WO2021228814A1 - Mdm2 inhibitor response prediction method - Google Patents

Mdm2 inhibitor response prediction method Download PDF

Info

Publication number
WO2021228814A1
WO2021228814A1 PCT/EP2021/062420 EP2021062420W WO2021228814A1 WO 2021228814 A1 WO2021228814 A1 WO 2021228814A1 EP 2021062420 W EP2021062420 W EP 2021062420W WO 2021228814 A1 WO2021228814 A1 WO 2021228814A1
Authority
WO
WIPO (PCT)
Prior art keywords
mdm2
neoplasm
treatment
expression
cells
Prior art date
Application number
PCT/EP2021/062420
Other languages
French (fr)
Inventor
Salvatore PISCUOGLIO
Kiu Yan Charlotte NG
Gaia BIANCO
Hesam MONTAZARI
Niko BEERENWINKEL
Sumana SRIVATSA
Original Assignee
ETH Zürich
Universität Basel
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ETH Zürich, Universität Basel filed Critical ETH Zürich
Publication of WO2021228814A1 publication Critical patent/WO2021228814A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5748—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving oncogenic proteins

Definitions

  • the present invention relates to MDM2 modulators in treatment of cancer characterized by decreased or abrogated function of GAT A3.
  • GAT A3 is one of the most frequently mutated genes in estrogen receptor (ER)-positive breast cancers and can be found mutated in 12% and 18% of primary and metastatic ER-positive breast cancers, respectively.
  • GAT A3 is a zinc-finger transcription factor with key functions in mammary epithelial cell differentiation. In the context of breast cancer, GAT A3 suppresses epithelial-to- mesenchymal transition and acts as a pioneer factor during this process by recruiting others cofactors such as ERa and FOXA1 .
  • GAT A3 expression is strongly associated with ERa expression in breast cancer, and the loss of GAT A3 expression, via GA TA3 somatic genetic alterations or other mechanisms, has been linked to poor prognosis in breast cancer patients. Importantly, targeted therapies directed at GAT A3 deficiency are not available.
  • the objective of the present invention is to provide means and methods to treat cancer characterized by decreased or abrogated function of GAT A3. This objective is attained by the subject-matter of the independent claims of the present specification.
  • a first aspect of the invention relates to an agent (a pharmaceutical drug compound) for use in treatment of a neoplasm, particularly a malignant neoplasm, wherein said neoplasm is characterized by decreased or abrogated function of GAT A3.
  • That agent is selected from: a. a nucleic acid biopolymer capable of specifically suppressing expression of MDM2; b. an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight ⁇ 700 Da, c. a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight ⁇ 700 Da, or d. a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist of that interaction.
  • a second aspect of the invention relates to a method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein
  • an expression and/or an enzymatic activity of GATA3 is determined in a sample of a neoplasm isolated from said patient and • a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is a. characterized by low expression of GAT A3 or lack of expression of GAT A3; and/or b. characterized by expression of a non-active GATA3 variant; and/or c. characterized by the presence of somatic genetic alterations in the GATA3 gene, particularly a mutation, a copy number alteration or a genomic rearrangement; particularly wherein the MDM2 modulator is selected from
  • nucleic acid biopolymer capable of specifically suppressing expression of MDM2
  • an MDM2 specific inhibitor particularly an MDM2 inhibitor characterized by a molecular weight ⁇ 700 Da
  • a specific modulator of the MDM2-p53 interaction particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight ⁇ 700 Da, or
  • the invention encompasses a system for determining the GAT A3 status of a patient as a basis for making the assessment of likelihood of MDM2 modulator treatment response.
  • a third aspect of the invention relates to the agent for use in treatment or prevention of a neoplasm, particularly a malignant neoplasm, according to the first aspect, wherein a high likelihood of responding to MDM2 modulator treatment is assigned to said patient according to the method of the second aspect.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, diluent or excipient for use in treatment of a neoplasm.
  • Fig. 1 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
  • Fig. 2 GAT A3 status determines response to MDM2 inhibitors in vitro.
  • Fig. 3 GAT A3 expression determines response to MDM2 inhibitor in vivo.
  • Fig. 4 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
  • Fig. 5 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
  • GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
  • Fig. 7 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
  • Fig. 8 GAT A3 status determines response to MDM2 inhibitors in vitro.
  • Fig. 9 GAT A3 status determines response to MDM2 inhibitors in vitro.
  • Fig. 10 GAT A3 expression determines response to MDM2 inhibitor in vivo.
  • Fig. 11 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
  • Fig. 12 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
  • Fig. 13 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
  • MDM2 in the context of the present specification relates to the human MDM2 proto oncogene, also known as the homolog of the mouse double minute 2, encoding for the E3 ubiquitin- protein ligase Mdm2.
  • GATA3 in the context of the present specification relates to the human gene GATA binding protein 3, encoding for the protein product Trans-activating-T-cell-specific transcription factor GAT A3.
  • the TP53 in the context of the present specification relates to the human tumor suppressor gene Tumor Protein p53 (TP53), encoding for the protein product cellular tumor antigen p53.
  • TP53 Tumor Protein p53
  • gene expression or expression may refer to either of, or both of, the processes - and products thereof - of generation of nucleic acids (RNA) or the generation of a peptide or polypeptide, also referred to transcription and translation, respectively, or any of the intermediate processes that regulate the processing of genetic information to yield polypeptide products.
  • RNA nucleic acids
  • the term gene expression may also be applied to the transcription and processing of a RNA gene product, for example a regulatory RNA or a structural (e.g. ribosomal) RNA. If an expressed polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • variant refers to a polypeptide that differs from a reference polypeptide, but retains essential properties.
  • a typical variant of a polypeptide differs in its primary amino acid sequence from another, reference polypeptide. Differences may be limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
  • Truncated variants refer to more substantial differences between the variant polypeptide and the reference polypeptide, such as a shorter version of the polypeptide is translated and an entire protein domain can be lost (e.g. DNA binding domain).
  • a variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and/or deletions).
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
  • a variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally.
  • a non-active variant is a polypeptide, which does not retain the physiological function of the reference polypeptide inside a cell.
  • siRNA small/short interfering RNA
  • siRNA in the context of the present specification relates to an RNA molecule capable of interfering with the expression (in other words: inhibiting or preventing the expression) of a gene comprising a nucleic acid sequence complementary or hybridizing to the sequence of the siRNA in a process termed RNA interference.
  • the term siRNA is meant to encompass both single stranded siRNA and double stranded siRNA.
  • siRNA is usually characterized by a length of 17-24 nucleotides. Double stranded siRNA can be derived from longer double stranded RNA molecules (dsRNA).
  • RNA interference often works via binding of an siRNA molecule to the mRNA molecule having a complementary sequence, resulting in degradation of the mRNA. RNA interference is also possible by binding of an siRNA molecule to an intronic sequence of a pre-mRNA (an immature, non-spliced mRNA) within the nucleus of a cell, resulting in degradation of the pre-mRNA.
  • shRNA small hairpin RNA
  • RNAi RNA interference
  • sgRNA single guide RNA
  • CRISPR clustered regularly interspaced short palindromic repeats
  • miRNA in the context of the present specification relates to a small non coding RNA molecule (containing about 22 nucleotides) that functions in RNA silencing and post- transcriptional regulation of gene expression.
  • nucleotides in the context of the present specification relates to nucleic acid or nucleic acid analogue building blocks, oligomers of which are capable of forming selective hybrids with RNA or DNA oligomers on the basis of base pairing.
  • nucleotides in this context includes the classic ribonucleotide building blocks adenosine, guanosine, uridine (and ribosylthymine), cytidine, the classic deoxyribonucleotides deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine.
  • nucleic acids such as phosphotioates, 2’0-methylphosphothioates, peptide nucleic acids (PNA; N-(2-aminoethyl)-glycine units linked by peptide linkage, with the nucleobase attached to the alpha-carbon of the glycine) or locked nucleic acids (LNA; 2 ⁇ , 4’C methylene bridged RNA building blocks).
  • PNA peptide nucleic acids
  • LNA locked nucleic acids
  • hybridizing sequence may be composed of any of the above nucleotides, or mixtures thereof.
  • antisense oligonucleotide in the context of the present specification relates to an oligonucleotide having a sequence substantially complimentary to, and capable of hybridizing to, an RNA. Antisense action on such RNA will lead to modulation, particular inhibition or suppression of the RNA’s biological effect. If the RNA is an mRNA, expression of the resulting gene product is inhibited or suppressed.
  • Antisense oligonucleotides can consist of DNA, RNA, nucleotide analogues and/or mixtures thereof. The skilled person is aware of a variety of commercial and noncommercial sources for computation of a theoretically optimal antisense sequence to a given target.
  • optimization can be performed both in terms of nucleobase sequence and in terms of backbone (ribo, deoxyribo, analogue) composition.
  • backbone ribo, deoxyribo, analogue
  • specific binding in the context of the present invention refers to a property of ligands that bind to their target with a certain affinity and target specificity.
  • the affinity of such a ligand is indicated by the dissociation constant of the ligand.
  • a specifically reactive ligand has a dissociation constant of ⁇ 10 7 mol/L when binding to its target, but a dissociation constant at least three orders of magnitude higher in its interaction with a molecule having a globally similar chemical composition as the target, but a different three-dimensional structure.
  • a polymer of a given group of monomers is a homopolymer (made up of a multiple of the same monomer); a copolymer of a given selection of monomers is a heteropolymer constituted by monomers of at least two of the group.
  • the term pharmaceutical composition refers to a compound of the invention, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier.
  • the pharmaceutical composition according to the invention is provided in a form suitable for topical, parenteral or injectable administration.
  • the term pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (for example, antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington: the Science and Practice of Pharmacy, ISBN 0857110624).
  • treating or treatment of any disease or disorder refers in one embodiment, to ameliorating the disease or disorder (e.g. slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof).
  • treating or treatment refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient.
  • treating or treatment refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
  • a first aspect of the invention relates to an agent for use in treatment of a neoplasm, particularly a malignant neoplasm, wherein said neoplasm is characterized by decreased or abrogated function of GAT A3 (particularly a non-functional GATA3 mutant or lack of expression of GAT A3).
  • the agent is a nucleic acid biopolymer capable of specifically suppressing expression of MDM2.
  • nucleic acid biopolymer can be, for example, an antisense oligonucleotide designed to specifically bind to MDM2 mRNA and inhibit expression of its message.
  • the agent is an MDM2 specific inhibitor, particularly an MDM2 inhibitor pharmaceutical drug molecule characterized by a molecular weight ⁇ 700 Da.
  • the agent is a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight ⁇ 700 Da.
  • the agent is a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist of such interaction, wherein said agent is able to reduce the amount of functional MDM2 inside a cell.
  • the decreased or abrogated function of GATA3 is determined via sequencing of the GATA3 gene, quantification of GATA3 mRNA, particularly quantification via qRT- PCR, or evaluation of GAT A3 protein expression, particularly by immunohistochemistry. Mutations in the GATA3 gene affecting residues essential for GAT A3 function or frameshift mutations leading to a truncated GAT A3 may be detected via sequencing of the GATA3 gene.
  • the nucleic acid biopolymer capable of specifically suppressing expression of MDM2 is selected from an siRNA, an miRNA, an antisense oligonucleotide, an shRNA, and an sgRNA.
  • the MDM2 specific inhibitor is selected from MEL23 and MEL24.
  • the specific modulator of the MDM2-p53 interaction is a nutlin.
  • a nutlin is a small molecule, a c/s-imidazole analogue, which occupies the p53 binding pocket of MDM2. The nutlin thereby disrupts the MDM2-p53 interaction and this leads to stabilization of p53. Any nutlin is encompassed by the present invention.
  • the specific modulator of the MDM2-p53 interaction is selected from HLI373, NSC 66811 , Nutlin-3, Nutlin-3a, RITA, SKPin C1 , SMER 3, SP141 , SZL P1-41 , TAME hydrochloride, Thalidomide, VH 298, YH 239-EE, proTAME, Lenalidomide, MZ 1 , TL 12-186, cis MZ 1 , dBET1 , AT 1 , NSC 66811 , HLI 373, NAB 2, GS 143, cis VH 298, CM 11 , CMP 98, TL 13-27, Idisulam, Indasanutlin, CRBN-6-5-5-VHL, RITA NSC 652287, Tenovin-1 , AT 406 (SM-406), Avadomide (CC-122), NSC 207895, JNJ-26854165 (Serdemetan), lberdomide
  • the specific modulator of the MDM2-p53 interaction is idasanutlin.
  • the peptide specifically modulating the MDM2-p53 interaction is selected from ATSP-7041 , M06, SAH-p53-8, sMTide-02/02A, and ATSP-7041 .
  • the neoplasm is characterized by expression of functional p53.
  • the assay for determining the function of p53 can be a flow-cytometry-based assay described in detail in Le Garff-Tavernier et al. (Blood Cancer J. 2011 Feb; 1 (2): e5).
  • staining of p53 is accomplished by a fluorescent antibody and cells expressing p53 are detected using flow cytometry.
  • Functionality of p53 inside the cell is assessed using etoposide and nutlin-3a.
  • the so- called type 1 profile corresponds to normal p53 function, wherein baseline expression of p53 is undetectable, but with etoposide and nutlin-3a stimulation, a clear increase of p53 expression and its transcriptional target p21 at day 1 is observed.
  • the neoplasm is a neoplasm of breast tissue, urothelial tissue, stomach, uterus, ovaries, or lung, or the neoplasm is melanoma, or diffuse large B-cell lymphoma.
  • the neoplasm is a neoplasm of breast tissue.
  • the neoplasm is an estrogen receptor (ER) positive neoplasm of breast tissue.
  • a second aspect of the invention relates to a method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein
  • a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is a. characterized by low expression of GAT A3 or lack of expression of GAT A3; and/or b. characterized by expression of a non-active GATA3 variant; and/or c. characterized by the presence of somatic genetic alterations in the GATA3 gene, particularly a mutation, a copy number alteration or a genomic rearrangement.
  • the MDM2 modulator is selected from a. a nucleic acid biopolymer capable of specifically suppressing expression of MDM2; b. an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight ⁇ 700 Da, c. a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight ⁇ 700 Da, or d. a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist.
  • low expression of GATA3 is a reduction of at least 30%, particularly at least 40%, more particularly at least 50% in relation to the amount of GAT A3 protein in healthy cells of the same tissue.
  • a non-active GAT A3 variant is a GAT A3 protein with a diminished or abrogated function.
  • a somatic genetic alteration in the GAT A3 gene can consist of, but is not limited to a mutation, a copy number alteration and/or a genomic rearrangement.
  • a frameshift mutation is encompassed by the term mutation. Frameshift mutations may result in truncated forms of GAT A3 that e.g. lose the DNA binding domain.
  • the method according to the second aspect comprises additionally the following steps:
  • a third aspect of the invention relates to the agent for use in treatment or prevention of a neoplasm, particularly a malignant neoplasm, according to the first aspect, wherein a high likelihood of responding to MDM2 modulator treatment is assigned to said patient according to the method of the second aspect.
  • MDM2 modulators include, but are not limited to, - 5-[[3-Dimethylarnino)propyl]amino]-3,10-dimethylpyrimido[4,5-b]quinoline- 2,4(3H,10H)-dione dihydrochloride (HLI373);
  • any specifically mentioned drug provided for use in treatment of a neoplasm according to the invention may be present as a pharmaceutically acceptable salt of said drug.
  • Pharmaceutically acceptable salts comprise the ionized drug and an oppositely charged counterion.
  • Non-limiting examples of pharmaceutically acceptable anionic salt forms include acetate, benzoate, besylate, bitatrate, bromide, carbonate, chloride, citrate, edetate, edisylate, embonate, estolate, fumarate, gluceptate, gluconate, hydrobromide, hydrochloride, iodide, lactate, lactobionate, malate, maleate, mandelate, mesylate, methyl bromide, methyl sulfate, mucate, napsylate, nitrate, pamoate, phosphate, diphosphate, salicylate, disalicylate, stearate, succinate, sulfate, tartrate, tosylate, triethiod
  • Dosage forms may be for oral administration.
  • parenteral administration may be used, such as subcutaneous, intravenous, intrahepatic or intramuscular injection forms.
  • a pharmaceutically acceptable carrier and/or excipient may be present.
  • compositions for use in treatment of cancer comprising a compound of the present invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
  • the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein.
  • the compound of the present invention is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to give the patient an elegant and easily handleable product.
  • the pharmaceutical composition can be formulated for oral administration, parenteral administration, or rectal administration.
  • the pharmaceutical compositions of the present invention can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
  • the pharmaceutical composition or combination of the present invention can be in unit dosage of about 1-1000 mg of active ingredient(s) for a subject of about 50-70 kg.
  • the therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.
  • compositions of the present invention can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc. They may be produced by standard processes, for instance by conventional mixing, granulating, dissolving or lyophilizing processes. Many such procedures and methods for preparing pharmaceutical compositions are known in the art, see for example L. Lachman et al. The Theory and Practice of Industrial Pharmacy, 4th Ed, 2013 (ISBN 8123922892).
  • Fig. 1 (a) Schematic representation of the project DRIVE shRNA screening data used to identify synthetic lethal interactors of GATA3. (b) SLIdR-derived statistical significance (- log10(P)) plotted against the difference in the mean viability scores between GATA3- mutant and GA 743-wild type breast cancer cell lines for each gene knocked-down in the shRNA screen. Middle lines of the boxplots indicate medians. Box limits are first and third quartiles.
  • the whiskers extend to the range (c) Viability scores of MDM2 knock down in GA 7A3-mutant and GA 743-wild type cell lines (d-f) Proliferation kinetics of (d) GA 743-mutant MCF-7 cells transfected with siRNA targeting MDM2 (gray) or control (black), (e) GA 743-wild type BT-474 cells and (f) GA 743-wild type MDA-MB134 cells transfected with siRNA targeting GAT A3 (blue), MDM2 (gray), GAT A3 and MDM2 (red) or siRNA control (black) (g) Apoptosis assay using Annexin V and propidium iodide co staining.
  • Fig. 2 Proliferation kinetics of (a) GA7A3-mutant MCF-7 cell line under increasing dosage of idasanutlin, (d) BT-474 cells upon GATA3 silencing and/or treatment with 12.5mM idasanutlin.
  • Fig. 3 (a) Schematic representation of the zebrafish xenotransplantation assay (b) Barplot shows the percentages of fish that harboured (grey) or did not harbour (blue) tumours upon transplantation with GAL43-silenced or control BT-474 cells pre-treated with idasanutlin or DMSO. In total, 70-100 embryos were analyzed per group over two independent experiments (c) Representative confocal images of tumour formation in zebrafish injected with fluorescent tracker-labelled BT-474 cells with GATA3 siRNA or control siRNA, pretreated with idasanutlin or DMSO. (d) FACS analysis showing the percentage of red-tracker labelled tumour cells extracted from the embryos.
  • Error bars represent, in total, three replicates performed over two independent experiments. Each replicate represents the pooled lysate of 20-30 fish for each condition.
  • e Schematic illustration of the CAM assay
  • f Photographs of GAL43-silenced or control BT-474 cells pre-treated with DMSO or idasanutlin implanted in CAMs and grown for 4 days post implantation.
  • g Volume of tumours derived from the CAM experiment (n >10 tumours from 3 independent experiments). Values are normalized to the mean of siCTR DMSO.
  • Tumoural cells (upper panel) were immunostained with GAT A3 (middle panel) and the apoptotic marker Cl. Caspase 3 (lower panel) in the different treatment conditions. Data are mean ⁇ SEM (d, g) n>4 replicates. Scale bars: 500pm (c), 1cm (f) and 50 and 100pM (h). Statistical significance was determined for (b) by two-sided Fisher's Exact and for (d,g) by the two-tailed unpaired Student’s t-test.
  • Fig. 4 (a) Schematic representation of the RNA-seq experimental setup to identify gene expression changes induced by concurrent GATA3 loss and MDM2 inhibition. Venn diagram shows the number of pathways enriched in both MCF-7 and MDA-MB134. (b) Normalised enrichment scores of significantly up- and down-regulated pathways in both MCF-7 (blue) and MDA-MB134 (red). Size of the dots is proportional to the adjusted p- value as indicated in the legend.
  • Fig. 5 (a) Immunoblot showing GA7A3-mutant, GATA3-w ⁇ d type and MDM2 protein level of expression in MCF-7 cells at 72 hours post-siRNA transfection (upper panel). MDM2 mRNA level of expression (relative expression to GAPDH) in MCF-7 cells at 24, 48 and 72 hours post-siRNA transfection (bottom panel) (b) Immunoblot showing MDM2 protein level of expression at 72 hours post-siRNA transfection (upper panel) and MDM2 mRNA levels at 48 hours post-siRNA transfection (bottom panel) after transfection with different concentrations of siRNA (6.25nM, 12.5nM or 25nM) in MCF-7 cells (c) Proliferation kinetics of MCF-7 cells transfected with MDM2 siRNA at different concentrations (d) Flow cytometry analysis of Annexin V and propidium iodide co-staining to measure the percentage of apoptotic cells (AnnV+) and live cells (AnnV
  • Fig. 6 (a,b) MDM2 and GATA3 mRNA level of expression (relative expression to GAPDH) in (a)
  • BT-474 and (b) MDA-MB134 cells at 24, 48 and 72 hours post-siRNA transfection (left panel). Immunoblot showing MDM2 and GATA3 protein level of expression in (a) BT-474 and (b) MDA-MB134 cells 72 hours post-siRNA transfection (right panel). Data are mean ⁇ s.d. (a, b) n >2 replicates. Statistical significance was determined for (a,b) by the two- tailed unpaired Student’s t-test.
  • Fig. 7 (a) MDM2 and GATA3 imRNA level of expression (relative expression to GAPDH) in T-
  • Fig. 8 (a) Log-dose response curve of idasanutlin in MCF-7 cells (b) Effect of GATA3 silencing on proliferation upon treatment with DMSO or idasanutlin 12.5 mM in MDA-MB134 cells (c) log-dose response curve of Idasanutlin in MDA-MB134 cells transfected with control siRNA or GAT A3 siRNA.
  • Fig. 9 (a) Effect of TP53 silencing on proliferation upon treatment with idasanutlin (12.5 pM) or
  • DMSO in MCF-7 cells (b) Percentage of apoptotic and live cells upon TP53 silencing and idasanutlin treatment (12.5 pM) in MCF-7 cells (c) Immunoblot showing MDM2 and p53 protein levels 24 hours post-treatment with DMSO or idasanutlin (12.5 pM) in MCF-7 cells transfected with control siRNAs or TP53 siRNAs. (d) mRNAs levels of BCL2 and BA in control and 7P53-silenced MCF-7 cells at 12 and 24 hours post-treatment. Data are mean ⁇ s.d. (a,b,d) n>3 replicates. Statistical significance was determined for (a,b,d) by the two-tailed unpaired Student’s t-test.
  • Fig. 10 Representative micrographs of BT-474 tumours extracted 4 days post-implantation. Tumoural cells (hematoxylin/eosin; upper panel) were immunostained with the apoptotic marker Cl. Caspase 3 (lower panel) in the different treatment conditions. Scale bars 100 and 50pM.
  • Fig. 11 (a) Immunoblot showing MDM2 protein expression in MCF-7 (left) and MDM2, GAT A3, p53, PARP and cleaved PARP protein expression in BT-474 cells (right) (b) Immunoblot showing markers of mTOR signalling pathway activation at 48 hours post siRNA transfection and 24 hours post-treatment with DMSO or Idasanutlin in BT-474 cells.
  • Fig. 12 Doughnut charts showing the mutual exclusivity between GATA3 and PI3KCA (a) and GAT A3 and PTEN (b) genetic alterations in ER-positive breast cancer patients. Statistical significance was determined for (a, b) by one-sided Fisher's Exact.
  • Fig. 13 Normalised enrichment scores of significantly up- and down-regulated pathways identified by gene set enrichment analysis (a) in ER-positive breast cancers with low GA 743versus high GA 7A3expression and (b) in ER-positive breast cancers with GA 743-mutant versus GA 7A3wild-type. Statistical significance was determined for (a, b) by fgsea (Sergushichev, A. A, BioRxiv, June 20, 2016).
  • Example 1 GATA3 and MDM2 are synthetic lethal in ER-positive breast cancer
  • MDM2 encodes an E3 ubiquitin ligase that inhibits the tumour suppressor p53-mediated transcriptional activation and is frequently amplified and overexpressed in human cancers, including breast.
  • MCF-7 the ER-positive breast cancer cell line
  • MCF-7 cells harbour the GA TA3 frameshift mutation p.D335Gfs (Barretina, J. et al. Nature 483, 603-607, 2012), a loss-of-function mutation that has been recurrently observed in breast cancer patients, and leads to a truncated GAT A3 protein.
  • MDM2 siRNA titration analysis showed that the vulnerability induced by MDM2 inhibition in MCF-7 cells was dose- dependent and that 50% reduction in MDM2 expression is sufficient to inhibit proliferation in the presence of GATA3 mutation (Fig. 5b-c).
  • MDM2 silencing was merely inhibiting cell growth or was inducing cell death
  • the authors assessed apoptosis using Annexin V and propidium iodide co-staining followed by flow cytometry analysis. They observed that MDM2 silencing significantly induced apoptosis in MCF-7 cells in a dose-dependent manner (Fig. 1g and Fig. 5d).
  • dua ⁇ -GATA3/MDM2 silencing in BT-474 and MDA-MB134 cells led to 15-20% higher proportion of apoptotic cells than the silencing of the two genes individually (Fig. 1 g), indicating that dual inhibition induced increased apoptosis.
  • the authors results provide evidence that MDM2 is a selected vulnerability in breast cancer with GAL43-mutant and/or loss of GAT A3.
  • MDM2 plays a central role in the regulation of p53 and they regulate each other in a complex regulatory feedback loop.
  • GATA3 and TP53 mutations are mutually exclusive (Fig. 1h).
  • the authors therefore, hypothesized that the synthetic lethal effects between GATA3 and MDM2 may be p53-dependent.
  • idasanutlin was inducing the canonical apoptotic cascade, they assessed the expression of p53, Bax and Bcl-2, together with the canonical markers of apoptosis PARP and cleaved PARP, by immunoblot at 6, 12 and 24 hours post-treatment. Idasanutlin induced an early upregulation of p53 and MDM2 proteins, together with the up- and down-regulation of pro- and anti-apoptotic proteins, respectively (Fig. 2c), leading to the activation of the apoptotic cascade. TP53 silencing partially reverted the effects of idasanutlin treatment on cell growth and apoptosis (Fig. 9).
  • tumour cells present in the fish were quantified by performing FACS analysis of the fluorescence-labelled tumour cells in whole fish extracts. Consistent with the results from the tumour formation assay, idasanutlin treatment was only effective in reducing the overall percentage of tumour cells in fish injected with GATA3- silenced cells (purple vs DMSO-treated in blue) but not in fish injected with control cells (yellow vs DMSO-treated in black, Fig. 3d), indicating that GATA3 expression level modulates sensitivity to MDM2 inhibition in vivo.
  • the zebrafish xenograft model provides insights into the tumourigenic and proliferative capability of cancer cells.
  • the authors employed the chicken chorioallantoic membrane (CAM), a densely vascularized, extraembryonic tissue, as a second in vivo mode .
  • CAM chicken chorioallantoic membrane
  • idasanutlin treatment reduced the volume of tumours formed by GAL43-silenced cells (purple vs DMSO-treated in blue) but not in control cells (yellow vs DMSO-treated in black, Fig, 3f-g), suggesting that GAT A3 expression modulates response to MDM2 inhibitors in the CAM model as well.
  • the authors then evaluated apoptosis induction by staining tumour sections with the apoptotic marker cleaved caspase 3.
  • Example 4 The synthetic lethality between GATA3 and MDM2 acts via the PI3K-Akt-mTOR sipnalinp pathway
  • RNA- sequencing analysis of the /WD/W2-silenced MCF-7 cells and dual GATA3/MDM2-sWerced MDA- MB134 cells revealed 20 commonly dysregulated pathways (Fig. 4a).
  • p53 related pathways and apoptosis were significantly up-regulated in both cell lines, while many proliferation- related pathways such as E2F and MYC targets were down-regulated (Fig. 4b).
  • the mTORCI signalling pathway was among the most significantly down-regulated pathways in both cell lines.
  • MDM2 silencing in the GA 743-mutant MCF7 cells reduced phospho-Akt, phospho-S6, as well as phospho-GSl ⁇ , compared to control cells (Fig. 4c and Fig. 11), indicating the downregulation of the mTOR pathway.
  • dual GATA3/MDM2 silencing reduced levels of phospho-Akt, phospho-S6 and phospho-GSl ⁇ and induced apoptosis (Fig. 4d and Fig. 11a).
  • phospho-Akt levels were higher when only GATA3 was silenced.
  • ER-positive breast cancer-derived cell lines MCF-7 ( GATA3 mutant p.D335Gfs; TP53 wild-type), BT-474 (GATA3 wild-type, TP53 mutant p.E285K with retained transactivation activity (Jordan, J. J. et al. Mol. Cancer Res. 8, 701-716, 2010)), MDA-MB-134 (GATA3 wild-type; TP53 wild-type) and T47D (GATA3 wild-type, TP53 mutant p.L194F) authenticated by short tandem repeat profiling. All the cells were monitored regularly for mycoplasma contamination by PCR using specific primers as previously described (Geyer, F. C. et al. Nat. Commun.
  • All cell lines were maintained under the condition as recommended by the provider. Briefly, all cell lines were culture in DMEM supplemented with 5% Fetal Bovine Serum (FBS), non-essential amino-acids (NEAA) and antibiotics (Penicillin/Streptomycin). The cells were incubated at 37°C in a humidified atmosphere containing 5% C02. Exponentially growing cells were used for all in vitro and in vivo studies.
  • FBS Fetal Bovine Serum
  • NEAA non-essential amino-acids
  • antibiotics Penicillin/Streptomycin
  • ON-TARGET plus siRNA transfection was conducted using ON-TARGET plus siRNA transfection.
  • ON- TARGET plus SMARTpool siRNAs against human GATA3 (Dharmacon, CO; #L-003781-00- 0005), MDM2 (Dharmacon, CO; #L-003279-00-0005), TP53 (Dharmacon, CO; # L-009625-00- 0005), ON-TARGET plus SMARTpool non-targeting control and DharmaFECT transfection reagent (Dharmacon, CO; #T-2001-03) were all purchased from GE Dharmacon. Transfection was performed according to the manufacturer’s protocol. Briefly, log-phase ER positive breast cancer cells were seeded at approximately 60% confluence.
  • siRNAs were added to a final concentration of 25 nM. (Note: siRNAs targeting different genes can be multiplexed). Cells were incubated at 37°C in 5% C02 for 24-48-72 hours (for mRNA analysis) or for 48-72 hours (for protein analysis). To avoid cytotoxicity, transfection medium was replaced with complete medium after 24 hours.
  • GA7A3_Reverse GAGTTTCCGTAGTAGGGCGG (SEQ ID 002)
  • GAPDH28L T G G AAG AT G GTG ATG G G ATTT (SEQ ID 014)
  • Immunoblot total protein was harvested by directly lysing the cells in Co-IP lysis buffer (100 mmol/L NaCI, 50 mmol/L Tris pH 7.5, 1 mmol/L EDTA, 0.1 % Triton X-100) supplemented with 1x protease inhibitors (complete TM , Mini, EDTA-free Protease Inhibitor Cocktail, Roche, CO; #4693159001) and 1x phosphatase inhibitors (PhosSTOP, CO; #4906845001).
  • Co-IP lysis buffer 100 mmol/L NaCI, 50 mmol/L Tris pH 7.5, 1 mmol/L EDTA, 0.1 % Triton X-100
  • 1x protease inhibitors complete TM , Mini, EDTA-free Protease Inhibitor Cocktail, Roche, CO; #4693159001
  • PhosSTOP 1x phosphatase inhibitors
  • xCELLigence system RTCA, ACEA Biosciences, San Diego, CA, USA
  • Background impedance of the xCELLigence system was measured for 12 s using 50 pi of room temperature cell culture media in each well of E-plate 16.
  • Cells were grown and expanded in tissue culture flasks as previously described (Andreozzi, M. et al. Neoplasia 18, 724-731 , 2016). After reaching 75% confluence, the cells were washed with PBS and detached from the flasks using a short treatment with trypsin/EDTA.
  • Cells were collected 72 hours post siRNA transfection and 48 hours post treatment with RG7388 respectively, stained with annexin V (Annexin V, FITC conjugate; Invitrogen, CO; #V13242) and propidium iodide (PI; Invitrogen, CO; #V13242), and analyzed by flow cytometry using the BD FACSCanto II cytometer (BD Biosciences, USA). Briefly, cells were harvested after incubation period and washed twice by centrifugation (1 ,200 g, 5 min) in cold phosphate-buffered saline (DPBS; Gibco, CO; #14040133).
  • DPBS cold phosphate-buffered saline
  • AnnV binding buffer 1X (ABB 5X, Invitrogen, CO; #V13242; 50 mM HEPES, 700 mM NaCI, and 12.5 mM CaCI2 at pH 7.4) containing fluorochrome-conjugated AnnV and PI (PI to a final concentration of 1 ug/mL) and incubated in darkness at room temperature for 15 min. As soon as possible cells were analyzed by flow cytometry, measuring the fluorescence emission at 530 nm and >575 nm. All experiments were performed in triplicate. Data were analyzed by FlowJo software version 10.5.3.
  • GATA3 silenced and control BT-474 cells were pre-treated for 24 hours with idasanutlin (25 mM). After harvesting, the cells were labeled with a lipophilic red fluorescent dye (CellTrackerTM CM-Dil #07000; Life Technologies, Darmstadt, Germany), according to the manufacturer's instructions. Wild-type zebrafish were maintained, collected, grown and staged in E3 medium at 28.5°C according to standard protocols.
  • zebrafish embryos were anesthetized in 0.4% tricaine (Sigma) at 48 hours post fertilization (hpf) and 200 control or GATA3 silenced BT-474 cells were mi era- injected into the vessel-free area of the yolk sac. After injection, embryos were incubated for 1 hr at 28.5-29°C for recovery and cell transfer verified by fluorescence microscopy. Embryos were examined for the presence of a fluorescent cell mass localized at the injection site in the yolk sac or hindbrain ventricle. Fish harbouring red cells were incubated at 35°C as described previously. (Konantz, M. et al. Zebrafish xenografts as a too!
  • Fertilized chicken eggs were obtained from Gepro Gefliigelzucht AG at day 1 of gestation and were maintained at 37°C in a humidified (60%) incubator for 10 days (Zijlstra, A. et al. Cancer Res. 62, 7083-7092, 2002).
  • an artificial air sac was formed using the following procedure: a small hole was drilled through the eggshell into the air sac and a second hole near the allantoic vein that penetrates the eggshell membrane. A mild vacuum was applied to the hole over the air sac in order to drop the CAM. Subsequently, a square 1cm window encompassing the hole near the allantoic vein was cut to expose the underlying CAM (Zijlstra, A. et al.
  • BT-474 cells growing in tissue culture were inoculated on CAMs at 2x10cells per CAM, on three to four CAMs each. Specifically, 48 hrs post-siRNA transfection, GATA3- silenced and control BT-474 cells were treated with idasanutlin (25mM). 24 hrs post-treatment, cells were detached from the culture dish with Trypsin, counted, suspended in 20pl of medium (DMEM) and mixed with an equal volume of Matrigel.
  • DMEM medium
  • a 8mm (inner diameter) sterile teflon ring (removed from 1 8ml freezing vials, Nunc, Denmark) was placed on the CAMs and the final mixture was grafted onto the chorioallantoic membranes inoculating the cells with a pipette inside the ring (Kim, J., Yu, W et al. Cell 94, 353-362,1998).
  • Embryos were maintained at 37 °C for 4 days after which tumors at the site of inoculation were excised using surgical forceps. Images of each tumor were acquired with a Canon EOS 1100D digital camera.
  • Tumors were fixed in 10% Paraformaldehyde (PFA) immediately after excision from the CAM. PFA-fixed and paraffin-embedded tumors were cut as 3.5pm thick sections. Hematoxylin and eosin (H&E) staining was performed according to standard protocols. Tissue sections were rehydrated and immunohistochemical staining was performed on a BOND-MAX immunohistochemistry robot (Leica Biosystems) with BOND polymer refine detection solution for DAB, using anti-GATA3, cleaved caspase 3, phospho-Akt or phospho-S6 primary antibodies as substrate. Photomicrographs of the tumors were acquired using an Olympus BX46 microscope. All stained sections were evaluated blindly by two independent pathologists.
  • PFA Paraformaldehyde
  • RNA integrity was measured using the Agilent Bioanalyzer 2100 (Agilent Technologies).
  • RNA sequencing was performed using the TruSeq Stranded mRNA (lllumina). Paired-end RNA sequencing was performed on the lllumina NovaSeq 6000 platform using the 2x100bp protocol according to the manufacturer's guidelines. Reads were aligned to the GRCh37 human reference genome using STAR 2.7.1 (Dobin, A. et al. Bioinformatics 29, 15-21 , 2013), and transcript quantification was performed using RSEM 1 .3.2 (Li, B. & Dewey, C. N. BMC Bioinformatics vol. 12, 2011 ). Genes without at least 10 assigned reads in at least 2 samples were discarded. Counts were normalized using the median of ratios method from the DESeq2 package (Love, M.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to MDM2 modulators in treatment of ER+ breast cancer characterized by decreased or abrogated function of GATA3.

Description

MDM2 INHIBITOR RESPONSE PREDICTION METHOD
The present invention relates to MDM2 modulators in treatment of cancer characterized by decreased or abrogated function of GAT A3.
Background of the Invention
GAT A3 is one of the most frequently mutated genes in estrogen receptor (ER)-positive breast cancers and can be found mutated in 12% and 18% of primary and metastatic ER-positive breast cancers, respectively. GAT A3 is a zinc-finger transcription factor with key functions in mammary epithelial cell differentiation. In the context of breast cancer, GAT A3 suppresses epithelial-to- mesenchymal transition and acts as a pioneer factor during this process by recruiting others cofactors such as ERa and FOXA1 . GAT A3 expression is strongly associated with ERa expression in breast cancer, and the loss of GAT A3 expression, via GA TA3 somatic genetic alterations or other mechanisms, has been linked to poor prognosis in breast cancer patients. Importantly, targeted therapies directed at GAT A3 deficiency are not available.
Based on the above-mentioned state of the art, the objective of the present invention is to provide means and methods to treat cancer characterized by decreased or abrogated function of GAT A3. This objective is attained by the subject-matter of the independent claims of the present specification.
Summary of the Invention
A first aspect of the invention relates to an agent (a pharmaceutical drug compound) for use in treatment of a neoplasm, particularly a malignant neoplasm, wherein said neoplasm is characterized by decreased or abrogated function of GAT A3. That agent is selected from: a. a nucleic acid biopolymer capable of specifically suppressing expression of MDM2; b. an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight <700 Da, c. a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight <700 Da, or d. a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist of that interaction.
A second aspect of the invention relates to a method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein
• an expression and/or an enzymatic activity of GATA3 is determined in a sample of a neoplasm isolated from said patient and • a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is a. characterized by low expression of GAT A3 or lack of expression of GAT A3; and/or b. characterized by expression of a non-active GATA3 variant; and/or c. characterized by the presence of somatic genetic alterations in the GATA3 gene, particularly a mutation, a copy number alteration or a genomic rearrangement; particularly wherein the MDM2 modulator is selected from
- a nucleic acid biopolymer capable of specifically suppressing expression of MDM2;
- an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight <700 Da,
- a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight <700 Da, or
- a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist.
Likewise, the invention encompasses a system for determining the GAT A3 status of a patient as a basis for making the assessment of likelihood of MDM2 modulator treatment response.
A third aspect of the invention relates to the agent for use in treatment or prevention of a neoplasm, particularly a malignant neoplasm, according to the first aspect, wherein a high likelihood of responding to MDM2 modulator treatment is assigned to said patient according to the method of the second aspect.
In another embodiment, the present invention relates to a pharmaceutical composition comprising at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, diluent or excipient for use in treatment of a neoplasm.
Brief Description of the Figures
Fig. 1 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
Fig. 2 GAT A3 status determines response to MDM2 inhibitors in vitro.
Fig. 3 GAT A3 expression determines response to MDM2 inhibitor in vivo.
Fig. 4 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
Fig. 5 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
Fig. 6. GATA3 and MDM2 are synthetic lethal ER-positive breast cancer. Fig. 7 GATA3 and MDM2 are synthetic lethal ER-positive breast cancer.
Fig. 8 GAT A3 status determines response to MDM2 inhibitors in vitro.
Fig. 9 GAT A3 status determines response to MDM2 inhibitors in vitro.
Fig. 10 GAT A3 expression determines response to MDM2 inhibitor in vivo.
Fig. 11 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
Fig. 12 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
Fig. 13 The synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
Detailed Description of the Invention Terms and definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.) and chemical methods.
The term MDM2 in the context of the present specification relates to the human MDM2 proto oncogene, also known as the homolog of the mouse double minute 2, encoding for the E3 ubiquitin- protein ligase Mdm2.
The term GATA3 in the context of the present specification relates to the human gene GATA binding protein 3, encoding for the protein product Trans-activating-T-cell-specific transcription factor GAT A3.
The TP53 in the context of the present specification relates to the human tumor suppressor gene Tumor Protein p53 (TP53), encoding for the protein product cellular tumor antigen p53.
The terms gene expression or expression, or alternatively the term gene product, may refer to either of, or both of, the processes - and products thereof - of generation of nucleic acids (RNA) or the generation of a peptide or polypeptide, also referred to transcription and translation, respectively, or any of the intermediate processes that regulate the processing of genetic information to yield polypeptide products. The term gene expression may also be applied to the transcription and processing of a RNA gene product, for example a regulatory RNA or a structural (e.g. ribosomal) RNA. If an expressed polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. Expression may be assayed both on the level of transcription and translation, in other words mRNA and/or protein product. The term variant refers to a polypeptide that differs from a reference polypeptide, but retains essential properties. A typical variant of a polypeptide differs in its primary amino acid sequence from another, reference polypeptide. Differences may be limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. Truncated variants refer to more substantial differences between the variant polypeptide and the reference polypeptide, such as a shorter version of the polypeptide is translated and an entire protein domain can be lost (e.g. DNA binding domain). A variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and/or deletions). A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. A non-active variant is a polypeptide, which does not retain the physiological function of the reference polypeptide inside a cell.
The term siRNA (small/short interfering RNA) in the context of the present specification relates to an RNA molecule capable of interfering with the expression (in other words: inhibiting or preventing the expression) of a gene comprising a nucleic acid sequence complementary or hybridizing to the sequence of the siRNA in a process termed RNA interference. The term siRNA is meant to encompass both single stranded siRNA and double stranded siRNA. siRNA is usually characterized by a length of 17-24 nucleotides. Double stranded siRNA can be derived from longer double stranded RNA molecules (dsRNA). According to prevailing theory, the longer dsRNA is cleaved by an endo-ribonuclease (called Dicer) to form double stranded siRNA. In a nucleoprotein complex (called RISC), the double stranded siRNA is unwound to form single stranded siRNA. RNA interference often works via binding of an siRNA molecule to the mRNA molecule having a complementary sequence, resulting in degradation of the mRNA. RNA interference is also possible by binding of an siRNA molecule to an intronic sequence of a pre-mRNA (an immature, non-spliced mRNA) within the nucleus of a cell, resulting in degradation of the pre-mRNA.
The term shRNA (small hairpin RNA) in the context of the present specification relates to an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
The term sgRNA (single guide RNA) in the context of the present specification relates to an RNA molecule capable of sequence-specific repression of gene expression via the CRISPR (clustered regularly interspaced short palindromic repeats) mechanism.
The term miRNA (microRNA) in the context of the present specification relates to a small non coding RNA molecule (containing about 22 nucleotides) that functions in RNA silencing and post- transcriptional regulation of gene expression.
The term Nucleotides in the context of the present specification relates to nucleic acid or nucleic acid analogue building blocks, oligomers of which are capable of forming selective hybrids with RNA or DNA oligomers on the basis of base pairing. The term nucleotides in this context includes the classic ribonucleotide building blocks adenosine, guanosine, uridine (and ribosylthymine), cytidine, the classic deoxyribonucleotides deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine. It further includes analogues of nucleic acids such as phosphotioates, 2’0-methylphosphothioates, peptide nucleic acids (PNA; N-(2-aminoethyl)-glycine units linked by peptide linkage, with the nucleobase attached to the alpha-carbon of the glycine) or locked nucleic acids (LNA; 2Ό, 4’C methylene bridged RNA building blocks). Wherever reference is made herein to a hybridizing sequence, such hybridizing sequence may be composed of any of the above nucleotides, or mixtures thereof.
The term antisense oligonucleotide in the context of the present specification relates to an oligonucleotide having a sequence substantially complimentary to, and capable of hybridizing to, an RNA. Antisense action on such RNA will lead to modulation, particular inhibition or suppression of the RNA’s biological effect. If the RNA is an mRNA, expression of the resulting gene product is inhibited or suppressed. Antisense oligonucleotides can consist of DNA, RNA, nucleotide analogues and/or mixtures thereof. The skilled person is aware of a variety of commercial and noncommercial sources for computation of a theoretically optimal antisense sequence to a given target. Optimization can be performed both in terms of nucleobase sequence and in terms of backbone (ribo, deoxyribo, analogue) composition. Many sources exist for delivery of the actual physical oligonucleotide, which generally is synthesized by solid state synthesis.
The term specific binding in the context of the present invention refers to a property of ligands that bind to their target with a certain affinity and target specificity. The affinity of such a ligand is indicated by the dissociation constant of the ligand. A specifically reactive ligand has a dissociation constant of < 107mol/L when binding to its target, but a dissociation constant at least three orders of magnitude higher in its interaction with a molecule having a globally similar chemical composition as the target, but a different three-dimensional structure.
A polymer of a given group of monomers is a homopolymer (made up of a multiple of the same monomer); a copolymer of a given selection of monomers is a heteropolymer constituted by monomers of at least two of the group.
As used herein, the term pharmaceutical composition refers to a compound of the invention, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical composition according to the invention is provided in a form suitable for topical, parenteral or injectable administration.
As used herein, the term pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (for example, antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington: the Science and Practice of Pharmacy, ISBN 0857110624).
As used herein, the term treating or treatment of any disease or disorder (e.g. cancer) refers in one embodiment, to ameliorating the disease or disorder (e.g. slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another embodiment, "treating" or "treatment" refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. Methods for assessing treatment and/or prevention of disease are generally known in the art, unless specifically described hereinbelow.
A first aspect of the invention relates to an agent for use in treatment of a neoplasm, particularly a malignant neoplasm, wherein said neoplasm is characterized by decreased or abrogated function of GAT A3 (particularly a non-functional GATA3 mutant or lack of expression of GAT A3).
In certain embodiments of this first aspect of the invention, the agent is a nucleic acid biopolymer capable of specifically suppressing expression of MDM2. Such nucleic acid biopolymer can be, for example, an antisense oligonucleotide designed to specifically bind to MDM2 mRNA and inhibit expression of its message.
In certain embodiments of this first aspect of the invention, the agent is an MDM2 specific inhibitor, particularly an MDM2 inhibitor pharmaceutical drug molecule characterized by a molecular weight <700 Da.
In certain embodiments of this first aspect of the invention, the agent is a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight <700 Da.
In yet other certain embodiments of this first aspect of the invention, the agent is a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist of such interaction, wherein said agent is able to reduce the amount of functional MDM2 inside a cell.
In certain embodiments, the decreased or abrogated function of GATA3 is determined via sequencing of the GATA3 gene, quantification of GATA3 mRNA, particularly quantification via qRT- PCR, or evaluation of GAT A3 protein expression, particularly by immunohistochemistry. Mutations in the GATA3 gene affecting residues essential for GAT A3 function or frameshift mutations leading to a truncated GAT A3 may be detected via sequencing of the GATA3 gene.
In certain embodiments, the nucleic acid biopolymer capable of specifically suppressing expression of MDM2 is selected from an siRNA, an miRNA, an antisense oligonucleotide, an shRNA, and an sgRNA.
In certain embodiments, the MDM2 specific inhibitor is selected from MEL23 and MEL24. MEL23
Figure imgf000007_0001
( ) and MEL24 ( ) are described in detail in Herman et al.
(Cancer discovery 2011 . 1(4); 312-25.). In certain embodiments, the specific modulator of the MDM2-p53 interaction is a nutlin. A nutlin is a small molecule, a c/s-imidazole analogue, which occupies the p53 binding pocket of MDM2. The nutlin thereby disrupts the MDM2-p53 interaction and this leads to stabilization of p53. Any nutlin is encompassed by the present invention.
In certain embodiments, the specific modulator of the MDM2-p53 interaction is selected from HLI373, NSC 66811 , Nutlin-3, Nutlin-3a, RITA, SKPin C1 , SMER 3, SP141 , SZL P1-41 , TAME hydrochloride, Thalidomide, VH 298, YH 239-EE, proTAME, Lenalidomide, MZ 1 , TL 12-186, cis MZ 1 , dBET1 , AT 1 , NSC 66811 , HLI 373, NAB 2, GS 143, cis VH 298, CM 11 , CMP 98, TL 13-27, Idisulam, Indasanutlin, CRBN-6-5-5-VHL, RITA NSC 652287, Tenovin-1 , AT 406 (SM-406), Avadomide (CC-122), NSC 207895, JNJ-26854165 (Serdemetan), lberdomide(CC220), CGM097, HDM201 , SAR405838, RG7112, MI-77301 , MI-888, MK-8242, AMG232, DS3032b, ALRN-6924 and idasanutlin (RG7388).
In certain embodiments, the specific modulator of the MDM2-p53 interaction is idasanutlin.
In certain embodiments, the peptide specifically modulating the MDM2-p53 interaction is selected from ATSP-7041 , M06, SAH-p53-8, sMTide-02/02A, and ATSP-7041 .
In certain embodiments, the neoplasm is characterized by expression of functional p53.
Assay of p53 function
The assay for determining the function of p53 can be a flow-cytometry-based assay described in detail in Le Garff-Tavernier et al. (Blood Cancer J. 2011 Feb; 1 (2): e5). In brief, staining of p53 is accomplished by a fluorescent antibody and cells expressing p53 are detected using flow cytometry. Functionality of p53 inside the cell is assessed using etoposide and nutlin-3a. The so- called type 1 profile corresponds to normal p53 function, wherein baseline expression of p53 is undetectable, but with etoposide and nutlin-3a stimulation, a clear increase of p53 expression and its transcriptional target p21 at day 1 is observed.
In certain embodiments, the neoplasm is a neoplasm of breast tissue, urothelial tissue, stomach, uterus, ovaries, or lung, or the neoplasm is melanoma, or diffuse large B-cell lymphoma. For neoplasms of breast tissue, urothelial tissue, stomach, uterus, ovaries, or lung, and for melanoma, or diffuse large B-cell lymphoma, it is known from literature that GAT A3 loss-of-function may occur. In certain embodiments, the neoplasm is a neoplasm of breast tissue. In certain embodiments, the neoplasm is an estrogen receptor (ER) positive neoplasm of breast tissue.
A second aspect of the invention relates to a method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein
• an expression and/or an enzymatic activity of GATA3 is determined in a sample of a neoplasm isolated from said patient; and
• a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is a. characterized by low expression of GAT A3 or lack of expression of GAT A3; and/or b. characterized by expression of a non-active GATA3 variant; and/or c. characterized by the presence of somatic genetic alterations in the GATA3 gene, particularly a mutation, a copy number alteration or a genomic rearrangement.
In certain particular embodiments, the MDM2 modulator is selected from a. a nucleic acid biopolymer capable of specifically suppressing expression of MDM2; b. an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight <700 Da, c. a specific modulator of the MDM2-p53 interaction, particularly an inhibitor/antagonist, more particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight <700 Da, or d. a peptide specifically modulating the MDM2-p53 interaction, particularly an inhibitor/antagonist.
In the context of the present invention, low expression of GATA3 is a reduction of at least 30%, particularly at least 40%, more particularly at least 50% in relation to the amount of GAT A3 protein in healthy cells of the same tissue.
In the context of the present invention, a non-active GAT A3 variant is a GAT A3 protein with a diminished or abrogated function.
A somatic genetic alteration in the GAT A3 gene can consist of, but is not limited to a mutation, a copy number alteration and/or a genomic rearrangement. A frameshift mutation is encompassed by the term mutation. Frameshift mutations may result in truncated forms of GAT A3 that e.g. lose the DNA binding domain.
In certain embodiments, the method according to the second aspect comprises additionally the following steps:
• an expression and/or a functionality of p53 is determined in said sample of a neoplasm isolated from said patient; and
• a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is additionally characterized by expression of functional p53.
An assay for assessing the function of p53 is mentioned above.
A third aspect of the invention relates to the agent for use in treatment or prevention of a neoplasm, particularly a malignant neoplasm, according to the first aspect, wherein a high likelihood of responding to MDM2 modulator treatment is assigned to said patient according to the method of the second aspect.
MDM2 modulators (nutlins)
MDM2 modulators according to the invention include, but are not limited to, - 5-[[3-Dimethylarnino)propyl]amino]-3,10-dimethylpyrimido[4,5-b]quinoline- 2,4(3H,10H)-dione dihydrochloride (HLI373);
- 4-[[[(2R,3S,4R,5S)-3-(3-Chloro-2-fluorophenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5- (2,2-dimethylpropyl)-2-pyrrolidinyl]carbonyl]amino]-3-methoxybenzoic acid (Idasanutlin);
- 2-Methyl-7-[phenyl(phenylamino)methyl]-8-quinolinol (NSC 66811 );
- (±)-4-[4,5-S/'s(4-chlorophenyl)-2-(2-isopropoxy-4-methoxy-phenyl)-4,5-dihydro- imidazole-1 -carbonyl]-piperazin-2-one (Nutlin-3);
- 4-[[(4S,5R)-4,5-Bis(4-chlorophenyl)-4,5-dihydro-2-[4-methoxy-2-(1- methylethoxy)phenyl]-1 H- imidazol-1 -yl]carbonyl]-2-piperazinone (Nutlin-3a);
- 5,5'-(2,5-Furandiyl)b/'s-2-thiophenemethanol (RITA);
- 2-[4-Bromo-2-[[4-oxo-3-(3-pyridinylmethyl)-2-thioxo-5 thiazolidinylidene]methyl]phenoxy]acetic acid (SKPin C1);
- 9/-/-lndeno[1 ,2-e][1 ,2,5]oxadiazolo[3,4-b]pyrazin-9-one (SMER 3);
- 6-Methoxy-1-(1-naphthalenyl)-9/-/-pyrido[3,4-b]indole (SP141);
- 3-(2-Benzothiazolyl)-6-ethyl-7-hydroxy-8-(1 -piperidinylmethyl)-4/-/-1 -benzopyran-4- one (SZL P1-41);
- /V2-[(4-Methylphenyl)sulfonyl]-L-arginine methyl ester hydrochloride (TAME hydrochloride);
- /V-(2,6-dioxo-3-piperidinyl)phthalimide (Thalidomide);
- (2S,4R)-1 -((S)-2-(1 -cyanocyclopropanecarboxamido)-3,3-dimethylbutanoyl)-4- hydroxy-/V-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (VH 298);
- Ethyl 3-[2-(terf-butylamino)-1 -[/V-(4-chlorobenzyl)formamido]-2-oxoethyl]-6-chloro-1 H- indole-2-carboxylate (YH 239-EE);
- (2S)-2-[[(4-methylphenyl)sulfonyl]amino]-9,13-dioxo-14-phenyl-7-[[[[(2- phenylacetyl)oxy]methoxy]carbonyl]amino]-10,12-dioxa-6,8-diazatetradec-6-enoic acid.methylester (proTAME);
- 3-(4-Amino-1 ,3-dihydro-1-oxo-2/-/-isoindol-2-yl)-2,6-piperidinedione (Lenalidomide);
- (2S,4R)-1 -((S)-2-(tert-butyl)-17-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- /][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,16-dioxo-6,9,12-trioxa-3,15- diazaheptadecanoyl)-4-hydroxy-/V-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2- carboxamide (MZ 1);
- /V-(2-(2-(2-(4-(4-((5-Chloro-4-((2-(isopropylsulfonyl)phenyl)amino)pyrimidin-2- yl)amino)phenyl)piperazin-1-yl)ethoxy)ethoxy)ethyl)-2-((2-(2,6-dioxopiperidin-3-yl)- 1 ,3-dioxoisoindolin-4-yl)amino)acetamide (TL 12-186);
- (2S,4S)-1 -((S)-2-(tert-butyl)-17-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- /][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,16-dioxo-6,9,12-trioxa-3,15- diazaheptadecanoyl)-4-hydroxy-/V-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2- carboxamide (cis MZ 1 );
- (6S)-4-(4-Chlorophenyl)-/V-[4-[[2-[[2-(2,6-dioxo-3-piperidinyl)-2,3-dihydro-1 ,3-dioxo- 1H-isoindol-4-yl]oxy]acetyl]amino]butyl]-2,3,9-trimethyl-6/-/-thieno[3,2- f\[ 1 ,2,4]triazolo[4,3-a][1 ,4]diazepine-6-acetamide (dBET 1 );
- (2S,4R)-1-(2R)-2-Acetamido-3-[[6-[2-[(6S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H- thieno[3,2-f][1 ,2,4]triazolo[4,3-a][1 ,4]diazepin-6-yl]acetamido]hexyl]thio]-3- methylbutanoyl]-4-hydroxy-/V-[4-(4-methylthiazol-5-yl)benzyl)pyrrolidinine-2- carboxamide (AT 1 );
- 2-Methyl-7-[phenyl(phenylamino)methyl]-8-quinolinol (NSC 66811 );
- 5-[[3-Dimethylamino)propyl]amino]-3,10-dimethylpyrimido[4,5-/b]quinoline- 2,4(3H,10H)-dione dihydrochloride (HLI 373);
- /V-[(2-Chlorophenyl)methyl]-1 -(2,5-dimethylphenyl)-1 /-/-benzimidazole-5-carboxamide (NAB 2);
- 4-[4-[[5-(2-Fluorophenyl)-2-furanyl]methylene]-4,5-dihydro-5-oxo-3-(phenylmethyl)- 1/-/-pyrazol-1-yl]benzoic acid (GS 143);
- (2S,4S)-1 -((S)-2-(1 -cyanocyclopropanecarboxamido)-3,3-dimethylbutanoyl)-4- hydroxy-/V-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide ( cis VH 298);
- /Vi,/V20-bis((S)-1-((2S,4R)-4-Hydroxy-2-((4-(4-methylthiazol-5- yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)-3,6,9,12,15,18- hexaoxaicosanediamide (CM 11 );
- /Vi,/V20-bis((S)-1-((2S,4S)-4-Hydroxy-2-((4-(4-methylthiazol-5- yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)-3,6,9,12,15,18- hexaoxaicosanediamide (CMP 98);
- /V-(2-(2-(2-(4-(4-((5-Chloro-4-((2-(isopropylsulfonyl)phenyl)amino)pyrimidin-2- yl)amino)phenyl)piperazin-1-yl)ethoxy)ethoxy)ethyl)-2-((1 ,3-dioxo-2-(2-oxopiperidin-3- yl)isoindolin-4-yl)amino)acetamide (TL 13-27);
- Chloro-l H-indol-7-yl)-1 ,4-benzenedisulfonamide (Idisulam);
- 4-[[[(2R,3S,4R,5S)-3-(3-Chloro-2-fluorophenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5- (2,2-dimethylpropyl)-2-pyrrolidinyl]carbonyl]amino]-3-methoxybenzoic acid (Indasanutlin);
- (2S,4R)-1 -((2S)-2-(5-((5-((6-((2-(2,6-Dioxopiperidin-3-yl)-1 ,3-dioxoisoindolin-4- yl)amino)hexyl)oxy)pentyl)oxy)pentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-/V-(4- (4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (CRBN-6-5-5-VHL);
- 2-Thiophenemethanol, 5,5'-(2,5-furandiyl)bis- (RITA NSC 652287);
- Benzamide, N-[[[4-(acetylamino)phenyl]amino]thioxomethyl]-4-(1 ,1-dimethylethyl)- (Tenovin-1 ); - (5S,8S,10aR)-N-benzhydryl-5-((S)-2-(methylamino)propanamido)-3-(3- methylbutanoyl)-6-oxo- decahydropyrrolo[1 ,2-a][1 ,5]diazocine-8-carboxamide (AT 406 (SM-406));
- 2,6-Piperidinedione, 3-(5-amino-2-methyl-4-oxo-3(4H)-quinazolinyl)- (Avadomide (CC-122));
- 2,1 ,3-Benzoxadiazole, 4-(4-methyl-1-piperazinyl)-7-nitro-, 3-oxide (NSC 207895);
- N1-(2-(1 H-indol-3-yl)ethyl)-N4-(pyridin-4-yl)benzene-1 ,4-diamine (JNJ-26854165 (Serdemetan));
- 2,6-Piperidinedione, 3-[1 ,3-dihydro-4-[[4-(4-morpholinylmethyl)phenyl]methoxy]-1- oxo-2H-isoindol-2-yl]-, (3S)- (lberdomide(CC220)).
The skilled person is aware that any specifically mentioned drug provided for use in treatment of a neoplasm according to the invention may be present as a pharmaceutically acceptable salt of said drug. Pharmaceutically acceptable salts comprise the ionized drug and an oppositely charged counterion. Non-limiting examples of pharmaceutically acceptable anionic salt forms include acetate, benzoate, besylate, bitatrate, bromide, carbonate, chloride, citrate, edetate, edisylate, embonate, estolate, fumarate, gluceptate, gluconate, hydrobromide, hydrochloride, iodide, lactate, lactobionate, malate, maleate, mandelate, mesylate, methyl bromide, methyl sulfate, mucate, napsylate, nitrate, pamoate, phosphate, diphosphate, salicylate, disalicylate, stearate, succinate, sulfate, tartrate, tosylate, triethiodide and valerate. Non-limiting examples of pharmaceutically acceptable cationic salt forms include aluminium, benzathine, calcium, ethylene diamine, lysine, magnesium, meglumine, potassium, procaine, sodium, tromethamine and zinc.
Dosage forms may be for oral administration. Alternatively, parenteral administration may be used, such as subcutaneous, intravenous, intrahepatic or intramuscular injection forms. Optionally, a pharmaceutically acceptable carrier and/or excipient may be present.
Pharmaceutical Composition and Administration
Another aspect of the invention relates to a pharmaceutical composition for use in treatment of cancer comprising a compound of the present invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. In further embodiments, the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein.
In certain embodiments of the invention, the compound of the present invention is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to give the patient an elegant and easily handleable product.
The pharmaceutical composition can be formulated for oral administration, parenteral administration, or rectal administration. In addition, the pharmaceutical compositions of the present invention can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions). In certain embodiments, the pharmaceutical composition or combination of the present invention can be in unit dosage of about 1-1000 mg of active ingredient(s) for a subject of about 50-70 kg. The therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof, is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.
The pharmaceutical compositions of the present invention can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc. They may be produced by standard processes, for instance by conventional mixing, granulating, dissolving or lyophilizing processes. Many such procedures and methods for preparing pharmaceutical compositions are known in the art, see for example L. Lachman et al. The Theory and Practice of Industrial Pharmacy, 4th Ed, 2013 (ISBN 8123922892).
Wherever alternatives for single separable features such as, for example, a ligand type or a medical indication are laid out herein as “embodiments”, it is to be understood that such alternatives may be combined freely to form discrete embodiments of the invention disclosed herein. Thus, any of the alternative embodiments for a ligand type may be combined with any of the alternative embodiments of a medical indication mentioned herein.
The invention is further illustrated by the following examples and figures, from which further embodiments and advantages can be drawn. These examples are meant to illustrate the invention but not to limit its scope.
Description of the Figures
Fig. 1 (a) Schematic representation of the project DRIVE shRNA screening data used to identify synthetic lethal interactors of GATA3. (b) SLIdR-derived statistical significance (- log10(P)) plotted against the difference in the mean viability scores between GATA3- mutant and GA 743-wild type breast cancer cell lines for each gene knocked-down in the shRNA screen. Middle lines of the boxplots indicate medians. Box limits are first and third quartiles. The whiskers extend to the range (c) Viability scores of MDM2 knock down in GA 7A3-mutant and GA 743-wild type cell lines (d-f) Proliferation kinetics of (d) GA 743-mutant MCF-7 cells transfected with siRNA targeting MDM2 (gray) or control (black), (e) GA 743-wild type BT-474 cells and (f) GA 743-wild type MDA-MB134 cells transfected with siRNA targeting GAT A3 (blue), MDM2 (gray), GAT A3 and MDM2 (red) or siRNA control (black) (g) Apoptosis assay using Annexin V and propidium iodide co staining. From the left: gating strategy to define apoptotic (yellow) and live (blue) cells; the percentage of apoptotic and live cells upon MDM2 silencing in MCF-7 cells; upon silencing of GATA3 or MDM2 alone or in combination in BT-474 and MDA-MB134 cells (h) Doughnut chart showing GATA3 and TP53 mutations in ER-positive breast cancer patients (Hoadley, K. A. et al. Cell 173, 291 -304. e6, 2018), Pereira, B. et al. Nat. Commun. 7, 11479, 2016). (i) Proliferation kinetics of 7P53-mutant T-47D cells transfected with siRNA targeting GAT A3 (blue), MDM2 (grey), GAT A3 and MDM2 (red) or siRNA control (black) (j) Percentage of apoptotic and live cells upon silencing of GATA3 and MDM2 alone or in combination in T-47D cells. Data are mean ± s.d. (d,e,f,g,i,j) n >4 replicates. Statistical significance was determined for (d,e,f,g,i,j) by the two-tailed unpaired Student’s t-test and for (h) by one-sided Fisher's Exact.
Fig. 2 (a,d) Proliferation kinetics of (a) GA7A3-mutant MCF-7 cell line under increasing dosage of idasanutlin, (d) BT-474 cells upon GATA3 silencing and/or treatment with 12.5mM idasanutlin. (b,f) Apoptosis assay using Annexin V and propidium iodide co-staining to measure the percentage of apoptotic cells (Fig. 1g) (b) upon increasing dosage of idasanutlin in MCF-7 cells, (f) upon GATA3 silencing and treatment with 12.5mM idasanutlin in BT-474 cells. (c,g) Immunoblot showing pro- and anti-apoptotic proteins (c) at 6, 12 and 24 hours post-treatment with DMSO, 12.5mM idasanutlin and 25mM idasanutlin in MCF-7 cells, (g) at 12 and 24 hours post-treatment with DMSO or 12.5mM idasanutlin in BT-474 cells transfected with GAT A3 siRNA or control siRNA. For all the western blots, quantification is relative to the loading control (actin) and normalized to the corresponding DMSO control. Data are mean ± s.d. (a,b,d,e,f) n>3 replicates. Statistical significance was determined for (a,b,d,e,f) by the two-tailed unpaired Student’s t-test.
Fig. 3 (a) Schematic representation of the zebrafish xenotransplantation assay (b) Barplot shows the percentages of fish that harboured (grey) or did not harbour (blue) tumours upon transplantation with GAL43-silenced or control BT-474 cells pre-treated with idasanutlin or DMSO. In total, 70-100 embryos were analyzed per group over two independent experiments (c) Representative confocal images of tumour formation in zebrafish injected with fluorescent tracker-labelled BT-474 cells with GATA3 siRNA or control siRNA, pretreated with idasanutlin or DMSO. (d) FACS analysis showing the percentage of red-tracker labelled tumour cells extracted from the embryos. Error bars represent, in total, three replicates performed over two independent experiments. Each replicate represents the pooled lysate of 20-30 fish for each condition (e) Schematic illustration of the CAM assay (f) Photographs of GAL43-silenced or control BT-474 cells pre-treated with DMSO or idasanutlin implanted in CAMs and grown for 4 days post implantation. (g) Volume of tumours derived from the CAM experiment (n >10 tumours from 3 independent experiments). Values are normalized to the mean of siCTR DMSO. (h) Representative micrographs of BT-474 tumours extracted 4 days post-implantation. Tumoural cells (upper panel) were immunostained with GAT A3 (middle panel) and the apoptotic marker Cl. Caspase 3 (lower panel) in the different treatment conditions. Data are mean ± SEM (d, g) n>4 replicates. Scale bars: 500pm (c), 1cm (f) and 50 and 100pM (h). Statistical significance was determined for (b) by two-sided Fisher's Exact and for (d,g) by the two-tailed unpaired Student’s t-test.
Fig. 4 (a) Schematic representation of the RNA-seq experimental setup to identify gene expression changes induced by concurrent GATA3 loss and MDM2 inhibition. Venn diagram shows the number of pathways enriched in both MCF-7 and MDA-MB134. (b) Normalised enrichment scores of significantly up- and down-regulated pathways in both MCF-7 (blue) and MDA-MB134 (red). Size of the dots is proportional to the adjusted p- value as indicated in the legend. (c,d) Immunoblot showing markers of mTOR signalling pathway activation at 24, 48 and 72 hours post-siRNA transfection in (c) MCF-7 cells upon MDM2 silencing and (d) BT-474 cells upon GATA3 and/or MDM2 silencing (e) Representative immunohistochemistry micrographs of phospho-S6 stainings in BT-474 tumours extracted 4 days post-implantation in the CAM model (f) Schematic representation of the mechanistic hypothesis. Scale bar (e) 50 and 100pM. Statistical significance was determined for (b) by fgsea (Sergushichev, A. A, BioRxiv, June 20, 2016).
Fig. 5 (a) Immunoblot showing GA7A3-mutant, GATA3-w\\d type and MDM2 protein level of expression in MCF-7 cells at 72 hours post-siRNA transfection (upper panel). MDM2 mRNA level of expression (relative expression to GAPDH) in MCF-7 cells at 24, 48 and 72 hours post-siRNA transfection (bottom panel) (b) Immunoblot showing MDM2 protein level of expression at 72 hours post-siRNA transfection (upper panel) and MDM2 mRNA levels at 48 hours post-siRNA transfection (bottom panel) after transfection with different concentrations of siRNA (6.25nM, 12.5nM or 25nM) in MCF-7 cells (c) Proliferation kinetics of MCF-7 cells transfected with MDM2 siRNA at different concentrations (d) Flow cytometry analysis of Annexin V and propidium iodide co-staining to measure the percentage of apoptotic cells (AnnV+) and live cells (AnnV-/PI-) upon MDM2 silencing with different concentrations of siRNA in MCF-7 cells. Data are mean ± s.d. (a,b,c,d) n>2 replicates. Statistical significance was determined for (a,b,c,d) by the two-tailed unpaired Student’s t-test.
Fig. 6 (a,b) MDM2 and GATA3 mRNA level of expression (relative expression to GAPDH) in (a)
BT-474 and (b) MDA-MB134 cells at 24, 48 and 72 hours post-siRNA transfection (left panel). Immunoblot showing MDM2 and GATA3 protein level of expression in (a) BT-474 and (b) MDA-MB134 cells 72 hours post-siRNA transfection (right panel). Data are mean ± s.d. (a, b) n >2 replicates. Statistical significance was determined for (a,b) by the two- tailed unpaired Student’s t-test. Fig. 7 (a) MDM2 and GATA3 imRNA level of expression (relative expression to GAPDH) in T-
47D at 24, 48 and 72 hours post siRNA transfection (left panel). Immunoblot showing MDM2 and GATA3 protein level of expression in T-47D cells 72 hours post-siRNA transfection (right panel) (b) MDM2 and TP53 imRNA level of expression (relative to expression of GAPDH) in MCF-7 cells 48 hours post-siRNA transfection (left panel). Immunoblot showing MDM2 and p53 protein level of expression in MCF-7 cells 72 hours post-siRNA transfection (right panel) (c) Proliferation kinetics of GA 7A3-mutant MCF-7 cells transfected with siRNA targeting MDM2 (grey), TP53 (yellow), TP53 and MDM2 (red) or siRNA control (black) (d) Flow cytometry analysis of Annexin V and propidium iodide co-staining to measure the percentage of apoptotic cells (AnnV+) and live cells (AnnV- /PI-) upon silencing of MDM2 and TP53 alone or in combination in MCF-7 cells. Data are mean ± s.d. (a,b,c,d) n>2 replicates. Statistical significance was determined for (a,b,c,d) by the two-tailed unpaired Student’s t-test.
Fig. 8 (a) Log-dose response curve of idasanutlin in MCF-7 cells (b) Effect of GATA3 silencing on proliferation upon treatment with DMSO or idasanutlin 12.5 mM in MDA-MB134 cells (c) log-dose response curve of Idasanutlin in MDA-MB134 cells transfected with control siRNA or GAT A3 siRNA. (e) Percentage of apoptotic cells upon GAT A3 silencing and Idasanutlin treatment (12.5 pM) in MDA-MB134 cells (e) Immunoblot showing pro- and anti-apoptotic proteins at 12 and 24 hours post-treatment with DMSO or Idasanutlin 12.5 pM in MDA-MB134 cells transfected with control siRNAs or GAT A3 siRNAs. For all the western blots, quantification is relative to the loading control (actin) and normalized to the corresponding DMSO control. Data are mean ± s.d. (a,b,c,d,e,g) n>3 replicates. Statistical significance was determined for (c,e,g) by the two-tailed unpaired Student’s t- test.
Fig. 9 (a) Effect of TP53 silencing on proliferation upon treatment with idasanutlin (12.5 pM) or
DMSO in MCF-7 cells (b) Percentage of apoptotic and live cells upon TP53 silencing and idasanutlin treatment (12.5 pM) in MCF-7 cells (c) Immunoblot showing MDM2 and p53 protein levels 24 hours post-treatment with DMSO or idasanutlin (12.5 pM) in MCF-7 cells transfected with control siRNAs or TP53 siRNAs. (d) mRNAs levels of BCL2 and BA in control and 7P53-silenced MCF-7 cells at 12 and 24 hours post-treatment. Data are mean ± s.d. (a,b,d) n>3 replicates. Statistical significance was determined for (a,b,d) by the two-tailed unpaired Student’s t-test.
Fig. 10 Representative micrographs of BT-474 tumours extracted 4 days post-implantation. Tumoural cells (hematoxylin/eosin; upper panel) were immunostained with the apoptotic marker Cl. Caspase 3 (lower panel) in the different treatment conditions. Scale bars 100 and 50pM. Fig. 11 (a) Immunoblot showing MDM2 protein expression in MCF-7 (left) and MDM2, GAT A3, p53, PARP and cleaved PARP protein expression in BT-474 cells (right) (b) Immunoblot showing markers of mTOR signalling pathway activation at 48 hours post siRNA transfection and 24 hours post-treatment with DMSO or Idasanutlin in BT-474 cells. Note that this immunoblot was performed using the same membrane as the immunoblot for 24hrs in Fig. 2g. (c) Representative immunohistochemistry phospho-Akt staining in BT- 474 tumours extracted 4 days post-implantation. For all the western blots, quantification is relative to the loading control (actin) and normalized to the corresponding siCTR control or DMSO control. Scale bars 100 and 50mM.
Fig. 12 Doughnut charts showing the mutual exclusivity between GATA3 and PI3KCA (a) and GAT A3 and PTEN (b) genetic alterations in ER-positive breast cancer patients. Statistical significance was determined for (a, b) by one-sided Fisher's Exact.
Fig. 13 Normalised enrichment scores of significantly up- and down-regulated pathways identified by gene set enrichment analysis (a) in ER-positive breast cancers with low GA 743versus high GA 7A3expression and (b) in ER-positive breast cancers with GA 743-mutant versus GA 7A3wild-type. Statistical significance was determined for (a, b) by fgsea (Sergushichev, A. A, BioRxiv, June 20, 2016).
Example 1: GATA3 and MDM2 are synthetic lethal in ER-positive breast cancer
To identify synthetically lethal vulnerabilities of GATA3 in breast cancer, the authors analysed the breast cancer cell line (n=22) data from the large-scale, deep RNAi screen project DRIVE (McDonald, E. R., 3rd et al. Cell 170, 577-592. e10, 2017) (Fig. 1a) using our recently developed SLIdR (Synthetic Lethal Identification in R) algorithm (Srivatsa, S. etal. BioRxiv, 2019). SLIdR uses rank-based statistical tests to compare the viability scores for each gene knock-down between the GA 743-mutant and GA 743-wild type cell lines and identified MDM2 as the top gene whose knock down significantly reduced cell viability in the two GA 743-mutant breast cancer cell lines (Fig. 1b- c). MDM2 encodes an E3 ubiquitin ligase that inhibits the tumour suppressor p53-mediated transcriptional activation and is frequently amplified and overexpressed in human cancers, including breast.
The authors first sought to validate the predicted synthetic lethality between GAT A3 and MDM2 in the ER-positive breast cancer cell line MCF-7, one of the two GA 743-mutant cell lines used in the RNAi screen (McDonald, E. R., 3rd et al. Cell 170, 577-592. e10, 2017). MCF-7 cells harbour the GA TA3 frameshift mutation p.D335Gfs (Barretina, J. et al. Nature 483, 603-607, 2012), a loss-of-function mutation that has been recurrently observed in breast cancer patients, and leads to a truncated GAT A3 protein. Using a siRNA approach, we confirmed that silencing MDM2 significantly reduced cell proliferation in MCF-7 cells (Fig. 1d and Fig. 5a). MDM2 siRNA titration analysis showed that the vulnerability induced by MDM2 inhibition in MCF-7 cells was dose- dependent and that 50% reduction in MDM2 expression is sufficient to inhibit proliferation in the presence of GATA3 mutation (Fig. 5b-c).
To confirm that the effect of MDM2 silencing is unequivocally related to GAT A3 loss of function and to exclude any gain-of-function effects of the GATA3 mutation, the authors assessed the changes in cell proliferation upon single- and dual-silencing of GATA3 and MDM2 using siRNA in two ER- positive GATA3-w\\d type breast cancer cell lines, the luminal A cell line MDA-MB134 and the luminal B cell line BT-474 (Fig. 6). Consistent with the oncosuppressor role of GATA3 in breast cancer, silencing GATA3 led to a significant increase in cell proliferation in both BT-474 and MDA- MB134 (Fig. 1e-f). By contrast, dual-silencing of GATA3 and MDM2 significantly reduced cell proliferation compared to cells transfected with control siRNA, GATA3 siRNA or MDM2 siRNA alone (Fig. 1e-f).
To determine if MDM2 silencing was merely inhibiting cell growth or was inducing cell death, the authors assessed apoptosis using Annexin V and propidium iodide co-staining followed by flow cytometry analysis. They observed that MDM2 silencing significantly induced apoptosis in MCF-7 cells in a dose-dependent manner (Fig. 1g and Fig. 5d). Similarly, dua\-GATA3/MDM2 silencing in BT-474 and MDA-MB134 cells led to 15-20% higher proportion of apoptotic cells than the silencing of the two genes individually (Fig. 1 g), indicating that dual inhibition induced increased apoptosis. The authors results provide evidence that MDM2 is a selected vulnerability in breast cancer with GAL43-mutant and/or loss of GAT A3.
MDM2 plays a central role in the regulation of p53 and they regulate each other in a complex regulatory feedback loop. In ER-positive breast cancer, GATA3 and TP53 mutations are mutually exclusive (Fig. 1h). The authors, therefore, hypothesized that the synthetic lethal effects between GATA3 and MDM2 may be p53-dependent. To test this hypothesis, they assessed cell growth and apoptosis in the ER-positive, GAL43-wild-type, 7P53-mutant (p.L194F) T-47D breast cancer cell line. Consistent with the mutual exclusivity of GATA3 and TP53 mutations in patients, GAT A3 silencing in a 7P53-mutant context resulted in a strong reduction of cell viability and induction of apoptosis (Fig. 1 i-j, Fig. 7a). Contrary to the results obtained in cells with functional p53, GATA3IMDM2 dual silencing did not show synthetic lethal effect (Fig. 1i). The authors further observed no difference in terms of apoptosis between single GAT A3 knock-down and GATA3/MDM2 dual knock-down (Fig. 1j). If the synthetic lethal interaction between GATA3 and MDM2 is TP53- dependent, one should expect that silencing TP53 should partially revert the phenotype. Therefore we silenced MDM2 alone or in combination with TP53 in the GA7A3-mutant MCF-7 cell line. As expected, TP53 silencing partially rescued the effect induced by MDM2 knock down (Fig. 7b-d), demonstrating the p53 dependency of the synthetic lethal interaction. Example 2: GAT A3 status determines response to MDM2 inhibitor in vitro
The selected vulnerability of MDM2 in GA7A3-deficient ER-positive breast cancers presents MDM2 as an attractive therapeutic target in this patient cohort. To test whether the apoptotic effects of MDM2 inhibition could be achieved using an MDM2 antagonist, the authors treated the breast cancer cell lines with idasanutlin (RG7388; Ding, Q. et al. J. Med. Chem. 56, 5979-5983, 2013; Reis, B. et al. Haematologica 101 , e185-8, 2016). In the GA7A3-mutant MCF7 cells, idasanutlin induced cell growth arrest and apoptosis in a dose-dependent manner (Fig. 2a-b, Fig.8a). To assess if idasanutlin was inducing the canonical apoptotic cascade, they assessed the expression of p53, Bax and Bcl-2, together with the canonical markers of apoptosis PARP and cleaved PARP, by immunoblot at 6, 12 and 24 hours post-treatment. Idasanutlin induced an early upregulation of p53 and MDM2 proteins, together with the up- and down-regulation of pro- and anti-apoptotic proteins, respectively (Fig. 2c), leading to the activation of the apoptotic cascade. TP53 silencing partially reverted the effects of idasanutlin treatment on cell growth and apoptosis (Fig. 9).
To determine whether GATA3 expression levels would modulate response to idasanutlin, the authors assessed the effect of treatment on GAL43-silenced BT-474 and MDA-MB134 cells. They observed that while idasanutlin treatment had no effect on the proliferation of the control cells, it significantly reduced cell proliferation upon GATA3 silencing (Fig. 2d and Fig. 8b). In fact, both cell lines showed that GATA3 silencing substantially reduced the IC50 for idasanutlin (Fig. 2e and Fig. 8c). Flow cytometry and immunoblot further demonstrated that idasanutlin treatment induced apoptosis in both BT-474 and MDA-MB134 upon GATA3 silencing but not in control cells (Fig. 2f- g and Fig. 8d-e).
Taken together, the authors results demonstrate that GATA3 silencing sensitizes cells to MDM2 inhibition
Figure imgf000019_0001
To ascertain whether GATA3 expression levels would also modulate response to idasanutlin in vivo, the authors performed xenotransplantation into zebrafish embryos. As a cancer model system, human cancer xenografts in zebrafish recapitulate the response to anticancer therapies of mammalian models. To generate the zebrafish models, they treated GA7A3-silenced and control BT-474 cells with idasanutlin (25mM) or vehicle (DMSO) 48 hours post-siRNA transfection (Fig. 3a). Twenty-four hours later, they labelled the cells with a red fluorescent cell tracker, injected them into the yolk sac of zebrafish embryos and screened embryos for tumour cell engraftment after four days.
The authors observed that GAL43-silenced cells injected into fish were more sensitive to idasanutlin treatment than the control (42% vs 61 %, Fig. 3b). More importantly, idasanutlin reduced tumour formation only in the context of GAL43-silencing (42% vs 65% treated with DMSO) but not in control cells (61 % vs 56 % treated with DMSO, Fig. 3b). Tumours derived from GA7A3-silenced, idasanutlin-treated cells, were very small, largely consisting of small clusters of tumour cells, compared to the larger solid tumour masses derived from GA7A3-silenced cells without idasanutlin (Fig. 3c). To assess cell proliferation, the authors quantified the percentage of tumour cells present in the fish by performing FACS analysis of the fluorescence-labelled tumour cells in whole fish extracts. Consistent with the results from the tumour formation assay, idasanutlin treatment was only effective in reducing the overall percentage of tumour cells in fish injected with GATA3- silenced cells (purple vs DMSO-treated in blue) but not in fish injected with control cells (yellow vs DMSO-treated in black, Fig. 3d), indicating that GATA3 expression level modulates sensitivity to MDM2 inhibition in vivo.
The zebrafish xenograft model provides insights into the tumourigenic and proliferative capability of cancer cells. However, to assess apoptosis and to quantify tumour growth, the authors employed the chicken chorioallantoic membrane (CAM), a densely vascularized, extraembryonic tissue, as a second in vivo mode . Similar to the zebrafish assay, we treated GAL43-silenced and control BT-474 cells with idasanutlin (25mM) or vehicle (DMSO) for 24 hours (Fig. 3e). They then inoculated the cells into the CAMs and screened the eggs for tumour formation four days later. In accordance with our results in the zebrafish model, idasanutlin treatment reduced the volume of tumours formed by GAL43-silenced cells (purple vs DMSO-treated in blue) but not in control cells (yellow vs DMSO-treated in black, Fig, 3f-g), suggesting that GAT A3 expression modulates response to MDM2 inhibitors in the CAM model as well. The authors then evaluated apoptosis induction by staining tumour sections with the apoptotic marker cleaved caspase 3. Notably, only GA7A3-silenced idasanutlin-treated tumours showed a strong positive signal for cleaved caspase 3, as well as morphological features of apoptosis (e.g. nuclear fragmentation, hypereosinophilic cytoplasm, “apoptotic bodies”, Fig. 3h and Fig. 10). demonstrating that idasanutlin induces apoptosis in the context of GATA3 silencing in vivo. Taken together, their results show that GATA3 expression modulates response to idasanutlin in two independent in vivo models.
Example 4: The synthetic lethality between GATA3 and MDM2 acts via the PI3K-Akt-mTOR sipnalinp pathway
To investigate the putative mechanisms driving the synthetic lethality, the authors analysed the gene expression changes induced by concurrent GATA3 loss and MDM2 silencing. RNA- sequencing analysis of the /WD/W2-silenced MCF-7 cells and dual GATA3/MDM2-sWerced MDA- MB134 cells revealed 20 commonly dysregulated pathways (Fig. 4a). As expected, p53 related pathways and apoptosis were significantly up-regulated in both cell lines, while many proliferation- related pathways such as E2F and MYC targets were down-regulated (Fig. 4b). Interestingly, the mTORCI signalling pathway was among the most significantly down-regulated pathways in both cell lines. Indeed, the authors confirmed that MDM2 silencing in the GA 743-mutant MCF7 cells reduced phospho-Akt, phospho-S6, as well as phospho-GSl·^, compared to control cells (Fig. 4c and Fig. 11), indicating the downregulation of the mTOR pathway. Similarly, in BT-474 cells, dual GATA3/MDM2 silencing reduced levels of phospho-Akt, phospho-S6 and phospho-GSl·^ and induced apoptosis (Fig. 4d and Fig. 11a). By contrast, phospho-Akt levels were higher when only GATA3 was silenced. Pharmacological inhibition of MDM2 in GA7A3-silenced BT-474 cells also resulted in a reduction in phospho-Akt, phospho-S6 and phospho-GSl·^ (Fig. 11b). To determine whether activation of the mTOR signalling could also be observed in vivo, the authors stained the tumours in our CAM model with phospho-S6 and phospho-Akt. Indeed, in tumours derived from GA7A3-silenced BT-474 cells, both phospho-S6 and phospho-Akt were drastically reduced upon treatment with idasanutlin, while in tumours derived from control cells, idasanutlin treatment did not have an effect on mTOR signalling (Fig. 4e and Fig. 11c).
The authors, therefore, hypothesized that GAT A3 loss may induce addiction to mTOR signalling in breast cancer cells. In support of their hypothesis, they observed that, in ER-positive breast cancers, genetic alterations in GATA3 are significantly mutually exclusive with those in both PI3KCA and PTEN (Fig. 12). Furthermore, differential gene expression and pathway enrichment analyses between GAL43-mutant and GATA3-w\\d type ER-positive breast cancers and between ER-positive breast cancers with low and high GATA3 expression levels also showed significant enrichment for the mTORCI signalling pathway (Fig. 13). Taken together, their results show that synthetic lethality between GAT A3 and MDM2 acts via the PI3K-Akt-mTOR signalling pathway.
Methods Cell lines
ER-positive breast cancer-derived cell lines MCF-7 ( GATA3 mutant p.D335Gfs; TP53 wild-type), BT-474 (GATA3 wild-type, TP53 mutant p.E285K with retained transactivation activity (Jordan, J. J. et al. Mol. Cancer Res. 8, 701-716, 2010)), MDA-MB-134 (GATA3 wild-type; TP53 wild-type) and T47D (GATA3 wild-type, TP53 mutant p.L194F) authenticated by short tandem repeat profiling. All the cells were monitored regularly for mycoplasma contamination by PCR using specific primers as previously described (Geyer, F. C. et al. Nat. Commun. 9, 1816, 2018). All cell lines were maintained under the condition as recommended by the provider. Briefly, all cell lines were culture in DMEM supplemented with 5% Fetal Bovine Serum (FBS), non-essential amino-acids (NEAA) and antibiotics (Penicillin/Streptomycin). The cells were incubated at 37°C in a humidified atmosphere containing 5% C02. Exponentially growing cells were used for all in vitro and in vivo studies.
Transient gene knockdown by siRNAs
Transient gene knockdown was conducted using ON-TARGET plus siRNA transfection. ON- TARGET plus SMARTpool siRNAs against human GATA3 (Dharmacon, CO; #L-003781-00- 0005), MDM2 (Dharmacon, CO; #L-003279-00-0005), TP53 (Dharmacon, CO; # L-009625-00- 0005), ON-TARGET plus SMARTpool non-targeting control and DharmaFECT transfection reagent (Dharmacon, CO; #T-2001-03) were all purchased from GE Dharmacon. Transfection was performed according to the manufacturer’s protocol. Briefly, log-phase ER positive breast cancer cells were seeded at approximately 60% confluence. Because residual serum affects the knockdown efficiency of ON-TARGET plus siRNAs, growth medium was removed as much as possible and replaced by serum-free medium (Opti-MEM). siRNAs were added to a final concentration of 25 nM. (Note: siRNAs targeting different genes can be multiplexed). Cells were incubated at 37°C in 5% C02 for 24-48-72 hours (for mRNA analysis) or for 48-72 hours (for protein analysis). To avoid cytotoxicity, transfection medium was replaced with complete medium after 24 hours.
RNA extraction and relative expression by gRT-PCR
Total RNA was extracted from cells at 75% confluence using TRIZOL (ThermoFisher Waltham, Massachusetts, USA) according to manufacturer's guidelines. cDNA was synthesized from 1 pg of total RNA using Superscript™ VILO™ cDNA Synthesis Kit (Invitrogen). All reverse transcriptase reactions, including no-template controls, were run on an Applied Biosystem 7900HT thermocycler. The expression for all the genes was assessed by using FastStart Universal SYBR Green Master Mix (Merk, CO; #4913850001 ) and all qPCR performed were conducted at 50°C for 2 min, 95°C for 10 min, and then 40 cycles of 95°C for 15 s and 60°C for 1 min on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The specificity of the reaction was verified by melt curve analysis. Measurements were normalized using GAPDH level as reference. The fold change in gene expression was calculated using the standard AACt method as previously described (Livak, K. J. & Schmittgen, Methods 25, 402-408, 2001 ). All samples were analyzed in triplicate.
List of primers used:
GA7A3_Forward (TCGCAG AATT GCAG AGT CGT) (SEQ ID 001 )
GA7A3_Reverse (GAGTTTCCGTAGTAGGGCGG) (SEQ ID 002)
MD/W2_ Forward (GGCGAGCTTGGCTGCTTC) (SEQ ID 003)
MD/W2_ Reverse (T G AGT CCG AT GATT CCTGCT G ) (SEQ ID 004)
TP53_ Forward (T GOT CAAGACTGGCGCTAAA) (SEQ ID 005)
7P53_Reverse (TTT CAGG AAGTAGTTT COAT AGGT) (SEQ ID 006) eCZ_2_Forward (TCTTTGAGTTCGGTGGGGTC) (SEQ ID 007)
BCL2_ Reverse (GACTTCACTTGTGGCCCAGAT) (SEQ ID 008)
BAX_ Forward (GCCCTTTTCTACTTTGCCAGC) (SEQ ID 09)
BAX_Reverse (AGACAGGGACATCAGTCGC) (SEQ ID 010)
PU/WA_Forward (CTGCCAGATTT GTGGT CCT C) (SEQ ID 011 )
PUMA_Reverse (CCTT CCG ATGCT G AGT CCAT) (SEQ ID 012) GAPDH83U (AGGTGAAGGTCGGAGTCAACG) (SEQ ID 013)
GAPDH28L (T G G AAG AT G GTG ATG G G ATTT) (SEQ ID 014)
Immunoblot
Immunoblot total protein was harvested by directly lysing the cells in Co-IP lysis buffer (100 mmol/L NaCI, 50 mmol/L Tris pH 7.5, 1 mmol/L EDTA, 0.1 % Triton X-100) supplemented with 1x protease inhibitors (complete™, Mini, EDTA-free Protease Inhibitor Cocktail, Roche, CO; #4693159001) and 1x phosphatase inhibitors (PhosSTOP, CO; #4906845001). Cell lysates were then treated with 1x reducing agent (NuPAGE Sample Reducing Agent), 1x loading buffer (NuPAGE LDS Sample Buffer), boiled and loaded onto neutral pH, pre-cast, discontinuous SDS- PAGE mini-gel system (NuPAGE 10% Bis-Tris Protein Gels). After electrophoresis, proteins were transferred to nitrocellulose membranes using Trans-Blot Turbo Transfer System(Bio-Rad). The transblotted membranes were blocked for 1 hr in TBST 5% milk and then probed with appropriate primary antibodies (from 1 :200 to 1 : 1000) overnight at 4°C. Next, the membranes were incubated for 1 hour at room temperature with fluorescent secondary goat anti-mouse (IRDye 680) or anti- rabbit (IRDye 800) antibodies (both from LI-COR Biosciences). Blots were scanned using the
Odyssey Infrared Imaging System (LI-COR Biosciences) and band intensity was quantified using ImageJ software. The ratio of proteins of interest/loading control in idasanutlin-treated samples were normalized to their DMSO-treated control counterparts. All experiments were performed and analysed in triplicate. List of antibodies and working concentrations: Antibodies Immunoblot
Figure imgf000023_0001
Figure imgf000024_0001
Drug treatment
10x103exponentially growing cells were plated in a 96-well plate. After 24hrs, cells were treated with serial dilution of RG7388-idasanutlin (Selleckchem, CO; #S7205) or dimethyl sulfoxide (DMSO). DMSO served as the drug vehicle, and its final concentration was no more than 0.1 %. Cell viability was measured after 72 hours using CellTiter-Glo Luminescent Cell Viability Assay reagent (Promega, CO; #G7570). Results were normalized to vehicle(=100%DMSO). Curve fitting was performed using Prism (GraphPad) software and the nonlinear regression equation. All experiments were performed at least two times in triplicate. Results are shown as mean ± SD.
Proliferation assay
Cell proliferation was assayed using the xCELLigence system (RTCA, ACEA Biosciences, San Diego, CA, USA) as previously described (Andreozzi, M. et al. Neoplasia 18, 724-731 , 2016). Background impedance of the xCELLigence system was measured for 12 s using 50 pi of room temperature cell culture media in each well of E-plate 16. Cells were grown and expanded in tissue culture flasks as previously described (Andreozzi, M. et al. Neoplasia 18, 724-731 , 2016). After reaching 75% confluence, the cells were washed with PBS and detached from the flasks using a short treatment with trypsin/EDTA. 5 000 cells were dispensed into each well of an E-plate 16. Growth and proliferation of the cells were monitored every 15 min up to 120 hours via the incorporated sensor electrode arrays of the xCELLigence system, using the RTCA-integrated software according to the manufacturer’s parameters. In the case of transient siRNA transfection, cells were detached and plated on xCELLigence 24 hours post transfection. For all the experiments with idasanutlin (RG7388), the drug or DMSO were added to the cells 24hrs post-seeding on the xCELLigence system, as indicated on the figures. All experiments were performed in triplicate. Results are shown as mean ± SD.
Apoptosis analysis bv flow cytometry
Cells were collected 72 hours post siRNA transfection and 48 hours post treatment with RG7388 respectively, stained with annexin V (Annexin V, FITC conjugate; Invitrogen, CO; #V13242) and propidium iodide (PI; Invitrogen, CO; #V13242), and analyzed by flow cytometry using the BD FACSCanto II cytometer (BD Biosciences, USA). Briefly, cells were harvested after incubation period and washed twice by centrifugation (1 ,200 g, 5 min) in cold phosphate-buffered saline (DPBS; Gibco, CO; #14040133). After washing, cells were resuspended in 0.1 mL AnnV binding buffer 1X (ABB 5X, Invitrogen, CO; #V13242; 50 mM HEPES, 700 mM NaCI, and 12.5 mM CaCI2 at pH 7.4) containing fluorochrome-conjugated AnnV and PI (PI to a final concentration of 1 ug/mL) and incubated in darkness at room temperature for 15 min. As soon as possible cells were analyzed by flow cytometry, measuring the fluorescence emission at 530 nm and >575 nm. All experiments were performed in triplicate. Data were analyzed by FlowJo software version 10.5.3.
Zebrafish Xenograft
Animal experiments and zebrafish husbandry were approved by the “Kantonales Veterinaeramt Basel-Stadt” (haltenewilligung: 1024H). Zebrafish were bred and maintained as described previously (Nusslein-Volhard, C. & Dahm, R. Ze Zebrafish, Oxford University Press, 2002). Staging was done by hours post-fertilization (hpf) as described previously (Kimmel, C. B., et at. Development 108, 581-594, 1990). and according to FELASA and Swiss federal law guidelines. Zebrafish wild-type Tuebingen strains were used in this study. 48 hours post siRNA transfection, GATA3 silenced and control BT-474 cells were pre-treated for 24 hours with idasanutlin (25 mM). After harvesting, the cells were labeled with a lipophilic red fluorescent dye (CellTracker™ CM-Dil #07000; Life Technologies, Darmstadt, Germany), according to the manufacturer's instructions. Wild-type zebrafish were maintained, collected, grown and staged in E3 medium at 28.5°C according to standard protocols. For xenotransplantation experiments, zebrafish embryos were anesthetized in 0.4% tricaine (Sigma) at 48 hours post fertilization (hpf) and 200 control or GATA3 silenced BT-474 cells were mi era- injected into the vessel-free area of the yolk sac. After injection, embryos were incubated for 1 hr at 28.5-29°C for recovery and cell transfer verified by fluorescence microscopy. Embryos were examined for the presence of a fluorescent cell mass localized at the injection site in the yolk sac or hindbrain ventricle. Fish harbouring red cells were incubated at 35°C as described previously. (Konantz, M. et al. Zebrafish xenografts as a too! for in vivo studies on human cancer. Annals of the New York Academy of Sciences 1268, 124-137 (2012)., Haldi, M., Ton, C., Seng, W. L. & McGrath, P. Human melanoma cells transplanted into zebrafish proliferate, migrate, produce melanin, form masses and stimulate angiogenesis in zebrafish. Angiogenesis 9, 139-151 (2006).). On assay day 4, embryos were screened by fluorescence microscopy for (a) normal morphology, (b) a visible cell mass in the yolk or hindbrain ventricle, using a Zeiss SteREO Discovery V20 microscope and the number of tumor-bearing fish quantified. The screening was performed independently by two scientists. For each condition, 70 to 100 fish were analysed over two experiments. Representative pictures were taken using a Nikon CSU-W1 spinning disk microscope. To assess cell proliferation, fish were further dissociated into single cells as described previously (; Carapito, R. et al. Mutations in signal recognition particle SRP54 cause syndromic neutropenia with Shwachman-Diamond-like features. J. Clin. Invest. 127, 4090-4103 (2017).) and cells analyzed on a BD FACSCanto II cytometer for CM-Dil-positive cells. For each condition, 20 to 30 fishes were analyzed. Each experiment was repeated twice., 1007- 1020 (2016).; Carapito, R. et al. J. Clin. Invest. 127, 4090-4103 (2017).) and the number of fluorescence-labeled cells was then determined using flow cytometry on a BD FACSCanto II cytometer for CM-Dil-positive cells. For each condition, 20 to 30 fishes were analyzed. Each experiment was repeated twice. Chorioallantoic membrane (CAM) assays
Fertilized chicken eggs were obtained from Gepro Gefliigelzucht AG at day 1 of gestation and were maintained at 37°C in a humidified (60%) incubator for 10 days (Zijlstra, A. et al. Cancer Res. 62, 7083-7092, 2002). At this time, an artificial air sac was formed using the following procedure: a small hole was drilled through the eggshell into the air sac and a second hole near the allantoic vein that penetrates the eggshell membrane. A mild vacuum was applied to the hole over the air sac in order to drop the CAM. Subsequently, a square 1cm window encompassing the hole near the allantoic vein was cut to expose the underlying CAM (Zijlstra, A. et al. ibid.). After the artificial air sac was formed, BT-474 cells growing in tissue culture were inoculated on CAMs at 2x10cells per CAM, on three to four CAMs each. Specifically, 48 hrs post-siRNA transfection, GATA3- silenced and control BT-474 cells were treated with idasanutlin (25mM). 24 hrs post-treatment, cells were detached from the culture dish with Trypsin, counted, suspended in 20pl of medium (DMEM) and mixed with an equal volume of Matrigel. To prevent leaking and spreading of cells, a 8mm (inner diameter) sterile teflon ring (removed from 1 8ml freezing vials, Nunc, Denmark) was placed on the CAMs and the final mixture was grafted onto the chorioallantoic membranes inoculating the cells with a pipette inside the ring (Kim, J., Yu, W et al. Cell 94, 353-362,1998). Embryos were maintained at 37 °C for 4 days after which tumors at the site of inoculation were excised using surgical forceps. Images of each tumor were acquired with a Canon EOS 1100D digital camera. Surface measurements were performed by averaging the volume (height*width*width) of each tumor using ImageJ, as previously described (Lauzier, A. et al. Sci. Rep. 9, 11316, 2019). Total n>10 tumours for each condition were analysed over three independent experiments.
Immunohistochemistry
Tumors were fixed in 10% Paraformaldehyde (PFA) immediately after excision from the CAM. PFA-fixed and paraffin-embedded tumors were cut as 3.5pm thick sections. Hematoxylin and eosin (H&E) staining was performed according to standard protocols. Tissue sections were rehydrated and immunohistochemical staining was performed on a BOND-MAX immunohistochemistry robot (Leica Biosystems) with BOND polymer refine detection solution for DAB, using anti-GATA3, cleaved caspase 3, phospho-Akt or phospho-S6 primary antibodies as substrate. Photomicrographs of the tumors were acquired using an Olympus BX46 microscope. All stained sections were evaluated blindly by two independent pathologists.
List of antibodies and working concentrations:
Immunoistochemistry
Figure imgf000026_0001
Figure imgf000027_0001
RNA sequencing and pathway analysis
Biological duplicates were generated for all the samples analyzed. Total RNA was extracted from cells at 75% confluence using TRIZOL (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to manufacturer's guidelines. RNA samples were treated with Turbo Dnase (AM 1907, Thermo Fisher Scientific) and quantified using a Qubit Fluorometer (Life Technologies). RNA integrity was measured using the Agilent Bioanalyzer 2100 (Agilent Technologies).
Library generation was performed using the TruSeq Stranded mRNA (lllumina). Paired-end RNA sequencing was performed on the lllumina NovaSeq 6000 platform using the 2x100bp protocol according to the manufacturer's guidelines. Reads were aligned to the GRCh37 human reference genome using STAR 2.7.1 (Dobin, A. et al. Bioinformatics 29, 15-21 , 2013), and transcript quantification was performed using RSEM 1 .3.2 (Li, B. & Dewey, C. N. BMC Bioinformatics vol. 12, 2011 ). Genes without at least 10 assigned reads in at least 2 samples were discarded. Counts were normalized using the median of ratios method from the DESeq2 package (Love, M. I., Huber, W. & Anders, S. Genome Biol. 15, 550, 2014) in R version 3.6.1 (https://www.R-proiect.org/). Differential expression analysis was performed using the DESeq2 Wald test. Gene set enrichment analysis was performed using the fgsea R package (Sergushichev, A. A, BioRxiv, June 20, 2016) and the Hallmark gene set from the Molecular Signatures Database (Liberzon, A. et al. Cell Systems vol. 1 417-425, 2015) using the ranked t statistics from the DESeq2 Wald test. Pathways with false discovery rate (FDR) < 0.05 were considered to have significantly altered expression. Results were visualised using ggplot2 (Wickham, H. ggplot2, 2009).
Analysis of The Cancer Genome Atlas (TCGA) data
ER-positive breast cancer mutation annotation file for variant calling pipeline mutect2, FPKM gene expression data and raw read counts of the TCGA BRCA project were downloaded using TCGAbiolinks (Colaprico, A. et al. Nucleic Acids Res. 44, e71 , 2016) package. Tumor samples were classified as GA7A3-mutant (n=122) and GA7 \3-wild type (n=596) according to the GATA3 mutation status. Samples with GAT A3 mRNA expression in the bottom and top quartile were classified as GATA3-\ow (n=200) and GAL43-high (n=204), respectively. edgeR package (Robinson, M. D. etal. Bioinformatics vol. 26 139-140, 2010) was used for differential expression analysis and the genes with low expression (<1 log-counts per million in > 30 samples) were filtered out. Normalization was performed using the “TMM” (weighted trimmed mean) method (Robinson, M. D. & Oshlack, A. Genome Biol. 11 , R25, 2010) and differential expression was assessed using the quasi-likelihood F-test. Gene set enrichment analysis of all analyzed genes ranked based on signed p-value according to the direction of the log-fold change was performed using the fgsea package (Sergushichev, A. A, BioRxiv, June 20, 2016) Hallmark gene sets from Molecular Signatures Database (Liberzon, A. et al. Cell Systems vol. 1 417-425, 2015) were used to identify significantly upregulated/downregulated pathways. Pathways with FDR < 0.05 were considered significantly regulated.
Mutual exclusive / co-occurrence event analysis ER-positive breast cancer mutational data for the GAT A3, TP53, PIK3CA and PTEN genes and copy number status for PTEN derived from the TCGA PanCancer Atlas (Hoadley, K. A. et al. Cell 173, 291 -304. e6, 2018) and the METABRIC dataset Pereira, B. et al. Nat. Commun. 7, 11479, 2016) were obtained using cBioportal (Cerami, E. etal. Cancer Discov. 2, 401-404, 2012). A total of 2379 samples were used for the analysis. Mutual exclusivity and co-occurrence of somatic mutations in GATA3, TP53, PIK3CA and PTEN and deep deletions for PTEN were calculated using one-sided Fisher's Exact and P< 0.05 was considered statistically significant.
Quantification and statistical analysis
Statistical analyses were conducted using Prism software v7.0 (GraphPad Software, La Jolla, CA, USA). For in vitro studies, statistical significance was determined by the two-tailed unpaired Student’s t-test. For comparison involving multiple time points, statistical significance was determined by the two-tailed unpaired multiple Student’s t-test. A Rvalue < 0.05 was considered statistically significant. For all figures, ns, not significant. For in vivo studies two-sided Fisher's Exact was used to compare the number of tumour-harboring fish (Figure 3b). For the CAM assay a two-tailed unpaired Student’s t-test was used. Mutual exclusivity and co-occurrence of somatic mutations were calculated using one-sided Fisher's Exact. The statistical parameters (i.e. , exact value of n, p values) have been noted in the figures. Unless otherwise indicated, all data represent the mean ± standard deviation from at least three independent experiments.

Claims

Claims
1. An agent for use in treatment of a neoplasm, particularly in treatment of a malignant neoplasm, wherein said neoplasm is characterized by decreased or abrogated function of GAT A3, and wherein the agent is selected from a. a nucleic acid biopolymer capable of specifically suppressing expression of MDM2; b. an MDM2 specific inhibitor, particularly an MDM2 inhibitor characterized by a molecular weight <700 Da, c. a specific modulator of the MDM2-p53 interaction, particularly a specific modulator of the MDM2-p53 interaction characterized by a molecular weight <700 Da, or d. a peptide specifically modulating the MDM2-p53 interaction.
2. The agent for use in treatment of a neoplasm according to claim 1 , wherein said nucleic acid biopolymer capable of specifically suppressing expression of MDM2 is selected from an siRNA, an miRNA, an antisense oligonucleotide, an shRNA, and an sgRNA.
3. The agent for use in treatment of a neoplasm according to claim 1 , wherein said MDM2 specific inhibitor is selected from MEL23 and MEL24.
4. The agent for use in treatment of a neoplasm according to claim 1 , wherein said specific modulator of the MDM2-p53 interaction is a nutlin, particularly wherein said specific modulator of the MDM2-p53 interaction is selected from HLI373, NSC 66811 , Nutlin-3, Nutlin-3a, RITA, SKPin C1, SMER 3, SP141 , SZL P1-41 , TAME hydrochloride, Thalidomide, VH 298, YH 239-EE, proTAME, Lenalidomide, MZ 1 , TL
12-186, cis MZ 1 , dBET1 , AT 1 , NSC 66811 , HLI 373, NAB 2, GS 143, c/'s VH 298, CM 11 , CMP 98, TL 13-27, Idisulam, Indasanutlin, CRBN-6-5-5-VHL, RITA NSC 652287, Tenovin-1 , AT 406 (SM-406), Avadomide (CC-122), NSC 207895, JNJ- 26854165 (Serdemetan), lberdomide(CC220), CGM097, HDM201 , SAR405838, RG7112, MI-77301, MI-888, MK-8242, AMG232, DS3032b, ALRN-6924 and idasanutlin (RG7388).
5. The agent for use in treatment of a neoplasm according to claim 1 or 4, wherein said specific modulator of the MDM2-p53 interaction is idasanutlin.
6. The agent for use in treatment of a neoplasm according to claim 1 , wherein said peptide specifically modulating the MDM2-p53 interaction is selected from ATSP- 7041 , M06, SAH-p53-8, sMTide-02/02A, and ATSP-7041.
7. The agent for use in treatment of a neoplasm according to any one of the preceding claims, wherein the neoplasm is characterized by expression of functional p53.
8. The agent for use in treatment of a neoplasm according to any one of the preceding claims, wherein the neoplasm is a neoplasm of breast tissue, urothelial tissue, stomach, uterus, ovaries, or lung, or the neoplasm is melanoma, or diffuse large 13- cell lymphoma, particularly the neoplasm is a neoplasm of breast tissue, more particularly the neoplasm is an estrogen receptor (ER) positive neoplasm of breast tissue.
9. A method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein
• an expression and/or an enzymatic activity of GATA3 is determined in a sample of a neoplasm isolated from said patient, particularly a malignant neoplasm, of said patient; and
• a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is a. characterized by low expression of GAT A3 or lack of expression of GATA3; and/or b. characterized by expression of a non-active GATA3 variant; and/or c. characterized by the presence of somatic genetic alterations in the GATA3 gene, particularly a mutation, a copy number alteration or a genomic rearrangement.
10. The method for assigning a likelihood of responding to MDM2 modulator treatment to a patient, wherein additionally
• an expression and/or a functionality of p53 is determined in said sample of a neoplasm isolated from said patient; and
• a high likelihood of responding to MDM2 modulator treatment is assigned if the sample of a neoplasm isolated from said patient is additionally characterized by expression of functional p53.
11. The agent for use in treatment or prevention of a neoplasm, particularly a malignant neoplasm, according to any one of claims 9 or 10, wherein a high likelihood of responding to MDM2 modulator treatment is assigned to said patient according to the method of claims 1 to 8.
PCT/EP2021/062420 2020-05-15 2021-05-11 Mdm2 inhibitor response prediction method WO2021228814A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20174984 2020-05-15
EP20174984.3 2020-05-15

Publications (1)

Publication Number Publication Date
WO2021228814A1 true WO2021228814A1 (en) 2021-11-18

Family

ID=70738398

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/062420 WO2021228814A1 (en) 2020-05-15 2021-05-11 Mdm2 inhibitor response prediction method

Country Status (1)

Country Link
WO (1) WO2021228814A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113979999A (en) * 2021-12-23 2022-01-28 北京鑫开元医药科技有限公司 Compound for targeted ubiquitination degradation of BCR-ABL kinase and preparation method, composition and application thereof
CN115252603A (en) * 2022-07-08 2022-11-01 深圳市第二人民医院(深圳市转化医学研究院) Application of indisulam in the preparation of drugs for treating bladder cancer
US12097261B2 (en) 2021-05-07 2024-09-24 Kymera Therapeutics, Inc. CDK2 degraders and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014020502A2 (en) * 2012-07-31 2014-02-06 Novartis Ag Markers associated with human double minute 2 inhibitors
WO2016056673A1 (en) * 2014-10-09 2016-04-14 Daiichi Sankyo Company, Limited Algorithms for gene signature-based predictor of sensitivity to mdm2 inhibitors

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014020502A2 (en) * 2012-07-31 2014-02-06 Novartis Ag Markers associated with human double minute 2 inhibitors
WO2016056673A1 (en) * 2014-10-09 2016-04-14 Daiichi Sankyo Company, Limited Algorithms for gene signature-based predictor of sensitivity to mdm2 inhibitors

Non-Patent Citations (39)

* Cited by examiner, † Cited by third party
Title
ANDREOZZI, M. ET AL., NEOPLASIA, vol. 18, 2016, pages 724 - 731
ANNE Y. SAIKI ET AL: "Identifying the determinants of response to MDM2 inhibition", ONCOTARGET, vol. 6, no. 10, 10 April 2015 (2015-04-10), pages 7701 - 7712, XP055736359, DOI: 10.18632/oncotarget.3116 *
AUSUBEL ET AL.: "Short Protocols in Molecular Biology", 1999, JOHN WILEY & SONS, INC.
BARRETINA, J. ET AL., NATURE, vol. 483, 2012, pages 603 - 607
C. SADDLER ET AL: "Comprehensive biomarker and genomic analysis identifies p53 status as the major determinant of response to MDM2 inhibitors in chronic lymphocytic leukemia", BLOOD, vol. 111, no. 3, 25 October 2007 (2007-10-25), pages 1584 - 1593, XP055139885, ISSN: 0006-4971, DOI: 10.1182/blood-2007-09-112698 *
CARAPITO, R. ET AL., J. CLIN. INVEST., vol. 127, 2017, pages 4090 - 4103
CARAPITO, R. ET AL.: "Mutations in signal recognition particle SRP54 cause syndromic neutropenia with Shwachman-Diamond-like features", J. CLIN. INVEST., vol. 127, 2017, pages 4090 - 4103
CERAMI, E. ET AL., CANCER DISCOV, vol. 2, 2012, pages 401 - 404
CHAPEAU EMILIE A ET AL: "Resistance mechanisms to TP53-MDM2 inhibition identified by in vivo piggyBac transposon mutagenesis screen in an Arf(-/-) mouse model", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 114, no. 12, 21 March 2017 (2017-03-21), pages 3151 - 3156, XP002779205, ISSN: 0027-8424 *
CIOCCA V ET AL: "The significance of GATA3 expression in breast cancer: a 10-year follow-up study", HUMAN PATHOLOGY, SAUNDERS, PHILADELPHIA, PA, US, vol. 40, no. 4, 1 April 2009 (2009-04-01), pages 489 - 495, XP025983245, ISSN: 0046-8177, [retrieved on 20081211], DOI: 10.1016/J.HUMPATH.2008.09.010 *
COLAPRICO, A. ET AL., NUCLEIC ACIDS RES., vol. 44, 2016, pages e71
DING, Q. ET AL., J. MED. CHEM., vol. 56, 2013, pages 5979 - 5983
DOBIN, A. ET AL., BIOINFORMATICS, vol. 29, 2013, pages 15 - 21
GEYER, F. C. ET AL., NAT. COMMUN., vol. 9, 2018, pages 1816
HALDI, M.TON, C.SENG, W. L.MCGRATH, P.: "Human melanoma cells transplanted into zebrafish proliferate, migrate, produce melanin, form masses and stimulate angiogenesis in zebrafish", ANGIOGENESIS, vol. 9, 2006, pages 139 - 151, XP019432803, DOI: 10.1007/s10456-006-9040-2
HERMAN ET AL., CANCER DISCOVERY, vol. 1, no. 4, 2011, pages 312 - 25
HOADLEY, K. A. ET AL., CELL, vol. 173, 2018, pages 291 - 304
JORDAN, J. J. ET AL., MOL. CANCER RES., vol. 8, 2010, pages 701 - 716
KIM, J.YU, W ET AL., CELL, vol. 94, 1998, pages 353 - 362
KIMMEL, C. B. ET AL., DEVELOPMENT, vol. 108, 1990, pages 581 - 594
KONANTZ, M. ET AL.: "Zebrafish xenografts as a tool for in vivo studies on human cancer", ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 1266, 2012, pages 124 - 137, XP055256762, DOI: 10.1111/j.1749-6632.2012.06575.x
L. LACHMAN ET AL., THE THEORY AND PRACTICE OF INDUSTRIAL PHARMACY, 2013, ISBN: 8123922892
LAUZIER, A. ET AL., SCI. REP., vol. 9, 2019, pages 11316
LE GARFF-TAVERNIER ET AL., BLOOD CANCER J, vol. 1, no. 2, February 2011 (2011-02-01), pages e5
LI, B.DEWEY, C. N, BMC BIOINFORMATICS, vol. 12, 2011
LIBERZON, A. ET AL., CELL SYSTEMS, vol. 1, 2015, pages 417 - 425
LIVAK, K. J.SCHMITTGEN, METHODS, vol. 25, 2001, pages 402 - 408
LOVE, M. I.HUBER, W.ANDERS, S., GENOME BIOL, vol. 15, 2014, pages 550
MCDONALD, E. R. ET AL., CELL, vol. 170, 2017, pages 577 - 592
NAM K. YOON ET AL: "Higher levels of GATA3 predict better survival in women with breast cancer", HUMAN PATHOLOGY., vol. 41, no. 12, 1 December 2010 (2010-12-01), US, pages 1794 - 1801, XP055736202, ISSN: 0046-8177, DOI: 10.1016/j.humpath.2010.06.010 *
PEREIRA, B. ET AL., NAT. COMMUN., vol. 7, 2016, pages 11479
REIS, B. ET AL., HAEMATOLOGICA, vol. 101, 2016, pages e185 - 8
REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, ISBN: 0857110624
ROBINSON, M. D. ET AL., BIOINFORMATICS, vol. 26, 2010, pages 139 - 140
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SÉBSTIEN JEAY ET AL: "A distinct p53 target gene set predicts for response to the selective p53-HDM2 inhibitor NVP-CGM097", ELIFE, 12 May 2015 (2015-05-12), pages 1 - 23, XP055736377 *
SERGUSHICHEV, A. A, BIORXIV, 20 June 2016 (2016-06-20)
SI WENZHE ET AL: "Dysfunction of the Reciprocal Feedback Loop between GATA3- and ZEB2-Nucleated Repression Programs Contributes to Breast Cancer Metastasis", CANCER CELL, CELL PRESS, US, vol. 27, no. 6, 28 May 2015 (2015-05-28), pages 822 - 836, XP029166208, ISSN: 1535-6108, DOI: 10.1016/J.CCELL.2015.04.011 *
ZIJLSTRA, A. ET AL., CANCER RES., vol. 62, 2002, pages 7083 - 7092

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12097261B2 (en) 2021-05-07 2024-09-24 Kymera Therapeutics, Inc. CDK2 degraders and uses thereof
CN113979999A (en) * 2021-12-23 2022-01-28 北京鑫开元医药科技有限公司 Compound for targeted ubiquitination degradation of BCR-ABL kinase and preparation method, composition and application thereof
CN115252603A (en) * 2022-07-08 2022-11-01 深圳市第二人民医院(深圳市转化医学研究院) Application of indisulam in the preparation of drugs for treating bladder cancer

Similar Documents

Publication Publication Date Title
WO2021228814A1 (en) Mdm2 inhibitor response prediction method
AU2014348291A9 (en) Compositions and methods of using transposons
Simatou et al. Historical retrospective of the SRC oncogene and new perspectives
AU2014246667A1 (en) Methods of treating diseases characterized by excessive Wnt signalling
Chuang et al. Functional role of the long noncoding RNA X-inactive specific transcript in leiomyoma pathogenesis
CN111670247B (en) Method for preparing cancer spheroids and method for selecting colorectal cancer patients
TW201628655A (en) Use of pan FGFR inhibitors and method of identifying patients with cancer eligible for treatment with a pan FGFR inhibitor
WO2016081634A1 (en) Compositions and methods for treating endometriosis
US20220218734A1 (en) Combinations of therapeutic agents for treating uveal melanoma
EP3371211B1 (en) Rho-associated protein kinase (&#34;rock&#34;) inhibitor for treating tumors and cancer, and identifying candidate subjects for such treatment
ES2794628T3 (en) Compositions and methods for the reactivation of chromosomes XI
US12024707B2 (en) Methods and compositions for modulating lncRNAs and methods of treatment based on lncRNA expression
US11920135B2 (en) Methods of treating VEGF/VEGFR resistant prostate, renal, or colorectal cancers using combination therapies
CN109512833B (en) Function and use of E2F6 inhibitors
WO2013165320A1 (en) Treating cancer by increasing expression of socs6
Suzuki et al. Overexpression of TEAD4 in atypical teratoid/rhabdoid tumor: new insight to the pathophysiology of an aggressive brain tumor
US20220259673A1 (en) Methods for identifying and treating high-plasticity cell state driving tumor progression in lung cancer
EP3448881B1 (en) Treatment of hippo pathway mutant tumors and methods of identifying subjects as candidates for treatment
WO2021025018A1 (en) Pharmaceutical composition for therapy and/or prophylaxis of colorectal cancer
US11179413B2 (en) Methods of treatment of cancer with reduced UBB expression
US11642362B2 (en) Methods of inhibiting cell proliferation and METTL8 activity
KR101900278B1 (en) Method for Screening a Composition for Preventing or Treating MYC-AP4 Activated Cancers
KR102707587B1 (en) COMPOSITION FOR ENHANCING SENSITIVITY TO ANTI-CANCER AGENT COMPRISING OF miR-4487 AS AN ACTIVE INGREDIENT
WO2018160699A1 (en) Biomarkers for diagnosis, prediction and/or prognosis of pancreatic cancer and uses thereof
WO2025056601A1 (en) Pharmaceutical combination product comprising kinase inhibitor and autophagy inducer and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21724303

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21724303

Country of ref document: EP

Kind code of ref document: A1