WO2021231436A1 - Therapeutic methods for treating covid-19 infections - Google Patents

Abstract

Provided are innovative diagnostics and therapy for coronavirus infection. It is shown herein that SARS-CoV2 infection results in a program of host innate immunity characterized by the simultaneous silencing of peripheral innate immune responses and hyperactivation of proinflammatory responses in the lung.

Description

THERAPEUTIC METHODS FOR TREATING COVID-19 INFECTIONS STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH [0001] This invention was made with Government support under contract U19AI090023 awarded by the National Institutes of Health. The Government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS [0002] The present application claims the benefit of and priority to U.S. Provisional Patent Application No. 63/023,035 filed May 11, 2020, and the U.S. Provisional Patent Application No. 63/026,577 filed May 18, 2020 the entire disclosure of which is hereby incorporated by reference herein in its entireties for all purposes. BACKGROUND [0003] The recent emergence of the SARS-coronavirus 2 (SARS-CoV2) in Wuhan, China in December 2019, and its rapid international spread poses a major global crisis with more than 3 million cases and 230,000 deaths to date. Science has moved rapidly in isolating, sequencing and cloning the virus, and developing diagnostic kits. However, profound knowledge gaps remain about the dynamic interaction between the human immune system and SARS-CoV2. [0004] COVID-19 presents with a spectrum of clinical phenotypes, with most patients exhibiting mild-to-moderate symptoms, and 15% progressing typically in a week to severe or critical disease that needs hospitalization, and a minority of those progressing to develop acute respiratory disease syndrome (ARDS) requiring mechanical ventilation. Epidemiological data so far suggest that COVID-19 has case fatality rate of about 2.3%, several times greater than that of seasonal influenza. The elderly and individuals with underlying medical comorbidities such as cardiovascular disease, diabetes mellitus, chronic lung disease, chronic kidney disease, obesity, hypertension or cancer have a much higher mortality rate than healthy young adults. The underlying causes are unknown, but may be due to an impaired interferon response, and dysregulated inflammatory responses as observed with other zoonotic coronavirus infections such as Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS). [0005] The degree to which the adaptive immune response to SARS-CoV2 is induced with optimal functional capacities know to be important for viral clearance in SARS-CoV1 infection, is yet to be uncovered. Understanding the immunological mechanisms underlying the diverse clinical presentations of COVID-19 is a critical step in the design of rational diagnostic and therapeutic strategies. [0006] Recent reports suggest that COVID-19 patients are characterized by lymphopenia, and increased numbers of neutrophils. Most patients with severe COVID-19 exhibit enhanced levels of proinflammatory cytokines including IL-6 and IL-1b, as well as MCP-1, IP-10 and G- CSF in the plasma. It has been proposed that high levels of pro-inflammatory cytokines may lead to shock, as well as respiratory failure or multiple organ failure, and several trials to assess inflammatory mediators are underway. However, little is known about the immunological mechanisms underlying COVID-19 severity, and the extent to which they differ from the immune response to other respiratory viruses. Furthermore, the question of whether populations in different parts of the world respond differently to SARS-CoV2 remains unknown. SUMMARY [0007] Methods and compositions are provided for diagnosis and therapy of coronavirus infection, including without limitation infection by SARS-CoV2. It is shown herein that SARS- CoV2 infection results in a program of host innate immunity characterized by the simultaneous silencing of peripheral innate immune responses and hyperactivation of proinflammatory responses in the lung. A signature of COVID-19 infection comprises prolonged plasmablast and effector T cell response, reduced expression of HLA-DR in myeloid cells and inhibition of mTOR signaling in plasmacytoid DCs. Consistent with this, myeloid cells and pDCs are impaired in their capacity to produce pro-inflammatory cytokines and IFN-α, respectively, upon Toll-Like Receptor (TLR) stimulation. [0008] Therapeutic methods are provided that reduce hyperactive proinflammatory responses, which methods comprise administering an agent that blocks the activity of one or more of the inflammatory mediators: EN-RAGE, TNFSF14 and Oncostatin M. In some embodiments the inflammatory mediator is EN-RAGE. In some embodiments the inflammatory mediator is TNSF14. In some embodiments the inflammatory mediator is Oncostatin M. [0009] In some embodiments a blocking agent is administered that specifically binds to EN- RAGE, TNFSF14 or Oncostatin M. In some embodiments a blocking agent specifically binds to a receptor for EN-RAGE, TNFSF14 and Oncostatin M. In some embodiments a blocking agent is an antibody. In some embodiments a blocking agent is a soluble receptor. In some embodiments a blocking agent comprises a non-activating polypeptide of EN-RAGE, TNFSF14 and Oncostatin M, e.g. a fragment, a dominant negative mutant, and the like. In some embodiments a blocking agent is a small molecule. [0010] It is shown herein that there is a strong correlation of over-elevated plasma levels of inflammatory mediators EN-RAGE, TNFSF14, and Oncostatin-M with the clinical severity of the disease. Over-elevated plasma levels may be assessed relative to normal control, i.e. the base level in uninfected controls; or relative to the average levels in individuals with non- severe disease. Clinical severity may be as defined in the Examples. A determination of over- elevated inflammatory mediators may comprise a determination for one of EN-RAGE, TNFSF14, and Oncostatin-M; or a combination of two or more of EN-RAGE; TNFSF14, and Oncostatin-M. Over-elevation may be a level that is at least 25% greater than control, at least 50% greater, at least 75% greater, at least 100% greater, at least 125% greater, at least 150% greater, and may be a 2-fold increase, a 3-fold increase, a 4-fold increase, a 5-fold increase or more. [0011] In some embodiments, methods are provided for patient stratification based on the prognosis for development of severe COVID-19 disease. In some embodiments a patient sample is obtained. A sample may be a blood or blood-derived sample, e.g. a blood sample, plasma sample, serum sample, etc. A sample may be a tissue derived sample, e.g. lung or nasopharygeal aspirate, lavage, and the like. The patient sample is analyzed for the presence of one or more of EN-RAGE, TNFSF14, and Oncostatin-M; and the level compared to a control value or level. The presence of elevated levels of one or more of EN-RAGE, TNFSF14, and Oncostatin-M is indicative of a likelihood to progress to severe disease. [0012] In some embodiments, an individual determined to have a likelihood to progress to severe disease is treated to reduce viral infection, including without limitation by administration of a nucleoside or nucleotide analog, e.g. Remdesivir; protease inhibitors; anti-viral antibodies, and the like. In some embodiments an individual determined to have a likelihood to progress to severe disease is treated to reduce hyperactive proinflammatory responses, e.g. by administering a blocking agent as described above; by administering an inhibitor of IL-6 activity; and the like. In some embodiments, an individual determined to have a likelihood to progress to severe disease is treated to enhance lung function, e.g. with supplemental oxygen, ventilation, C-PAP and the like. [0013] In severe COVID-19 patients that there is increased bacterial products in the plasma, and that there is a very strong correlation between these products and serum ENRAGE, OSM and TNSF14. In some embodiments, an individual determined to have a likelihood to progress to severe disease is treated to reduce viral infection, including without limitation by administration of an antibiotic. [0014] Circulating inflammatory mediators, including EN-RAGE, TNFSF14 and Oncostatin M, are identified and described herein that are differentially expressed in patients with severe coronavirus infection. Such inflammatory mediators are analyzed, optionally in conjunction with detection of plasma microbial DNA sequences. BRIEF DESCRIPTION OF THE DRAWINGS [0015] FIG. 1A-1F. Mass cytometry analysis of peripheral blood leukocytes. (A) A schematic representation of the experimental strategy. (B) Representation of mass cytometry identified cell clusters visualized by t-SNE in two-dimensional space. The box plots on the bottom show frequency of plasmablasts (CD3- CD20- CD56- HLA-DR⁺ CD14- CD16- CD11c- CD123- CD19^lo CD27^hi CD28^hi) and effector CD8 T cells (CD3⁺ CD8⁺ CD38^hi HLA-DR^hi) in both cohorts. (C) Frequencies of pDCs (CD3- CD20- CD56- HLA-DR⁺ CD14- CD16- CD11c- CD123⁺) in healthy and infected populations in both cohorts. (D, E) Box plots showing fold change of pS6 staining in pDCs (D) and IKBa staining in mDCs (E) relative to median of healthy controls. The histograms on the right depict representative staining of the same. (F) The distinguishing features detected by linear regression analysis of the mass cytometry data between healthy and infected subjects. In all the box plots, the boxes show median, upper and lower quartiles. The whiskers show 5 – 95 percentiles. Each dot represents a donor (Healthy: n = 17 and 30; Infected: n = 17 and 29, for Atlanta and Hong Kong cohorts, respectively). Infected includes only subjects with active COVID-19 disease (convalescent and other illnesses have been removed). Colors of the dots indicate severity of clinical disease as shown in the legends. The differences between the groups was measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE). The p-values depicting significance are shown within the box plots. For the linear regression analysis, FDR <0.03 was used as a cut-off. [0016] FIGS. 2A-2C. Flow cytometry analysis of ex vivo stimulated peripheral blood leukocytes. (A) Box plots showing fraction of pDCs in PBMCs of healthy or infected donors (_CD3- _CD20- _CD56- _HLA-DR ⁺ _CD14- _CD16- _CD11c- _CD123 ⁺ _{) producing IFN-α, TNF-α or} IFN-α+TNF-α in response to stimulation with the viral cocktail (polyIC + R848). The contour plots on the right show IFN-α, TNF-α or IFN-α+TNF-α staining in pDCs. (B) Box plots showing f_{raction of mDCs in PBMCs of healthy or infected donors (CD3}- _CD20- _CD56- _HLA-DR ⁺ C_D14- _CD16- _CD123 ⁺ _CD11c-_{) producing IL-6, TNF-α or IL-6+TNF-α in response to no} stimulation (top panel), bacterial cocktail (middle panel, Pam3CSK4, LPS and Flagellin) or viral cocktail (bottom panel, polyIC + R848). The flow cytometry plots on the right are representative plots gated on mDCs showing IL-6, TNF- a or IL-6+TNF-α response. (C) Fold change of NF- kb p65 (Ser529) staining in PBMCs stimulated with bacterial cocktail relative to no stimulation in healthy and infected donors to showing reduced induction of p65 phosphorylation in infected individuals. The histograms show representative flow cytometry plots of p65 staining in myeloid DCs. In all the box plots, the boxes show median, upper and lower quartiles. The whiskers show 5 – 95 percentiles. Each dot represents an Atlanta cohort donor (n = 14 and 17 for healthy and infected, respectively). Colors of the dots indicate severity of clinical disease as shown in the legends. The differences between the groups was measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE). The p-values depicting significance are shown within the box plots. [0017] FIG. 3. Multiplex cytokine analysis in plasma. Cytokine expression in plasma of healthy or infected individuals. The infected individuals are further classified based on severity of clinical disease. The normalized protein expression values plotted on the Y-axis is an arbitrary unit defined by Olink Proteomics to represent Olink data. In all the box plots, the boxes show median, upper and lower quartiles. The whiskers show 5 – 95 percentiles. Each dot represents an Atlanta cohort donor (n = 18 healthy, 4 moderate, 18 severe, 12 ICU, 2 convalescent, 8 Flu and 11 RSV). Colors of the dots indicate severity of clinical disease as shown in the legends. The differences between the groups was measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE). The p-values depicting significance are shown within the plots. [0018] FIS. 4A-4C. The single-cell landscape of COVID-19 infection. (A) PBMCs from healthy donors and patients infected with respiratory diseases, including COVID-19, were enriched for dendritic cells and profiled [for simultaneous transcription and cell-surface proteins] using CITE-seq. (B) UMAP representation of PBMCs from all analyzed samples (n = 18) colored by manually annotated cell type (left), infection (middle) or COVID-19 infection severity (right). (C) Top: Heatmap showing the expression of IFN-induced genes in up to 500 randomly sampled cells per cluster. Bottom: Bar plot showing the fraction of cells derived from a particular infection status in each cluster. [0019] FIGS. 5A-5I. The transcriptional state of innate immune cells from COVID-19- infected patients. (A) Pairwise comparison of genes from healthy donors and COVID-19- infected patients was conducted for each cluster. Differentially expressed genes were analyzed for overrepresentation of BTM modules. Heatmap showing a selection of the overrepresented pathways in up- and downregulated genes. B) Average expression levels of the unique union of genes from IFN- related pathways upregulated in COVID-19-infected patients in (A). (C) UMAP representation of PBMCs from all analyzed samples showing the expression levels of selected interferon and interferon-stimulated genes. (D) Flow cytometry analysis of PBMCs analyzed in parallel to the CITE-seq experiment. Shown is the log10 m^{edian fluorescence intensity of HLA-DR expression.} _{E) Median intensity of HLA-DR} expression in phospho-CyTOF experiment from Figure 1. Wilcoxon rank sum test, n: HK (Healthy = 30, Moderate = 15, Severe = 10), Atlanta (Healthy = 17, Moderate = 4, Severe = 13). F) Expression levels of selected inflammatory cytokines in monocyte and dendritic cell clusters. *p < 0.05; ** p<0.01, *** p<0.001 F) Dot plot showing the expression of selected inflammatory cytokines in myeloid and dendritic cell subsets. G) UMAP representation showing the expression of S100A12 (EN-RAGE) in the dataset. H, I) Correlation analysis of S100A12 expression in cells from myeloid and dendritic cell clusters (C MONO_1, NC MONO, CDC2, PDC, C MONO_IFN, C MONO_2, C MONO_3) with HLA-DRA expression in the same clusters (H) and EN-RAGE levels in plasma (I). [0020] FIGS. 6A-6C. Mass cytometry analysis of peripheral blood leukocytes. Kinetics of frequency of plasmablast, CD8 effector T cells and pDCs in Atlanta and Hong Kong cohorts determined by CyTOF. Each dot is an individual and colors indicate severity of the disease. The blue lines show exptrapolated median and grey shade defines the range. [0021] FIG.7. Gating strategy to identify 25 different immune cell subpopulations. [0022] FIG.8. Flow cytometry analysis of ex vivo stimulated peripheral blood leukocytes. Box plots showing fraction of CD14+ monocytes (CD3- CD20- CD56- HLA-DR+ CD14+ CD16-/+) in PBMCs of healthy or infected producing cytokines indicated on the plots. Each dot represents an individual and the colors indicate severity of clinical disease. In all the box plots, the boxes show median, upper and lower quartiles. The whiskers show 5 – 95 percentiles. Each dot represents an Atlanta cohort donor (n = 14 and 17 for healthy and infected, respectively). The differences between the groups was measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE). The p-values depicting significance are shown within the box plots. [0023] FIG.9. Multiplex cytokine analysis in plasma. Cytokine expression in plasma of healthy or infected individuals. The infected individuals are further classified based on severity of clinical disease. The normalized protein expression values plotted on the Y-axis is an arbitrary unit defined by Olink Proteomics to represent Olink data. In all the box plots, the boxes show median, upper and lower quartiles. The whiskers show 5 – 95 percentiles. Each dot represents an Atlanta cohort donor (n = 18 healthy, 4 moderate, 18 severe, 12 ICU, 2 convalescent, 8 Flu and 11 RSV). Colors of the dots indicate severity of clinical disease as shown in the legends. The differences between the groups was measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE). The p-values depicting significance are shown within the plots. [0024] FIG. 10. Age distribution of diseases group of subjects analyzed per CITE-seq experiment. [0025] FIGS. 11A-11B. UMAP representation of PBMCs from all analyzed samples (n=18) before final QC filtering colored by experiment (A) or cluster (B). [0026] FIG.12. Per-cell QC metrics: fraction of mitochondrial RNA detected in each cell (top). Number of unique molecules per cell (middle), number of unique genes per cell (bottom), [0027] FIG. 13. Heatmap showing the expression levels of the top 10 genes characterizing each detected cluster. [0028] FIG. 14. Heatmap showing the abundance of CITE-seq antibodies in each detected cluster. [0029] FIG.15. Bar graph showing the fraction of cells in each cluster after QC filtering colored by experiment (top), subject (second from top), and COVID-19 disease severity (bottom). [0030] FIG.16. DEG analysis between COVID-19 infected and healthy subjects. We identified DEG in each cluster that distinguished cells derived from moderate and severe COVID-19 patients from healthy cells within that cluster. Overrepresentation analysis was used to identify enrichment of BTMs in the up or downregulated genes. Heatmap shows top 10 enriched BTMs that appear in at least 2 clusters for each cluster. [0031] FIG.17. Heatmaps showing the average expression level of the unique union of genes with the IFN pathways highlighted in FIG.5A for COVID-19 infected and healthy subjects. [0032] FIG.18. Dotplots showing the expression levels of different interferon genes in COVID- 19 infected and healthy subjects. [0033] FIG.19. Boxplots showing the log10 MFU of CD86 expression on mDCs and classical monocytes detected via flow cytometry on samples analyzed in CITE-seq experiment. [0034] FIG.20. Top 5 genes that significantly correlate positively or negatively with S100A12 in monocytes and dendritic cells. [0035] FIG. 21. Dotplots showing the expression levels of S100A12 and different HLA-DR genes in single cells of different myeloid and dendritic cell clusters as detected via CITE-seq. [0036] FIG. 22. UMAP representation showing the expression of the EN-RAGE receptor RAGE (AGER). [0037] FIG. 23. Hierarchical clustering of phosphor CyTOF and plasma cytokine datasets. Hierarchical clustering of healthy and COVID-19 infected subjects using immune cell type frequencies and signaling molecules detected in phosphor-CyTOF and circulating plasma cytokines. The heatmap colors represent row-wise z score. [0038] FIG. 24. Multiplex cytokine analysis in plasma. Spearman’s correlation between cytokine responses measured in plasma samples with and without heat-inactivation. The changes >2-fold are highlighted with labels. [0039] FIG.25. Systemic release of microbial products in severe COVID-19 infection. (A and B) Box plots showing bacterial 16S rRNA gene (A) and LPS (B) measured in the plasma of healthy or infected individuals. qPCR, quantitative PCR. (C) Spearman’s correlation between cytokines and bacterial DNA measured in plasma. Each dot represents a sample (n = 18 and 51 for healthy and infected, respectively). The colors of the dots indicate the severity of clinical disease, as shown in the legends. The boxes show median, upper, and lower quartiles in the box plots. The whiskers show 5th to 95th percentiles. The differences between the groups were measured by Mann-Whitney rank sum test; ***P < 0.001; ****P < 0.0001. NPX, normalized protein expression units; R, correlation coefficient. DESCRIPTION OF THE SPECIFIC EMBODIMENTS [0040] Before the subject invention is described further, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments; and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims. In this specification and the appended claims, the singular forms "a," "an" and "the" include plural reference unless the context clearly dictates otherwise. [0041] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. [0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described. [0043] All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the subject components of the invention that are described in the publications, which components might be used in connection with the presently described invention. [0044] EN-RAGE, (S100 calcium binding protein A12, also known as S100A12, and calgranulin C), is a proinflammatory protein with significant potential as a biomarker. It is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and it is involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100A12 is proposed to be involved in specific calcium-dependent signal transduction pathways and its regulatory effect on cytoskeletal components can modulate various neutrophil activities. It has been reported to be secreted by activated granulocytes and binds to the receptor for advanced gycation end products, which induces NFΚB-dependent activation of endothelium. Swiss-Prot Accession Number: P80511 [0045] Agents that block EN-RAGE include antibodies, which are known in the art and commercially available. For example, see Srikrishna et al. (2005) J. Immunol., 175: 5412-22; Fagerhol et al. (2012) Scand J Clin Lab Invest.72(2):129-36; and Brederson et al. (2016) Eur J Pain 20(4):607-14), each herein specifically incorporated by reference. [0046] TNFSF14, also referred to as LIGHT (homologous to lymphotoxin, exhibits inducible expression and competes with Herpes Simplex Virus glycoprotein D for Herpes Virus Entry Mediator, a receptor expressed by T cells), is a protein primarily expressed on activated T cells, activated Natural Killer (NK) cells, and immature dendritic cells (DC). Approximately 29 kD in size, LIGHT can function as both a soluble and cell surface-bound type II membrane protein and must be in its homotrimeric form to interact with its two primary functional receptors: Herpes Virus Entry Mediator (HVEM) and Lymphotoxin-β Receptor (LTβR). LIGHT signaling through these receptors have distinct functions that are cell-type dependent, but interactions with both types of receptors have immune-related implications in tumor biology. [0047] Agents that block TNFSF14 include antibodies, which are known in the art and commercially available. For example, see Anti-Human TNFSF14 Therapeutic Antibody (TR01G03); or Afuco™ Anti-Human TNFSF14 ADCC Therapeutic Antibody (SAR252067). [0048] OSM is a pleiotropic cytokine that belongs to the interleukin 6 group of cytokines. Of these cytokines it most closely resembles leukemia inhibitory factor (LIF) in both structure and function. OSM signals through cell surface receptors that contain the protein gp130. The type I receptor is composed of gp130 and LIFR, the type II receptor is composed of gp130 and OSMR. [0049] Agents that block OSM include antibodies, which are known in the art and commercially available. For example, see Choy et al. (2013) Arthritis Res Ther 15(5):R132; and anti-oncostatin M monoclonal antibody (mAb) GSK2330811 herein specifically incorporated by reference.. [0050] The term "biological sample" encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples. [0051] Dendritic cell. As used herein, the term refers to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. Dendritic cells are a class of "professional" antigen presenting cells; and have a high capacity for sensitizing MHC-restricted T cells. Dendritic cells may be recognized by function, or by phenotype, particularly by cell surface phenotype. These cells are characterized by their distinctive morphology, intermediate to high levels of surface MHC-class II expression and ability to present antigen to T cells, particularly to naive T cells (Steinman et al. (1991) Ann. Rev. Immunol. 9:271; incorporated herein by reference for its description of such cells). The dendritic cells affected by the methods of the invention may be selected to be immature or mature dendritic cells. [0052] The cell surface of dendritic cells is unusual, with characteristic veil-like projections, and is characterized by expression of the cell surface markers CD1a+, CD4+, CD86+, or HLA- DR+. Mature human myeloid dendritic cells are typically CD11c+, while precursors of dendritic cells include those having the phenotype CD11c-, IL-3Rαlow; and those that are CD11c- IL- 3Rα high are typically plasmacytoid dendritic cells. Treatment with GM-CSF in vivo preferentially expands CD11b.high, CD11c.high DC, while Flt-3 ligand, especially in combination with TPO, has been shown to expand CD11c+ IL-3Rα.low DC, and CD11c- IL- 3Rα.high DC precursors. [0053] The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms also apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non- naturally occurring amino acid polymer. [0054] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma- carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an .alpha. carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. [0055] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a mammal being assessed for treatment and/or being treated. In an embodiment, the mammal is a human. The terms “subject,” “individual,” and “patient” encompass, without limitation, individuals that have been infected with SARS-CoV2. Subjects may be human, but also include other mammals, particularly those mammals useful as laboratory models for human disease, e.g. mouse, rat, etc. Also included are mammals such as domestic and other species of canines, felines, and the like. [0056] The term “diagnosis” is used herein to refer to the identification of a molecular or pathological state, disease or condition. [0057] The term “prognosis” is used herein to refer to the prediction of the likelihood of disease-attributable death or progression. The term “prediction” is used herein to refer to the act of foretelling or estimating, based on observation, experience, or scientific reasoning. In one example, a physician may predict the likelihood that a patient will survive, following therapy. [0058] As used herein, the terms “treatment,” “treating,” and the like, refer to administering an agent, or carrying out a procedure, for the purposes of obtaining an effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of effecting a partial or complete cure for a disease and/or symptoms of the disease. [0059] Treating may refer to any indicia of success in the treatment or amelioration or prevention of disease, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the disease condition more tolerable to the patient; slowing in the rate of degeneration or decline; or making the final point of degeneration less debilitating. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of an examination by a physician. Accordingly, the term "treating" includes the administration of the compounds or agents of the present invention to prevent or delay, to alleviate, or to arrest or inhibit development of the symptoms or conditions. The term "therapeutic effect" refers to the reduction, elimination, or prevention of the disease, symptoms of the disease, or side effects of the disease in the subject. [0060] "In combination with", "combination therapy" and "combination products" refer, in certain embodiments, to the concurrent administration to a patient of a first therapeutic and the compounds as used herein. When administered in combination, each component can be administered at the same time or sequentially in any order at different points in time. Thus, each component can be administered separately but sufficiently closely in time so as to provide the desired therapeutic effect. [0061] As used herein, the term “correlates,” or “correlates with,” and like terms, refers to a statistical association between instances of two events, where events include numbers, data sets, and the like. For example, when the events involve numbers, a positive correlation (also referred to herein as a “direct correlation”) means that as one increases, the other increases as well. A negative correlation (also referred to herein as an “inverse correlation”) means that as one increases, the other decreases. [0062] "Dosage unit" refers to physically discrete units suited as unitary dosages for the particular individual to be treated. Each unit can contain a predetermined quantity of active compound(s) calculated to produce the desired therapeutic effect(s) in association with the required pharmaceutical carrier. The specification for the dosage unit forms can be dictated by (a) the unique characteristics of the active compound(s) and the particular therapeutic effect(s) to be achieved, and (b) the limitations inherent in the art of compounding such active compound(s). [0063] "Pharmaceutically acceptable excipient” means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous. [0064] "Pharmaceutically acceptable salts and esters" means salts and esters that are pharmaceutically acceptable and have the desired pharmacological properties. Such salts include salts that can be formed where acidic protons present in the compounds are capable of reacting with inorganic or organic bases. Suitable inorganic salts include those formed with the alkali metals, e.g. sodium and potassium, magnesium, calcium, and aluminum. Suitable organic salts include those formed with organic bases such as the amine bases, e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N methylglucamine, and the like. Such salts also include acid addition salts formed with inorganic acids (e.g., hydrochloric and hydrobromic acids) and organic acids (e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid). Pharmaceutically acceptable esters include esters formed from carboxy, sulfonyloxy, and phosphonoxy groups present in the compounds, e.g., C1-6 alkyl esters. When there are two acidic groups present, a pharmaceutically acceptable salt or ester can be a mono-acid-mono- salt or ester or a di-salt or ester; and similarly where there are more than two acidic groups present, some or all of such groups can be salified or esterified. Compounds named in this invention can be present in unsalified or unesterified form, or in salified and/or esterified form, and the naming of such compounds is intended to include both the original (unsalified and unesterified) compound and its pharmaceutically acceptable salts and esters. Also, certain compounds named in this invention may be present in more than one stereoisomeric form, and the naming of such compounds is intended to include all single stereoisomers and all mixtures (whether racemic or otherwise) of such stereoisomers. [0065] The terms "pharmaceutically acceptable", "physiologically tolerable" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a human without the production of undesirable physiological effects to a degree that would prohibit administration of the composition. [0066] The term “antibody” herein is used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, monomers, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), heavy chain only antibodies, three chain antibodies, single chain Fv, single domain antibodies, nanobodies, etc., and also include antibody fragments with or without pegylation, so long as they exhibit the desired biological activity (Miller et al (2003) Jour. of Immunology 170:4854-4861). Antibodies may be murine, human, humanized, chimeric, or derived from other species. Antibodies, also referred to as immunoglobulins, conventionally comprise at least one heavy chain and one light, where the amino terminal domain of the heavy and light chains is variable in sequence, hence is commonly referred to as a variable region domain, or a variable heavy (VH) or variable light (VL) domain. The two domains conventionally associate to form a specific binding region. [0067] A “functional” or “biologically active” antibody or antigen-binding molecule is one capable of exerting one or more of its natural activities in structural, regulatory, biochemical or biophysical events. For example, a functional antibody or other binding molecule may have the ability to specifically bind an antigen and the binding may in turn elicit or alter a cellular or molecular event such as signaling transduction or phagocytosis. A functional antibody may also block ligand activation of a receptor or act as an agonist or antagonist or as an allosteric modulator. [0068] The term antibody may reference a full-length heavy chain, a full length light chain, an intact immunoglobulin molecule; or an immunologically active portion of any of these polypeptides, i.e., a polypeptide that comprises an antigen binding site that immunospecifically binds an antigen of a target of interest or part thereof. The immunoglobulin disclosed herein may comprise any suitable Fc region, including without limitation, human or other mammalian, e.g. cynomogulus, IgG, IgE, IgM, IgD, IgA, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2 or subclass of immunoglobulin molecule, including hybrid Igs, hybrid Fcs, and engineered subclasses with altered Fc portions that provide for reduced or enhanced effector cell activity. The immunoglobulins can be derived from any species. [0069] The term “variable” refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FRs). The variable domains of native heavy and light chains each comprise four FRs, largely adopting a beta-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al (1991) Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md.). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC). [0070] The term “hypervariable region” when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding. The hypervariable region may comprise amino acid residues from a “complementarity determining region” or “CDR”, and/or those residues from a “hypervariable loop”. “Framework Region” or “FR” residues are those variable domain residues other than the hypervariable region residues as herein defined. [0071] The term “monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations, which include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. [0072] The antibodies herein specifically include “chimeric” antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567; and Morrison et al (1984) Proc. Natl. Acad. Sci. USA, 81:6851-6855). Chimeric antibodies of interest herein include “primatized” antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g., Old World Monkey, Ape etc) and human constant region sequences. [0073] An “intact antibody chain” as used herein is one comprising a full length variable region and a full length constant region. An intact “conventional” antibody comprises an intact light chain and an intact heavy chain, as well as a light chain constant domain (CL) and heavy chain constant domains, CH1, hinge, CH2 and CH3 for secreted IgG. Other isotypes, such as IgM or IgA may have different CH and CL domains. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variants thereof. The intact antibody may have one or more “effector functions” which refer to those biological activities attributable to the Fc constant region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody. Examples of antibody effector functions include C1q binding; complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; and down regulation of cell surface receptors. Constant region variants include those that alter the effector profile, binding to Fc receptors, and the like. [0074] Depending on the amino acid sequence of the constant domain of their heavy chains, intact antibodies can be assigned to different “classes.” There are five major classes of intact immunoglobulin antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into “subclasses” (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy- chain constant domains that correspond to the different classes of antibodies are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known. Ig forms include hinge-modifications or hingeless forms (Roux et al (1998) J. Immunol. 161:4083-4090; Lund et al (2000) Eur. J. Biochem. 267:7246-7256; US 2005/0048572; US 2004/0229310). The light chains of antibodies from any vertebrate species can be assigned to one of two clearly distinct types, called κ and λ, based on the amino acid sequences of their constant domains. [0075] A “functional Fc region” possesses an “effector function” of a native-sequence Fc region. Exemplary effector functions include C1q binding; CDC; Fc-receptor binding; ADCC; ADCP; down-regulation of cell-surface receptors (e.g., B-cell receptor), etc. Such effector functions generally require the Fc region to be interact with a receptor, e.g. the FcγRI; FcγRIIA; FcγRIIB1; FcγRIIB2; FcγRIIIA; FcγRIIIB receptors, and the recycling receptor, FcRn ; and can be assessed using various assays as disclosed, for example, in definitions herein. A “dead” or silenced Fc is one that has been mutagenized to retain activity with respect to, for example, prolonging serum half-life, but which does not bind to or activate the low and high affinity Fc receptors. [0076] “Fv” is the minimum antibody fragment, which contains a complete antigen-recognition and antigen-binding site. The Fab fragment contains the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain. Fab′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. [0077] "Antibody fragment", and all grammatical variants thereof, as used herein are defined as a portion of an intact antibody comprising the antigen binding site or variable region of the intact antibody, wherein the portion is free of the constant heavy chain domains (i.e. CH2, CH3, and CH4, depending on antibody isotype) of the Fc region of the intact antibody. Examples of antibody fragments include Fab, Fab', Fab'-SH, F(ab')2, and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of one uninterrupted sequence of contiguous amino acid residues (referred to herein as a "single-chain antibody fragment" or "single chain polypeptide"), including without limitation (1) single-chain Fv (scFv) molecules; nanobodies or domain antibodies comprising single Ig domains from human or non-human species or other specific single-domain binding modules including non-antibody binding proteins such as, but not limited to, adnectins and anticalins; and multispecific or multivalent structures formed from antibody fragments. [0078] As used in this disclosure, the term "epitope" means any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. [0079] The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the binding protein. The label may itself be detectable by itself (directly detectable label) (e.g., radioisotope labels or fluorescent labels) or, or the label can be indirectly detectable, e.g., in the case of an enzymatic label, the enzyme may catalyze a chemical alteration of a substrate compound or composition and the product of the reaction is detectable. [0080] As used herein, the term “correlates,” or “correlates with,” and like terms, refers to a statistical association between instances of two events, where events include numbers, data sets, and the like. For example, when the events involve numbers, a positive correlation (also referred to herein as a “direct correlation”) means that as one increases, the other increases as well. A negative correlation (also referred to herein as an “inverse correlation”) means that as one increases, the other decreases. Methods of Diagnosis [0081] In one embodiment of the invention, a sample from an individual, e.g. an individual suspected of coronavirus infection, is analyzed for the expression profile of one or a panel of inflammatory mediators indicative of an early tendency to severe disease and clinical sequelae thereof. In one embodiment, the expression profile is determined by measurements of protein concentrations or amounts. A predictive model of the invention utilizes quantitative data from one or more markers as set out herein. In some embodiments a predictive model provides for a level of accuracy in classification; i.e. the model satisfies a desired quality threshold. A quality threshold of interest may provide for an accuracy or AUC of a given threshold, and either or both of these terms (AUC; accuracy) may be referred to herein as a quality metric. A predictive model may provide a quality metric, e.g. accuracy of classification or AUC, with varying cut-offs of biomarker levels selected to provide a desired balance of sensitivity and selectivity. [0082] SARS-CoV2 infection results in a program of host innate immunity characterized by the simultaneous silencing of peripheral innate immune responses and hyperactivation of proinflammatory responses in the lung. A signature of COVID-19 infection comprises prolonged plasmablast and effector T cell response, reduced expression of HLA-DR in myeloid cells and inhibition of mTOR signaling in plasmacytoid DCs. Consistent with this, myeloid cells and pDCs are impaired in their capacity to produce pro-inflammatory cytokines and IFN-α, respectively, upon Toll-Like Receptor (TLR) stimulation. [0083] It is shown herein that there is a strong correlation of over-elevated plasma levels of inflammatory mediators EN-RAGE, TNFSF14, and Oncostatin-M with the clinical severity of the disease. Over-elevated plasma levels may be assessed relative to normal control, i.e. the base level in uninfected controls; or relative to the average levels in individuals with non- severe disease. Clinical severity may be as defined in the Examples. A determination of over- elevated inflammatory mediators may comprise a determination for one of EN-RAGE, TNFSF14, and Oncostatin-M; or a combination of two or more of EN-RAGE; TNFSF14, and Oncostatin-M. Over-elevation may be a level that is at least 25% greater than control, at least 50% greater, at least 75% greater, at least 100% greater, at least 125% greater, at least 150% greater, and may be a 2-fold increase, a 3-fold increase, a 4-fold increase, a 5-fold increase or more. [0084] In some embodiments, methods are provided for patient stratification based on the prognosis for development of severe COVID-19 disease. In some embodiments a patient sample is obtained. A sample may be a blood or blood-derived sample, e.g. a blood sample, plasma sample, serum sample, etc. A sample may be a tissue derived sample, e.g. lung or nasopharygeal aspirate, lavage, and the like. The patient sample is analyzed for the presence of one or more of EN-RAGE, TNFSF14, and Oncostatin-M; and the level compared to a control value or level. The presence of elevated levels of one or more of EN-RAGE, TNFSF14, and Oncostatin-M is indicative of a likelihood to progress to severe disease. [0085] Various techniques and reagents find use in the diagnostic methods of the present invention. In one embodiment of the invention, blood samples, or samples derived from blood, e.g. plasma, serum, etc. are assayed for the presence of specific inflammatory mediators or autoantibodies. Typically a blood sample is drawn, and a derivative product, such as plasma or serum, is tested. Such antibodies may be detected through specific binding members. Various formats find use for such assays, including autoantigen arrays; ELISA and RIA formats; binding of labeled peptides in suspension/solution and detection by flow cytometry, mass spectroscopy, and the like. Inflammatory mediator detection may utilize a panel of antibodies specific for a spectrum of inflammatory mediators. Autoantibody and inflammatory mediator signature patterns typically utilize a detection method coupled with analysis of the results to determine if there is a statistically significant match with a pre-determined signature pattern of interest. [0086] Inflammatory mediators, e.g. EN-RAGE, OSM, TNFSF14, etc. may be measured using a panel of antibodies against inflammatory mediators, mass spectrometry or with other detection methods. Panels of anti-inflammatory mediator antibodies can be used to measure inflammatory mediators in assay formats such as ELISA, fluorescent immunoassays, antibody array technologies, bead array technologies, radioimmunoassay (RIAs) and other immunoassay methodologies. [0087] The identification of such individuals provides prognostic methods, which assess an individual's susceptibility to severe disease, by detecting altered levels of the identified circulating proteins e.g. EN-RAGE, OSM, TNFSF14, etc. Early detection can be used to determine the occurrence of developing disease, thereby allowing for intervention with appropriate preventive or protective measures. [0088] In addition to the specific biomarker sequences identified in this application by name, accession number, or sequence, the invention also contemplates use of biomarker variants that are at least 90% or at least 95% or at least 97% identical to the exemplified sequences and that are now known or later discover and that have utility for the methods of the invention. These variants may represent polymorphisms, splice variants, mutations, and the like. Various techniques and reagents find use in the diagnostic methods of the present invention. In one embodiment of the invention, blood samples, or samples derived from blood, e.g. plasma, circulating, etc. are assayed for the presence of polypeptides. Typically a blood sample is drawn, and a derivative product, such as plasma or serum, is tested. Such polypeptides may be detected through specific binding members. The use of antibodies for this purpose is of particular interest. Various formats find use for such assays, including antibody arrays; ELISA and RIA formats; binding of labeled antibodies in suspension/solution and detection by flow cytometry, mass spectroscopy, and the like. Detection may utilize one or a panel of antibodies, preferably a panel of antibodies in an array format. Expression signatures typically utilize a detection method coupled with analysis of the results to determine if there is a statistically significant match with a disease signature. [0089] The differential presence of inflammatory mediators is shown to provide for prognostic evaluations to detect individuals in a pre-disease state. In general, such prognostic methods involve determining the presence or level of inflammatory mediators in an individual sample, usually a blood derived sample, e.g. blood, serum, plasma, etc. A variety of different assays can be utilized to quantitate the presence of inflammatory mediators. Many such methods are known to one of skill in the art, including ELISA, fluorescence immunoassays, protein arrays, eTag system, bead based systems, tag or other array based systems, surface plasmon resonance (SPR)-based detection systems, etc. Examples of such methods are set forth in the art, including, inter alia, chip-based capillary electrophoresis: Colyer et al. (1997) J Chromatogr A. 781(1-2):271-6; mass spectroscopy: Petricoin et al. (2002) Lancet 359: 572- 77; eTag systems: Chan-Hui et a/. (2004) Clinical Immunology 111:162-174; microparticle- enhanced nephelometric immunoassay: Montagne et a/. (1992) Eur J Clin Chem Clin Biochem.30(4):217-22; the Luminex XMAP bead array system (www.luminexcorp.com); and the like, each of which are herein incorporated by reference. [0090] The signature pattern may be generated from a biological sample using any convenient protocol, for example as described below. The readout may be a mean, average, median or the variance or other statistically or mathematically-derived value associated with the measurement. The inflammatory mediators readout information may be further refined by direct comparison with the corresponding reference or control pattern. A binding pattern may be evaluated on a number of points: to determine if there is a statistically significant change at any point in the data matrix; whether the change is an increase or decrease in the inflammatory mediators; and the like. The absolute values obtained for each inflammatory mediator under identical conditions will display a variability that is inherent in live biological systems. [0091] Following obtainment of the signature pattern from the sample being assayed, the signature pattern is compared with a reference or control profile to make a prognosis regarding the phenotype of the patient from which the sample was obtained/derived. Typically a comparison is made with a sample or set of samples from an unaffected, normal source. Additionally, a reference or control signature pattern may be a signature pattern that is obtained from a sample of a patient known to have a coronavirus infection, and therefore may be a positive reference or control profile. [0092] In certain embodiments, the obtained signature pattern is compared to a single reference/control profile to obtain information regarding the phenotype of the patient being assayed. In yet other embodiments, the obtained signature pattern is compared to two or more different reference/control profiles to obtain more in depth information regarding the phenotype of the patient. For example, the obtained signature pattern may be compared to a positive and negative reference profile to obtain confirmed information regarding whether the patient has the phenotype of interest. [0093] Samples can be obtained from the tissues or fluids of an individual. For example, samples can be obtained from whole blood, lung tissue biopsy, serum, etc. Other sources of samples are body fluids such as lymph, cerebrospinal fluid, bronchial aspirates, and may further include saliva, milk, urine, and the like. Also included in the term are derivatives and fractions of such cells and fluids. Diagnostic samples are collected any time after an individual is suspected to have a coronavirus infection or has exhibited symptoms that predict such a disease. [0094] Various immunoassays designed to quantitate inflammatory mediators may be used in screening. Measuring the concentration of the target protein in a sample or fraction thereof may be accomplished by a variety of specific assays. For example, a conventional sandwich type assay may be used in an array, ELISA, RIA, etc. format. A sandwich assay may first attach specific anti-inflammatory mediator antibodies to an insoluble surface or support. The particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non- covalently. [0095] The insoluble supports may be any compositions to which polypeptides can be bound, which is readily separated from soluble material, and which is otherwise compatible with the overall method. The surface of such supports may be solid or porous and of any convenient shape. Examples of suitable insoluble supports to which the receptor is bound include slides, beads, e.g. magnetic beads, membranes and microtiter plates. These are typically made of glass, plastic (e.g. polystyrene), polysaccharides, nylon or nitrocellulose. [0096] Patient sample preparations may then be added to an antibody containing substrate. Preferably, a series of standards, containing known concentrations of the test protein is assayed in parallel with the samples or aliquots thereof to serve as controls. Preferably, samples are assayed in multiple spots, wells, etc. so that mean values can be obtained for each. The incubation time should be sufficient for binding, generally, from about 0.1 to 3 hr is sufficient. After incubation, the insoluble support is generally washed of non-bound components. A dilute non-ionic detergent medium at an appropriate pH, generally 7-8, can be used as a wash medium. From one to six washes can be employed, with sufficient volume to thoroughly wash non-specifically bound proteins present in the sample. [0097] After washing, a solution containing a detection reagent, e.g. antibodies reactive with the inflammatory mediator, is applied. The second stage reagent may be labeled to facilitate direct or indirect quantification of binding. Examples of labels that permit direct measurement of second receptor binding include radiolabels, such as 3H or 125I, fluorescers, dyes, beads, chemiluminescers, colloidal particles, and the like. Examples of labels that permit indirect measurement of binding include enzymes where the substrate may provide for a colored or fluorescent product. In a preferred embodiment, the antibodies are labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate. Examples of suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art. The incubation time should be sufficient for the labeled ligand to bind available molecules. Generally, from about 0.1 to 3 hr is sufficient, usually 1 hr sufficing. [0098] After the second binding step, the insoluble support is again washed free of non- specifically bound material, leaving the specific complex formed between the patient inflammatory mediators and the detection reagent. The signal produced by the bound conjugate is detected by conventional means. Where an enzyme conjugate is used, an appropriate enzyme substrate is provided so a detectable product is formed. [0099] Other immunoassays are known in the art and may find use as diagnostics. Ouchterlony plates provide a simple determination of antibody binding. Western blots may be performed on protein gels or protein spots on filters, using a detection system specific for the coronavirus infection associated polypeptide as desired, conveniently using a labeling method as described for the sandwich assay. [00100] In some cases, a competitive assay will be used. In addition to the patient sample, a competitor to the inflammatory mediator is added to the reaction mix. The competitor and the inflammatory mediator compete for binding. Usually, the competitor molecule will be labeled and detected as previously described, where the amount of competitor binding will be proportional to the amount of target antigen present. The concentration of competitor molecule will be from about 10 times the maximum anticipated protein concentration to about equal concentration in order to make the most sensitive and linear range of detection. [00101] Alternatively, a reference sample may be used as a comparator. In such a case, the reference sample is labeled with or detected using a spectrally distinct fluorophore from that used to label or detect inflammatory mediators from the patient sample. This reference sample is mixed with the patient sample, and the mixed sample analyzed on arrays or another measurement methodology. Such an approach provides a ratio of patient: reference sample binding for an individual inflammatory mediator, thereby enabling direct comparative analysis of binding relative to reference sample binding. Methods of Treatment [00102] Methods are provided for reducing severity of symptoms associated with COVID-19 infection in an individual by contacting the individual with a therapeutically effective dose of a blocking agent as described herein, e.g. an antibody specific for EN-RAGE, OSM, TNFSF14. An effective dose of a blocking agent can reduce undesirable immune responses, e.g, hyperactive inflammation, can enhance desirable immune responses, e.g. reducing silencing of peripheral innate immune responses, can shorten the period of time for recovery; and the like. [00103] In other embodiments, an individual determined by the methods disclosed herein to be at risk of developing severe disease is treated to reduce viral infection, including without limitation by administration SARS_CoV2 specific monoclonal antibody, a nucleoside or nucleotide analog, e.g. Remdesivir; protease inhibitors; and the like. The individual may also be treated with an antibiotic. In some embodiments an individual determined to have a likelihood to progress to severe disease is treated to reduce hyperactive proinflammatory responses, e.g. by administering a blocking agent as described above; by administering an inhibitor of IL-6 activity; and the like. In some embodiments, an individual determined to have a likelihood to progress to severe disease is treated to enhance lung function, e.g. with supplemental oxygen, ventilation, C-PAP and the like. [00104] The treatment course may be from about 12 days, from about 8 days, from about 4 days, and may be, for example, from 1-12 days, from 2-12 days, from 4-12 days, from 4-8 days, etc. Administration may be once a day, twice a day, 4 times a day, every other day, etc. In some embodiments, more than one course of treatment is administered. [00105] In other embodiments, administration of a blocking is combined with administration of an agent that specifically reduces virus infection, enhances peripheral innate immune responses, blocks cytokine signaling, and the like. [00106] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. The term “treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and/or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease and/or symptom(s), i.e., arresting their development; or (c) relieving the disease symptom(s), i.e., causing regression of the disease and/or symptom(s). Those in need of treatment include those already inflicted (e.g., those with infection, those with an infection, those with an immune disorder, etc.) as well as those in which prevention is desired (e.g., those with increased susceptibility to infection, those with an increased likelihood of infection, those suspected of having infection, those suspected of harboring an infection, etc.). [00107] A therapeutic treatment is one in which the subject is inflicted prior to administration and a prophylactic treatment is one in which the subject is not inflicted prior to administration. In some embodiments, the subject has an increased likelihood of becoming inflicted or is suspected of being inflicted prior to treatment. In some embodiments, the subject is suspected of having an increased likelihood of becoming inflicted. [00108] As used herein, the term “infection” refers to any state in at least one cell of an organism (i.e., a subject) is infected by a virus. As used herein, the term “infectious agent” refers to a foreign biological entity, particularly SARS-COV2. [00109] The terms "co-administration", “co-administer”, and "in combination with" include the administration of two or more therapeutic agents (e.g., a blocking agent and a nucleotide/nucleoside analog) either simultaneously, concurrently or sequentially within no specific time limits. In one embodiment, the agents are present in the cell or in the subject's body at the same time or exert their biological or therapeutic effect at the same time. In one embodiment, the therapeutic agents are in the same composition or unit dosage form. In other embodiments, the therapeutic agents are in separate compositions or unit dosage forms. In certain embodiments, a first agent can be administered prior to (e.g., minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapeutic agent. Administration may be combined with co- administration of agents preventing re-infection of new cells, siRNAs targeting virus sequences, immunodulator (TLR agonists, etc), RT or polymerase inhibitor, therapeutic vaccines, antibiotics, and the like. [00110] A blocking agent need not be, but is optionally, formulated with one or more agents that potentiate activity, or that otherwise increase the therapeutic effect. These are generally used in the same dosages and with administration routes as used herein or from 1 to 99% of the heretofore employed dosages. In some embodiments, treatment is accomplished by administering a combination (co-administration) of a subject agent and/or another agent. [00111] Treatment may also be combined with other active agents, such as antibiotics, e.g. antibiotics with the classes of aminoglycosides; carbapenems; and the like; penicillins, e.g. penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc. penicillins in combination with β-lactamase inhibitors, cephalosporins, e.g. cefaclor, cefazolin, cefuroxime, moxalactam, etc:; tetracyclines; cephalosporins; quinolones; lincomycins; macrolides; sulfonamides; glycopeptides including the anti-infective antibiotics vancomycin, teicoplanin, telavancin, ramoplanin and decaplanin. Derivatives of vancomycin include, for example, oritavancin and dalbavancin (both lipoglycopeptides). Telavancin is a semi-synthetic lipoglycopeptide derivative of vancomycin (approved by FDA in 2009). Other vancomycin analogs are disclosed, for example, in WO 2015022335 A1 and Chen et al. (2003) PNAS 100(10): 5658-5663, each herein specifically incorporated by reference. Non-limiting examples of antibiotics include vancomycin, linezolid, azithromycin, daptomycin, colistin, eperezolid, fusidic acid, rifampicin, tetracyclin, fidaxomicin, clindamycin, lincomycin, rifalazil, and clarithromycin. Cytokines may also be included, e.g. interferon γ, tumor necrosis factor α, interleukin 12, etc. Antiviral agents may also be used in treatment. [00112] A "therapeutically effective dose" or “therapeutic dose” is an amount sufficient to effect desired clinical results (i.e., achieve therapeutic efficacy). A therapeutically effective dose can be administered in one or more administrations. In some embodiments the agent is an antibody specific for human inflammatory mediator, which optionally is a chimeric or humanized monoclonal antibody. In some embodiments an antibody is administered at a dose of less than 20 mg/kg body weight, less than 10 mg/kg, less than 5 mg/kg, less than 1 mg/kg, less than 0.5 mg/kg, less than 0.25 mg/kg, less than 0.1 mg/kg, less than 0.5 mg/kg, less than 0.1 mg/kg. The therapeutic dose may be, for example, from 0.1 to 5 mg/kg, from 0.25 to 5 mg/kg, from 0.5 to 5 mg/kg, from 0.75 to 5 mg/kg, from 1 to 5 mg/kg; or from 0.1 to 2.5 mg/kg, from 0.25 to 2.5 mg/kg, from 0.5 to 2.5 mg/kg, from 0.7 to 2.5 mg/kg; from 0.1 to 1 mg/kg, from 0.25 to 1 mg/kg, from 0.5 to 1 mg/kg, from 0.75 to 1 mg/kg, etc. [00113] Dosage and frequency may vary depending on the half-life of the agent. It will be understood by one of skill in the art that such guidelines will be adjusted for the molecular weight of the active agent, e.g. in the use of antibody fragments, in the use of antibody conjugates, etc. The dosage may also be varied for localized administration, e.g. intranasal, inhalation, etc., or for systemic administration, e.g. i.m., i.p., i.v., s.c., and the like. [00114] An agent can be administered by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal or subcutaneous administration. This may include injections, by parenteral routes such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumor, intraperitoneal, intraventricular, intraepidural, or others as well as oral, nasal, ophthalmic, rectal, or topical. Sustained release administration is also specifically included in the disclosure, by such means as depot injections or erodible implants. Localized delivery is particularly contemplated, by such means as delivery via inhalation to the lungs. [00115] As noted above, an agent can be formulated with an a pharmaceutically acceptable carrier (one or more organic or inorganic ingredients, natural or synthetic, with which a subject agent is combined to facilitate its application). A suitable carrier includes sterile saline although other aqueous and non-aqueous isotonic sterile solutions and sterile suspensions known to be pharmaceutically acceptable are known to those of ordinary skill in the art. An "effective amount" refers to that amount which is capable of ameliorating or delaying progression of the diseased, degenerative or damaged condition. An effective amount can be determined on an individual basis and will be based, in part, on consideration of the symptoms to be treated and results sought. An effective amount can be determined by one of ordinary skill in the art employing such factors and using no more than routine experimentation. [00116] An agent is often administered as a pharmaceutical composition comprising an active therapeutic agent and another pharmaceutically acceptable excipient. The preferred form depends on the intended mode of administration and therapeutic application. The compositions can also include, depending on the formulation desired, pharmaceutically- acceptable, non-toxic carriers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like. [00117] Compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation also can be emulsified or encapsulated in liposomes or micro particles such as polylactide, polyglycolide, or copolymer for enhanced adjuvant effect, as discussed above. Langer, Science 249: 1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28: 97-119, 1997. The agents of this invention can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient. The pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. [00118] Toxicity of the agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. The data obtained from these cell culture assays and animal studies can be used in further optimizing and/or defining a therapeutic dosage range and/or a sub-therapeutic dosage range (e.g., for use in humans). The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. Kits [00119] Also provided are kits for use in the methods. The agents of a kit can be present in the same or separate containers. The agents may also be present in the same container. In addition to the above components, the subject kits may further include (in certain embodiments) instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, and the like. Yet another form of these instructions is a computer readable medium, e.g., diskette, compact disk (CD), flash drive, and the like, on which the information has been recorded. Yet another form of these instructions that may be present is a website address which may be used via the internet to access the information at a removed site. [00120] Therapeutic formulations comprising one or more agents of the invention are prepared for storage by mixing the blocking agent having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. The agent composition will be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The "therapeutically effective amount" of the antibody to be administered will be governed by such considerations, and is the minimum amount necessary to prevent the disease. [00121] The therapeutic dose may be at least about 0.01 µg/kg body weight, at least about 0.05 µg/kg body weight; at least about 0.1 µg/kg body weight, at least about 0.5 µg/kg body weight, at least about 1 µg/kg body weight, at least about 2.5 µg/kg body weight, at least about 5 µg/kg body weight, and not more than about 100 µg/kg body weight. It will be understood by one of skill in the art that such guidelines will be adjusted for the molecular weight of the active agent, e.g. in the use of antibody fragments, or in the use of antibody conjugates. The dosage may also be varied for localized administration, e.g. intranasal, inhalation, etc., or for systemic administration, e.g. i.m., i.p., i.v., and the like. [00122] The agent need not be, but is optionally formulated with one or more agents that potentiate activity, or that otherwise increase the therapeutic effect. These are generally used in the same dosages and with administration routes as used hereinbefore or about from 1 to 99% of the heretofore employed dosages. [00123] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyidimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN^TM, PLURONICS^TM or polyethylene glycol (PEG). Formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes. [00124] The active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980). [00125] In another embodiment of the invention, an article of manufacture containing materials useful for the treatment of the disorders described above is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The active agent in the composition is the agent. The label on, or associated with, the container indicates that the composition is used for treating the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. [00126] Also within the scope of the invention are kits comprising the compositions (e.g., agent and formulations thereof) of the invention and instructions for use. The kit can further contain a least one additional reagent, e.g. a chemotherapeutic drug, etc. Kits typically include a label indicating the intended use of the contents of the kit. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit. EXPERIMENTAL [00127] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees centigrade, and pressure is at or near atmospheric. Example 1 [00128] In the current study, we used a systems biological approach (mass cytometry and single cell transcriptomics of leukocytes, and multiplex analysis of cytokines in plasma), to analyze immune response in 53 COVID-19 patients and 54 age- and sex-matched controls, from two geographically distant cohorts. Results [00129] Analysis of peripheral blood leukocytes by mass cytometry. COVID-19 infected patient samples and age- and sex- matched healthy controls were obtained from two independent cohorts, from the Princess Margaret Hospital in Hong Kong University, and from the Hope Clinic at Emory University in Atlanta, USA. Patient characteristics and the different assays performed are shown in table 1. We used mass cytometry to assess immune responses to nSARS-CoV2 infection in 53 COVID-19 patients, confirmed positive for viral RNA by PCR, and 54 age and gender matched healthy controls distributed between the two cohorts. To characterize immune cell phenotypes in PBMCs, we used a phospho-CyTOF panel that includes 22 cell surface markers and 12 intracellular markers against an assortment of kinases and phospho-specific epitopes of signaling molecules and H3K27ac, a marker of histone modification that drives epigenetic remodeling (table. 2). The experimental strategy is described in Fig. 1A. The phospho-CyTOF identified 12 major subtypes of innate and adaptive immune cells in both cohorts, as represented in the tSNE plots (Fig. 1B). There was a striking increase in the frequency of plasmablast and effector CD8 T cells in all infected individuals (Fig. 1 B) in both cohorts, as described recently. Of note, the kinetics of the CD8 effector T cell response was prolonged and continued to increase up to day 40 post onset of the symptoms (fig. 6).

Table 1.

* Sonie p&lients have blood Soas multiple time points Table 2,

[00130] We further used a manual gating to clearly identify 25 immune cell subsets (Fig. 7) and determined if there were changes in the frequency or signaling molecules of innate immune cell populations consistent between the two cohorts. There were several differences, but strikingly the frequency of plasmacytoid DCs (pDC) was significantly reduced in PBMCs of infected individuals in both cohorts (Fig. 1C). The kinetics of pDC response did not show an association with the time since symptom onset (fig. 6C). Neither did the observed changes correlate with clinical severity of infection (fig. 6). Second, pS6 (phosphorylated ribosomal protein S6, a canonical target of mTOR activation) was significantly decreased in plasmacytoid DCs (pDCs) and third, decreased IKBa, an inhibitor of the NF-Kb pathway, in myeloid DCs (mDCs) (Fig. 1D and E). The mTOR signaling is directly involved in type I interferon (IFN) response in pDCs suggesting that the pDC may be impaired in their function. In contrast, the decreased IKBa indicated an activated state of the NF-Kb pathway in mDCs. Finally, we employed a linear modeling approach to detect features that distinguish healthy from infected individuals, and individuals based on clinical severity. This analysis was performed with site as a covariate to identify only features that were consistent across cohorts. The distinguishing features between healthy and infected subjects are shown in Fig. 1F which include frequencies of plasmablast and effector T cells, and the changes in innate immune cells described above in addition to STAT1 and other signaling events in T cells and NK cells. Of note, no features were significantly different between clinical severity groups.

[00131] COVID-19 results in functional impairment of blood myeloid cells and plasmacytoid DCs. The reduced pS6 signal in pDCs suggested that these cells may be impaired in type 1 IFN production, as demonstrated by a recent study. To examine if the reduced pS6 signal affects type I IFN response, we stimulated PBMCs from healthy or COVID-19 infected individuals ex vivo with a mixture of Toll-like receptor (TLR) 7/8 and 3 ligands, expressed by viruses, and performed an intracellular staining assay to detect cytokine responses. The TLR ligands included TLR-3 and -7/8 ligands, poly IC and R848. Consistent with our hypothesis, the fraction of pDCs producing IFN-α in response to the TLR-stimuli was significantly lower in PBMCs of infected individuals in comparison to healthy controls (Fig. 2A). The TNF-α response was also significantly reduced in pDCs of infected individuals demonstrating that the pDCs are functionally impaired in COVID-19 infection. We also determined the ability of myeloid DCs (mDCs) and CD14⁺ monocytes to respond to TLR stimuli. Surprisingly, the response in mDCs as well as monocytes was also significantly lower in response to stimulation with a bacterial ligand cocktail that includes TLR-2, 4 and 5 ligands as well as the viral TLR cocktail (Fig. 2B and fig. 8). Furthermore, the reduced IKBa levels did not translate into enhanced NF-κb p65 phosphorylation as measured by p65 (Ser 529) in the same cells (Fig. 2C). These results demonstrate that the innate immune cells in the periphery of COVID-19 infected individuals, irrespective of the clinical severity, are suppressed in their response to TLR stimulation. [00132] Enhanced concentrations of cytokines and inflammatory mediators in plasma. The impaired cytokine response of myeloid cells and pDCs in response to TLR stimulation was surprising and seemingly at odds with the literature describing an enhanced inflammatory response in COVID-19 infected individuals. Several studies have described higher levels of cytokines including but not limited to IL-6, TNF-α, and CXCL10. Therefore, we evaluated cytokines and chemokines in plasma samples from the Emory cohort using Olink multiplex inflammation panel that measures 92 different cytokines and chemokines. Of the 92 analytes measured, 71 proteins were detected within the dynamic range of the assay. Of the 71 proteins, 50 cytokines including IL-6, IL-7, TNF-α, MCP-3 and CXCL10 were significantly upregulated in COVID-19 infection (Fig. 3, top row and fig. 9). These results demonstrate that plasma levels of inflammatory molecules were significantly upregulated despite the muted innate immune responses in the periphery, arguing for a tissue origin of these cytokines. [00133] In addition to IL-6 and other cytokines described previously, we identified 3 new proteins that are significantly enhanced in COVID-19 infection (Fig.3, bottom row). They are TNFSF14 (LIGHT, a ligand of Lymphotoxin B receptor, highly expressed in human lung fibroblasts and implicated in lung tissue fibrosis and remodeling and inflammation), EN-RAGE (S100A12, a biomarker of pulmonary injury, and implicated in pathogenesis of sepsis-induced acute respiratory distress syndrome (ARDS)) and Oncostatin-M (OSM, a regulator of IL-6). Importantly, these molecules strongly correlated with clinical disease severity. Of note, the TNFSF14 is uniquely enhanced in the plasma of COVID-19 infected individuals, but not other related pulmonary infections such as Flu and RSV (Fig.3). These results suggest that COVID- 19 infection induces a unique inflammation program that involves cytokines released from tissues, most likely the lung, but suppression of the innate immune system in the periphery. More importantly, these findings provide novel therapeutic strategies for intervention against severe COVID-19. [00134] Single cell transcriptional response to COVID-19. To investigate the molecular and cellular events that lead to the unique inflammation program during COVID-19 infection, we used cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) and profiled the gene and protein expression in single cells from PBMC samples of COVD-19-infected subjects. Cryopreserved PBMC samples from a total of 18 age- matched subjects in the Emory cohort (5 Healthy, 9 COVID-19, 2 Influenza A, 2 RSV; Table 2, Fig. 10), were enriched for DCs, stained using a cocktail of 36 DNA-labeled antibodies (Table 4), and analyzed using droplet-based single-cell gene expression profiling approaches, in two independent experiments (Fig. 4A). Transcriptomes for more than 92,000 cells in two experiments were obtained after initial preprocessing. Next, we generated a cell-by-gene matrix and conducted dimensionality reduction via UMAP and graph- based clustering. Analysis of cell distribution within the UMAP between experiments revealed no major differences and we analyzed both datasets from the two independent experiments, together without batch correction (Fig. 11). Next, we calculated the per-cell QC metrics (Fig.12), differentially expressed genes (DEGs) in each cluster compared to all other cells (Fig. 118), and the abundance of DNA-labeled antibodies in each cell (Fig.9). Using this information, we filtered low quality cells and manually annotated the clusters. After QC and cluster annotation, we retained a final dataset with more than 84,000 high quality transcriptomes and a median of ~4,430 cells per sample and 1860 unique genes per cell that we used to construct the single-cell immune cell landscape of COVID-19 (Fig.4B). [00135] We observed several clusters that were primarily identified in infected subjects, including a population of plasmablasts, platelets, red blood cells and several populations of granulocytes. Interestingly, we detected several clusters of T cells, platelets, and especially monocytes, that were characterized by the expression of interferon-response genes such as IFI27, IFITM3, or ISG15. These interferon response-enriched clusters emerged uniquely in samples from COVID-19- and Flu-infected subjects, but not subjects infected with RSV or healthy controls (Fig. 4B, C and Fig. 15). In addition to the interferon-response genes, two clusters of monocytes that were highly enriched in COVID-19 patients also expressed elevated levels of S100A12 (EN-RAGE), which was upregulated in plasma of COVID-19 infected subjects (Fig.3). [00136] To further describe the unique transcriptional state of single cells from COVID-19 infected subjects, we determined the DEGs for cells from all COVID-19-infected subjects in a given cluster compared to the cells of all healthy subjects in the same cluster. We then analyzed these DEGs with overrepresentation analysis using blood transcriptional modules (BTMs) to better understand which immune pathways are differentially regulated in patients with COVID-19 compared to healthy subjects (Fig. 5A, Fig. 16). Strikingly, the analysis indicated a profound induction of antiviral BTMs, especially in cell types belonging to the myeloid and dendritic cell lineage. Detailed analysis of the expression pattern of the unique union of genes driving the enrichment of these antiviral pathways in monocytes and dendritic cells revealed that many interferon-stimulated genes were upregulated in these cell types, especially in subjects with moderate disease (Fig. 5B, Fig. 17). Given our observations of muted type I IFN production in pDCs (Fig 2), we further investigated the interferon expression profile across cell types (Fig.5C, Fig.18). Importantly, with the exception of modest levels of IFNγ expression in T and NK cells, we could not detect any meaningful expression of IFN-α and -β genes, consistent with the functional data demonstrating impaired type I IFN production by pDCs and myeloid cells (Fig 2). Together these data demonstrate enhanced expression of interferon response genes in patients with COVID-19, especially those with moderate infection, despite an impaired capacity of the innate cells in the blood compartment to produce these cytokines. [00137] In addition to interferon production, myeloid cells from COVID-19-infected subjects showed reduced expression of genes important for antigen presentation (Fig. 5A, Fig.16). Using flow cytometry data acquired on PBMCs from the same samples in parallel to scRNA- seq, we observed a reduction in the expression of the proteins CD86 and HLA-DR on monocytes and mDCs of patients infected with COVID-19 which was most pronounced in subjects with severe infection (Fig.5D, Fig.19). HLA-DR is an important mediator of antigen- presentation and crucial for the induction of T helper cell responses. Using the phospho- CyTOF data from both the Atlanta and the Hong Kong cohorts, we again measured a reduced abundance of HLA-DR on monocytes and mDCs in patients with COVID-19 versus healthy controls (Fig.5E). [00138] Finally, to gain clarity as to why there are elevated levels of inflammatory cytokines in plasma, despite impaired cytokine production by DCs upon in-vitro stimulation, we determined the expression of genes encoding proinflammatory mediators. Strikingly, we observed an increase in S100A12 (EN- RAGE) expression in subjects with severe COVID-19 infection (Fig. 5F) while the expression of most other proinflammatory cytokines was either absent or unchanged compared to healthy controls. Importantly, the expression of S100A12 (EN-RAGE) was restricted to monocytes and DCs. Correlation analysis revealed a strong negative linear relationship between the expression levels of S100A12 and multiple genes of the antigen presentation machinery (HLA-DPA1, HLA- DPB1, HLA-DR, CD74) (Fig.5H, Fig.20). Of note, the receptor or S100A12 (EN-RAGE), AGER (RAGE), was only expressed at low levels in a small portion of cells varying types (Fig.22). [00139] Taken together, these results demonstrate a direct relationship between EN-RAGE production and impaired antigen presentation, and position suppressive blood circulating monocytes as a source of EN-RAGE during COVID-19 infection. Indeed, we found a significant correlation between S100A12 gene expression in monocyte and myeloid cell clusters and EN-RAGE protein levels in plasma (Fig.5I). [00140] We used a systems biology approach to determine host immune responses to COVID- 19. Mass cytometry analysis of peripheral blood leukocytes from two independent cohorts, from Hong Kong and Atlanta revealed several common features of immune responses induced upon SARS-CoV2 infection. There was striking and prolonged expansion of plasmablast and effector CD8 T cells in peripheral blood consistent with recent studies. Of note, the effector T cells continued to increase up to day 40 post symptom onset. Studies have shown that SARS- CoV2 infection induces exhaustion and apoptosis in T cells. Whether the continuing effector CD8 T cell response reflects continuous exposure to antigen, and if the cells are exhausted needs further investigation. [00141] In addition to robust activation of B and T cells, we observed significant decrease in the frequency of pDCs. Furthermore, the mTOR signaling was reduced significantly in COVID- 19 infected individuals, as measured by decreased pS6 signaling by mass cytometry. These results suggest that pDCs, the major producer of antiviral type I IFNs are impaired in COVID- 19 infection. These results are consistent with recent observations as well as studies in SARS- CoV infection. To determine whether the reduced mTOR signaling in pDCs lead to an impairment of type I IFN production, we stimulated the cells in vitro using potent TLR cocktails. Our results demonstrate that pDCs from COVID-19 infected patients are functionally impaired in their capacity to produce type I IFNs in response to TLR stimulation. Notably, there was no detectable IFN-α prior to stimulation. Taken together, the data suggest a lack of IFN-I response that could lead to enhanced viral replication in vivo. Administration of IFN-I has been proposed as a strategy for COVID-19 intervention; however, it must be noted that IFN-I signaling has been shown to elevate ACE2 expression in lung cells potentially leading to enhanced infection. [00142] In addition to the suppressed type I IFN response in pDCs, there was a marked diminution of the pro-inflammatory mediators IL-6, TNF-α and IL-1b in monocytes and myeloid DCs. These results argue for a severely attenuated innate response in blood leukocytes of patients with COVID-19. This concept was further supported by the CyTOF and flow cytometry data showing decreased HLA-DR and CD86 expression, respectively, in myeloid cells (Fig. 5D and E and fig.18). These results appear to be at odds with the literature describing an inflammatory status in COVID-19 infection. Importantly, we demonstrate that SARS-CoV2 infection results in a particular program of host innate immunity, characterized by the simultaneous silencing of peripheral innate immune responses and hyperactivation of proinflammatory responses in the lung, similar to previous observations in SARS-CoV infection. To what extent this dichotomous innate immune response in the lung versus peripheral blood contributes to immune pathology versus protective immunity to SARS-CoV- 2 remains to be determined. [00143] In order to obtain deeper insight into the mechanisms of host immunity to SARS-CoV2, we performed CITE-seq single cell RNA sequencing analysis in COVID-19 patients encompassing various stages of clinical severity. Our data demonstrate a profound absence of the expression of genes encoding type I IFN or ISGs in patients with severe COVID-19 infection, consistent with the impairment of type I IFN response reported in Fig.2. However in moderate patients, there was an enhanced expression of ISGs relative to healthy controls despite the absence of type I IFN gene expression. The reasons for this are at present unclear but could be due to an early, transient type I IFN production in the lung during mild or moderate COVID-19 infection. Importantly, we observed reduced expression of genes encoding proteins in the antigen presentation machinery in myeloid cells which was further supported by the CyTOF and flow cytometry data showing decreased HLA-DR and CD86 expression, respectively, in myeloid cells. [00144] Finally, our multiplex analysis of plasma cytokines revealed a striking association of the inflammatory mediators EN-RAGE, TNFSF14 and OSM with the clinical severity of the disease. Taken together, the mass cytometry data and the plasma cytokine data can be used to construct an immunological profile that discriminates between severe versus moderate COVID-19 disease (Fig.23). Of note, these three cytokines have been associated with lung inflammatory diseases. In particular, EN-RAGE is expressed by CD14⁺ HLA-DR^lo cells, the myeloid-derived suppressor cells, and is a marker of inflammation in severe sepsis and its receptor, RAGE is highly expressed in type I alveolar cells in the lung. Strikingly, we observed that the classical monocytes and myeloid cells from severe COVID-19 patients in the single- cell RNAseq data expressed high levels of S100A12, the gene encoding EN-RAGE, but not the typical inflammatory molecules IL-6 and TNF-α. These data suggest that the pro- inflammatory cytokines observed in plasma likely originate from the cells in lung tissue rather than from peripheral blood cells. The biological mechanisms underlying the spatially dichotomous innate immune response represents an exciting avenue for future research. In addition, EN-RAGE or TNFSF14, and their receptors, could represent attractive targets for therapeutic intervention against severe COVID-19 infections. Methods [00145] Study design and patient characteristics. In the Atlanta cohort, 24 healthy controls, 31 patients with diagnosis of COVID-19 and 16 patients with diagnosis of influenza and RSV were included in this observational study. Healthy controls were asymptomatic adults from whom samples were collected prior to the widespread circulation of SARS-CoV-2 in the community. Patients with COVID-19 were defined according to WHO guidance and positive SARS-CoV-2 RT-PCR testing by nasopharyngeal swabs. Patients with COVID-19 were classified as acute hospitalized (less than 14 days from symptom onset) or convalescent non-hospitalized (more than 4 weeks since symptom onset and currently asymptomatic). The severity of inpatient COVID-19 cases was classified based on the adaptation of the Sixth Revised Trial Version of the Novel Coronavirus Pneumonia Diagnosis and Treatment Guidance. Moderate cases were defined as respiratory symptoms with radiological findings of pneumonia. Severe cases were defined as requiring supplemental oxygen. Critical cases were organ failure necessitating intensive care unit (ICU) care. Patients with RSV and influenza were defined as acute hospitalized patients with confirmed diagnoses by BioFire® FilmArray® of nasopharyngeal and oropharyngeal swabs. RSV and Flu patients were classified as moderate if not requiring oxygen, severe if requiring oxygen and critical if requiring ICU level care. The study conforms to the principles outlined in the Declaration of Helsinki and received approval by the appropriate Institutional Review Board (Stanford University and Emory University). All study procedures were performed after informed consent was obtained. [00146] In the Hong Kong cohort, 22 patients with confirmed COVID-19 disease after RT- PCR testing on a respiratory sample from the Princess Margaret Hospital, Hong Kong, were invited to participate in the study after providing informed consent. Samples from 30 healthy controls which were matched with cases on age and gender were collected from the Hong Kong Red Cross. The study was approved by the institutional review board of the Hong Kong West Cluster of the Hospital Authority of Hong Kong (approval number: UW20-169). All study procedures were performed after informed consent was obtained. Day 1 of clinical onset was defined as the first day of the appearance of clinical symptoms. The severity of the COVID-19 cases was classified based on the adaptation of the Sixth Revised Trial Version of the Novel Coronavirus Pneumonia Diagnosis and Treatment Guidance. The severity of the patients was categorized as follows; Mild - no sign of pneumonia on imaging, mild clinical symptoms; Moderate - fever, respiratory symptoms and radiological evidence of pneumonia; Severe - dyspnea, respiratory frequency >30/min, blood oxygen saturation 93%, partial pressure of arterial oxygen to fraction of inspired oxygen ratio <300, and/or lung infiltrates >50% within 24 to 48 hours; Critical - respiratory failure, septic shock, and/or multiple organ dysfunction or failure or death. RSV and Flu patients were classified as moderate if not requiring oxygen, severe if requiring oxygen and critical if requiring ICU level care. [00147] Phospho-CyTOF analysis of peripheral blood mononuclear cells. Live frozen PBMCs were revived by gentle resuspension in RPMI 1640 medium supplemented with 10% FBS (complete RPMI). One million live PBMCs were immediately fixed with 1 ml of 2% paraformaldehyde (Cat #28906, Pierce) for 30 min. After 30 min, the cells were centrifuged at 500 g for 5 min at room temperature. The cells were resuspended in 90% FBS + 10% DMSO (freezing medium) and frozen at -80°C until staining. Fixed and frozen PBMCs were shipped in dry ice for further analysis at the Human Immune Monitoring Center at Stanford University. The CyTOF assay was run in 5 batches of 20 samples each. Each batch was well controlled with equal distribution of healthy and infected samples in similar age and gender. [00148] Fixed frozen PBMCs were thawed by gentle resuspension in CSM (PBS supplemented with 2% BSA, 2 mM EDTA, and 0.1% sodium azide), washed twice with CSM and counted. Cells were permeabilized and barcoded using Cell-ID™ 20-Plex Pd Barcoding Kit (Fluidigm). The samples were washed with CSM, pooled, and counted. One pooled sample containing a mix of all barcoded PBMC samples were stained for 30 min with surface antibody cocktail at room temperature. The sample was then fixed with 4% freshly prepared paraformaldehyde (Alfa Aesar) for 10 min at room temperature, washed with CSM, permeabilized with 100% methanol (Sigma) and kept at -80°C overnight. Next day, the cells were washed with CSM, counted and stained with pre-titrated intracellular antibody cocktail for 30 min at room temperature. Cells were then washed with CSM, stained with iridium-containing DNA intercalator (Fluidigm), washed with MilliQ water and acquired on Helios mass cytometer (Fluidigm) in MilliQ water supplemented with 1x EQ four element calibration beads (Fluidigm). [00149] The FCS files were bead-normalized before data export. The data were processed for debarcoding in Flowjo software v10 (TreeStar Inc.). Briefly, the bead-normalized file was used to gate single cells based on DNA content and event length using FlowJo. The single cells were reimported and debarcoded using Helios software version 7.0.5189. The debarcoded samples were analyzed using FlowJo or R version 1.2.1335 for downstream tSNE analysis and visualization. [00150] CyTOF data analysis. High-dimensional analysis of phospho-CyTOF data was performed using an R based pipeline. Briefly, the raw fcs files were imported into R and the data were transformed to normalize marker intensities using arcsinh with a cofactor of 5. For visualization, another transformation was applied that scales the expression of all values between 0 and 1 using percentiles as the boundary. Cell clustering was performed with 4,000 cells randomly selected from each sample using FlowSom and ConsensusClusterPlus. The transformed matrix was used as an input for FlowSom and cells were separated into 20 clusters. To obtain reproducible results (avoid random start), a seed was set for each clustering. The 20 clusters were manually annotated based on the lineage marker expression and were merged to produce the final clusters. The clusters were visualized in two-dimensional space using tSNE. The abundance of cell populations was determined using Plotabundance function. In parallel, the data are manually gated to identify 25 immune cell subpopulations that were not well-distinguished in tSNE and used for all quantitation purposes. [00151] Linear modeling of CyTOF data. In order to identify robust distinguishing features of infection status and disease severity, linear models were constructed for each CyTOF feature via the limma package in R (29), using age, gender, and batch as covariates. As the batches were site specific, this also accounted for variability across the two cohorts (Hong Kong and Atlanta). When comparing the features across disease severity, days post symptom onset was also used as a covariate. Briefly, each feature is modeled as a linear function of infection status or disease severity plus additional covariates. Once the model is fit, the estimated coefficients of the comparison of interest are then tested for significance by computing the associated t- statistic and adjusting for multiple testing. [00152] In vitro stimulation of peripheral blood leukocytes. Live frozen PBMCs were revived, counted and resuspended at a density of 15 million live cells/ml ^{in complete RPMI.} The cells were rested at 37°C in CO₂ incubators for 1 h before stimulation. _{After the rest,} 100 µl of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate. Each sample was treated with three conditions, no stimulation, viral cocktail containing 4 µg/ml R848 and 25 µg/ml polyIC or bacterial cocktail containing 25 ng/ml LPS, 10 µg/ml Pam3CSK and 0.3 µg/ml Flagellin. All samples c_ontained 0.18% v/v DMSO in total volume of 200 µl per well. The samples were incubated at 3^{7°C in CO}2 incubators for 1.5 h before addition of 10 µg/ml Brefeldin-A. The cells were incubated for an additional 3.5 h. The cells were washed with PBS, incubated with PBS containing 2 mM EDTA for 10 min at 4°C, and stained with Zombie UV fixable viability dye (Biolegend). The cells were washed with PBS containing 5% FCS, blocked with 5 µl of Human Trustain FcX blocking solution (BioLegend) for 5 min before the addition of surface antibody cocktail containing anti-CD3 (clone SP34-2, BD Biosciences), anti-CD11c (clone S-HCL-3, BD Biosciences), anti-CD123 (clone 7G3, BS Biosciences), anti-HLA-DR (clone L243, BioLegend), anti-CD16 (clone 3G8, BioLegend), anti- CD56 (clone HCD56, BioLegend), anti-CD8a (clone RPA-T8, BD Biosciences), anti-CD20 (clone 2H7, BD Biosciences) and anti-CD14 (clone M5E2, BD Biosciences). The cells were stained for 20 min at 4°C in 100 µl volume. Subsequently, the cells were washed, fixed and permeabilized with cytofix/cytoperm buffer (BD Biosciences) for 20 minutes. The permeabilized cells were stained with ICS antibodies to IL-1b (clone H1b-98, BioLegend), phospho-NF-kB p65 Ser529 (clone B33B4WP, Thermo Fisher Scientific), IFN-a (clone LT27:295, Milteyni Biotec), IL-6 (clone MQ2-13A5, BioLegend), IL-12p40/p70 (clone C8.6, BD Biosciences) and Perforin (clone dG9, BioLegend), TNF-a (clone Mab11, BioLegend), MCP-1 (clone 5D3-F7, BioLegend) and IFN-γ (clone 4S.B3, BD Biosciences). Cells were then washed twice with perm/wash buffer and once with staining buffer before analysis using BD Symphony Flow Cytometer. All flow cytometry data were analyzed using Flowjo software v10 (TreeStar Inc.). [00153] Plasma protein profiling using Olink multiplex panel. All plasma samples were heat-inactivated at 56°C for 15 min to inactivate the virus. A pilot experiment using 2 plasma samples was performed to determine the effect of heat-inactivation on cytokine measurements. We tested these samples at two dilutions and the best dilution was determined for the assay. The inflammation panel used in the current study had minimal effects on heat- inactivation (figure. 24). The analytes affected more than 2-fold are highlighted. In the final assay, all samples were from Emory were quantified using Olink multiplex proximity extension assay (PEA) inflammation panel (Olink proteomics) according to the manufacturer’s instructions and as described before (30). The PEA is a dual- recognition immunoassay, where two matched antibodies labelled with unique DNA oligonucleotides simultaneously bind to a target protein in solution. This brings the two antibodies into proximity, allowing their DNA oligonucleotides to hybridize, serving as template for a DNA polymerase-dependent extension step. This creates a double-stranded DNA “barcode” which is unique for the specific antigen and quantitatively proportional to the initial concentration of target protein. The hybridization and extension are immediately followed by PCR amplification and the amplicon is then finally quantified by microfluidic qPCR using Fluidigm BioMark HD system (Fluidigm Corporation. South San Francisco, California). [00154] CITE-seq single-cell RNA sequencing. Live frozen PBMCs were thawed and 2x washed with RPMI supplemented with 10% FBS and 20 µg/mL DNAse I (Sigma Aldrich). DCs were enriched using the Dynabeads™ DC Enrichment Kit (Invitrogen, 11308D) according to manufacturer’s instructions with 3 – 4 million PBMCs as starting material. The enriched cells were mixed with total PBMCs at a ratio of 1:2 and mixed cells were stained with a cocktail of TotalSeq-A antibodies in PBS supplemented with 5% FBS, 2 mM EDTA, and 5 mg/mL human IgG (table 4), washed twice with PBS supplemented with 5% FBS, and 2 mM EDTA, and resuspended in PBS supplemented with 1% BSA (Miltenyi), and 0.5 U/µL RNase Inhibitor (Sigma Aldrich). About 9,000 cells were targeted for each experiment. [00155] Cells were mixed with the reverse transcription mix and subjected to partitioning along with the Chromium gel-beads using the 10X Chromium system to generate the Gel-Bead in Emulsions (GEMs) using the 3' V3 chemistry (10X Genomics, Pleasanton, CA). The RT reaction was conducted in the C1000 touch PCR instrument (BioRad). Barcoded cDNA was extracted from the GEMs by Post-GEM RT-cleanup and amplified for 12 cycles. Prior to amplification the cDNA amplification mix was spiked in with ADT additive primer (0.2 µM stock) in order to amplify the antibody barcodes. Amplified cDNA was subjected to 0.6x SPRI beads cleanup (Beckman, B23318). Amplified antibody barcodes were recovered from the supernatant and were processed to generate TotalSeq-A libraries as instructed by the manufacturer (BioLegend, TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v33.1 Protocol). The rest of the amplified cDNA was subjected to enzymatic fragmentation, end-repair, A tailing, adapter ligation and 10X specific sample indexing as per manufacturer’s protocol. Libraries were quantified using Bioanalyzer (Agilent) analysis. 10x Genomics scRNA-Seq and TotalSeq-A libraries were pooled and sequenced on an Illumina HiSeq 4000 using the recommended sequencing read lengths of 28 bp (Read 1), 8 bp (i7 Index Read), and 91 bp (Read 2). Cell Ranger v3.1.0 (10x Genomics) was used to demultiplex raw sequencing data and quantitate transcript levels against the 10x Genomics GRCh38 reference v3.0.0. [00156] Single-cell RNA seq processing and analysis. Raw count data was filtered to remove cells with a mitochondrial RNA fraction greater than 25% of total RNA counts per cell. The resultant count matrix was used to create a Seurat (v 3.1.4) object. Filtered read counts were scaled by a factor of 10,000 and log transformed. The antibody- derived tag matrix was normalized per feature using center log normalization. The top 2000 variable RNA features were used to perform PCA on the log-transformed counts. Using a scree plot, we chose the first 25 principle components (PCs) (98.5% of variance explained) to perform further downstream analyses, including clustering and UMAP projections. Clusters were identified with Seurat SNN graph construction followed by Louvain community detection on the resultant graph with a resolution of 0.4, yielding 25 clusters. We removed one cluster that was composed of a majority of dead cells, as judged by the percentage of mitochondrial RNA (>80% before filtering) and exceptionally low unique features, resulting in 24 final clusters. The R package uwot (v.0.1.7) was used to produce UMAP projections with the previously selected 25 PCs. [00157] Statistical analysis. Two-sided wilcox tests were used in all differentially expressed gene analyses. First, we identified DEG that distinguished each cluster from the remaining 23 clusters. These differentially expressed genes were cross-referenced with known immune markers to annotate clusters. Differentially expressed genes were displayed in heatmaps with a random subsample of up to 500 cells per cluster. Next, we identified DEG in each cluster that distinguished cells derived from severe and moderate COVID-19 patients from healthy cells within that cluster. DEG were defined as those with p-value less than 0.05 and a minimum log fold change of 0.25. The DEG from each cluster were analyzed with overrepresentation analysis using the BTM modules. P-values were determined by hypergeometric distribution. Significant pathways were those with a p-value < 0.005. For visualization purposes, only the top 10 most significant pathways were selected. ComplexHeatmap (v.2.1.0) was used to produce all heatmaps. [00158] IFN and inflammatory gene analysis in myeloid cells. To further compare the inflammatory state of myeloid clusters between subjects, we took the average expression of each patient in the pDC and CDC2 clusters across all genes. We filtered this gene list to only include the union set of genes that contributed to the significance of BTMs M150, M127, M165 or M75 in any cluster. Average expression values for each subject were hierarchically clustered using Euclidean distance. For the expression analysis of selected interferons and inflammatory cytokines measured during in-vitro stimulation and Olink plasma analysis, we averaged the gene expression values in each of the COVID-19 severity groups (severe, moderate, convalescent) as well as healthy subjects. We centered and scaled the average expression to enable improved visualization and cross-gene comparisons. Pearson’s correlation coefficients were calculated between S100A12 and all measured genes. The five most positively and negatively correlated genes were then plotted for comparison; all adjusted correlation p-values were smaller than the smallest positive floating-point number precisely calculable in the R environment (2.22*10^-16) and therefore not comparable. [00159] Hierarchical clustering using CyTOF and cytokine measurements. Features distinguishing between infection status (cell frequencies and functional markers by CyTOF) and disease severity (cytokine abundancies by Olink) were integrated in order to examine whether the combination of these features could segregate subjects by both disease state and severity. Features were z-score normalized across subjects and then both features and subjects were grouped by hierarchical clustering via the Ward algorithm (cite Murtagh and Legendre 2014), using Euclidean distance as a distance metric. Visualization was performed using the pheatmap package in R.

Table 3

Table 4

1 . W. H. Organization, "Coronavirus disease (COVID-19) " (2020).

2. Z. Wu, J. M. McGoogan, Characteristics of and Important Lessons From the Coronavirus Disease

2019 (COVID-19) Outbreak in China: Summary of a Report of 72314 Cases From the Chinese

Center for Disease Control and Prevention. JAMA , (2020). 4. R. Channappanavar, S. Perlman, Pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology. Semin Immunopathol 39, 529- 539 (2017). 5. J. Chen et al., Cellular immune responses to severe acute respiratory syndrome coronavirus (SARS-CoV) infection in senescent BALB/c mice: CD4+ T cells are important in control of SARS- CoV infection. J Virol 84, 1289-1301 (2010). 6. J. Zhao, J. Zhao, S. Perlman, T cell responses are required for protection from clinical disease and for virus clearance in severe acute respiratory syndrome coronavirus-infected mice. J Virol 84, 9318-9325 (2010). 7. C. Wu et al., Risk Factors Associated With Acute Respiratory Distress Syndrome and Death in Patients With Coronavirus Disease 2019 Pneumonia in Wuhan, China. JAMA Intern Med, (2020). 8. C. Huang et al., Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395, 497-506 (2020). 9. E. J. Giamarellos-Bourboulis et al., Complex Immune Dysregulation in COVID-19 Patients with Severe Respiratory Failure. Cell Host Microbe, (2020). 10. P. Cheung et al., Single-Cell Chromatin Modification Profiling Reveals Increased Epigenetic Variations with Aging. Cell 173, 1385-1397 e1314 (2018). 11. R. Fernandez, H. Maecker, Cytokine-stimulated Phosphoflow of PBMC Using CyTOF Mass Cytometry. Bio Protoc 5, (2015). 12. A. Arif, J. Jia, B. Willard, X. Li, P. L. Fox, Multisite Phosphorylation of S6K1 Directs a Kinase Phospho-code that Determines Substrate Selection. Mol Cell 73, 446-457 e446 (2019). 13. W. Cao et al., Toll-like receptor-mediated induction of type I interferon in plasmacytoid dendritic cells requires the rapamycin-sensitive PI(3)K-mTOR-p70S6K pathway. Nat Immunol 9, 1157-1164 (2008). 14. B. E. N.-P. Blanco-Melo Daniel, 2,*, Wen-Chun Liu1,3,*, Skyler Uhl1,2, Daisy, Hoagland1, Rasmus Møller1,2, Tristan X. Jordan1,2, Kohei Oishi1,2, Maryline Panis1,2, David, T. T. W. Sachs4, 6, Robert E. Schwartz7,#, Jean K. Lim1,#, Randy A. Albrecht1,3,#, Benjamin, R. tenOever1, 3,#, Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell, (2020). 15. R. da Silva Antunes, A. K. Mehta, L. Madge, J. Tocker, M. Croft, TNFSF14 (LIGHT) Exhibits Inflammatory Activities in Lung Fibroblasts Complementary to IL-13 and TGF-beta. Front Immunol 9, 576 (2018). 16. Z. Zhang, N. Han, Y. Shen, S100A12 promotes inflammation and cell apoptosis in sepsis-induced ARDS via activation of NLRP3 in fl ammasome signaling. Mol Immunol 122, 38-48 (2020). 17. S. Li et al., Molecular signatures of antibody responses derived from a systems biology study of five human vaccines. Nat Immunol 15, 195-204 (2014). 18. A. R. Wilk AJ, Nancy Q. Zhao2*, Jonasel Roque3, Giovanny J. Martinez-, J. L. M. Colon3, Geoffrey T. Ivison2, Thanmayi Ranganath3, Rosemary Vergara3,, L. J. S. Taylor Hollis3, Philip Grant3, Aruna Subramanian3, Angela J. Rogers3**,, Catherine A. Blish1, 4**, A SINGLE-CELL ATLAS OF THE PERIPHERAL IMMUNE RESPONSE TO SEVERE COVID- 19. BioRxiv, (2020). 19. C. W. Bo Diao, Yingjun Tan, Xiewan Chen, Ying Liu, Lifeng Ning, Li Chen, Min Li, Yueping Liu, Gang Wang, Zilin Yuan, Zeqing Feng, Yuzhang Wu, Yongwen Chen, Reduction and Functional Exhaustion of T Cells in Patients with Coronavirus Disease 2019 (COVID-19). MedRxiv, (2020). 20. M. Zheng et al., Functional exhaustion of antiviral lymphocytes in COVID-19 patients. Cell Mol Immunol 17, 533-535 (2020). 21. R. Channappanavar et al., Dysregulated Type I Interferon and Inflammatory Monocyte- Macrophage Responses Cause Lethal Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe 19, 181-193 (2016). 22. N. Y. Jérôme Hadjadj*, *, Laura Barnabei1, Aurélien Corneau4, Jeremy et al., Impaired type I interferon activity and exacerbated inflammatory responses in severe Covid- 19 patients. MedRxiv, (2020). 23. E. Sallard, F. X. Lescure, Y. Yazdanpanah, F. Mentre, N. Peiffer-Smadja, Type 1 interferons as a potential treatment against COVID-19. Antiviral Res 178, 104791 (2020). 24. S. J. A. Carly G. K. Ziegler*, Sarah K. Nyquist*, Ian Mbano*, Vincent N. Miao, Yuming et al., SARS- CoV-2 receptor ACE2 is an interferon-stimulated gene in human airway epithelial cells and is enriched in specific cell subsets across tissues. Cell, (2020). 25. O. M. Pena et al., An Endotoxin Tolerance Signature Predicts Sepsis and Organ Dysfunction at Initial Clinical Presentation. EBioMedicine 1, 64-71 (2014). 26. F. Zhao et al., S100A9 a new marker for monocytic human myeloid-derived suppressor cells. Immunology 136, 176-183 (2012). 27. E. A. Oczypok, T. N. Perkins, T. D. Oury, All the "RAGE" in lung disease: The receptor for advanced glycation endproducts (RAGE) is a major mediator of pulmonary inflammatory responses. Paediatr Respir Rev 23, 40-49 (2017). 28. M. Nowicka et al., CyTOF workflow: differential discovery in high-throughput high- dimensional cytometry datasets. F1000Res 6, 748 (2017). 29. M. E. Ritchie et al., limma powers differential expression analyses for RNA- sequencing and microarray studies. Nucleic Acids Res 43, e47 (2015). 30. E. Assarsson et al., Homogenous 96-plex PEA immunoassay exhibiting high sensitivity, specificity, and excellent scalability. PLoS One 9, e95192 (2014). Example 2 [00160] We further examined the effect of various therapeutic interventions on the immune responses using samples from the Hong Kong cohort, in which some patients were treated with IFN-β1, corticosteroids, or antivirals. The infected individuals, irrespective of the intervention, showed an increased plasmablast and effector CD8 T cell frequency compared with healthy controls. However, there was an increased frequency of effector CD8 T cells and decreased pS6 signal in the pDCs of antiviral-treated individuals. [00161] COVID-19 results in functional impairment of blood myeloid cells and pDCs. Given the earlier findings that mTOR signaling in pDCs mediates the production of IFN-α in response to Toll-like receptor (TLR) stimulation, the reduced expression of pS6 in pDCs suggests that such cells may be impaired in their capacity to produce IFN-α. To test this, we performed ex vivo stimulation of PBMCs from healthy or COVID-19–infected individuals, using a mixture of synthetic TLR7 and TLR 8 (TLR7/8) and TLR3 ligands, which are known to be expressed by viruses, and we performed an intracellular staining assay to detect cytokine responses. The TLR ligands included TLR3 and TLR7/8 ligands, polyIC and R848. Consistent with our hypothesis, there was reduced production of IFN-α in response to the TLR stimuli in the pDCs of infected individuals compared with those of healthy controls. The TNF-α response was also significantly reduced in the pDCs of infected individuals, which demonstrates that the pDCs are functionally impaired in COVID-19 infection. We also determined the ability of mDCs and CD14⁺ monocytes to respond to TLR stimuli. Notably, the response in mDCs as well as that in monocytes were also significantly lower in response to stimulation with a bacterial ligand cocktail (composed of TLR2, TLR4, and TLR5 ligands) or with the viral TLR cocktail. Furthermore, the reduced IκBα levels did not translate into enhanced NF-κβ subunit p65 phosphorylation as measured by p65 (Ser⁵²⁹) in the same cells. These results suggest that the innate immune cells in the periphery of COVID-19–infected individuals are suppressed in their response to TLR stimulation, irrespective of the clinical severity. [00162] Enhanced concentrations of cytokines and inflammatory mediators in plasma from COVID-19 patients. The impaired cytokine response of myeloid cells and pDCs in response to TLR stimulation was unexpected and seemingly at odds with the literature describing an enhanced inflammatory response in COVID-19–infected individuals. Several studies have described higher plasma levels of cytokines, including but not limited to IL-6, TNF-α, and CXCL10. Therefore, we evaluated cytokines and chemokines in plasma samples from the Atlanta cohort using the Olink multiplex inflammation panel that measures 92 different cytokines and chemokines. Of the 92 analytes measured, 71 proteins were detected within the dynamic range of the assay. Of these 71 proteins, 43 cytokines, including IL-6, MCP-3, and CXCL10, were significantly up-regulated in COVID-19 infection. These results demonstrate that plasma levels of inflammatory molecules were significantly up-regulated, despite the impaired cytokine response in blood myeloid cells and pDCs, which suggests a tissue origin of the plasma cytokines. [00163] Cytokine levels in the plasma of healthy or infected individuals. The infected individuals are further classified on the basis of the severity of their clinical COVID-19 disease. The normalized protein expression values plotted on the y axes are arbitrary units defined by Olink Proteomics to represent Olink data. In all box plots, the boxes show median, upper, and lower quartiles. The whiskers show 5th to 95th percentiles. Each dot represents an Atlanta cohort sample (n = 18 healthy, 4 moderate, 18 severe, 12 ICU, 2 convalescent, 8 flu, and 11 RSV). The colors of the dots indicate the severity of clinical disease, as shown in the legends. The differences between the groups were measured by Mann-Whitney rank sum test (Wilcoxon, paired = FALSE; *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant). [00164] In addition to IL-6 and other cytokines described previously, we identified three proteins that were significantly enhanced in COVID-19 infection and strongly correlated with clinical severity. These were TNFSF14 [LIGHT, a ligand of lymphotoxin B receptor that is highly expressed in human lung fibroblasts and implicated in lung tissue fibrosis and remodeling and inflammation], EN-RAGE [S100A12, a biomarker of pulmonary injury that is implicated in pathogenesis of sepsis-induced ARDS], and oncostatin M [(OSM), a regulator of IL-6]. Of note, the TNFSF14 is distinctively enhanced in the plasma of COVID-19–infected individuals but not in cases of other related pulmonary infections such as influenza (flu) virus and respiratory syncytial virus (RSV). Given the pronounced and unappreciated observations of the enhanced plasma concentrations of TNFSF14, EN-RAGE, and OSM and their correlation to disease severity, we used an enzyme-linked immunosorbent assay (ELISA) to independently validate these results. Consistent with the multiplex Olink analysis, we found a significant increase of these inflammatory mediators in the plasma of severe and intensive care unit (ICU) COVID- 19 patients. Furthermore, we found a correlation between multiplex analysis by Olink and the ELISA results. These results suggest that COVID-19 infection induces a distinctive inflammatory program characterized by cytokines released from tissues (most likely the lungs) but suppression of the innate immune system in the periphery. These observations may also represent previously unexplored therapeutic strategies for intervention against severe COVID- 19. [00165] Single-cell transcriptional response to COVID-19 infection. To investigate the molecular and cellular processes that lead to the distinctive inflammatory program, we used cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) and profiled the gene and protein expression in PBMC samples of COVID-19–infected individuals. Cryopreserved PBMC samples from a total of 12 age-matched subjects in the Atlanta cohort were enriched for DCs, stained using a cocktail of 36 DNA-labeled antibodies, and analyzed using droplet-based single-cell gene expression profiling approaches. We performed the experiment in two batches and obtained transcriptomes for more than 63,000 cells after initial preprocessing. Next, we generated a cell-by-gene matrix and conducted dimensionality reduction through uniform manifold approximation and projection (UMAP) and graph-based clustering. Analysis of cell distribution within the UMAP between experiments revealed no major differences, and we analyzed the datasets from the two experiments together without batch correction. Next, we calculated the per-cell quality control (QC) metrics, differentially expressed genes (DEGs) in each cluster compared with all other cells, and the abundance of DNA-labeled antibodies in each cell. Using this information, we filtered low-quality cells and manually annotated the clusters. After QC and cluster annotation, we retained a final dataset with 57,669 high-quality transcriptomes and a median of ~4781 cells per sample and 1803 individual genes per cell that we used to construct the single-cell immune cell landscape of COVID-19. [00166] We observed several clusters that were primarily identified in COVID-19–infected individuals, including a population of plasmablasts, platelets, and red blood cells and several populations of granulocytes. Notably, we detected clusters of T cells and monocytes that were characterized by the expression of interferon-stimulated genes (ISGs) such as IFI27, IFITM3, or ISG15. These IFN response–enriched clusters emerged only in samples from COVID-19 patients. [00167] To describe the specific transcriptional state of single cells from COVID-19–infected individuals, we determined the DEGs for cells from all COVID-19–infected samples in a given cluster compared with the cells from all healthy individuals in the same cluster. We then analyzed these DEGs with overrepresentation analysis using blood transcriptional modules (BTMs) to better understand which immune pathways are differentially regulated in patients with COVID-19 compared with healthy individuals. The analysis indicated a marked induction of antiviral BTMs, especially in cell types belonging to the myeloid and dendritic cell lineage. Detailed analysis of the expression pattern of the distinct union of genes driving the enrichment of these antiviral pathways in monocytes and dendritic cells revealed that many ISGs were up-regulated in these cell types. Given our observations of muted IFN-α production in pDCs, we investigated the expression of genes encoding various type I and type II IFNs across cell types. Notably, with the exception of modest levels of IFN-γ expression in T and NK cells, we could not detect any expression of IFN-α and -β genes, which is consistent with the functional data demonstrating impaired type I IFN production by pDCs and myeloid cells. However, there was an enhanced expression of ISGs in patients with COVID-19 in spite of an impaired capacity of the innate cells in the blood compartment to produce these cytokines. [00168] Despite the lack of type I IFN gene expression, the presence of an ISG signature in the PBMCs of COVID-19–infected individuals raised the possibility that low quantities of type I IFNs produced in the lung by SARS-CoV-2 infection might circulate in the plasma and induce the expression of ISGs in PBMCs. We thus measured the concentration of IFN-α in plasma using a highly sensitive ELISA enabled by single molecule array (SIMoA) technology. We observed a marked increase in the concentration of IFN-α, which peaked around day 8 after onset of symptoms and regressed to baseline levels by day 20. Notably, we observed a strong correlation between the average expression levels of the ISG signature in PBMCs identified by CITE-seq analysis and the IFN-α concentration in plasma. Additionally, we noticed a strong temporal dependence of the IFN-α response. [00169] To investigate this further and to independently validate the observations in the CITE- seq analysis, we performed bulk RNA sequencing (RNA-seq) analysis of PBMCs in an extended group of subjects (17 COVID-19 patients and 17 healthy controls) from the same cohort. We first evaluated whether the ISG signature containing 33 genes identified in the CITE-seq data was also observed in the bulk RNA-seq dataset. We observed a strong induction of the ISGs in COVID-19 subjects compared with healthy donors in this dataset as well. Of note, we did not detect expression of genes encoding IFN-α or IFN-β, consistent with the CITE-seq and flow cytometry experiments. We also performed an unbiased analysis of an extended set of genes in the IFN transcriptional network and found that these were induced in COVID-19 subjects relative to healthy controls, as observed for the limited ISG signature. Similar to the observation with CITE-seq data, there was a strong correlation between circulating IFN-α and the ISG response measured by the bulk transcriptomics. Additionally, we analyzed the individual impact of major covariates—time, disease severity, sex, and age— on the observed ISG signature. Although time emerged as the primary driver of ISG signature, COVID-19 clinical severity also had an effect. Taken together, these data demonstrate that, early during SARS-CoV-2 infection, there are low levels of circulating IFN-α that induce ISGs in the periphery while the innate immune cells in the periphery are impaired in their capacity to produce inflammatory cytokines. [00170] In addition to an enhanced ISG signature, the CITE-seq analysis revealed a significant decrease in the expression of genes involved in the antigen-presentation pathways in myeloid cells. Consistent with this, we observed a reduction in the expression of the proteins CD86 and human leukocyte antigen class DR (HLA-DR) on monocytes and mDCs of COVID-19 patients, which was most pronounced in subjects with severe COVID-19 infection. HLA-DR is an important mediator of antigen presentation and is crucial for the induction of T helper cell responses. Using the phospho-CyTOF data from both the Atlanta and Hong Kong cohorts, we confirmed the reduced expression of HLA-DR on monocytes and mDCs in patients with severe COVID-19 disease. By contrast, S100A12, the gene encoding EN-RAGE, was substantially increased in the PBMCs of COVID-19 patients, whereas the expression of genes encoding other proinflammatory cytokines was either absent or unchanged compared with healthy controls. Notably, the S100A12 expression was highly restricted to monocyte clusters and showed a significant correlation with EN-RAGE protein levels in plasma measured by Olink. Finally, we examined whether there is an association between HLA-DR and S100A12 expression in our dataset, and we found a strong inverse correlation between S100A12 gene expression and the genes encoding the antigen presentation machinery (HLA-DPA1, HLA- DPB1, HLA-DR, and CD74). Notably, the receptor for S100A12, AGER (RAGE), was expressed sparsely in PBMCs, which suggests that the target of EN-RAGE action was likely to be elsewhere—perhaps the lung, where RAGE is known to be expressed in type I alveolar epithelial cells and mediate inflammation. [00171] Taken together, CITE-seq analysis of PBMCs in COVID-19 patients revealed the following mechanistic insights: (i) a lack of expression of genes encoding type I IFN and proinflammatory cytokines in PBMCs, which was consistent with the mass cytometry and functional data; (ii) an early but transient wave of ISG expression, which was entirely consistent with analysis of RNA-seq from bulk PBMCs and strongly correlated with an early burst of plasma IFN-α, likely of lung origin; and (iii) the impaired expression of HLA-DR and CD86 but enhanced expression of S100A12 in myeloid cells, which was consistent with the mass cytometr, Olink, and ELISA data, and is a phenotype reminiscent of myeloid-derived suppressor cells described previously. [00172] Severe COVID-19 infection is associated with the systemic release of bacterial products. The increased levels of proinflammatory mediators in the plasma—including IL-6, TNF, TNFSF14, EN-RAGE, and OSM, coupled with suppressed innate immune responses in blood monocytes and DCs suggested a sepsis-like clinical condition. In this context, it has been previously suggested that proinflammatory cytokines and bacterial products in the plasma may play pathogenic roles in sepsis, and the combination of these factors could be important in determining patient survival. Therefore, to determine whether a similar mechanism could be at play in patients with severe COVID-19, we measured bacterial DNA and lipopolysaccharide (LPS) in the plasma. Notably, the plasma of severe and ICU patients had significantly higher levels of bacterial DNA, as measured by PCR quantitation of bacterial 16S ribosomal RNA (rRNA) gene product, and of LPS, as measured by a TLR4-based reporter assay. Furthermore, there was a significant correlation between bacterial DNA or LPS and the plasma levels of the inflammatory mediators IL-6, TNF, MCP-3, EN-RAGE, TNFSF14, and OSM. The enhanced cytokine release may in part be caused by increased bacterial products in the lung or in other tissues. [00173] Bacterial DNA quantification by PCR DNA was extracted from 200 µl plasma using QIAamp DNA Mini Kit (QIAGEN, Germantown, MD) according to manufacturer’s guidelines. DNA was eluted in 30 ul of microbial DNA-free water. Bacterial DNA quantification was performed by qPCR with SsoAdvanced™ Universal SYBR® Green Supermix kit on the Bio- Rad CFX96. Universal 16S primers were used as previously reported (43): EUBF 5’ - TCCTACGGGAGGCAGCAGT - 3’ and EUBR 5’ - GGACTACCAGGGTATCTAATCCTGTT - 3’. Reactions were composed of 10 µl Supermix (2x), 0.5 ul each primer (10 µM), 4 µl PCR- grade water and 5 µl of DNA template. Reaction conditions include initial denaturation at 98o C for 3 min followed by 40 cycles of denaturation for 15 s at 90o C, annealing for 15 s at 60o C and elongation for 60 s at 72^o C. The specificity of all qPCR products was assessed by analysis of a post-PCR dissociation curve performed between 60°C and 95°C. Each sample was run in triplicate and the mean value was used. The absolute number of copies of the 16S rRNA gene was determined by comparison with a quantitative standard curve generated with serial dilution of a microbial DNA standard from Enterococcus faecalis (Sigma Aldrich). The average quantities of 16S copies per sample were presented as copies/ml plasma. Quantitation of LPS in plasma The LPS in plasma was quantified using human embryonic kidney (HEK)-Blue-hTLR4 cells (Cat #hkb-htlr4) Invivogen, San Diego, CA) according to manufacturer’s guidelines. Briefly, 20 µl of plasma heat-inactivated at 56ºC for 15 min, was added to 180 µl of HEK-Blue-hTLR4 cell 11 suspension in HEK-Blue detection medium. The cells were incubated at 37^o C in 5% CO2 for 9 h before secreted alkaline phosphatase activity was measured at 620 nm. The absolute quantities of LPS in plasma were determined by comparison with a quantitative standard curve generated with serial dilution of standard LPS- B5 (Invivogen, San Diego, CA). [00174] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. [00175] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

What is claimed is: 1. A method for treatment to reduce clinical symptoms associated with SARS-CoV2 infection, the method comprising: administering to an individual infected with SARS-CoV2 an effective dose of an agent that blocks the activity of one or more of the inflammatory mediators EN-RAGE, TNFSF14 and Oncostatin M.

2. The method of claim 1, wherein the inflammatory mediator is EN-RAGE.

3. The method of claim 1, wherein the inflammatory mediator is TNSF14.

4. The method of claim 1, wherein the inflammatory mediator is Oncostatin M.

5. The method any of claims 1-4, wherein the agent is an antibody.

6. The method of claim 5, wherein the antibody specifically binds to EN-RAGE, TNFSF14 or Oncostatin M.

7. The method of claim 5, wherein the antibody specifically binds to a receptor for EN- RAGE, TNFSF14 and Oncostatin M.

8. The method of any of claims 1-5, wherein the blocking agent is a soluble receptor.

9. The method of any of claims 1-5, wherein the blocking agent comprises a non- activating polypeptide of EN-RAGE, TNFSF14 or Oncostatin M.

10. A method for determining the likelihood of an individual infected with SARS-CoV2 to progress to severe disease, the method comprising: detecting the level of one or more of EN-RAGE, TNFSF14, and Oncostatin-M in a sample from the individual, wherein elevated levels of one or more of EN-RAGE, TNFSF14, and Oncostatin-M relative to a control is indicative of a likelihood to progress to severe disease.

11. The method of claim 10, wherein the elevated levels are at least 50% greater than a control.

12. The method of claim 10 or 11, wherein the sample is a blood, plasma or serum sample.

13. The method of claim 10 or 11 wherein the sample is a respiratory tract sample, e.g. lung or nasopharygeal aspirate or lavage, and the like.

14. The method of any of claims 10-13, wherein an individual an individual determined to have a likelihood to progress to severe disease is treated to reduce viral infection.

15. The method of claim 14, wherein the treatment to reduce viral infection comprises administration of nucleotide or nucleoside analogs.

16. The method of any of claims 10-13, wherein an individual determined to have a likelihood to progress to severe disease is treated to reduce hyperactive proinflammatory responses.

17. The method of claim 16, wherein the treatment comprises administration of an agent according to the methods of any of claims 1-9.

18. The method of any of claims 10-13, wherein an individual determined to have a likelihood to progress to severe disease is treated to enhance lung function.

19. The method of claim 18, wherein the treatment comprises administering supplemental oxygen, ventilation, or C-PAP.

20. The method of any of claims 10-13, wherein an individual an individual determined to have a likelihood to progress to severe disease is treated with an antibiotic.