol Neuroimmunol Neuroinflamm. 3(6):e301 (2016), incorporated herein by reference.

For administration to a subject, the agents disclosed herein can be provided in pharmaceutically acceptable compositions. These pharmaceutically acceptable compositions comprise a therapeutically-effective amount of one or more of the agents, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. The pharmaceutical compositions of the present invention can be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), gavages, lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intrathecal, intercranially, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally; or (9) nasally. Additionally, agents can be implanted into a patient or injected using a drug delivery system. (See, for example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No. 3,773,919; and U.S. Pat. No. 35 3,270,960, content of all of which is herein incorporated by reference.)

As used herein, the term “pharmaceutically acceptable” refers to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

As used herein, the term “pharmaceutically-acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject agent from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) semm component, such as semm albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as “excipient”, “carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein.

The phrase “therapeutically-effective amount” as used herein means that amount of an agent, material, or composition comprising an agent described herein which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment. For example, an amount of an agent administered to a subject that is sufficient to produce a statistically significant, measurable alteration in the gut microbiota of a subject.

The determination of a therapeutically effective amount of the agents and compositions disclosed herein is well within the capability of those skilled in the art. Generally, a therapeutically effective amount can vary with the subject’s history, age, condition, sex, and the administration of other pharmaceutically active agents.

As used herein, the term “administer” refers to the placement of an agent or composition into a subject (e.g., a subject in need) by a method or route which results in at least partial localization of the agent or composition at a desired site such that desired effect is produced. Routes of administration suitable for the methods of the invention include both local and systemic routes of administration. Generally, local administration results in more of the administered agents being delivered to a specific location as compared to the entire body of the subject, whereas, systemic administration results in delivery of the agents to essentially the entire body of the subject.

The compositions and agents disclosed herein can be administered by any appropriate route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion. “Injection” includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracranial, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In preferred embodiments of the aspects described herein, the compositions are administered by intravenous infusion or injection.

As used herein, a “subject” means a human or animal (e.g., a mammal). Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. Patient or subject includes any subset of the foregoing, e.g., all of the above, but excluding one or more groups or species such as humans, primates or rodents. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “patient” and “subject” are used interchangeably herein. A subject can be male or female. In some embodiments the subject suffers from a disease or condition associated with a hexanucleotide repeat expansion in C9orf72.

Agents and Pharmaceutical Compositions

The disclosure contemplates agents that reduce the microbial load of the gut, e.g., agents that alter the gut microbiome. In some aspects, the agents suppress gut microbiota. In some embodiments, the agents reduce the levels of one or more cytokines and/or chemokines (e.g., autoimmune and/or inflammatory phenotypes, including, but not limited to, IL-23, IL- 10, IL-22, G-csf, IL-17a, Tnfa, IRNg, IL-Ib, IL-12p70). In some embodiments, the agents reduce the accumulation of dipeptide repeat proteins in plasma and/or cerebral spinal fluid and/or cells of the central nervous system.

Exemplary types of agents that can be used include small organic or inorganic molecules; saccharines; oligosaccharides; polysaccharides; a biological macromolecule selected from the group consisting of peptides, proteins, peptide analogs and derivatives; peptidomimetics; nucleic acids selected from the group consisting of siRNAs, shRNAs, antisense RNAs, ribozymes, and aptamers; an extract made from biological materials selected from the group consisting of bacteria, plants, fungi, animal cells, and animal tissues; naturally occurring or synthetic compositions; antibodies; and any combination thereof.

In some aspects the agent is an antibiotic, a bacterium, a protein, a bacteriophage, or a small molecule. In some aspects, an antibiotic is a full spectrum antibiotic. In certain aspects, an antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, ceftriaxone, and combinations thereof. In some aspects, a bacterium is a beneficial bacterium, e.g., a bacterium that will adjust the gut microbiome of a subject to reduce the microbial burden caused by one or more microbial organisms. In certain aspects, the bacterium is a probiotic. Examples of bacteria that provide beneficial effects include, but are not limited to, those identified in FIG. 10F (e.g., human gut bacterial correlates of the bacteria identified as being enriched in pro-survival environments in FIG. 10F). In certain aspects, the agent is a pro-survival gut microflora, and in some aspects is a synthetic pro-survival gut microflora (e.g., Clostridium butyricum MIYAIRI 588 (CBM588)). A synthetic pro-survival gut microflora may include modified probiotic strains, where the strain is modified to improve efficacy by introducing or modifying the probiotic genome. See Zhou et ah, “Engineering probiotics as living diagnostics and therapeutics for improving human health,” Microbial Cell Factories , 19(56): 1-12 (2020). In some aspects, a bacteriophage is a vims that targets and destroys specific bacteria, e.g., bacteria identified as being enriched in pro-inflammatory environments in FIG. 10F.

The terms “decrease”, “reduced”, “reduction”, “decrease” or “inhibit” are all used herein generally to mean a decrease by a statistically significant amount. However, for avoidance of doubt, “reduced”, “reduction” or “decrease” or “inhibit” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% decrease (i.e. absent level as compared to a reference sample), or any decrease between 10- 100% as compared to a reference level.

The terms “increased” or “increase” are used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, or “increase” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4- fold, or at least about a 5-fold, or at least about a 10-fold increase, or any increase between 2- fold and 10-fold or greater as compared to a reference level. In some aspects the agent alters the gut microbiota in a subject by at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold. In some aspects the agent reduces the microbial burden in a subject by at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold.

The disclosure further contemplates pharmaceutical compositions comprising the agent that alters the gut microbiome. In some embodiments, the pharmaceutical composition comprises the agent that reduces the gut microbiota. In some aspects, the pharmaceutical composition comprises an agent that restores the gut microbiome to correspond with the gut microbiome of a healthy subject, e.g., a subject not having a C9orf72 mutation. In some embodiments, the pharmaceutical composition comprises an agent that reduces the levels of one or more inflammatory chemokines and/or cytokines. In some embodiments, the pharmaceutical composition comprises an antibiotic or a bacterium. In certain embodiments, the pharmaceutical composition comprises an antibiotic, e.g., a full spectrum antibiotic. In certain embodiments, the pharmaceutical composition comprises a beneficial bacterium, e.g., a probiotic.

In some embodiments, a pharmaceutical composition comprises an effective amount of a gut microbiome altering agent. In some embodiments, a pharmaceutical composition comprises an effective amount of a gut microbiome altering agent and an effective amount of a second agent. In some aspects, the second agent is an agent that treats or inhibits a neurodegenerative or neurological disorder. In some aspects, the second agent is an agent that treats or inhibits an autoimmune or inflammatory disorder.

In some embodiments, a pharmaceutical composition comprises an effective amount of a probiotic. In some embodiments, a pharmaceutical composition comprises an effective amount of a full spectrum antibiotic. In some embodiments, a pharmaceutical composition comprises an effective amount of a synthetic pro- survival gut microflora. In some embodiments, a pharmaceutical composition comprises an effective amount of an agent that reduces the gut microbiota, a pharmaceutically acceptable carrier, diluent, or excipient, and optionally a second agent. In some aspects, the second agent an antibiotic, a bacterium, a protein, a bacteriophage, or a small molecule. In some embodiments, a pharmaceutical composition comprises an effective amount of a synthetic pro-survival gut microflora that reduces the gut microbiota, a pharmaceutically acceptable carrier, diluent, or excipient, and optionally a second agent selected from an antibiotic, bacteria, and a bacteriophage.

The pharmaceutical compositions comprising the agent that alters the gut microbiome (e.g., reduces the gut microbiota) can be used for treating a disease or condition associated with a C9orf72 mutation. The pharmaceutical compositions comprising the agent that alters the gut microbiome (e.g., reduces the gut microbiota) can be used for treating a disease or condition associated with a hexanucleotide repeat expansion in C9orf72.

Screening Methods

The disclosure contemplates methods of screening one or more test agents to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with loss of function of C9orf72. In some aspects, a disease or condition is associated with a hexanucleotide repeat expansion in C9orf72.

In some embodiments, the methods comprise contacting a cell having a C9orf72 mutation in an environment having an increased microbial load. In some aspects, the cells are stimulated with chemical analogs of microbial components. In some embodiments the method comprises administering one or more test agents; determining if the cell expresses reduced levels of inflammatory cytokines and/or chemokines; and identifying the test agent as a candidate agent if the cell expresses reduced levels of inflammatory cytokines and/or chemokines. In some aspects the step of determining if the cell has reduced levels of inflammatory cytokines and/or chemokines comprises measuring cytokine protein levels in the cell. In some aspects cytokine protein level is measured using an ELISA (e.g., a sandwich ELISA), dot blot, and/or Western blot. In some aspects the step of determining if the ells has reduced levels of inflammatory cytokines and/or chemokines comprises measuring RNA expression of cytokines and/or chemokines. In some aspects RNA expression is measured using quantitative reverse transcriptase polymerase chain reaction and/or RNA sequencing.

The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description.

Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or prior publication, or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The details of the description and the examples herein are representative of certain embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention. It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The articles “a” and “an” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention provides all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. It is contemplated that all embodiments described herein are applicable to all different aspects of the invention where appropriate. It is also contemplated that any of the embodiments or aspects can be freely combined with one or more other such embodiments or aspects whenever appropriate. Where elements are presented as lists, e.g., in Markush group or similar format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification. For example, any one or more active agents, additives, ingredients, optional agents, types of organism, disorders, subjects, or combinations thereof, can be excluded.

Where the claims or description relate to a composition of matter, it is to be understood that methods of making or using the composition of matter according to any of the methods disclosed herein, and methods of using the composition of matter for any of the purposes disclosed herein are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where the claims or description relate to a method, e.g., it is to be understood that methods of making compositions useful for performing the method, and products produced according to the method, are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.

Where ranges are given herein, the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. It should be assumed that both endpoints are included unless indicated otherwise. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also understood that where a series of numerical values is stated herein, the invention includes embodiments that relate analogously to any intervening value or range defined by any two values in the series, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum. Numerical values, as used herein, include values expressed as percentages. For any embodiment of the invention in which a numerical value is prefaced by “about” or “approximately”, the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by “about” or “approximately”, the invention includes an embodiment in which the value is prefaced by “about” or “approximately”.

“Approximately” or “about” generally includes numbers that fall within a range of 1% or in some embodiments within a range of 5% of a number or in some embodiments within a range of 10% of a number in either direction (greater than or less than the number) unless otherwise stated or otherwise evident from the context (except where such number would impermissibly exceed 100% of a possible value). It should be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited, but the invention includes embodiments in which the order is so limited. It should also be understood that unless otherwise indicated or evident from the context, any product or composition described herein may be considered “isolated”.

EXAMPLES

A hexanucleotide repeat expansion in C90RF72 is the most common genetic variant contributing to Amyotrophic lateral sclerosis (ALS) and Frontotemporal dementia (FTD)[1],[2]. The C90RF72 mutation acts through gain and loss of function mechanisms to induce pathways implicated in neural degeneration [3]— [9] . The expansion is transcribed into a long repetitive RNA, which may negatively sequester RNA binding proteins [4] prior to its non-canonical translation into neural-toxic di-peptide proteins[3],[5]. Failure of RNA- polymerase to read through the mutation also reduces abundance of the endogenous C90RF72 gene product, which functions in endo-lysosomal pathways and suppresses systemic and neural inflammation [6]— [9] . Notably, effects of the repeat expansion act with incomplete penetrance in ALS/FTD families, indicating that either genetic or environmental factors modify each individual’s risk of disease. Identifying disease modifiers is of significant translational interest, as it could suggest strategies that diminish the risk of developing ALS/FTD, or that slow progression. Here, an environment with reduced abundance of immune-stimulating bacteria [10], [11] protects C9orf72 mutant mice from premature mortality and significantly ameliorates their underlying systemic inflammation and autoimmunity. Consistent with C9orf72 functioning to prevent microbiota from inducing a pathological inflammatory response, it was discovered that reducing microbial burden in mutants with broad spectrum antibiotics, as well as transplanting gut microflora from a protective environment attenuated inflammatory phenotypes, even after their onset. The studies provide further evidence that the microbial constituency of the gut plays an important role in brain health and can interact in surprising ways with well-known genetic risk factors for nervous system disorders.

Introduction

To understand the consequences of the long-term reduction in C90RF72 activity found in patients, mice harboring loss of function (LOF) mutations in the orthologous gene ( C9orf72 ) were studied [6], [7], [12], [13]. Reduced C9orf72 function led to age-dependent inflammation, characterized by cytokine storm [7], [14], neutrophilia [6], [7], [14], pseudo thrombocytopenia [7], autoimmunity [7], [14], splenomegaly [6], [7], [13], [14], and neuroinflammation [6], [7]. Informed by these observations and validating their importance, it was subsequently found that patients with C90RF72 ALS/FTD were significantly more likely to have been diagnosed with autoimmune disease prior to their neurological diagnosis

[15], [16].

However, long-term survival of C9orf72 LOF mutant mice varied dramatically between reports, despite many groups studying the same allele on a similar genetic background. Loss of one (+/-) or both (-/-) alleles of C9orf72 increased risk of premature mortality, while reduced survival of C9orf72 -/- but not +/- animals and another group [6] reported no survival differences between controls and mutants (FIG. 5). These findings suggested that the environment in which animals were reared might be a significant modifier of survival when C9orf72 levels are reduced. To test this hypothesis, C9orf72 mutant animals were aseptically re-derived into a new barrier facility at the Broad Institute of Harvard and MGG ( C9orf72^Broad ), while continuing to breed the colony at the Harvard BRI facility ( C9orf72^Harvard ) (FIG. 1A). To assess the reproducibility of the original findings at Harvard, an independent cohort of C9orf72^Harvard animals (+/+ n=55, +/- n=114, -/- n=62) was aged. It was found that +/- animals (P = 0.0460) and -/- animals (P < 0.0001) were at increased risk of premature mortality (FIG. IB). The causes of death in these animals, which included cervical lymphadenopathy, wasting, and severe ataxia, were indistinguishable from those observed in a previous study [7] and closely tied to their underlying autoimmune condition (FIGS. 6A- 6B). In remarkable contrast, no early mortality or motor behavior deficit was observed in either heterozygous or homozygous mutant animals at the Broad Institute ( C9orf72^Broad +/+ n=22, +/- n=36, -/- n=23) (FIG. 1C and FIG. 6C). As a result, C9orf72 -/- mice were significantly more likely to die prematurely when reared at Harvard than at Broad (P = 0.0179). It was therefore conclude that signals from the environment can be significant modifiers of lifespan when C9orf72 function declines.

To determine whether the observed improved survival in C9orf72^Broad mice was associated with a diminution of the inflammatory and autoimmune endophenotypes previously demonstrated to underlie the risk of mortality in C9orf72^Harvard animals [7], cohorts of age-matched animals reared at each facility were jointly analyzed (FIGS. 1D-1G and FIGS. 6D-6E). C9orf72^Harvard animals exhibited autoimmune and inflammatory phenotypes including significantly elevated levels of IL-23, IL-10, IL-22, G-csf, IL-17a, Tnfa, IGhg, IL-Ib and IL-12p70 (P < 0.05) (FIG. 5E) as well as splenomegaly (P < 0.0001) (FIG. Id), neutrophilia (P < 0.0001) (FIG. le), pseudo thrombocytopenia (P < 0.0001) (FIG. IF and FIGS. 6F-6G), and development of auto-antibodies (P < 0.0001) (FIG. 1G).

Strikingly, and in every case, these inflammatory phenotypes were significantly reduced in C9orf72^Broad -/- animals relative to their C9orf72^Harvard mutant counterparts (FIGS. 1D-1G).

In fact, the reduction of inflammation in the pro- survival Broad Institute environment was sufficiently reduced that many inflammatory phenotypes routinely observed in mutant animals at Harvard were no longer significantly different between -/- and +/+ animals at Broad. It is notable that the few phenotypes that remained significantly different between C9orf72^Broad -/- and C9orf72^Broad +/+ animals, such as modest splenomegaly (P = 0.0004), were those most widely reported in the past [6], [13], [14]. Thus, an environment that improved survival also ameliorated the underlying inflammatory and autoimmune disease found in C9orf72 mutants.

Antibiotics prevent inflammation

The variables between the two environments that might have contributed to such dramatic differences in the severity of mutant phenotypes were next considered. It was discovered that diet, light-cycle and many other features of the two environments were similar. However, a review of microbial screening reports from the two facilities indicated that murine norovims (P = 0.0140), Helicobacter spp. (P < 0.0001), Pasteurella pneumotropica (P = 0.0070) and Tritrichomonas muris (P < 0.0001) were significantly more common in C9orf72^Harvard animals than in C9orf72^Broad mice (FIG. 18). It is important to note, that these differences between the two colonies were well within norms for Assessment and Accreditation of Laboratory Animal Care (AAALAC) processes. The differential components of the microflora found at Harvard are not generally considered pathogenic, consistent with the normal health and lifespan of control animals in that environment (FIG. IB). However, Helicobacter spp. have been suggested to have immune- stimulating properties [10], raising the possibility that changes in gut microflora between the two environments might underlie the increased rate of mortality and inflammatory phenotypes found in C9orf72^Harvard mutant animals.

To learn whether resident microflora contributed to the inflammation and autoimmunity seen in C9orf72^Harvard mutants, new C9orf72^Harvard animals (+/+ n=14, -/- n=22) were weaned and administered either vehicle or broad- spectrum antibiotics prior to onset of inflammatory disease (Day 30), then monitored related phenotypes for 200 days (FIG. 2A). As expected, antibiotics significantly reduced the abundance and diversity of bacterial species including Helicobacter spp., without affecting levels of murine norovims. The guts of vehicle treated controls were largely unaltered (FIG. 2B and FIG. 7A). The vehicle had no effect on development of either inflammatory or autoimmune phenotypes in C9orf72^Harvard -/- mice, including cytokine storm (FIG. 7B), neutrophilia (FIG. 2C), pseudo thrombocytopenia (FIG. 2D), autoimmunity (FIG. 2E) and splenomegaly (FIG. 2F and FIG. 7C). In contrast, providing lifelong antibiotics treatment to C9orf72^Harvard -/- mice completely suppressed the emergence of all of these phenotypes in both males and females (FIGS. 2C-2F and FIGS. 7B-7I). Thus, the experiments suggest that signals derived from gut bacteria promote inflammation and autoimmunity when C9orf72 function is diminished. However, with respect to overall animal health, chronic antibiotics administration resulted in previously reported consequences including hepatoxicity [17], which prevented assessing behavioral and survival outcomes.

The next question was whether acute suppression of gut microbiota could ameliorate inflammatory and autoimmune phenotypes after their establishment in C9orf72^Harvard mutant mice. To this end, another independent cohort of C9orf72^Harvard mice (+/+ n=25, -/- n=24;

Day 250) was obtained, which demonstrated that these animals displayed the expected inflammatory phenotypes relative to controls and showed that they exhibited poor performance on the accelerating rotarod (FIG. 3A-3D and FIG. 8A). Acute administration of broad-spectrum antibiotics then began and associated phenotypes over the course of 60 days were monitored. It was discovered that this treatment significantly reduced each of the inflammatory and autoimmune phenotypes in mutant animals (FIGS. 3B-3D), including splenomegaly (P = 0.0002) (FIGS. 8C-8D) and improved rotarod performance (P = 0.0398) (FIG. 8A). In contrast, treatment with vehicle had no impact on these measures (FIGS. 3B-3D and FIGS. 8A-8D).

Fecal transplants mitigate inflammation

To more directly probe whether phenotypic improvements were due to microbial communities of the gut, rather than unrelated consequences of antibiotics treatment, fecal transplant experiments were performed. Another cohort of C9orf72^Harvard mice (+/+ n=27, -/- n=32; Day 100) was produced and these animals displayed the expected inflammatory phenotypes relative to controls. Transient antibiotic treatment suppressed animals’ gut microflora and then feces from either the pro-inflammatory (Harvard BRI) or pro-survival (Broad Institute) environment was transplanted (FIG. 3E).

Transplantation of pro-survival gut microflora significantly improved each of the inflammatory and autoimmune phenotypes (FIGS. 3F-3H and FIG. 8E). In contrast, transplant with microflora from the pro-inflammatory facility did not improve these measures, suggesting that the observed benefits when transplanting feces from the protective environment was not merely due to the brief antibiotic treatment that enabled microbial engraftment. Therefore, the inflammatory and autoimmune disease which underlies premature mortality in C9orf72^Harvard mutant mice can be therapeutically prevented and signals from certain gut microbiota help to maintain it.

Profiling gut bacteria

To identify bacterial constituents of the gut associated with severe phenotypes in C9orf72^Harvard mutant mice, the composition of feces from two pro- inflammatory environments where mutant mice perished was surveyed [7], [12] as well as two pro-survival environments [6] (FIG. 31). Principle components analysis readily separated samples from the four environments with the largest principle component (PCI; 28.7% of variance), separating the two pro-inflammatory environments from the two pro-survival environments (FIG. 3J). Deeper investigation of this axis of variance revealed a shared significant decrease in alpha diversity in the two pro-inflammatory environments while unsupervised hierarchical clustering demonstrated that samples from the pro-inflammatory environments showed disparate beta diversity from that found in the pro-survival environments (FIG. 3K and FIG. 9F). Exemplifying these considerable differences in community structure, 62 of 301 bacterial species that were identified (20.6%) were significantly altered in their abundance when jointly comparing the two pro-survival environments to the two pro-inflammatory environments (p < 0.0002) (FIGS. 9A-9E). Consistent with initial observation (FIG. 18), Helicobacter spp. was found in both pro-inflammatory environments (FIGS. 9G-9H) but absent in pro-survival environments.

The extent of microbial reconstitution in the fecal transplant recipient mice was then characterized (FIGS. 10A-10F). Hierarchical clustering of beta diversity revealed that the microbial constituencies of mice receiving Broad fecal transplants were more similar to Broad Institute animal feces than to feces from either animals housed at Harvard BRI or feces from Harvard transplant recipients (FIG. 10D). Analysis of individual bacteria similarly supported the success of the transplants, with 85% (199/234) of bacterial species identified in Harvard BRI feces detected in Harvard fecal recipients and 75% (178/236) of bacterial species identified in Broad Institute feces detected in Broad fecal recipients (FIG. 10F). Quantitative PCR for Helicobacter spp. rDNA further confirmed the reconstitution of Harvard specific microbes in Harvard recipients and their elimination from Broad fecal recipients (FIG. 91).

Gut components regulate myeloid cytokines

To mechanistically explore how varied fecal components arising in separate environments alter cytokine burden and autoimmunity in C9orf72 -/- mice, bone marrow derived macrophages (BMDMs) were stimulated from C9orf72^Harvard animals with chemical analogs of microbial components and found that both +/- and -/- C9orf72^Harvard BMDMs released higher levels of several pro-inflammatory cytokines than +/+ control cells in response to bacterial lipopeptide, single stranded (ss)RNA and ssDNA (FIGS. 11A-11C). Given these findings, a question presented was whether fecal material from Harvard BRI housed animals contained higher levels of innate immune stimulating factors than feces from mice at the Broad Institute. To this end, normalized concentrations of fecal eubacteria from both institutions to C9orf72^Harvard -/- and +/+ BMDMs were individually administered. C9orf72 -/- BMDMs produced significantly higher levels of TNF-alpha when exposed to Harvard BRI fecal material than when exposed to Broad feces (FIG. 1 ID). In addition, serial dilutions revealed that a combination of Harvard BRI feces and a C9orf72 -/- genotype lead to TNF-alpha release at the lowest fecal concentrations (FIG. 1 ID).

Environment governs neuroinflammation

Neuroinflammation is a pathological hallmark of C90RF72 ALS and FTD [18], [19], with substantial infiltration of peripheral immune cells noted in the spinal cord of ALS patients [20], [21]. the pan-hematopoietic marker CD45 was used to distinguish CD45mid resident microglia from peripherally derived CD45hi cells22 and found that infiltrating cells were present at sites of focal inflammation within the spinal cord parenchyma of C9orf72^Harvard -/- mice (FIG. 4A and FIGS. 12A-12H). Mass Cytometry analysis revealed the CD45hi cells that infiltrated the spinal cord were mostly CD1 lb-i- Ly6C+ Ly6G+ CD39- neutrophils and CD3e+ T cells (FIGS. 12A-12F). Strikingly, lifelong suppression of gut microflora with antibiotics prevented the accumulation of infiltrating myeloid cells within the spinal cord of C9orf72^Harvard -/- mice (FIGS. 4B-4C).

In addition to infiltrating peripheral immune cells, there are also substantial changes to resident microglia in the nervous system of ALS/FTD patients [23], [24]. Studies from this group [25] and others [6], [8], [9] have implicated C9orf72 and its interactor Smcr8 in regulation of endo-lysosomal trafficking and autophagy, particularly in myeloid derivatives. Microglia from the spinal cord of C9orf72^Harvard -/- animals expressed higher levels of the lysosome-associated proteins Lampl6 (FIG. 13A) and Cathepsin B (FIG. 13B). Lifelong suppression of gut microbiota did not significantly decrease Lampl or Cathepsin B levels in C9orf72^Harvard -/- microglia (FIGS. 13C-13D) suggesting that C9orf72 function regulates lysosomal constituents independently from microbial signals.

To examine the activation status of resident microglia in C9orf72^Harvard mutant animals and to also ask whether it might be altered by signals from the microbiota, levels of the pattern recognition receptor Dectinl, the chemokine receptor Ccr9, and the lipoprotein lipase Lpl, which have previously been associated with pro-inflammatory microglial states were measured [26]-[29] . Consistent with the notion that microglia become activated when C9orf72 levels decline, we found that Dectinl and Ccr9 were enriched on microglia from C9orf72^Harvard -/- mice (FIGS 4D-4F and FIGS. 13E-13G). Importantly, Dectinl and Ccr9 expression were significantly reduced in microglia from C9orf72^Harvard mutant animals whose gut microflora was chronically suppressed with antibiotics (FIGS. 4D-4F). Together these results demonstrate that when C9orf72 function is reduced, peripheral immune cells can infiltrate the spinal cord where they associate with sites of neuroinflammation and that treatment with antibiotics, which suppresses the microbiota, modulates both infiltration and microglial activation.

Discussion

The results indicate that when C9orf72 function declines, the environment generally and the gut microbiota specifically become potent modifiers of whether autoimmunity, neural inflammation, motor deficits and premature mortality occur. In fact, the effect of environment and accompanying changes of microbial microflora are so strong in this mouse model that in one environment, inflammatory disease and death were highly penetrant phenotypes, while in another they were essentially absent. The likely explanation for the considerable phenotypic variation that has been observed across groups studying this C9orf72 LOF allele in mice [6], [7], [12], [13]. These conclusions are important because they re-emphasize that the 50% reduction in the levels of C90RF72 found in C90RF72 ALS/FTD patients are a credible cause for the neural inflammation that are characteristic in their condition. These findings also suggest that variance in microbiota could explain why some carriers of the C90RF72 mutation develop ALS/FTD or overt inflammatory conditions like lupus [15], [16], while others do not.

It should be re-emphasized that the microbes present in the environments we studied here are not considered mouse pathogens per se, and that their abundances were within the scope found in comparable institutions [30]. Importantly, the environmental conditions that triggered severe phenotypes in the C9orf72^Harvard animals were reproducible elsewhere. There is a relationship between reduction in C9orf72 function and an increased rate of premature mortality, which was replicated here. It is notable that these two environments were most similar in their microbial constituents and also shared many microbes that were not present in the two pro-survival locations that were surveyed. Given the large number of species found to significantly differ in their abundance between pro-inflammatory and pro-survival environments, future studies will be needed to elucidate the relative contribution of individual bacterial species to variation in the inflammatory and autoimmune phenotypes reported herein. However, microbe by microbe analysis of varying environments and the transplant animals would seem to rule out reported protective effects of Akkermansia muciniphila [31], [32] (FIG. 10F) and potential inflammatory influences of Tritrichomonas muris (FIG. 9E).

It is increasingly appreciated that gut microbes alter the maturation and function of microglia [33], can influence the activity of neurons in the central nervous system [34] and contribute to neuroinflammation and neuropathology in models of Alzheimer’s [35] and Parkinson’s disease [36]. However, only initial surveys of the gut microbiota have been reported in patients with neurological conditions [37] and thus far results from initial studies in ALS patients have been mixed [38]— [40]. Two studies reported significant differences between the microbial constituencies of ALS/FTD patients and controls [38], [40] while others found no clear distinctions [39].

Consistent with the idea there are complex interactions between a patient’ s germline genotype and their gut microflora in ALS, it was recently reported that SOD1 transgenic mice displayed a more rapid decline when bacterial load was reduced, which was linked to reduced bacterial production of nicotinamide [31]. While the presence of protective microbes in some environments cannot be ruled out, the studies described herein suggest that lowering bacterial load in C9orf72 mutants was in aggregate protective, likely by reducing exposure of their genetically sensitized innate immune response to microbially-derived inflammatory factors.

In sum, the studies suggest that the microbiome may be an important governor of onset and progression in patients with C90RF72 mutations, including those experiencing autoimmune and inflammatory conditions prior to an ALS/FTD diagnosis [15], [16]. To properly test this idea, a key future experiment will be to identify C90RF72 repeat expansion carriers within known families and to determine whether the gut microbiota differs between individuals that remain healthy and those acquiring ALS/FTD.

Materials and Methods Animals

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Harvard University and the Broad Institute and were in compliance with all relevant ethical regulations. The KOMP and Neo deleted C9orf72 loss of function strains were generated as described previously [7]. Mice were housed with nestlet bedding, red hut for enrichment, provided water ad libitum and fed ad libitum either Prolab Isopro RMH 3000 (Harvard BRI) or PicoLab Rodent Diet 20 (Broad Institute) and kept on a 12 hour light-dark cycle. Embryo rederivation was performed by collecting embryos from super- ovulated C9orf72 +/- females, washing embryos, then surgical transfer using aseptic technique into the reproductive tract of pseudopregnant recipient females. For experiments involving antibiotics, animals were cohoused for at least a week prior to initiation of dosing. Animals were administered either vehicle (water) or a freshly prepared cocktail of four antibiotics including Ampicillin sodium salt (200 mg/kg/day), Neomycin trisulfate salt hydrate (200 mg/kg/day), Metronidazole (200 mg/kg/day), and Vancomycin hydrochloride from Streptomyces orientalis (100 mg/kg/day) (all from Sigma) administered by twice daily gavage. N, sex and ages of the animals used in each study are described in figure legends or text. Power calculations (G*Power 3.1.9.2) using the mean and standard error of endophenotype data was used to estimate necessary cohort sizes for antibiotics and fecal transplant studies. Before administration of antibiotics, animals were assessed for systemic inflammatory measures and mice were allocated into groups so that no significant differences were present prior to treatment initiation.

Motor behavior

Naive animals were trained on the rotarod at constant speed of 4 RPM for 300 seconds at least one day before competitive assessment. For performance trials, the rotarod accelerated from 4 to 40 RPM over 300 seconds using Ugo Basile mouse RotaRod NG (Harvard FAS BRI) or Panlab Rota Rod (Broad Institute). Each trial day consisted of three tests per mouse, with each test separated by at least 20 minutes. Operator was blinded to animal genotype during trials.

Fecal transplantation

Using sterilized forceps, donor fecal pellets were collected directly from the anus or donor upper and lower intestinal contents were isolated from euthanized animals and immediately frozen on dry ice. Recipient mice received antibiotics twice daily by gavage for two weeks, then two day secession of antibiotics, then fecal transplantation once per day for two days. Feces pellets and intestinal contents from donor mice were weighed, pooled, diluted to 200 mg/mL in degassed PBS and administered by oral gavage to recipient mice at 2mg feces/g body weight. All cage changes were performed in HEPA filtered hoods with freshly autoclaved cages, bedding and enrichment.

Blood and cytokine measures

Peripheral blood was collected via mandible puncture into EDTA-coated tubes. Blood counts were assessed using a Hemavet (Abaxis). Samples were then centrifuged to pellet cells and plasma harvested from supernatant. Plasma was diluted 1:2 for luminex-based multiplexed fluorescence assay to assess 36 cytokines and chemokines. Plasma was diluted 1:200 to assess mouse anti-dsDNA total IgG autoantibodies (Alpha Diagnostic International). Tissue preparation

Animals were anesthetized with isofluorane followed by transcardial perfusion with HBSS supplemented with 10 U/mL heparin. Spleens were dissociated by repeated trituration with glass pipetteman in HBSS, subjected to 10-minute RBC lysis (eBio science), washed in autoMACS (Miltenyi), filtered (40 pm) and counted using a Countess (Invitrogen) for antibody staining. For flow cytometry of the CNS, spinal cords were digested by papain and DNase diluted in EBSS (Worthington) for 10 minutes at 37°C, triturated with glass pipettman to generate large tissue chunks then allowed to digest for 20 minutes at 37°C.DMEM supplemented with glutamax was added, samples triturated to single cells, ovomucoid (Worthington) and DNase diluted in EBSS added to inhibit protease activity, cells filtered, washed in autoMACS buffer, and pelleted at 500xg for 15 minutes at 4°C. Cell pellets brought up in isotonic Percol Plus (Sigma) diluted to 30% in autoMACS and spun for 15 minutes at room temperature with no brake. Floating myelin was gently removed using plastic transfer pipette. Cell pellets were resuspended, filtered, washed in autoMACS and re pelleted at 4°C. Cells were fixed in 4% paraformaldehyde (PFA; Electron Microscopy Sciences) either before or after antibody staining depending on need. Samples collected on BD LSRII. Data analyzed using Flowjo and/or Cytobank. For immunofluorescence experimenets, following HBSS perfusion animals were perfused with 4% PFA and CNS tissue post-fixed in 4% PFA overnight at 4°C. The next day samples were washed with PBS overnight at 4°C. Tissue was submerged in 30% sucrose for two days. After cryoprotection, lumbar regions were mounted in OCT and cryostat sectioned at 30pm.

Immunofluorescence

Spinal cord sections were washed three times in PBS to remove residual OCT. Sections were incubated in a blocking solution (10% donkey serum, 0.1M glycine, 0.1% Tween20 or 0.3% Triton X100, PBS, Image-iT FX Signal Enhancer (Thermo) for 1 hour at room temperature. Following blocking, sections were incubated with primary antibodies for two days on a rocker at 4°C. Primary antibodies include: Rat-CDl lb-FITC 1:200 (Ml/70, BioLegend), rabbit-Cathepsin B 1:400 (D1C7Y CST), rat-CD45-488 1:200 (30-F11 BioLegend), guinea pig-Ibal 1:500 (234004 Synaptic Systems), rat-Lampl 1:200 (1D4B SCB), rat-Ccr9-FITC (9B1 Biolegend), rat-Dectinl/Clec7a (mabg-mdect Invivogen), mouse- Lpl (ab21356 Abeam). Sections were then washed with 0.1% Tween20 in PBS (for stains with CDllb, CD45, Ccr9, Cathepsin B) or 0.3% TritonXIOO in PBS (for stains with Ibal, Lampl, Clec7a/Dectinl, Lpl) at least five times. Secondary antibodies include: Donkey-anti- rat- AlexaFluor-488, -mouse IgG-555, -rabbit-555, -rabbit-647, -rat-647, -guinea pig-647, all 1:500 dilution (Invitrogen), for 2 hours at room temperature. Sections were washed again, mounted on microscope slides in Fluoromount for curing overnight. Spinal cords were imaged on a ZEISS LSM700 with either a lOx and 40x objective or Axio scan Z.l at 20x objective. Images were stitched and processed on ZEISS ZEN 2.6 image processing software and Bitplane Imaris 9.2. All comparative stains between control and mutant animals were acquired using identical laser and microscope settings and images processed with viewer blinded to genotype.

Flow cytometry

Dissociated single cells were stained in autoMACS on ice using the following antibodies (BioLegend): CD45-BV421 or APC-Cy7 1:200 (30-F11), rabbit-Cathepsin B 1:100 (D1C7Y CST) and goat-anti-rabbit- AlexaFluor-488 1:500 (Invitrogen), Ccr9-FITC 1:200 (9B1), F4/80-PE-Cy5 1:400 (BM8), CDllb-AlexaFluor-700 1:400 (Ml/70 Invitrogen), Lampl- APC-Cy7 1:400 (1D4B), TmStain FcX 1:250 (93), CD39-PE 1:400 (Duha59), Ly6G-PE-Cy7

1:600 (1A8), Ly6C-AlexaFluor-647 (HK1.4). To retrieve the cathepsin B epitope, fixed cells were slowly permeabilized in 90% methanol prior to staining for cathepsin B.

16S sequencing, PRIA

DNA was isolated by Powersoil (QIAGEN, Germantown, MD) per the manufacturer’s protocol and recovery yield and DNA quality was determined by fluorometric analysis. DNA concentration was standardized and amplified using 16s rRNA primers spanning the V3 and V4 regions (Illumina). Resulting amplified PCR products were analyzed on a Bioanalyzer (Agilent Technologies, Santa Clara, CA) then purified and amplified with primers containing unique sample nucleotide barcodes (Illumina). PCR products were analyzed with the Bioanalyzer for product quality control and also by SYBR green PCR to determine the quantity. All samples were pooled and standardized to a final concentration of 4.0 nM representation for each sample. The 16S PCR product pool was denatured with sodium hydroxide then adjusted to 4.0 pM and combined with 5% PhiX control DNA prior to loading onto a sequencing flow cell (Illumina) with 300 bp paired ends and a unique molecular tag for each sample. Following the sequencing run, the sequence data was separated based on the nucleotide bar code and then compared to the Greengenes database [41]. Relative abundance, alpha diversity, beta diversity and principal coordinate analysis was performed using QIIME analysis software [42]. PCR assays for rodent infectious agents (PRIA) were performed as described [43].

PCR

Fecal DNA was isolated from fecal pellets using QIAmp Fast DNA Stool Mini Kit (Qiagen). Helicobacter spp. 16S rRNA was amplified using primers 5’- CTATGACGGGTATCCGCC-3’ (SEQ ID NO: 1) and 5’-ATTCCACCTACCTCTCCCA-3’ (SEQ ID NO: 2). Total Eubacteria 16S rRNA amplified using primers 5’- TCCTACGGGAGGC AGC AG-3 ’ (SEQ ID NO: 3) and 5’-

GGACTACCAGGGTATCTAATCCTGTT -3’ (SEQ ID NO: 4). Tritrichomonas muris 28S rRNA was amplified using primers 5’-GCTTTTGCAAGCTAGGTCCC-3’ (SEQ ID NO: 5) and 5 ’ -TTTCT GAT GGGGC GT ACC AC -3’ (SEQ ID NO: 6). RNA was isolated from tissue by dissociating cortex in Trizol LS (Thermo) using pellet pestle and reverse transcriptase with iScript (Biorad). qRT- PCR was performed using SYBR (Biorad). Ly6C was amplified using primers 5’- TACTGTGTGCAGAAAGAGCTCAG-3’ (SEQ ID NO: 7) and 5’- TTCCTTCTTTGAGAGTCCTC AATC-3 ’ (SEQ ID NO: 8). Gapdh was amplified using primers 5’-TGCGACTTCAACAGCAACTC-3’ (SEQ ID NO: 9) and 5’- GCCTCTCTTGCTCAGTGTCC-3 ’ (SEQ ID NO: 10).

Bone marrow derived macrophages

Two femurs and tibias were stripped of musculature, flushed and cultured in IMDM supplemented with 10% FCS, NEAA, Glutamax, pen/strep and 20 ng/mL murine M-csf (PeproTech). Media was changed on day 3 and cells plated for experiments after 6 days.

Cells plated at 4E4 per 96 well and allowed to attach overnight, followed by stimulation with microbial moieties (Invivogen) including Pam3csk4 (10-1000 ng/mL; tlrl- pms), Zymosan (1 ug/mL; tlrl-zyn), HMW Poly(LC) (10 ug/mL; tlrl-pic), LPS (10 ng/mL; tlrl- peklps), R848 (20 ng/mL; tlrl-r848), CpG ODN (25 ug/mL; tlrl-1826), or PGN (20 ug/mL; tlrl-pgnb3). For fecal stimulations, previously frozen feces were thawed, diluted to 200 mg/mL in PBS, passed through 40 um filter, quick spun, and supernatant collected and kept on ice. Bacterial DNA was isolated from each sample using QIAmp Fast DNA Stool Mini Kit (Qiagen) and total Eubacteria 16S rDNA abundance determined by qPCR. The more concentrated sample was diluted in PBS to normalize the relative Eubacteria abundance, which was confirmed again by bacterial DNA isolation and qPCR. Dilution curves were prepared for each normalized fecal sample and added to macrophage cultures. Pen/strep added to cultures after 2 hours, then media harvested after 18 hours for testing by Tnf alpha ELISA at 1:2 and 1:10 dilution (BioLegend).

Statistics

Statistical calculations were performed using Graphpad prism 8.0. Tests between two groups used two-tailed Student t test. A Bonferroni corrected T test was used to assess differentially abundant bacterial species between pro-inflammatory and pro- survival environments. Tests between multiple groups used one-way analysis of variance (ANOVA) with either Tukey or Sidak multiple comparisons. Tests between multiple groups over time used two-way ANOVA with Dunnett multiple comparisons. Survival curves were evaluated by generalized Wilcoxon.

References

1. DeJesus-Hernandez, M. et al. Expanded GGGGCC hexanucleotide repeat in noncoding region of C90RF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245-256 (2011).

2. Majounie, E. et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. Lancet Neurol. 11, 323-330 (2012).

3. Mori, K. et al. The C9orf72 GGGGCC Repeat Is Translated into Aggregating Dipeptide- Repeat Proteins in FTLD/ALS. Science 339, 1335-1338 (2013).

4. Cooper-Knock, J. et al. Sequestration of multiple RNA recognition motif-containing proteins by C9orf72 repeat expansions. Brain J. Neurol. 137, 2040-2051 (2014). 5. Ash, P. E. A. et al. Unconventional translation of C90RF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639-646 (2013).

6. O’Rourke, J. G. et al. C9orf72 is required for proper macrophage and microglial function in mice. Science 351, 1324-1329 (2016).

7. Burberry, A. et al. Foss-of-function mutations in the C90RF72 mouse ortholog cause fatal autoimmune disease. Sci. Transl. Med. 8, 347ra93 (2016).

8. Shi, Y. et al. Haploinsufficiency leads to neurodegeneration in C90RF72 AFS/FTD human induced motor neurons. Nat. Med. 24, 313-325 (2018).

9. Nassif, M., Woehlbier, U. & Manque, P. A. The Enigmatic Role of C90RF72 in Autophagy. Front. Neurosci. 11, (2017).

10. Whary, M. T. & Fox, J. G. Natural and Experimental Helicobacter Infections. Available at ingentaconnect.com/content/aalas/cm/2004/00000054/00000002/art00002%3bjsessionid=lhk pa2iwdtskb.x-ic-live-02# (2004).

11. Flannigan, K. F. & Denning, T. F. Segmented filamentous bacteria- induced immune responses: a balancing act between host protection and autoimmunity. Immunology 154, 537-546 (2018).

12. Ugolino, J. et al. Foss of C9orf72 Enhances Autophagic Activity via Deregulated mTOR and TFEB Signaling. PFOS Genet. 12, el006443 (2016).

13. Jiang, J. et al. Gain of Toxicity from AFS/FTD-Finked Repeat Expansions in C90RF72 Is Alleviated by Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs. Neuron 90, 535-550 (2016). 14. Atanasio, A. et al. C9orf72 ablation causes immune dysregulation characterized by leukocyte expansion, autoantibody production, and glomerulonephropathy in mice. Sci. Rep. 6, (2016).

15. Miller, Z. A. et al. Increased prevalence of autoimmune disease within C9 and FTD/MND cohorts. Neurol. Neuroimmunol. Neuroinflammation 3, (2016).

16. Fredi, M. et al. C9orf72 Intermediate Alleles in Patients with Amyotrophic Lateral Sclerosis, Systemic Lupus Erythematosus, and Rheumatoid Arthritis. NeuroMolecular Med. (2019) doi: 10.1007/sl2017-019-08528-8.

17. Stine, J. G. & Lewis, J. H. Hepatotoxicity of antibiotics: a review and update for the clinician. Clin. Liver Dis. 17, 609-642, ix (2013).

18. Ransohoff, R. M. How neuroinflammation contributes to neurodegeneration. Science 353, 777-783 (2016).

19. McCauley, M. E. & Baloh, R. H. Inflammation in ALS/FTD pathogenesis. Acta Neuropathol. (Berl.) 137, 715-730 (2019).

20. Zhao, W., Beers, D. R. & Appel, S. H. Immune-mediated Mechanisms in the Pathoprogression of Amyotrophic Lateral Sclerosis. J. Neuroimmune Pharmacol. Off. J. Soc. Neurolmmune Pharmacol. 8, 888-899 (2013).

21. Zondler, L. et al. Peripheral monocytes are functionally altered and invade the CNS in ALS patients. Acta Neuropathol. (Berl.) 132, 391-411 (2016).

22. Zhang, G. X., Li, J., Ventura, E. & Rostami, A. Parenchymal microglia of naive adult C57BL/6J mice express high levels of B7.1, B7.2, and MHC class II. Exp. Mol. Pathol. 73, 35-45 (2002). 23. Geloso, M. C. et al. The Dual Role of Microglia in ALS: Mechanisms and Therapeutic Approaches. Front. Aging Neurosci. 9, (2017).

24. Lall, D. & Baloh, R. H. Microglia and C9orf72 in neuroinflammation and ALS and frontotemporal dementia. J. Clin. Invest. 127, 3250-3258 (2017).

25. Zhang, Y. et al. The C9orf72-interacting protein Smcr8 is a negative regulator of autoimmunity and lysosomal exocytosis. Genes Dev. 32, 929-943 (2018).

26. Li, H. et al. Different Neurotropic Pathogens Elicit Neurotoxic CCR9- or Neurosupportive CXCR3-Expressing Microglia. J. Immunol. 177, 3644-3656 (2006).

27. Steel, C. D. et al. Role of peripheral immune response in microglia activation and regulation of brain chemokine and proinflammatory cytokine responses induced during VSV encephalitis. J. Neuroimmunol. 267, 50-60 (2014).

28. Krasemann, S. et al. The TREM2-APOE pathway drives the transcriptional phenotype of dysfunctional microglia in neurodegenerative diseases. Immunity 47, 566-58 Le9 (2017).

29. Keren-Shaul, H. et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer’s Disease. Cell 169, 1276-1290. el7 (2017).

30. Nilsson, H.-O. et al. High Prevalence of Helicobacter Species Detected in Laboratory Mouse Strains by Multiplex PCR-Denaturing Gradient Gel Electrophoresis and Pyrosequencing. J. Clin. Microbiol. 42, 3781-3788 (2004).

31. Blacher, E. et al. Potential roles of gut microbiome and metabolites in modulating ALS in mice. Nature 572, 474-480 (2019).

32. Zhai, R. et al. Strain-Specific Anti-inflammatory Properties of Two Akkermansia muciniphila Strains on Chronic Colitis in Mice. Front. Cell. Infect. Microbiol. 9, (2019). 33. Erny, D. et al. Host microbiota constantly control maturation and function of microglia in the

CNS. Nat. Neurosci. 18, 965-977 (2015).

34. Olson, C. A. et al. The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic Diet. Cell 173, 1728-1741.el3 (2018).

35. Harach, T. et al. Reduction of Abeta amyloid pathology in APPPS1 transgenic mice in the absence of gut microbiota. Sci. Rep. 7, (2017).

36. Sampson, T. R. et al. Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson’s Disease. Cell 167, 1469- 1480. el2 (2016).

37. Tremlett, H., Bauer, K. C., Appel-Cres swell, S., Finlay, B. B. & Waubant, E. The gut microbiome in human neurological disease: A review. Ann. Neurol. 81, 369-382 (2017).

38. Fang, X. et al. Evaluation of the Microbial Diversity in Amyotrophic Lateral Sclerosis Using High-Throughput Sequencing. Front. Microbiol. 7, (2016).

39. Brenner, D. et al. The fecal microbiome of ALS patients. Neurobiol. Aging 61, 132-137 (2018).

40. Mazzini, L. et al. Potential Role of Gut Microbiota in ALS Pathogenesis and Possible Novel Therapeutic Strategies. J. Clin. Gastroenterol. 52 Suppl 1, Proceedings from the 9th Probiotics, Prebiotics and New Foods, Nutraceuticals and Botanicals for Nutrition & Human and Microbiota Health Meeting, held in Rome, Italy from September 10 to 12, 2017, S68- S70 (2018).

41. DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069-5072 (2006). 42. Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335-336 (2010).

43. Henderson, K. S. et al. Efficacy of Direct Detection of Pathogens in Naturally Infected Mice by Using a High- Density PCR Array. J. Am. Assoc. Lab. Anim. Sci. JAALAS 52, 763-772 (2013).

Claims

CLAIMS What is claimed is:

1. A method of treating or reducing the likelihood of a disease or condition associated with C9orf72 mutation in a subject, comprising administering to the subject a first agent that alters gut microbiota in the subject.

2. The method of claim 1, wherein the disease or condition is a neurodegenerative or neurological disease.

3. The method of claim 2, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) and/or frontotemporal dementia (FTD).

4. The method of claim 1, wherein the disease or condition is an autoimmune disease or condition.

5. The method of claim 4, wherein the disease or condition is selected from the group consisting of Ankylosing spondylitis, Asthma, chronic active hepatitis, Celiac disease, Crohn disease, dermatomyositis, insulin-dependent diabetes, idiopathic thrombocytopenic purpura, multiple sclerosis, myasthenia gravis, myxedema, pemphigoid, pernicious anemia, polymyositis, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, sarcoidosis and transverse myelitis, scleroderma, Sjogren syndrome, systemic lupus erythematosus, thyrotoxicosis, ulcerative colitis, and vitiligo.

6. The method of claim 1, wherein the disease or condition is an inflammatory disease or condition.

7. The method of claim 6, wherein the disease or condition is an inflammatory and autoimmune disease or condition.

8. The method of claim 6 or claim 7, wherein the disease or condition is selected from the group consisting of Crohn’s disease and ulcerative colitis.

9. The method of any one of claims 1-8, wherein the administration of the first agent to the subject has one or more effects selected from the group consisting of: reduces inflammation, reduces autoimmunity, improves motor function, reduces splenomegaly, reduces cytokine burden, reduces myeloid cell infiltration, and reduces microgliosis.

10. The method of any one of claims 1-9, wherein the first agent comprises an antibiotic, bacteria, and/or a bacteriophage.

11. The method of any one of claims 1-10, wherein the first agent comprises an antibiotic.

12. The method of claim 11, wherein the antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, and ceftriaxone.

13. The method of any one of claims 1-10, wherein the first agent comprises bacteria.

14. The method of claim 13, wherein the bacteria is pro-survival gut microflora.

15. The method of claim 14, wherein the pro-survival gut microflora is a synthetic pro survival gut microflora.

16. The method of claim 13, wherein the bacteria is a probiotic.

17. The method of any one of claims 1-10, wherein the first agent comprises a bacteriophage.

18. A method of treating or reducing the likelihood of a disease or condition associated with C9orf72 mutation in a subject, comprising administering to the subject a first agent that reduces microbial burden in the subject.

19. A method of treating or reducing the likelihood of a disease or condition associated with ALS or FTD, comprising one or more of: a. administering to the subject a first agent that alters gut microbiota in the subject; b. administering to the subject a first agent that reduces Helicobacter spp. in the subject; c. administering to the subject a first agent that reduces the infiltration of peripheral immune cells into the spinal cord in the subject; d. administering to the subject a first agent that reduces microglia activation in the subject; and e. administering to the subject a first agent that reduces TNF-alpha release by bone marrow derived macrophages in the subject.

20. The method of claim 19, wherein the disease or condition is one or more of an inflammatory disease or condition and an autoimmune disease or condition.

21. The method of claim 19 or claim 20, wherein the first agent reduces gut microbiota in the subject.

22. The method of any one of claims 19-21, wherein the first agent comprises an antibiotic, bacteria, and/or a bacteriophage.

23. The method of any one of claims 19-22, wherein the first agent comprises an antibiotic.

24. The method of claim 23, wherein the antibiotic is selected from the group consisting of vancomycin, metronidazole, neomycin, ampicillin, minocycline, and ceftriaxone.

25. The method of any one of claims 19-22, wherein the first agent comprises bacteria.

26. The method of claim 25, wherein the bacteria is pro-survival gut microflora.

27. The method of claim 26, wherein the pro-survival gut microflora is a synthetic pro survival gut microflora.

28. The method of claim 25, wherein the bacteria is a probiotic.

29. The method of any one of claims 19-22, wherein the first agent comprises a bacteriophage.

30. A pharmaceutical composition comprising an agent that alters gut microbiota in a subject.

31. The pharmaceutical composition of claim 30, wherein the agent reduces inflammation, reduces autoimmunity, improves motor function, reduces splenomegaly, reduces cytokine burden, reduces myeloid cell infiltration, and/or reduces microgliosis in a subject.

32. The pharmaceutical composition of claim 30 or claim 31, wherein the agent comprises a synthetic pro- survival gut microflora.

33. The pharmaceutical composition of any one of claims 30-32, further comprising a second agent.

34. The pharmaceutical composition of claim 33, wherein the second agent comprises an antibiotic, bacteria, and/or a bacteriophage.

35. The pharmaceutical composition of any one of claim 30-34, wherein the agent reduces the infiltration of peripheral immune cells into the spinal cord of the subject.

36. A method of screening one or more test agents to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with loss of function of C9orf72 in a subject, comprising: providing a cell having a C9orf72 mutation in an environment having an increased microbial load; contacting the cell with one or more test agents; determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines; and identifying the test agent as a candidate agent if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines.

37. The method of claim 36, wherein the step of determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines comprises measuring cytokine and/or chemokine protein levels in the cell.

38. The method of claim 37, wherein the cytokine and/or chemokine protein levels are measured using an ELISA, dot blot, and/or Western blot.

39. The method of claim 36, wherein the step of determining if the contacted cell expresses reduced levels of inflammatory cytokines and/or chemokines comprises measuring RNA expression of the cytokines and/or chemokines.

40. The method of claim 39, wherein RNA expression of the cytokines and/or chemokines is measured using quantitative reverse transcriptase polymerase chain reaction and/or RNA sequencing.