WO2021222633A2

WO2021222633A2 - Methods for treating covid-19

Info

Publication number: WO2021222633A2
Application number: PCT/US2021/029980
Authority: WO
Inventors: Cassian Yee; Ke Pan; Yulun CHIU
Original assignee: Board Of Regents, The University Of Texas System
Priority date: 2020-05-01
Filing date: 2021-04-29
Publication date: 2021-11-04
Also published as: WO2021222633A3

Abstract

The current disclosure methods and compositions for treating and vaccinating individuals against coronaviruses. Accordingly, embodiments of the disclosure relate to a peptide comprising at least 70% sequence identity to LQGPPGTGK (SEQ ID NO:1) Yet further aspects relate to a method for treating or preventing a coronavirus in a subject, the method comprising administering a peptide, composition, nucleic acid, expression vector, dendritic cell, or T cell of the disclosure. Also provided are compositions comprising a peptide of the disclosure and also compositions comprising a peptide of the disclosure and a MHC polypeptide.

Description

METHODS FOR TREATING COVID-19

BACKGROUND OF THE INVENTION

[0001] This application is claims benefit of priority of U.S. Provisional Application No. 63/019,132, filed May 1, 2020, which is hereby incorporated by reference in its entirety.

I. Field of the Invention

[0002] This invention relates to the field of treatment of infectious disease and molecular biology.

II. Background

[0003] Currently, about 150 million people have been infected with the SARS-CoV-2 virus and over 3 million have died worldwide due to COVID-19 or complications related thereto. There is an urgent need for the development of vaccines that can be used to prevent the disease in individuals without immunity to the virus and a need for treatments to mitigate the infection in the critically ill.

SUMMARY OF THE INVENTION

[0004] The current disclosure fulfills a need by providing methods and compositions for treating and vaccinating individuals against coronaviruses. Accordingly, aspects of the disclosure relate to a peptide comprising at least 66% sequence identity to LQGPPGTGK (SEQ ID NO:l). Further aspects of the disclosure relate to an isolated peptide comprising or consisting of a peptide having the amino acid sequence of SEQ ID NO:l. Yet further aspects relate to a method for treating or preventing a coronavims infection in a subject, the method comprising administering a peptide, composition, nucleic acid, expression vector, dendritic cell, or T cell of the disclosure. Further aspects relate to a method of treating a coronavims infection in a subject comprising administering an effective amount of the coronavims -specific T cells of the disclosure to the subject. Also provided are compositions comprising a peptide of the disclosure, compositions comprising a peptide of the disclosure and a MHC polypeptide, and compositions comprising an effective amount of the coronavims-specific T cells of the disclosure for the treatment of a coronavims infection in a subject. Other aspects of the disclosure relate to nucleic acids encoding a peptide of the disclosure, expression vectors comprising a nucleic acid of the disclosure, and host cells comprising peptide(s) and/or nucleic acids of the disclosure. [0005] Some aspects of the disclosure relate to an in vitro isolated dendritic cell comprising a peptide, nucleic acid, and/or expression vector of the disclosure. In other aspects, artificial antigen presenting cells comprise a peptide, nucleic acid, and/or expression vector of the disclosure. Further aspects relate to a method of making a cell comprising transferring a nucleic acid or expression vector of the disclosure into the cell. Further aspects relate to an in vitro method for making a therapeutic T cell vaccine comprising co-culturing T cells with a peptide of the disclosure. Also provided are T cells made by methods of the disclosure and a T cell comprising a TCR that specifically binds to a peptide of SEQ ID NO: 1. Further aspects relate to a coronavirus- specific engineered T cell produced according to a method of the disclosure. Also described are coronavirus -specific T cell produced according to the methods of the disclosure and pharmaceutical compositions comprising the coronavirus-specific T cells produced according to a method of the disclosure. Further methods of the disclosure relate to a method comprising contacting a composition of the disclosure with a composition comprising T cells and detecting T cells with bound peptide and/or MHC polypeptide by detecting a detection tag. Further aspects relate to methods for performing a tetramer or multimer assay or for detecting peptide-reactive T cells in a composition, the method comprising contacting a composition of the disclosure with a composition comprising T cells and detecting T cells with bound peptide and/or MHC polypeptide by detecting a detection tag.

[0006] Further aspects relate to a mammalian cell comprising a coronavirus nucleic acid. Futher aspects of the disclosure relate to a method comprising: contacting the cells of the disclosure, or an extract thereof with an anti-HLA-A, HLA-B, or HLA-C antibody. Methods of the disclosure also relate to a method for isolating, identifying, and/or detecting immunogenic coronavirus peptides, the method comprising : contacting the cells of the disclosure, or an extract thereof with an anti-HLA-A, HLA-B, and/or HLA-C antibody. Yet further aspects relate to a peptide identified by a method of the disclosure. Other method aspects relate to a method of producing coronavirus-specific immune effector cells comprising: (a) obtaining a starting population of immune effector cells; and (b) contacting the starting population of immune effector cells with a SARS-COV-2 peptide of the disclosure, thereby generating coronavirus-specific immune effector cells. Further method aspects relate to a method of cloning a coronavirus T cell receptor (TCR), the method comprising (a) obtaining a starting population of immune effector cells; (b) contacting the starting population of immune effector cells with the coronavirus peptide of the disclosure, thereby generating coronavirus- specific immune effector cells; (c) purifying immune effector cells specific to the coronavirus peptide, and (d) isolating a TCR sequence from the purified immune effector cells. Further aspects of the disclosure relate to a method for prognosing or diagnosing a patient or for detecting T cell responses in a patient, the method comprising: contacting a biological sample from the patient with a peptide of the disclosure.

[0007] In aspects of the disclosure, the coronavirus may refer to a coronavirus isolated from bats. In some aspects of the disclosure, the coronavirus is SARS-CoV, which is the virus that causes SARS in humans. In some aspects, the coronavirus is SARS-CoV-2, wherein is the virus that causes COVID-19 in humans. In some aspects, the method is for treating or preventing SARS. In some aspects, the method is for treating or preventing COVID-19. In some aspects, the coronavirus is a coronavirus that expresses a polypeptide comprising SEQ ID NO:l. In some aspects, the method is for stimulating an immune response in a subject. [0008] In some aspects, the nucleic acid comprises or consists of DNA. In some aspects, the nucleic acid comprises or consists of RNA. In some aspects, the nucleic acid is integrated into the host cell genome. In some aspects, the nucleic acid is not integrated into the host cell genome. In some aspects, the cell is a human cell. In some aspects, the cell is an immortalized cell. In some aspects, the cell is a primary cell. In some aspects, the cell is a K562 cell. In some aspects, the cell comprises a portion of a coronavirus genome or gene, such as 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 16000, 17000, 18000, 19000, 20000, 21000, 22000, 23000, 24000, 25000, 26000, 27000, 28000, 29000, or 30000 nucleotides (or any derivable range therein) from a coronavirus or from SEQ ID NO:2. In some aspects, the cell further comprises a heterologous promoter that directs the expression of the coronavirus nucleic acid. In some aspects, the promoter comprises a constitutive promoter. In some aspects, the promoter comprises an inducible promoter. In some aspects, the cell comprises or further comprises a polypeptide expressed from the nucleic acid. In some aspects, the cell further comprises an HLA-A3 polypeptide or HLA-A11 polypeptide. In some aspects, the nucleic acid is a cDNA. In some aspects, the HLA-A3 or HLA-A11 polypeptide is expressed from a nucleic acid encoding the HLA-A3 or HLA-A11 polypeptide. In some aspects, the cell is mutant for endogenous MHC genes. In some aspects, the cell does not express an endogenous MHC gene. In some aspects, the MHC comprises MHC class 1. In some aspects, the cell further comprises a heterologous promoter that directs the expression of the HLA-A3 or HLA-A11 nucleic acid. In some aspects, the promoter that directs the expression of the HLA-A3, HLA-A11, and/or the coronavirus nucleic acid is constitutive. In some aspects, the promoter that directs the expression of the HLA-A3, HLA- A11, and/or the coronavirus nucleic acid is inducible. In some aspects, the coronavirus nucleic acid comprises a nucleic acid from the ORFlb region of coronavirus. In some aspects, the coronavirus nucleic acid encodes for a spike or membrane protein from coronavirus. In some aspects, the coronavirus nucleic acid comprises SEQ ID NO:2 or a fragment thereof, or a gene encoded therein.

[0009] In some aspects, the methods of the disclosure further comprise lysing the cells. In some aspects, the antibody is conjugated or linked to a solid support. In some aspects, the solid support comprises a bead, such as a sepharose bead, or a microplate. In some aspects, the cells are lysed after contact of the antibody. In some aspects, the cells are lysed before contact of the antibody. In some aspects, the method further comprises one or more of washing components not complexed with the antibody, separation of components complexed with the antibody from components not complexed with the antibody, and/or elution of peptides complexed with the antibody. In some aspects, method further comprises elution of peptides complexed with the antibody and wherein the elution comprises elution with acetic acid. In some aspects, the method further comprises sequencing of the peptides. In some aspects, sequencing the peptides comprises mass spectrometry. In some aspects, mass spectrometry comprises tandem mass spectrometry.

In some aspects, the peptide comprises an amino acid sequence that is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,

89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical in sequence to SEQ ID NO:l. In some aspects, the peptide comprises at least 6 contiguous amino acids of SEQ ID NO:l. In some aspects, the peptide comprises at least or consists of 3, 4, 5, 6, 7, 8, or 9 contiguous amino acids of SEQ ID NO:l. In some aspects, the peptide comprises at least 7 contiguous amino acids of SEQ ID NO:l. In some aspects, the peptide comprises at least 8 contiguous amino acids of SEQ ID NO:l. In some aspects, the peptide comprises at least 77% sequence identity to SEQ ID NO: 1. In some aspects the peptide comprises at least 88% sequence identity to SEQ ID NO: 1. In some aspects the peptide comprises or consists of SEQ ID NO: 1. In some aspects, the peptide is 13 amino acids in length or less. In some aspects, the peptide is at least, at most, exactly or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in length. In some aspects, the peptide consists of 9 amino acids.

[0010] In some aspects, the peptide is immunogenic. The term immunogenic may refer to the production of an immune response, such as a protective immune response. In some aspects, the peptide is modified. In some aspects, the modification comprises conjugation to a molecule. The molecule may be an antibody, a lipid, an adjuvant, or a detection moiety (tag). [0011] In some aspects, the composition of the disclosure comprises a MHC polypeptide and a peptide of the disclosure and wherein the MHC polypeptide and/or peptide is conjugated to a detection tag. As such, suitable detection tags include, but are not limited to radioisotopes, fluorochromes, chemiluminescent compounds, dyes, and proteins, including enzymes. The tag may be simply detected or it may be quantified . A response that is simply detected generally comprises a response whose existence merely is confirmed, whereas a response that is quantified generally comprises a response having a quantifiable (e.g., numerically reportable) value such as an intensity, polarization, and/or other property. In luminescence or fluorescence assays, the detectable response may be generated directly using a luminophore or fluorophore associated with an assay component actually involved in binding, or indirectly using a luminophore or fluorophore associated with another (e.g., reporter or indicator) component. [0012] Examples of luminescent tags that produce signals include, but are not limited to bioluminescence and chemiluminescence. Examples of suitable fluorescent tags include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue.TM., and Texas Red. Other suitable optical dyes are described in the Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6.sup.th ed.).

[0013] In some aspects, the MHC polypeptide and peptide are operatively linked. The term “operatively linked” refers to a situation where two components are combined or capable of combining to form a complex. For example, the components may be covalently attached and/or on the same polypeptide, such as in a fusion protein or the components may have a certain degree of binding affinity for each other, such as a binding affinity that occurs through van der Waals forces. Accordingly, aspects of the disclosure relate to wherein the MHC polypeptide and peptide are operatively linked through a peptide bond. Further aspects relate to wherein the MHC polypeptide and peptide are operatively linked through van der Waals forces. In some aspects, at least two MHC polypeptides are linked to one peptide. In other aspects, the average ratio of MHC polypeptides to peptides is 4:1. In some aspects, the ratio or average ratio is at least, at most, or about 1, 2, 3, 4, 5, or 6 to about 1, 2, 3, 4, 5, or 6 (or any derivable range therein).

[0014] In some aspects, the compositions of the disclosure are formulated as a vaccine. In some aspects, the composition further comprises an adjuvant.

[0015] In some aspects regarding the dendritic cells of the disclosure, the dendritic cell comprises a mature dendritic cell. In some aspects, the cell is a cell with an HLA-A type. In some aspects, the cell is an HLA-A3 or HLA-A11 type. In some aspects, the method further comprises isolating the expressed peptide or polypeptide. In some aspects, the T cell comprises a CD8+ T cell. In some aspects, the T cell is a CD4+ T cell, a Thl, Th2, Thl7, Th9, or Tfh T cell, a cytotoxic T cell, a memory T cell, a central memory T cell, or an effector memory T cell,

[0016] In some aspects of the disclosure, the peptide is complexed with MHC. In some aspects, the peptide is complexed with MHC. In some aspects, the MHC comprises HLA-A type. In some aspects, the MHC comprises HLA-A3 or HLA-A11 type. In some aspects, the peptides are loaded onto dendritic cells, lymphoblastoid cells, peripheral blood mononuclear cells (PBMCs), artificial antigen presentation cells (aAPC) or artificial antigen presenting surfaces. In some aspects, the artificial antigen presenting surface comprises a MHC polpeptide conjugated or linked to a surface. Exemplary surfaces include a bead, microplate, glass slide, or cell culture plate.

[0017] In some aspects, the T cell is autologous. In some aspects, the T cell is isolated from a subject having an active coronavims infection. In some aspects, the T cell is isolated from a subject having an active SARS-CoV-2 or SARS-CoV infection. In some aspects, the T cell is isolated from a subject that has recovered from a coronavims infection. In some aspects, the T cell is isolated from a subject that has recovered from a SARS-CoV-2 or SARS-CoV infection. In some aspects, the subject does not have or has not had a coronavims infection. In some aspects, the subject does not have or has not had a SARS-CoV-2 or SARS-CoV infection. In some aspects, the subject has been determined to not have antibodies to a coronavims protein. In some aspects, the T cell is allogenic. In some aspects, the subject has and/or has been diagnosed with a coronavims infection. In some aspects, the subject has and/or has been diagnosed with COVID-19. In some aspects, the subject has and/or has been diagnosed with SARS. In some aspects, the subject has been diagnosed with complications relating to a coronavims infection. In some aspects, the subject has been diagnosed with complications relating to COVID-19 or SARS. In some aspects, the complication comprises pneumonia. In some aspects, the subject has not been diagnosed with a coronavims. In some aspects, the complication comprises pneumonia. In some aspects, the subject has not been diagnosed with COVID-19 or SARS. In some aspects, the method further comprises administering an additional treatment such as a second therapeutic agent. In some aspects, the additional treatment or second therapeutic agent is an additional agent described herein. In some aspects, the additional agent is an antiviral agent. In some aspects, the subject is vaccinated against a coronavims. In some aspects, the subject is vaccinated against SARS- CoV-2 or SARS-CoV. In some aspects, the subject described in the methods of the disclosure is a human. In some aspects, the subject is a laboratory animal, such as mouse, rat, pig, horse, rabbit, or guinea pig.

[0018] In some aspects, a method of the disclosure further comprises counting the number of T cells bound with peptide and/or MHC. In some aspects, the composition comprising T cells is isolated from a patient having or suspected of having a coronavirus infection. In some aspects, the composition comprising T cells is isolated from a patient having or suspected of having COVID- 19 or S ARS . In some aspects, the method further comprises sorting the number of T cells bound with peptide and/or MHC. In some aspects, the method further comprises sequencing one or more TCR genes from T cells bound with peptide and/or MHC. In some aspects, the method comprises or further comprises sequencing the TCR alpha and/or beta gene(s) from a TCR, such as a TCR that binds to a peptide of the disclosure. In some aspects, the method further comprises grouping of lymphocyte interactions by paratope hotspots (GLIPH) analysis. This is further described in Glanville et al., Nature. 2017 Jul 6; 547(7661): 94-98, which is herein incorporated by reference.

[0019] In some aspects, the composition of the disclosure has been determined to be serum- free, mycoplasma-free, endotoxin-free, and/or sterile. In some aspects, the method further comprises culturing the cell in media, incubating the cell at conditions that allow for the division of the cell, screening the cell, and/or freezing the cell. In some aspects, the method further comprises isolating the expressed peptide or polypeptide from a cell of the disclosure. [0020] In some aspects the methods of the disclosure further comprise screening the dendritic cell for one or more cellular properties. In some aspects, the method further comprises contacting the cell with one or more cytokines or growth factors. In some aspects, the one or more cytokines or growth factors comprises GM-CSF. In some aspects, the cellular property comprises cell surface expression of one or more of CD86, HLA, and CD 14. In some aspects, the dendritic cell is derived from a CD34+ hematopoietic stem or progenitor cell. In some aspects, the contacting in the methods of the disclosure is further defined as co-culturing the starting population of immune effector cells with antigen presenting cells (APCs), wherein the APCs present the coronavirus peptide on their surface. In some aspects, the APCs are dendritic cells. In some aspects, the dendritic cell is derived from a peripheral blood monocyte (PBMC). In some aspects, the dendritic cells are isolated from PBMCs. In some aspects, the dendritic cells are cells in which the DCs are derived from are isolated by leukaphereses. [0021] In some aspects, the immune effector cells are T cells, peripheral blood lymphocytes, NK cells, invariant NK cells, NKT cells. In some aspects, the immune effector cells have been differentiated from mesenchymal stem cell (MSC) or induced pluripotent stem (iPS) cells. In some aspects, the T cells are CD8⁺ T cells, CD4⁺ T cells, or gd T cells. In some aspects, the T cells are cytotoxic T lymphocytes (CTLs).

[0022] In some aspects of the disclosure, obtaining, as defined in the methods described herein, comprises isolating the starting population of immune effector cells from peripheral blood mononuclear cells (PBMCs). In some aspects, the starting population of immune effector cells is obtained from a subject. In some aspects, the methods of the disclosure comprise or further comprise introducing the coronavirus peptides or a nucleic acid encoding the coronavirus peptide into the dendritic cells prior to the co-culturing. The introduction of the peptide may be done by transfecting or infecting dendritic cells with a nucleic acid encoding the peptide or by incubating the peptide with the dendritic cells. In some aspects, the peptide or nucleic acids encoding the peptide are introduced by electroporation. Other methods of transfer of nucleic acids are known in the art, such as lipofection, calcium phosphate transfection, transfection with DEAE-dextran, microinjection, and virus-mediated transduction. In some aspects, the peptide or nucleic acids encoding the peptide are introduced by adding the peptide or nucleic acid encoding the peptide to the dendritic cell culture media. In some aspects, the immune effector cells are co-cultured with a second population of dendritic cells into which the peptide or the nucleic acid encoding the peptide has been introduced. In some aspects, a population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells are purified from the immune effector cells following the co-culturing. In some aspects, a clonal population of coronavirus-specific immune effector cells are generated by limiting or serial dilution followed by expansion of individual clones by a rapid expansion protocol. [0023] In some aspects, purifying further comprises generation of a clonal population of coronavirus-specific immune effector cells by limiting or serial dilution of sorted cells followed by expansion of individual clones by a rapid expansion protocol. In some aspects, methods of the disclosure comprise or further comprise cloning of a T cell receptor (TCR) from the clonal population of coronavirus-specific immune effector cells. In some aspects, the term isolating in the methods of the disclosure is defined as cloning of a T cell receptor (TCR) from the clonal population of coronavirus-specific immune effector cells. In some aspects, cloning of the TCR is cloning of a TCR alpha and a beta chain. In some aspects, the TCR is cloned using a 5’- Rapid amplification of cDNA ends (RACE) method. In some aspects, the TCR alpha and beta chains are cloned using a 5 ’-Rapid amplification of cDNA ends (RACE) method. In some aspects, the cloned TCR is subcloned into an expression vector. In some aspects, the expression vector comprises a linker domain between the TCR alpha sequence and TCR beta sequence. In some aspects, the expression vector is a retroviral or lentiviral vector. In some aspects, the vector is an expression vector described herein. In some aspects, the linker domain comprises a sequence encoding one or more peptide cleavage sites. In some aspects, the one or more cleavage sites are a Furin cleavage site and/or a P2A cleavage site. In some aspects, the TCR alpha sequence and TCR beta sequence are linked by an IRES sequence.

[0024] In some aspects, a host cell is transduced with the expression vector to generate an engineered cell that expresses the TCR alpha and/or beta chains. In some aspects, the host cell is an immune cell. In some aspects, the immune cell is a T cell and the engineered cell is an engineered T cell. In some aspects, the T cell is type of T cell described herein, such as a CD8⁺ T cell, CD4+ T cell, or gd T cell and the engineered cell is an engineered T cell. In some aspects, the starting population of immune effector cells is obtained from a subject with a coronavirus infection and the host cell is allogeneic or autologous to the subject. In some aspects, the SARS-COV-2-specific T cells are autologous or allogeneic. In some aspects, a population of CD8-positive and coronavirus peptide MHC tetramer-positive engineered T cells are purified from the transduced host cells. In some aspects, a clonal population of coronavims- specific engineered T cells are generated by limiting or serial dilution followed by expansion of individual clones by a rapid expansion protocol. In some aspects, purifying in the methods of the disclosure is defined as purifying a population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells from the immune effector cells following the co-culturing. In some aspects, the population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells are purified by fluorescence activated cell sorting (FACS).

[0025] In alternative aspects of the disclosure, the coronavirus is not SARS-Co-V or MERS. [0026] In some aspects of the disclosure, the biological sample comprises a blood sample or a fraction thereof. In some aspects, the biological sample comprises lymphocytes. In some aspects, the biological sample comprises a fractionated sample comprising lymphocytes. In some aspects, the biological sample is from a patient that has been diagnosed with a coronavirus infection. In some aspects, the biological sample is from a patient that has not been test and/or has not been diagnosed with a coronavirus infection. In some aspects, the peptide is linked to a solid support. In some aspects, the peptide is conjugated to the solid support or is bound to an antibody that is conjugated to the solid support. In some aspects, the solid support comprises a microplate, a bead, a glass surface, a slide, or a cell culture dish. In some aspects, detecting T cell responses comprises detecting the binding of the peptide to the T cell or TCR. In some aspects, detecting T cell responses comprises an ELISA, ELISPOT, or a tetramer assay.

- Si - [0027] In some aspects, the method comprises administering a cell or a composition comprising a cell and wherein the cell comprises an autologous cell. In some aspects, the cell comprises a non- autologous cell.

[0028] Throughout this application, the term “about” is used according to its plain and ordinary meaning in the area of cell and molecular biology to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. [0029] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0030] The phrase “and/or” means “and” or “or”. To illustrate, A, B, and/or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and/or” operates as an inclusive or.

[0031] The words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0032] The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of’ any of the ingredients or steps disclosed throughout the specification. Compositions and methods “consisting essentially of’ any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed invention.

[0033] Any method in the context of a therapeutic, diagnostic, or physiologic purpose or effect may also be described in “use” claim language such as “Use of’ any compound, composition, or agent discussed herein for achieving or implementing a described therapeutic, diagnostic, or physiologic purpose or effect.

[0034] Use of the one or more sequences or compositions may be employed based on any of the methods described herein. Other embodiments are discussed throughout this application. Any embodiment discussed with respect to one aspect of the disclosure applies to other aspects of the disclosure as well and vice versa.

[0035] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention. [0036] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0038] FIG. 1 shows the experimental procedure used to discover novel SARS-CoV-2 HLA-A3/A11 restricted peptides.

[0039] FIG. 2 shows the identification of a HLA-A3 and HLA-A11 restricted peptide of SARS-CoV-2 with MS.

[0040] FIG. 3 shows the location of the identified SARS-CoV-2 MHC binding peptide in the viral genome.

[0041] FIG. 4 shows FACS plots of tetramer assays that demonstrate the generation of SARS-CoV-2 peptide specific CTL generation.

[0042] FIG. 5A-C shows three transcripts assembled from 64 K562 RNA-seq data analyses.

[0043] FIG. 6 shows the consensus sequence based on measurement systems analysis (MSA).

[0044] FIG. 7 shows that the target sequence is located on a consensus region.

[0045] FIG. 8 shows analysis of peptide sequences of SEQ ID NO:l in “normal” lung/blood.

[0046] FIG. 9 shows structural variant calling.

DETAILED DESCRIPTION OF THE INVENTION I. Applications of antigenic peptides

[0047] Various aspects are directed to development of and use of antigenic peptides that that are useful for treating and preventing COVID-19. In many aspects, antigenic peptides are produced by chemical synthesis or by molecular expression in a host cell. Peptides can be purified and utilized in a variety of applications including (but not limited to) assays to determine peptide immunogenicity, assays to determine recognition by T cells, peptide vaccines for treatment of SARS-CoV-2, development of modified TCRs of T cells, and development of antibodies.

[0048] Peptides can be synthesized chemically by a number of methods. One common method is to use solid-phase peptide synthesis (SPPS). Generally, SPPS is performed by repeating cycles of alternate N-terminal deprotection and coupling reactions, building peptides from the c-terminus to the n-terminus. The c-terminus of the first amino acid is coupled the resin, wherein then the amine is deprecated and then coupled with the free acid of the second amino acid. This cycle repeats until the peptide is synthesized.

[0049] Peptides can also be synthesized utilizing molecular tools and a host cell. Nucleic acid sequences corresponding with antigenic peptides can be synthesized. In some aspects, synthetic nucleic acids synthesized in in vitro synthesizers (e.g., phosphoramidite synthesizer), bacterial recombination system, or other suitable methods. Furthermore, synthesized nucleic acids can be purified and lyophilized, or kept stored in a biological system (e.g., bacteria, yeast). For use in a biological system, synthetic nucleic acid molecules can be inserted into a plasmid vector, or similar. A plasmid vector can also be an expression vector, wherein a suitable promoter and a suitable 3’-polyA tail is combined with the transcript sequence.

[0050] Aspects are also directed to expression vectors and expression systems that produce antigenic peptides or proteins. These expression systems can incorporate an expression vector to express transcripts and proteins in a suitable expression system. Typical expression systems include bacterial (e.g., E. coli), insect (e.g., SF9), yeast (e.g., S. cerevisiae), animal (e.g., CHO), or human (e.g., HEK 293) cell lines. RNA and/or protein molecules can be purified from these systems using standard biotechnology production procedures.

[0051] Assays to determine immunogenicity and/or TCR binding can be performed. One such as is the dextramer flow cytometry assay. Generally, custom-made HLA-matched MHC Class I dextramenpeptide (pMHC) complexes are developed or purchased (Immudex, Copenhagen, Denmark). T cells from peripheral blood mononuclear cells (PBMCs) or tumor- infiltrating lymphocytes (TILs) are incubated the pMHC complexes and stained, which are then run through a flow cytometer to determine if the peptide is capable of binding a TCR of a T cell.

[0052] The peptides of the disclosure can also be used to isolate and/or identify T-cell receptors that bind to the peptide. T-cell receptors comprise two different polypeptide chains, termed the T-cell receptor a (TCRa) and b (TCRP) chains, linked by a disulfide bond. These a:b heterodimers are very similar in structure to the Fab fragment of an immunoglobulin molecule, and they account for antigen recognition by most T cells. A minority of T cells bear an alternative, but structurally similar, receptor made up of a different pair of polypeptide chains designated g and d. Both types of T-cell receptor differ from the membrane-bound immunoglobulin that serves as the B-cell receptor: a T-cell receptor has only one antigen binding site, whereas a B-cell receptor has two, and T-cell receptors are never secreted, whereas immunoglobulin can be secreted as antibody.

[0053] Both chains of the T-cell receptor have an amino-terminal variable (V) region with homology to an immunoglobulin V domain, a constant (C) region with homology to an immunoglobulin C domain, and a short hinge region containing a cysteine residue that forms the interchain disulfide bond. Each chain spans the lipid bilayer by a hydrophobic transmembrane domain, and ends in a short cytoplasmic tail.

[0054] The three-dimensional structure of the T-cell receptor has been determined. The structure is indeed similar to that of an antibody Fab fragment, as was suspected from earlier studies on the genes that encoded it. The T-cell receptor chains fold in much the same way as those of a Fab fragment, although the final structure appears a little shorter and wider. There are, however, some distinct differences between T-cell receptors and Fab fragments. The most striking difference is in the Ca domain, where the fold is unlike that of any other immunoglobulin-like domain. The half of the domain that is juxtaposed with the €b domain forms a b sheet similar to that found in other immunoglobulin-like domains, but the other half of the domain is formed of loosely packed strands and a short segment of a helix. The intramolecular disulfide bond, which in immunoglobulin-like domains normally joins two b strands, in a Ca domain joins a b strand to this segment of a helix.

[0055] There are also differences in the way in which the domains interact. The interface between the V and C domains of both T-cell receptor chains is more extensive than in antibodies, which may make the hinge joint between the domains less flexible. And the interaction between the Ca and Cb domains is distinctive in being assisted by carbohydrate, with a sugar group from the Ca domain making a number of hydrogen bonds to the Cb domain. Finally, a comparison of the variable binding sites shows that, although the complementarity determining region (CDR) loops align fairly closely with those of antibody molecules, there is some displacement relative to those of the antibody molecule. This displacement is particularly marked in the Va CDR2 loop, which is oriented at roughly right angles to the equivalent loop in antibody V domains, as a result of a shift in the b strand that anchors one end of the loop from one face of the domain to the other. A strand displacement also causes a change in the orientation of the nb CDR2 loop in two of the seven nb domains whose structures are known. As yet, the crystallographic structures of seven T-cell receptors have been solved to this level of resolution.

[0056] Aspects of the disclosure relate to engineered T cell receptors that bind a peptide of the disclosure, such as a peptide of SEQ ID NO:l. The term “engineered” refers to T cell receptors that have TCR variable regions grafted onto TCR constant regions to make a chimeric polypeptide that binds to peptides and antigens of the disclosure. In certain aspects, the TCR comprises intervening sequences that are used for cloning, enhanced expression, detection, or for therapeutic control of the construct, but are not present in endogenous TCRs, such as multiple cloning sites, linker, hinge sequences, modified hinge sequences, modified transmembrane sequences, a detection polypeptide or molecule, or therapeutic controls that may allow for selection or screening of cells comprising the TCR.

[0057] In some aspects, the TCR comprises non-TCR sequences. Accordingly, certain aspects relate to TCRs with sequences that are not from a TCR gene. In some aspects, the TCR is chimeric, in that it contains sequences normally found in a TCR gene, but contains sequences from at least two TCR genes that are not necessarily found together in nature.

II. Antibodies

[0058] Aspects of the disclosure relate to antibodies that target the peptides of the disclosure, or fragments thereof. The term “antibody” refers to an intact immunoglobulin of any isotype, or a fragment thereof that can compete with the intact antibody for specific binding to the target antigen, and includes chimeric, humanized, fully human, and bispecific antibodies. As used herein, the terms “antibody” or “immunoglobulin” are used interchangeably and refer to any of several classes of structurally related proteins that function as part of the immune response of an animal, including IgG, IgD, IgE, IgA, IgM, and related proteins, as well as polypeptides comprising antibody CDR domains that retain antigen-binding activity.

[0059] The term “antigen” refers to a molecule or a portion of a molecule capable of being bound by a selective binding agent, such as an antibody. An antigen may possess one or more epitopes that are capable of interacting with different antibodies.

[0060] The term “epitope” includes any region or portion of molecule capable eliciting an immune response by binding to an immunoglobulin or to a T-cell receptor. Epitope determinants may include chemically active surface groups such as amino acids, sugar side chains, phosphoryl or sulfonyl groups, and may have specific three-dimensional structural characteristics and/or specific charge characteristics. Generally, antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen within a complex mixture.

[0061] The epitope regions of a given polypeptide can be identified using many different epitope mapping techniques are well known in the art, including: x-ray crystallography, nuclear magnetic resonance spectroscopy, site-directed mutagenesis mapping, protein display arrays, see, e.g., Epitope Mapping Protocols, (Johan Rockberg and Johan Nilvebrant, Ed., 2018) Humana Press, New York, N.Y. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al. Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984); Geysen et al. Proc. Natl. Acad. Sci. USA 82:178-182 (1985); Geysen et al. Molec. Immunol. 23:709-715 (1986). Additionally, antigenic regions of proteins can also be predicted and identified using standard antigenicity and hydropathy plots.

[0062] The term “immunogenic sequence” means a molecule that includes an amino acid sequence of at least one epitope such that the molecule is capable of stimulating the production of antibodies in an appropriate host. The term “immunogenic composition” means a composition that comprises at least one immunogenic molecule (e.g., an antigen or carbohydrate).

[0063] An intact antibody is generally composed of two full-length heavy chains and two full-length light chains, but in some instances may include fewer chains, such as antibodies naturally occurring in camelids that may comprise only heavy chains. Antibodies as disclosed herein may be derived solely from a single source or may be “chimeric,” that is, different portions of the antibody may be derived from two different antibodies. For example, the variable or CDR regions may be derived from a rat or murine source, while the constant region is derived from a different animal source, such as a human. The antibodies or binding fragments may be produced in hybridomas, by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise indicated, the term “antibody” includes derivatives, variants, fragments, and muteins thereof, examples of which are described below (Sela-Culang et al., Front Immunol. 2013; 4: 302; 2013).

[0064] The term “light chain” includes a full-length light chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length light chain has a molecular weight of around 25,000 Daltons and includes a variable region domain (abbreviated herein as VL), and a constant region domain (abbreviated herein as CL). There are two classifications of light chains, identified as kappa (K) and lambda (l). The term “VL fragment” means a fragment of the light chain of a monoclonal antibody that includes all or part of the light chain variable region, including CDRs. A VL fragment can further include light chain constant region sequences. The variable region domain of the light chain is at the amino-terminus of the polypeptide.

[0065] The term “heavy chain” includes a full-length heavy chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length heavy chain has a molecular weight of around 50,000 Daltons and includes a variable region domain (abbreviated herein as VH), and three constant region domains (abbreviated herein as CHI, CH2, and CH3). The term “VH fragment” means a fragment of the heavy chain of a monoclonal antibody that includes all or part of the heavy chain variable region, including CDRs. A VH fragment can further include heavy chain constant region sequences. The number of heavy chain constant region domains will depend on the isotype. The VH domain is at the amino-terminus of the polypeptide, and the CH domains are at the carboxy-terminus, with the CH3 being closest to the — COOH end. The isotype of an antibody can be IgM, IgD, IgG, IgA, or IgE and is defined by the heavy chains present of which there are five classifications: mu (m), delta (d), gamma (g), alpha (a), or epsilon (e) chains, respectively. IgG has several subtypes, including, but not limited to, IgGl, IgG2, IgG3, and IgG4. IgM subtypes include IgMl and IgM2. IgA subtypes include IgAl and IgA2.

III. MHC Polypeptides

[0066] Aspects of the disclosure relate to compositions comprising MHC polypeptides. In some aspects, the MHC polypeptide comprises at least 2, 3, or 4 MHC polypeptides that may be expressed as separate polypeptides or as a fusion protein. Presentation of antigens to T cells is mediated by two distinct classes of molecules MHC class I (MHC-I) and MHC class II (MHC-II) (also identified as “pMHC” herein), which utilize distinct antigen processing pathways. Peptides derived from intracellular antigens are presented to CD8+ T cells by MHC class I molecules, which are expressed on virtually all cells, while extracellular antigen-derived peptides are presented to CD4+ T cells by MHC-II molecules. In certain aspects, a particular antigen is identified and presented in the antigen-MHC complex in the context of an appropriate MHC class I or II polypeptide. In certain aspects, the genetic makeup of a subject may be assessed to determine which MHC polypeptide is to be used for a particular patient and a particular set of peptides. In certain aspects, the MHC class 1 polypeptide comprises all or part of a HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G or CD-I molecule. In aspects wherein the MHC polypeptide is a MHC class II polypeptide, the MHC class II polypeptide can comprise all or a part of a HLA-DR, HLA-DQ, or HLA-DP. [0067] Non-classical MHC polypeptides are also contemplated for use in MHC complexes of the invention. Non-classical MHC polypeptides are non-polymorphic, conserved among species, and possess narrow, deep, hydrophobic ligand binding pockets. These binding pockets are capable of presenting glycolipids and phospholipids to Natural Killer T (NKT) cells or certain subsets of CD8+ T-cells such as Qal, HLA-E-restricted CD8+ T-cells, or MATT cells. NKT cells represent a unique lymphocyte population that co-express NK cell markers and a semi-invariant T cell receptor (TCR). They are implicated in the regulation of immune responses associated with a broad range of diseases.

IV. Host Cells

[0068] As used herein, the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. All of these terms also include both freshly isolated cells and ex vivo cultured, activated or expanded cells. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, “host cell” refers to a prokaryotic or eukaryotic cell, and it includes any transformable organism that is capable of replicating a vector or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors or viruses. A host cell may be “transfected” or “transformed,” which refers to a process by which exogenous nucleic acid, such as a recombinant protein-encoding sequence, is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny.

[0069] In certain aspects transfection can be carried out on any prokaryotic or eukaryotic cell. In some aspects electroporation involves transfection of a human cell. In other aspects electroporation involves transfection of an animal cell. In certain aspects transfection involves transfection of a cell line or a hybrid cell type. In some aspects the cell or cells being transfected are cancer cells, tumor cells or immortalized cells. In some instances tumor, cancer, immortalized cells or cell lines are induced and in other instances tumor, cancer, immortalized cells or cell lines enter their respective state or condition naturally. In certain aspects the cells or cell lines can be A549, B-cells, B16, BHK-21, C2C12, C6, CaCo-2, CAP/, CAP-T, CHO, CH02, CHO-DG44, CHO-K1, COS-1, Cos-7, CV-1, Dendritic cells, DLD-1, Embryonic Stem (ES) Cell or derivative, H1299, HEK, 293, 293T, 293FT, Hep G2, Hematopoietic Stem Cells, HOS, Huh-7, Induced Pluripotent Stem (iPS) Cell or derivative, Jurkat, K562, L5278Y, LNCaP, MCF7, MDA-MB-231, MDCK, Mesenchymal Cells, Min-6, Monocytic cell, Neuro2a, NIH 3T3, NIH3T3L1, K562, NK-cells, NS0, Panc-1, PC12, PC-3, Peripheral blood cells, Plasma cells, Primary Fibroblasts, RBL, Renca, RLE, SF21, SF9, SH-SY5Y, SK-MES-

1, SK-N-SH, SL3, SW403, Stimulus -triggered Acquisition of Pluripotency (STAP) cell or derivate SW403, T-cells, THP-1, Tumor cells, U20S, U937, peripheral blood lymphocytes, expanded T cells, hematopoietic stem cells, or Vero cells.

V. Additional Agents

[0070] In some aspects, the method further comprises administration of an additional agent. In some aspects, the additional agent is an immunostimulator. The term “immuno stimulator” as used herein refers to a compound that can stimulate an immune response in a subject, and may include an adjuvant. In some aspects, an immunostimulator is an agent that does not constitute a specific antigen, but can boost the strength and longevity of an immune response to an antigen. Such immunostimulators may include, but are not limited to stimulators of pattern recognition receptors, such as Toll-like receptors, RIG-1 and NOD-like receptors (NLR), mineral salts, such as alum, alum combined with monphosphoryl lipid (MPL) A of Enterobacteria, such as Escherihia coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri or specifically with MPL.RTM. (AS04), MPL A of above-mentioned bacteria separately, saponins, such as QS-21, Quil-A, ISCOMs, ISCOMATRIX, emulsions such as MF59, Montanide, ISA 51 and ISA 720, AS02 (QS21+squalene+MPL.), liposomes and liposomal formulations such as AS01, synthesized or specifically prepared microparticles and microcarriers such as bacteria-derived outer membrane vesicles (OMV) of N. gonorrheae, Chlamydia trachomatis and others, or chitosan particles, depot-forming agents, such as Pluronic block co-polymers, specifically modified or prepared peptides, such as muramyl dipeptide, aminoalkyl glucosaminide 4-phosphates, such as RC529, or proteins, such as bacterial toxoids or toxin fragments.

[0071] In some aspects, the additional agent comprises an agonist for pattern recognition receptors (PRR), including, but not limited to Toll-Like Receptors (TLRs), specifically TLRs

2, 3, 4, 5, 7, 8, 9 and/or combinations thereof. In some aspects, additional agents comprise agonists for Toll-Like Receptors 3, agonists for Toll-Like Receptors 7 and 8, or agonists for Toll-Like Receptor 9; preferably the recited immunostimulators comprise imidazoquinolines; such as R848; adenine derivatives, such as those disclosed in U.S. Pat. No. 6,329,381, U.S. Published Patent Application 2010/0075995, or WO 2010/018132; immuno stimulatory DNA; or immunostimulatory RNA. In some aspects, the additional agents also may comprise immuno stimulatory RNA molecules, such as but not limited to dsRNA, poly I:C or poly Lpoly C12U (available as Ampligen.RTM., both poly I:C and poly I:polyC12U being known as TLR3 stimulants), and/or those disclosed in F. Heil et al., "Species-Specific Recognition of Single- Stranded RNA via Toll-like Receptor 7 and 8" Science 303(5663), 1526-1529 (2004); J. Vollmer et al., "Immune modulation by chemically modified ribonucleosides and oligoribonucleotides" WO 2008033432 A2; A. Forsbach et al., "Immunostimulatory oligoribonucleotides containing specific sequence motif(s) and targeting the Toll-like receptor 8 pathway" WO 2007062107 A2; E. Uhlmann et al., "Modified oligoribonucleotide analogs with enhanced immunostimulatory activity" U.S. Pat. Appl. Publ. US 2006241076; G. Lipford et al., "Immunostimulatory viral RNA oligonucleotides and use for treating cancer and infections" WO 2005097993 A2; G. Lipford et al., "Immunostimulatory G,U-containing oligoribonucleotides, compositions, and screening methods" WO 2003086280 A2. In some aspects, an additional agent may be a TLR-4 agonist, such as bacterial lipopolysaccharide (LPS), VSV-G, and/or HMGB-1. In some aspects, additional agents may comprise TLR-5 agonists, such as flagellin, or portions or derivatives thereof, including but not limited to those disclosed in U.S. Pat. Nos. 6,130,082, 6,585,980, and 7,192,725.

[0072] In some aspects, additional agents may be proinflammatory stimuli released from necrotic cells (e.g., urate crystals). In some aspects, additional agents may be activated components of the complement cascade (e.g., CD21, CD35, etc.). In some aspects, additional agents may be activated components of immune complexes. Additional agents also include complement receptor agonists, such as a molecule that binds to CD21 or CD35. In some aspects, the complement receptor agonist induces endogenous complement opsonization of the synthetic nanocarrier. In some aspects, immunostimulators are cytokines, which are small proteins or biological factors (in the range of 5 kD-20 kD) that are released by cells and have specific effects on cell-cell interaction, communication and behavior of other cells. In some aspects, the cytokine receptor agonist is a small molecule, antibody, fusion protein, or aptamer. VI. Proteinaceous Compositions

[0073] As used herein, a “protein” “peptide” or “polypeptide” refers to a molecule comprising at least five amino acid residues. As used herein, the term “wild-type” refers to the endogenous version of a molecule that occurs naturally in an organism. In some aspects, wild- type versions of a protein or polypeptide are employed, however, in many aspects of the disclosure, a modified protein or polypeptide is employed to generate an immune response. The terms described above may be used interchangeably. A “modified protein” or “modified polypeptide” or a “variant” refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, is altered with respect to the wild-type protein or polypeptide. In some aspects, a modified/variant protein or polypeptide has at least one modified activity or function (recognizing that proteins or polypeptides may have multiple activities or functions). It is specifically contemplated that a modified/variant protein or polypeptide may be altered with respect to one activity or function yet retain a wild-type activity or function in other respects, such as immunogenicity.

[0074] Where a protein is specifically mentioned herein, it is in general a reference to a native (wild-type) or recombinant (modified) protein or, optionally, a protein in which any signal sequence has been removed. The protein may be isolated directly from the organism of which it is native, produced by recombinant DNA/exogenous expression methods, or produced by solid-phase peptide synthesis (SPPS) or other in vitro methods. In particular aspects, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences that encode a polypeptide (e.g., an antibody or fragment thereof). The term “recombinant” may be used in conjunction with a polypeptide or the name of a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is a replication product of such a molecule.

[0075] In certain aspects the size of a peptide, protein, or polypeptide (wild-type or modified), such as a peptide or protein of the disclosure comprising SEQ ID NO:l may comprise, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,

23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000,

2250, 2500 amino acid residues or greater, and any range derivable therein. It is contemplated that polypeptides may be mutated by truncation, rendering them shorter than their corresponding wild-type form, also, they might be altered by fusing or conjugating a heterologous protein or polypeptide sequence with a particular function (e.g., for targeting or localization, for enhanced immunogenicity, for purification purposes, etc.).

[0076] The polypeptides, proteins, or polynucleotides encoding such polypeptides or proteins of the disclosure may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,

44, 45, 46, 47, 48, 49, or 50 (or any derivable range therein) or more variant amino acids or nucleic acid substitutions or be at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) similar, identical, or homologous in sequence to at least, or at most 3, 4, 5, 6, 7, 8, or 9 contiguous amino acids of SEQ ID NO 1 or nucleic acids encoding SEQ ID NO:l. In certain aspects, the peptide or polypeptide is not naturally occurring and/or is in a combination of peptides or polypeptides.

[0077] In some aspects, the protein or polypeptide may comprise amino acids 1 to 2, 3, 4, 5, 6, 7, 8, or 9 (or any derivable range therein) of SEQ ID NO:l. In some aspects, the peptides of the disclosure comprise at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,

40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 (or any derivable range therein) flanking the carboxy and/or flanking the amino end of a peptide comprising or consisting of 3, 4, 5, 6, 7, 8, or 9 contiguous amino acids of SEQ ID NO:l.

[0078] In some aspects, the protein, polypeptide, or nucleic acid may comprise 1, 2, 3, 4, 5, 6, 7, 8, or 9 (or any derivable range therein) contiguous amino acids of SEQ ID NOs:l.

[0079] In some aspects, the polypeptide, protein, or nucleic acid may comprise at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, or 9 (or any derivable range therein) contiguous amino acids of SEQ ID NO:l that are at least, at most, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) similar, identical, or homologous to SEQ ID NOS:l.

[0080] In some aspects there is a nucleic acid molecule or polypeptide starting at position 1, 2, 3, 4, 5, 6, 7, 8 or 9 of SEQ ID NO:l and comprising at least, at most, or exactly 2, 3, 4, or 5, 6 (or any derivable range therein) contiguous amino acids of SEQ ID NO:l.

[0081] It is contemplated that in compositions of the disclosure, there is between about 0.001 mg and about 10 mg of total polypeptide, peptide, and/or protein per ml. The concentration of protein in a composition can be about, at least about or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg/ml or more (or any range derivable therein). [0082] The following is a discussion of changing the amino acid subunits of a protein to create an equivalent, or even improved, second-generation variant polypeptide or peptide. For example, certain amino acids may be substituted for other amino acids in a protein or polypeptide sequence with or without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein’ s functional activity, certain amino acid substitutions can be made in a protein sequence and in its corresponding DNA coding sequence, and nevertheless produce a protein with similar or desirable properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes which encode proteins without appreciable loss of their biological utility or activity.

[0083] The term “functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six different codons for arginine. Also considered are “neutral substitutions” or “neutral mutations” which refers to a change in the codon or codons that encode biologically equivalent amino acids.

[0084] Amino acid sequence variants of the disclosure can be substitutional, insertional, or deletion variants. A variation in a polypeptide of the disclosure may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,

34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more non-contiguous or contiguous amino acids of the protein or polypeptide, as compared to wild-type (or any range derivable therein). A variant can comprise an amino acid sequence that is at least 50%, 60%, 70%, 80%, or 90%, including all values and ranges there between, identical to any sequence provided or referenced herein. A variant can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more substitute amino acids.

[0085] It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids, or 5' or 3' sequences, respectively, and yet still be essentially identical as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region.

[0086] Deletion variants typically lack one or more residues of the native or wild type protein. Individual residues can be deleted or a number of contiguous amino acids can be deleted. A stop codon may be introduced (by substitution or insertion) into an encoding nucleic acid sequence to generate a truncated protein.

[0087] Insertional mutants typically involve the addition of amino acid residues at a non terminal point in the polypeptide. This may include the insertion of one or more amino acid residues. Terminal additions may also be generated and can include fusion proteins which are multimers or concatemers of one or more peptides or polypeptides described or referenced herein.

[0088] Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein or polypeptide, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar chemical properties. “Conservative amino acid substitutions” may involve exchange of a member of one amino acid class with another member of the same class. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Conservative amino acid substitutions may encompass non-naturally occurring amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptidomimetics or other reversed or inverted forms of amino acid moieties. [0089] Alternatively, substitutions may be “non-conservative”, such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting an amino acid residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa. Non-conservative substitutions may involve the exchange of a member of one of the amino acid classes for a member from another class.

[0090] One skilled in the art can determine suitable variants of polypeptides as set forth herein using well-known techniques. One skilled in the art may identify suitable areas of the molecule that may be changed without destroying activity by targeting regions not believed to be important for activity. The skilled artisan will also be able to identify amino acid residues and portions of the molecules that are conserved among similar proteins or polypeptides. In further aspects, areas that may be important for biological activity or for structure may be subject to conservative amino acid substitutions without significantly altering the biological activity or without adversely affecting the protein or polypeptide structure.

[0091] In making such changes, the hydropathy index of amino acids may be considered. The hydropathy profile of a protein is calculated by assigning each amino acid a numerical value (“hydropathy index”) and then repetitively averaging these values along the peptide chain. Each amino acid has been assigned a value based on its hydrophobicity and charge characteristics. They are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (^_0.7); serine ( 0.8); tryptophan ( 0.9); tyrosine (-1.3); proline (1.6); histidine ( 3.2); glutamate (-3.5); glutamine ( 3.5); aspartate ( 3.5); asparagine ( 3.5); lysine ( 3.9); and arginine ( 4.5). The importance of the hydropathy amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte et al., J. Mol. Biol. 157:105-131 (1982)). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein or polypeptide, which in turn defines the interaction of the protein or polypeptide with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and others. It is also known that certain amino acids may be substituted for other amino acids having a similar hydropathy index or score, and still retain a similar biological activity. In making changes based upon the hydropathy index, in certain aspects, the substitution of amino acids whose hydropathy indices are within +2 is included. In some aspects of the invention, those that are within +1 are included, and in other aspects of the invention, those within +0.5 are included.

[0092] It also is understood in the art that the substitution of like amino acids can be effectively made based on hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. In certain aspects, the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigen binding, that is, as a biological property of the protein. The following hydrophilicity values have been assigned to these amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0+1); glutamate (+3.0+1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine ( 0.4); proline (-0.5+1); alanine ( 0.5); histidine ( 0.5); cysteine (-1.0); methionine (-1.3); valine ( 1.5); leucine ( 1.8); isoleucine ( 1.8); tyrosine ( 2.3); phenylalanine ( 2.5); and tryptophan (-3.4). In making changes based upon similar hydrophilicity values, in certain aspects, the substitution of amino acids whose hydrophilicity values are within +2 are included, in other aspects, those which are within +1 are included, and in still other aspects, those within +0.5 are included. In some instances, one may also identify epitopes from primary amino acid sequences based on hydrophilicity. These regions are also referred to as “epitopic core regions.” It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein.

[0093] Additionally, one skilled in the art can review structure-function studies identifying residues in similar polypeptides or proteins that are important for activity or structure. In view of such a comparison, one can predict the importance of amino acid residues in a protein that correspond to amino acid residues important for activity or structure in similar proteins. One skilled in the art may opt for chemically similar amino acid substitutions for such predicted important amino acid residues.

[0094] One skilled in the art can also analyze the three-dimensional structure and amino acid sequence in relation to that structure in similar proteins or polypeptides. In view of such information, one skilled in the art may predict the alignment of amino acid residues of a polypeptide with respect to its three-dimensional structure. One skilled in the art may choose not to make changes to amino acid residues predicted to be on the surface of the protein, since such residues may be involved in important interactions with other molecules. Moreover, one skilled in the art may generate test variants containing a single amino acid substitution at each desired amino acid residue. These variants can then be screened using standard assays for binding and/or activity, thus yielding information gathered from such routine experiments, which may allow one skilled in the art to determine the amino acid positions where further substitutions should be avoided either alone or in combination with other mutations. Various tools available to determine secondary structure can be found on the world wide web at expasy . org/proteomic s/pro tein_s tructure .

[0095] In some aspects of the invention, amino acid substitutions are made that: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter ligand or antigen binding affinities, and/or (5) confer or modify other physicochemical or functional properties on such polypeptides. For example, single or multiple amino acid substitutions (in certain aspects, conservative amino acid substitutions) may be made in the naturally occurring sequence. Substitutions can be made in that portion of the antibody that lies outside the domain(s) forming intermolecular contacts. In such aspects, conservative amino acid substitutions can be used that do not substantially change the structural characteristics of the protein or polypeptide (e.g., one or more replacement amino acids that do not disrupt the secondary structure that characterizes the native antibody). VII. Nucleic Acids

[0096] In certain aspects, nucleic acid sequences can exist in a variety of instances such as: isolated segments and recombinant vectors of incorporated sequences or recombinant polynucleotides encoding peptides and polypeptides of the disclosure, or a fragment, derivative, mutein, or variant thereof, polynucleotides sufficient for use as hybridization probes, PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide, anti-sense nucleic acids for inhibiting expression of a polynucleotide, and complementary sequences of the foregoing described herein. Nucleic acids encoding fusion proteins that include these peptides are also provided. The nucleic acids can be single-stranded or double- stranded and can comprise RNA and/or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids).

[0097] The term “polynucleotide” refers to a nucleic acid molecule that either is recombinant or has been isolated from total genomic nucleic acid. Included within the term “polynucleotide” are oligonucleotides (nucleic acids 100 residues or less in length), recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like. Polynucleotides include, in certain aspects, regulatory sequences, isolated substantially away from their naturally occurring genes or protein encoding sequences. Polynucleotides may be single- stranded (coding or antisense) or double- stranded, and may be RNA, DNA (genomic, cDNA or synthetic), analogs thereof, or a combination thereof. Additional coding or non coding sequences may, but need not, be present within a polynucleotide.

[0098] In this respect, the term “gene,” “polynucleotide,” or “nucleic acid” is used to refer to a nucleic acid that encodes a protein, polypeptide, or peptide (including any sequences required for proper transcription, post-translational modification, or localization). As will be understood by those in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence encoding all or a portion of such a polypeptide. It also is contemplated that a particular polypeptide may be encoded by nucleic acids containing variations having slightly different nucleic acid sequences but, nonetheless, encode the same or substantially similar protein.

[0099] In certain aspects, there are polynucleotide variants having substantial identity to the sequences disclosed herein; those comprising at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, including all values and ranges there between, compared to a polynucleotide sequence provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). In certain aspects, the isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that has at least 90%, preferably 95% and above, identity to an amino acid sequence described herein, over the entire length of the sequence; or a nucleotide sequence complementary to said isolated polynucleotide.

[0100] The nucleic acid segments, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. The nucleic acids can be any length. They can be, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000 or more nucleotides in length, and/or can comprise one or more additional sequences, for example, regulatory sequences, and/or be a part of a larger nucleic acid, for example, a vector. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol. In some cases, a nucleic acid sequence may encode a polypeptide sequence with additional heterologous coding sequences, for example to allow for purification of the polypeptide, transport, secretion, post-translational modification, or for therapeutic benefits such as targeting or efficacy. As discussed above, a tag or other heterologous polypeptide may be added to the modified polypeptide-encoding sequence, wherein “heterologous” refers to a polypeptide that is not the same as the modified polypeptide.

A. Hybridization

[0101] The nucleic acids that hybridize to other nucleic acids under particular hybridization conditions. Methods for hybridizing nucleic acids are well known in the art. See, e.g., Current Protocols in Molecular Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. As defined herein, a moderately stringent hybridization condition uses a prewashing solution containing 5x sodium chloride/sodium citrate (SSC), 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization buffer of about 50% formamide, 6xSSC, and a hybridization temperature of 55° C. (or other similar hybridization solutions, such as one containing about 50% formamide, with a hybridization temperature of 42° C), and washing conditions of 60° C. in 0.5xSSC, 0.1% SDS. A stringent hybridization condition hybridizes in 6xSSC at 45° C., followed by one or more washes in O.lxSSC, 0.2% SDS at 68° C. Furthermore, one of skill in the art can manipulate the hybridization and/or washing conditions to increase or decrease the stringency of hybridization such that nucleic acids comprising nucleotide sequence that are at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to each other typically remain hybridized to each other. [0102] The parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by, for example, Sambrook, Fritsch, and Maniatis (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11 (1989); Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley and Sons, Inc., sections 2.10 and 6.3-6.4 (1995), both of which are herein incorporated by reference in their entirety for all purposes) and can be readily determined by those having ordinary skill in the art based on, for example, the length and/or base composition of the DNA.

1. Mutation

[0103] Changes can be introduced by mutation into a nucleic acid, thereby leading to changes in the amino acid sequence of a polypeptide (e.g., an antigenic peptide or polypeptide) that it encodes. Mutations can be introduced using any technique known in the art. In one aspect, one or more particular amino acid residues are changed using, for example, a site- directed mutagenesis protocol. In another aspect, one or more randomly selected residues are changed using, for example, a random mutagenesis protocol. However it is made, a mutant polypeptide can be expressed and screened for a desired property.

[0104] Mutations can be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one can make nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues. Alternatively, one or more mutations can be introduced into a nucleic acid that selectively changes the biological activity of a polypeptide that it encodes. See, eg., Romain Studer et al., Biochem. J. 449:581-594 (2013). For example, the mutation can quantitatively or qualitatively change the biological activity. Examples of quantitative changes include increasing, reducing or eliminating the activity. Examples of qualitative changes include altering the antigen specificity of an antibody.

2. Probes

[0105] In another aspect, nucleic acid molecules are suitable for use as primers or hybridization probes for the detection of nucleic acid sequences. A nucleic acid molecule can comprise only a portion of a nucleic acid sequence encoding a full-length polypeptide, for example, a fragment that can be used as a probe or primer or a fragment encoding an active portion of a given polypeptide.

[0106] In another aspect, the nucleic acid molecules may be used as probes or PCR primers for specific nucleic acid sequences. For instance, a nucleic acid molecule probe may be used in diagnostic methods or a nucleic acid molecule PCR primer may be used to amplify regions of DNA that could be used, inter alia, to isolate nucleic acid sequences for use in producing the engineered cells of the disclosure. In a preferred aspect, the nucleic acid molecules are oligonucleotides. In a more preferred aspect, the oligonucleotides are from a coronavirus genome.

[0107] Probes based on the desired sequence of a nucleic acid can be used to detect the nucleic acid or similar nucleic acids, for example, transcripts encoding a polypeptide of interest. The probe can comprise a label group, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used to identify a cell that expresses the polypeptide.

VIII. Polypeptide Expression

[0108] In some aspects, there are nucleic acid molecule encoding polypeptides or peptides of the disclosure (e.g antibodies, TCR genes, MHC molecules, and immunogenic peptides). These may be generated by methods known in the art, e.g., isolated from B cells of mice that have been immunized and isolated, phage display, expressed in any suitable recombinant expression system and allowed to assemble to form antibody molecules or by recombinant methods.

[0109] The nucleic acid molecules may be used to express large quantities of polypeptides. If the nucleic acid molecules are derived from a non-human, non-transgenic animal, the nucleic acid molecules may be used for humanization of the antibody or TCR genes.

A. Vectors

[0110] In some aspects, contemplated are expression vectors comprising a nucleic acid molecule encoding a polypeptide of the desired sequence or a portion thereof (e.g., a fragment containing one or more CDRs or one or more variable region domains). Expression vectors comprising the nucleic acid molecules may encode the heavy chain, light chain, or the antigen binding portion thereof. In some aspects, expression vectors comprising nucleic acid molecules may encode fusion proteins, antigenic peptides and polypeptides, TCR genes, MHC molecules, modified antibodies, antibody fragments, and probes thereof. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.

[0111] To express the polypeptides or peptides of the disclosure, DNAs encoding the polypeptides or peptides are inserted into expression vectors such that the gene area is operatively linked to transcriptional and translational control sequences. In some aspects, a vector that encodes a functionally complete human CH or CL immunoglobulin sequence with appropriate restriction sites engineered so that any VH or VL sequence can be easily inserted and expressed. In some aspects, a vector that encodes a functionally complete human TCR alpha or TCR beta sequence with appropriate restriction sites engineered so that any variable sequence or CDR1, CDR2, and/or CDR3 can be easily inserted and expressed. Typically, expression vectors used in any of the host cells contain sequences for plasmid or vims maintenance and for cloning and expression of exogenous nucleotide sequences. Such sequences, collectively referred to as “flanking sequences” typically include one or more of the following operatively linked nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. Such sequences and methods of using the same are well known in the art.

B. Expression Systems

[0112] Numerous expression systems exist that comprise at least a part or all of the expression vectors discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with an embodiment to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Commercially and widely available systems include in but are not limited to bacterial, mammalian, yeast, and insect cell systems. Different host cells have characteristic and specific mechanisms for the post- translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. Those skilled in the art are able to express a vector to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide using an appropriate expression system.

C. Methods of Gene Transfer

[0113] Suitable methods for nucleic acid delivery to effect expression of compositions are anticipated to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Patents 5,994,624,5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et ah, 1990); by using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et ah, 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et ah, 1979; Nicolau et ah, 1987; Wong et ah, 1980; Kaneda et ah, 1989; Kato et ah, 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Patents 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et ah, 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium mediated transformation (U.S. Patents 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG mediated transformation of protoplasts (Omimlleh et ah, 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition mediated DNA uptake (Potrykus et ah, 1985). Other methods include viral transduction, such as gene transfer by lentiviral or retroviral transduction.

2. Host Cells

[0114] In another aspect, contemplated are the use of host cells into which a recombinant expression vector has been introduced. Polypeptides can be expressed in a variety of cell types. An expression construct encoding a polypeptide or peptide of the disclosure can be transfected into cells according to a variety of methods known in the art. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would understand the conditions under which to incubate host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides. [0115] For stable transfection of mammalian cells, it is known, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die), among other methods known in the arts.

IX. Formulations and Culture of the Cells

[0116] In particular aspects, the cells of the disclosure may be specifically formulated and/or they may be cultured in a particular medium. The cells may be formulated in such a manner as to be suitable for delivery to a recipient without deleterious effects.

[0117] The medium in certain aspects can be prepared using a medium used for culturing animal cells as their basal medium, such as any of AIM V, X-VIVO-15, NeuroBasal, EGM2, TeSR, BME, BGJb, CMRL 1066, Glasgow MEM, Improved MEM Zinc Option, IMDM, Medium 199, Eagle MEM, aMEM, DMEM, Ham, RPMI-1640, and Fischer's media, as well as any combinations thereof, but the medium may not be particularly limited thereto as far as it can be used for culturing animal cells. Particularly, the medium may be xeno-free or chemically defined.

[0118] The medium can be a serum-containing or serum-free medium, or xeno-free medium. From the aspect of preventing contamination with heterogeneous animal-derived components, serum can be derived from the same animal as that of the stem cell(s). The serum- free medium refers to medium with no unprocessed or unpurified serum and accordingly, can include medium with purified blood-derived components or animal tissue-derived components (such as growth factors).

[0119] The medium may contain or may not contain any alternatives to serum. The alternatives to serum can include materials which appropriately contain albumin (such as lipid- rich albumin, bovine albumin, albumin substitutes such as recombinant albumin or a humanized albumin, plant starch, dextrans and protein hydrolysates), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'- thiolgiycerol, or equivalents thereto. The alternatives to serum can be prepared by the method disclosed in International Publication No. 98/30679, for example (incorporated herein in its entirety). Alternatively, any commercially available materials can be used for more convenience. The commercially available materials include knockout Serum Replacement (KSR), Chemically-defined Lipid concentrated (Gibco), and Glutamax (Gibco).

[0120] In certain aspects, the medium may comprise one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more of the following: Vitamins such as biotin; DL Alpha Tocopherol Acetate; DL Alpha-Tocopherol; Vitamin A (acetate); proteins such as BSA (bovine serum albumin) or human albumin, fatty acid free Fraction V; Catalase; Human Recombinant Insulin; Human Transferrin; Superoxide Dismutase; Other Components such as Corticosterone; D-Galactose; Ethanolamine HC1; Glutathione (reduced); L-Carnitine HC1; Linoleic Acid; Linolenic Acid; Progesterone; Putrescine 2HC1; Sodium Selenite; and/or T3 (triodo-I-thyronine). . In specific aspects, one or more of these may be explicitly excluded. [0121] In some aspects, the medium further comprises vitamins. In some aspects, the medium comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 of the following (and any range derivable therein): biotin, DL alpha tocopherol acetate, DL alpha- tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, folic acid nicotinamide, pyridoxine, riboflavin, thiamine, inositol, vitamin B12, or the medium includes combinations thereof or salts thereof. In some aspects, the medium comprises or consists essentially of biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, folic acid nicotinamide, pyridoxine, riboflavin, thiamine, inositol, and vitamin B12. In some aspects, the vitamins include or consist essentially of biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, or combinations or salts thereof. In some aspects, the medium further comprises proteins. In some aspects, the proteins comprise albumin or bovine serum albumin, a fraction of BSA, catalase, insulin, transferrin, superoxide dismutase, or combinations thereof. In some aspects, the medium further comprises one or more of the following: corticosterone, D-Galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triodo-I-thyronine, or combinations thereof. In some aspects, the medium comprises one or more of the following: a B-27® supplement, xeno-free B-27® supplement, GS21TM supplement, or combinations thereof. In some aspects, the medium comprises or futher comprises amino acids, monosaccharides, inorganic ions. In some aspects, the amino acids comprise arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine, or combinations thereof. In some aspects, the inorganic ions comprise sodium, potassium, calcium, magnesium, nitrogen, or phosphorus, or combinations or salts thereof. In some aspects, the medium further comprises one or more of the following: molybdenum, vanadium, iron, zinc, selenium, copper, or manganese, or combinations thereof. In certain aspects, the medium comprises or consists essentially of one or more vitamins discussed herein and/or one or more proteins discussed herein, and/or one or more of the following: corticosterone, D-Galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triodo-I- thyronine, a B-27® supplement, xeno-free B-27® supplement, GS21TM supplement, an amino acid (such as arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine), monosaccharide, inorganic ion (such as sodium, potassium, calcium, magnesium, nitrogen, and/or phosphorus) or salts thereof, and/or molybdenum, vanadium, iron, zinc, selenium, copper, or manganese. In specific aspects, one or more of these may be explicitly excluded.

[0122] The medium can also contain one or more externally added fatty acids or lipids, amino acids (such as non-essential amino acids), vitamin(s), growth factors, cytokines, antioxidant substances, 2-mercaptoethanol, pyruvic acid, buffering agents, and/or inorganic salts. In specific aspects, one or more of these may be explicitly excluded.

[0123] One or more of the medium components may be added at a concentration of at least, at most, or about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng/L, ng/ml, pg/ml, mg/ml, or any range derivable therein. [0124] In specific aspects, the cells of the disclosure are specifically formulated. They may or may not be formulated as a cell suspension. In specific cases they are formulated in a single dose form. They may be formulated for systemic or local administration. In some cases the cells are formulated for storage prior to use, and the cell formulation may comprise one or more cryopreservation agents, such as DMSO (for example, in 5% DMSO). The cell formulation may comprise albumin, including human albumin, with a specific formulation comprising 2.5% human albumin. The cells may be formulated specifically for intravenous administration; for example, they are formulated for intravenous administration over less than one hour. In particular aspects the cells are in a formulated cell suspension that is stable at room temperature for 1, 2, 3, or 4 hours or more from time of thawing.

[0125] In some aspects, the method further comprises priming the T cells. In some aspects, the T cells are primed with antigen presenting cells. In some aspects, the antigen presenting cells present tumor antigens or peptides, such as those disclosed herein.

[0126] In particular aspects, the cells of the disclosure comprise an exogenous TCR, which may be of a defined antigen specificity, such as defined antigen specificity to SEQ ID NO:l. In some aspects, the TCR can be selected based on absent or reduced alloreactivity to the intended recipient (examples include certain virus-specific TCRs, xeno-specific TCRs, or cancer-testis antigen- specific TCRs). In the example where the exogenous TCR is non- alloreactive, during T cell differentiation the exogenous TCR suppresses rearrangement and/or expression of endogenous TCR loci through a developmental process called allelic exclusion, resulting in T cells that express only the non-alloreactive exogenous TCR and are thus non- alloreactive. In some aspects, the choice of exogenous TCR may not necessarily be defined based on lack of alloreactivity. In some aspects, the endogenous TCR genes have been modified by genome editing so that they do not express a protein. Methods of gene editing such as methods using the CRISPR/Cas9 system are known in the art and described herein.

X. Administration of Therapeutic Compositions

[0127] The therapy provided herein may comprise administration of a combination of therapeutic agents, such as a first anti-viral therapy and a second anti-viral therapy. The therapies may be administered in any suitable manner known in the art. For example, the first and second cancer treatment may be administered sequentially (at different times) or concurrently (at the same time). In some aspects, the first and second cancer treatments are administered in a separate composition. In some aspects, the first and second cancer treatments are in the same composition.

[0128] Aspects of the disclosure relate to compositions and methods comprising therapeutic compositions. The different therapies may be administered in one composition or in more than one composition, such as 2 compositions, 3 compositions, or 4 compositions. Various combinations of the agents may be employed.

[0129] The therapeutic agents of the disclosure may be administered by the same route of administration or by different routes of administration. In some aspects, the cancer therapy is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In some aspects, the antibiotic is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. The appropriate dosage may be determined based on the type of disease to be treated, severity and course of the disease, the clinical condition of the individual, the individual's clinical history and response to the treatment, and the discretion of the attending physician.

[0130] The treatments may include various “unit doses.” Unit dose is defined as containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, is within the skill of determination of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. In some aspects, a unit dose comprises a single administrable dose.

[0131] The quantity to be administered, both according to number of treatments and unit dose, depends on the treatment effect desired. An effective dose is understood to refer to an amount necessary to achieve a particular effect. In the practice in certain aspects, it is contemplated that doses in the range from 10 mg/kg to 200 mg/kg can affect the protective capability of these agents. Thus, it is contemplated that doses include doses of about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400,

500, 1000 pg/kg, mg/kg, pg/day, or mg/day or any range derivable therein. Furthermore, such doses can be administered at multiple times during a day, and/or on multiple days, weeks, or months.

[0132] In certain aspects, the effective dose of the pharmaceutical composition is one which can provide a blood level of about 1 mM to 150 mM. In another aspect, the effective dose provides a blood level of about 4 pM to 100 pM.; or about 1 pM to 100 pM; or about 1 pM to 50 pM; or about 1 pM to 40 pM; or about 1 pM to 30 pM; or about 1 pM to 20 pM; or about 1 pM to 10 pM; or about 10 pM to 150 pM; or about 10 pM to 100 pM; or about 10 pM to 50 pM; or about 25 pM to 150 pM; or about 25 pM to 100 pM; or about 25 pM to 50 pM; or about 50 pM to 150 pM; or about 50 pM to 100 pM (or any range derivable therein). In other aspects, the dose can provide the following blood level of the agent that results from a therapeutic agent being administered to a subject: about, at least about, or at most about 1, 2,

3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,

80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 pM or any range derivable therein. In certain aspects, the therapeutic agent that is administered to a subject is metabolized in the body to a metabolized therapeutic agent, in which case the blood levels may refer to the amount of that agent. Alternatively, to the extent the therapeutic agent is not metabolized by a subject, the blood levels discussed herein may refer to the unmetabolized therapeutic agent.

[0133] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment (alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance or other therapies a subject may be undergoing.

[0134] It will be understood by those skilled in the art and made aware that dosage units of pg/kg or mg/kg of body weight can be converted and expressed in comparable concentration units of pg/ml or mM (blood levels), such as 4 mM to 100 pM. It is also understood that uptake is species and organ/tissue dependent. The applicable conversion factors and physiological assumptions to be made concerning uptake and concentration measurement are well-known and would permit those of skill in the art to convert one concentration measurement to another and make reasonable comparisons and conclusions regarding the doses, efficacies and results described herein.

XI. Kits

[0135] Certain aspects of the present invention also concern kits containing compositions of the disclosure or compositions to implement methods of the invention. In some aspects, kits can be used to evaluate one or more biomarkers or HLA types. In further aspects, the kits comprise a composition of the disclosure comprising at least one MHC polypeptide and a peptide of the disclosure. In further aspects, the kits comprise a detection tag or a MHC polypeptide or peptide conjugated to a detection tag. Also provided are aspects that include reagents and compositions necessary for performing multimer and tetramer assays.

[0136] In certain aspects, a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 500, 1,000 or more probes, primers or primer sets, synthetic molecules or inhibitors, or any value or range and combination derivable therein.

[0137] Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.

[0138] Individual components may also be provided in a kit in concentrated amounts; in some aspects, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as lx, 2x, 5x, lOx, or 20x or more.

[0139] In certain aspects, negative and/or positive control nucleic acids, probes, and inhibitors are included in some kit aspects. In addition, a kit may include a sample that is a negative or positive control for methylation of one or more biomarkers. [0140] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.

XII. Sequences

[0141] The SARS-CoV-2 genome is represented by the following sequence from GenBank: LC528232.1: tgcttatgaaaattttaatctcccaggtaacaaaccaaccaactttcgatctcttgtagatctgttctctaaacgaactttaaaatctgtgtggc tgtcactcggctgcatgcttagtgcactcacgcagtataattaataactaattactgtcgttgacaggacacgagtaactcgtctatcttctg caggctgcttacggtttcgtccgtgttgcagccgatcatcagcacatctaggtttcgtccgggtgtgaccgaaaggtaagatggagagc cttgtccctggtttcaacgagaaaacacacgtccaactcagtttgcctgttttacaggttcgcgacgtgctcgtacgtggctttggagactc cgtggaggaggtcttatcagaggcacgtcaacatcttaaagatggcacttgtggcttagtagaagttgaaaaaggcgttttgcctcaact tgaacagccctatgtgttcatcaaacgttcggatgctcgaactgcacctcatggtcatgttatggttgagctggtagcagaactcgaagg cattcagtacggtcgtagtggtgagacacttggtgtccttgtccctcatgtgggcgaaataccagtggcttaccgcaaggttcttcttcgta agaacggtaataaaggagctggtggccatagttacggcgccgatctaaagtcatttgacttaggcgacgagcttggcactgatccttat gaagattttcaagaaaactggaacactaaacatagcagtggtgttacccgtgaactcatgcgtgagcttaacggaggggcatacactc gctatgtcgataacaacttctgtggccctgatggctaccctcttgagtgcattaaagaccttctagcacgtgctggtaaagcttcatgcact ttgtccgaacaactggactttattgacactaagaggggtgtatactgctgccgtgaacatgagcatgaaattgcttggtacacggaacgtt ctgaaaagagctatgaattgcagacaccttttgaaattaaattggcaaagaaatttgacaccttcaatggggaatgtccaaattttgtatttc ccttaaattccataatcaagactattcaaccaagggttgaaaagaaaaagcttgatggctttatgggtagaattcgatctgtctatccagtt gcgtcaccaaatgaatgcaaccaaatgtgcctttcaactctcatgaagtgtgatcattgtggtgaaacttcatggcagacgggcgattttg ttaaagccacttgcgaattttgtggcactgagaatttgactaaagaaggtgccactacttgtggttacttaccccaaaatgctgttgttaaaa tttattgtccagcatgtcacaattcagaagtaggacctgagcatagtcttgccgaataccataatgaatctggcttgaaaaccattcttcgta agggtggtcgcactattgcctttggaggctgtgtgttctcttatgttggttgccataacaagtgtgcctattgggttccacgtgctagcgcta acataggttgtaaccatacaggtgttgttggagaaggttccgaaggtcttaatgacaaccttcttgaaatactccaaaaagagaaagtca acatcaatattgttggtgactttaaacttaatgaagagatcgccattattttggcatctttttctgcttccacaagtgcttttgtggaaactgtga aaggtttggattataaagcattcaaacaaattgttgaatcctgtggtaattttaaagttacaaaaggaaaagctaaaaaaggtgcctggaat attggtgaacagaaatcaatactgagtcctctttatgcatttgcatcagaggctgctcgtgttgtacgatcaattttctcccgcactcttgaaa ctgctcaaaattctgtgcgtgttttacagaaggccgctataacaatactagatggaatttcacagtattcactgagactcattgatgctatga tgttcacatctgatttggctactaacaatctagttgtaatggcctacattacaggtggtgttgttcagttgacttcgcagtggctaactaacat ctttggcactgtttatgaaaaactcaaacccgtccttgattggcttgaagagaagtttaaggaaggtgtagagtttcttagagacggttgg gaaattgttaaatttatctcaacctgtgcttgtgaaattgtcggtggacaaattgtcacctgtgcaaaggaaattaaggagagtgttcagac attctttaagcttgtaaataaatttttggctttgtgtgctgactctatcattattggtggagctaaacttaaagccttgaatttaggtgaaacattt gtcacgcactcaaagggattgtacagaaagtgtgttaaatccagagaagaaactggcctactcatgcctctaaaagccccaaaagaaa ttatcttcttagagggagaaacacttcccacagaagtgttaacagaggaagttgtcttgaaaactggtgatttacaaccattagaacaacc tactagtgaagctgttgaagctccattggttggtacaccagtttgtattaacgggcttatgttgctcgaaatcaaagacacagaaaagtact gtgcccttgcacctaatatgatggtaacaaacaataccttcacactcaaaggcggtgcaccaacaaaggttacttttggtgatgacactgt gatagaagtgcaaggttacaagagtgtgaatatcacttttgaacttgatgaaaggattgataaagtacttaatgagaagtgctctgcctata cagttgaactcggtacagaagtaaatgagttcgcctgtgttgtggcagatgctgtcataaaaactttgcaaccagtatctgaattacttaca ccactgggcattgatttagatgagtggagtatggctacatactacttatttgatgagtctggtgagtttaaattggcttcacatatgtattgttc tttctaccctccagatgaggatgaagaagaaggtgattgtgaagaagaagagtttgagccatcaactcaatatgagtatggtactgaag atgattaccaaggtaaacctttggaatttggtgccacttctgctgctcttcaacctgaagaagagcaagaagaagattggttagatgatga tagtcaacaaactgttggtcaacaagacggcagtgaggacaatcagacaactactattcaaacaattgttgaggttcaacctcaattaga gatggaacttacaccagttgttcagactattgaagtgaatagttttagtggttatttaaaacttactgacaatgtatacattaaaaatgcagac attgtggaagaagctaaaaaggtaaaaccaacagtggttgttaatgcagccaatgtttaccttaaacatggaggaggtgttgcaggagc cttaaataaggctactaacaatgccatgcaagttgaatctgatgattacatagctactaatggaccacttaaagtgggtggtagttgtgtttt aagcggacacaatcttgctaaacactgtcttcatgttgtcggcccaaatgttaacaaaggtgaagacattcaacttcttaagagtgcttatg aaaattttaatcagcacgaagttctacttgcaccattattatcagctggtatttttggtgctgaccctatacattctttaagagtttgtgtagata ctgttcgcacaaatgtctacttagctgtctttgataaaaatctctatgacaaacttgtttcaagctttttggaaatgaagagtgaaaagcaagt tgaacaaaagatcgctgagattcctaaagaggaagttaagccatttataactgaaagtaaaccttcagttgaacagagaaaacaagatg ataagaaaatcaaagcttgtgttgaagaagttacaacaactctggaagaaactaagttcctcacagaaaacttgttactttatattgacatta atggcaatcttcatccagattctgccactcttgttagtgacattgacatcactttcttaaagaaagatgctccatatatagtgggtgatgttgtt caagagggtgttttaactgctgtggttatacctactaaaaaggctggtggcactactgaaatgctagcgaaagctttgagaaaagtgcca acagacaattatataaccacttacccgggtcagggtttaaatggttacactgtagaggaggcaaagacagtgcttaaaaagtgtaaaag tgccttttacattctaccatctattatctctaatgagaagcaagaaattcttggaactgtttcttggaatttgcgagaaatgcttgcacatgca gaagaaacacgcaaattaatgcctgtctgtgtggaaactaaagccatagtttcaactatacagcgtaaatataagggtattaaaatacaa gagggtgtggttgattatggtgctagattttacttttacaccagtaaaacaactgtagcgtcacttatcaacacacttaacgatctaaatgaa actcttgttacaatgccacttggctatgtaacacatggcttaaatttggaagaagctgctcggtatatgagatctctcaaagtgccagctac agtttctgtttcttcacctgatgctgttacagcgtataatggttatcttacttcttcttctaaaacacctgaagaacattttattgaaaccatctca cttgctggttcctataaagattggtcctattctggacaatctacacaactaggtatagaatttcttaagagaggtgataaaagtgtatattaca ctagtaatcctaccacattccacctagatggtgaagttatcacctttgacaatcttaagacacttctttctttgagagaagtgaggactattaa ggtgtttacaacagtagacaacattaacctccacacgcaagttgtggacatgtcaatgacatatggacaacagtttggtccaacttatttg gatggagctgatgttactaaaataaaacctcataattcacatgaaggtaaaacattttatgttttacctaatgatgacactctacgtgttgag gcttttgagtactaccacacaactgatcctagttttctgggtaggtacatgtcagcattaaatcacactaaaaagtggaaatacccacaagt taatggtttaacttctattaaatgggcagataacaactgttatcttgccactgcattgttaacactccaacaaatagagttgaagtttaatcca cctgctctacaagatgcttattacagagcaagggctggtgaagctgctaacttttgtgcacttatcttagcctactgtaataagacagtagg tgagttaggtgatgttagagaaacaatgagttacttgtttcaacatgccaatttagattcttgcaaaagagtcttgaacgtggtgtgtaaaac ttgtggacaacagcagacaacccttaagggtgtagaagctgttatgtacatgggcacactttcttatgaacaatttaagaaaggtgttcag ataccttgtacgtgtggtaaacaagctacaaaatatctagtacaacaggagtcaccttttgttatgatgtcagcaccacctgctcagtatga acttaagcatggtacatttacttgtgctagtgagtacactggtaattaccagtgtggtcactataaacatataacttctaaagaaactttgtatt gcatagacggtgctttacttacaaagtcctcagaatacaaaggtcctattacggatgttttctacaaagaaaacagttacacaacaaccat aaaaccagttacttataaattggatggtgttgtttgtacagaaattgaccctaagttggacaattattataagaaagacaattcttatttcaca gagcaaccaattgatcttgtaccaaaccaaccatatccaaacgcaagcttcgataattttaagtttgtatgtgataatatcaaatttgctgat gatttaaaccagttaactggttataagaaacctgcttcaagagagcttaaagttacatttttccctgacttaaatggtgatgtggtggctattg attataaacactacacaccctcttttaagaaaggagctaaattgttacataaacctattgtttggcatgttaacaatgcaactaataaagcca cgtataaaccaaatacctggtgtatacgttgtctttggagcacaaaaccagttgaaacatcaaattcgtttgatgtactgaagtcagagga cgcgcagggaatggataatcttgcctgcgaagatctaaaaccagtctctgaagaagtagtggaaaatcctaccatacagaaagacgtt cttgagtgtaatgtgaaaactaccgaagttgtaggagacattatacttaaaccagcaaataatagtttaaaaattacagaagaggttggcc acacagatctaatggctgcttatgtagacaattctagtcttactattaagaaacctaatgaattatctagagtattaggtttgaaaacccttgc tactcatggtttagctgctgttaatagtgtcccttgggatactatagctaattatgctaagccttttcttaacaaagttgttagtacaactactaa catagttacacggtgtttaaaccgtgtttgtactaattatatgccttatttctttactttattgctacaattgtgtacttttactagaagtacaaattc tagaattaaagcatctatgccgactactatagcaaagaatactgttaagagtgtcggtaaattttgtctagaggcttcatttaattatttgaag tcacctaatttttctaaactgataaatattataatttggtttttactattaagtgtttgcctaggttctttaatctactcaaccgctgctttaggtgttt taatgtctaatttaggcatgccttcttactgtactggttacagagaaggctatttgaactctactaatgtcactattgcaacctactgtactggt tctataccttgtagtgtttgtcttagtggtttagattctttagacacctatccttctttagaaactatacaaattaccatttcatcttttaaatgggat ttaactgcttttggcttagttgcagagtggtttttggcatatattcttttcactaggtttttctatgtacttggattggctgcaatcatgcaattgttt ttcagctattttgcagtacattttattagtaattcttggcttatgtggttaataattaatcttgtacaaatggccccgatttcagctatggttagaa tgtacatcttctttgcatcattttattatgtatggaaaagttatgtgcatgttgtagacggttgtaattcatcaacttgtatgatgtgttacaaacg taatagagcaacaagagtcgaatgtacaactattgttaatggtgttagaaggtccttttatgtctatgctaatggaggtaaaggcttttgcaa actacacaattggaattgtgttaattgtgatacattctgtgctggtagtacatttattagtgatgaagttgcgagagacttgtcactacagttta aaagaccaataaatcctactgaccagtcttcttacatcgttgatagtgttacagtgaagaatggttccatccatctttactttgataaagctg gtcaaaagacttatgaaagacattctctctctcattttgttaacttagacaacctgagagctaataacactaaaggttcattgcctattaatgtt atagtttttgatggtaaatcaaaatgtgaagaatcatctgcaaaatcagcgtctgtttactacagtcagcttatgtgtcaacctatactgttact agatcaggcattagtgtctgatgttggtgatagtgcggaagttgcagttaaaatgtttgatgcttacgttaatacgttttcatcaacttttaac gtaccaatggaaaaactcaaaacactagttgcaactgcagaagctgaacttgcaaagaatgtgtccttagacaatgtcttatctacttttat ttcagcagctcggcaagggtttgttgattcagatgtagaaactaaagatgttgttgaatgtcttaaattgtcacatcaatctgacatagaagt tactggcgatagttgtaataactatatgctcacctataacaaagttgaaaacatgacaccccgtgaccttggtgcttgtattgactgtagtg cgcgtcatattaatgcgcaggtagcaaaaagtcacaacattgctttgatatggaacgttaaagatttcatgtcattgtctgaacaactacga aaacaaatacgtagtgctgctaaaaagaataacttaccttttaagttgacatgtgcaactactagacaagttgttaatgttgtaacaacaaa gatagcacttaagggtggtaaaattgttaataattggttgaagcagttaattaaagttacacttgtgttcctttttgttgctgctattttctatttaa taacacctgttcatgtcatgtctaaacatactgacttttcaagtgaaatcataggatacaaggctattgatggtggtgtcactcgtgacatag catctacagatacttgttttgctaacaaacatgctgattttgacacatggtttagccagcgtggtggtagttatactaatgacaaagcttgcc cattgattgctgcagtcataacaagagaagtgggttttgtcgtgcctggtttgcctggcacgatattacgcacaactaatggtgactttttg catttcttacctagagtttttagtgcagttggtaacatctgttacacaccatcaaaacttatagagtacactgactttgcaacatcagcttgtgt tttggctgctgaatgtacaatttttaaagatgcttctggtaagccagtaccatattgttatgataccaatgtactagaaggttctgttgcttatg aaagtttacgccctgacacacgttatgtgctcatggatggctctattattcaatttcctaacacctaccttgaaggttctgttagagtggtaac aacttttgattctgagtactgtaggcacggcacttgtgaaagatcagaagctggtgtttgtgtatctactagtggtagatgggtacttaaca atgattattacagatctttaccaggagttttctgtggtgtagatgctgtaaatttacttactaatatgtttacaccactaattcaacctattggtg ctttggacatatcagcatctatagtagctggtggtattgtagctatcgtagtaacatgccttgcctactattttatgaggtttagaagagctttt ggtgaatacagtcatgtagttgcctttaatactttactattccttatgtcattcactgtactctgtttaacaccagtttactcattcttacctggtgt ttattctgttatttacttgtacttgacattttatcttactaatgatgtttcttttttagcacatattcagtggatggttatgttcacacctttagtaccttt ctggataacaattgcttatatcatttgtatttccacaaagcatttctattggttctttagtaattacctaaagagacgtgtagtctttaatggtgttt cctttagtacttttgaagaagctgcgctgtgcacctttttgttaaataaagaaatgtatctaaagttgcgtagtgatgtgctattacctcttacg caatataatagatacttagctctttataataagtacaagtattttagtggagcaatggatacaactagctacagagaagctgcttgttgtcat ctcgcaaaggctctcaatgacttcagtaactcaggttctgatgttctttaccaaccaccacaaacctctatcacctcagctgttttgcagagt ggttttagaaaaatggcattcccatctggtaaagttgagggttgtatggtacaagtaacttgtggtacaactacacttaacggtctttggctt gatgacgtagtttactgtccaagacatgtgatctgcacctctgaagacatgcttaaccctaattatgaagatttactcattcgtaagtctaat cataatttcttggtacaggctggtaatgttcaactcagggttattggacattctatgcaaaattgtgtacttaagcttaaggttgatacagcca atcctaagacacctaagtataagtttgttcgcattcaaccaggacagactttttcagtgttagcttgttacaatggttcaccatctggtgttta ccaatgtgctatgaggcccaatttcactattaagggttcattccttaatggttcatgtggtagtgttggttttaacatagattatgactgtgtct ctttttgttacatgcaccatatggaattaccaactggagttcatgctggcacagacttagaaggtaacttttatggaccttttgttgacaggc aaacagcacaagcagctggtacggacacaactattacagttaatgttttagcttggttgtacgctgctgttataaatggagacaggtggtt tctcaatcgatttaccacaactcttaatgactttaaccttgtggctatgaagtacaattatgaacctctaacacaagaccatgttgacatacta ggacctctttctgctcaaactggaattgccgttttagatatgtgtgcttcattaaaagaattactgcaaaatggtatgaatggacgtaccata ttgggtagtgctttattagaagatgaatttacaccttttgatgttgttagacaatgctcaggtgttactttccaaagtgcagtgaaaagaacaa tcaagggtacacaccactggttgttactcacaattttgacttcacttttagttttagtccagagtactcaatggtctttgttcttttttttttatgaa aatgcctttttaccttttgctatgggtattattgctatgtctgcttttgcaatgatgtttgtcaaacataagcatgcatttctctgtttgtttttgttac cttctcttgccactgtagcttattttaatatggtctatatgcctgctagttgggtgatgcgtattatgacatggttggatatggttgatactagttt gtctggttttaagctaaaagactgtgttatgtatgcatcagctgtagtgttactaatccttatgacagcaagaactgtgtatgatgatggtgct aggagagtgtggacacttatgaatgtcttgacactcgtttataaagtttattatggtaatgctttagatcaagccatttccatgtgggctcttat aatctctgttacttctaactactcaggtgtagttacaactgtcatgtttttggccagaggtattgtttttatgtgtgttgagtattgccctattttctt cataactggtaatacacttcagtgtataatgctagtttattgtttcttaggctatttttgtacttgttactttggcctcttttgtttactcaaccgcta ctttagactgactcttggtgtttatgattacttagtttctacacaggagtttagatatatgaattcacagggactactcccacccaagaatagc atagatgccttcaaactcaacattaaattgttgggtgttggtggcaaaccttgtatcaaagtagccactgtacagtctaaaatgtcagatgt aaagtgcacatcagtagtcttactctcagttttgcaacaactcagagtagaatcatcatctaaattgtgggctcaatgtgtccagttacaca atgacattctcttagctaaagatactactgaagcctttgaaaaaatggtttcactactttctgttttgctttccatgcagggtgctgtagacata aacaagctttgtgaagaaatgctggacaacagggcaaccttacaagctatagcctcagagtttagttcccttccatcatatgcagcttttg ctactgctcaagaagcttatgagcaggctgttgctaatggtgattctgaagttgttcttaaaaagttgaagaagtctttgaatgtggctaaat ctgaatttgaccgtgatgcagccatgcaacgtaagttggaaaagatggctgatcaagctatgacccaaatgtataaacaggctagatct gaggacaagagggcaaaagttactagtgctatgcagacaatgcttttcactatgcttagaaagttggataatgatgcactcaacaacatt atcaacaatgcaagagatggttgtgttcccttgaacataatacctcttacaacagcagccaaactaatggttgtcataccagactataaca catataaaaatacgtgtgatggtacaacatttacttatgcatcagcattgtgggaaatccaacaggttgtagatgcagatagtaaaattgtt caacttagtgaaattagtatggacaattcacctaatttagcatggcctcttattgtaacagctttaagggccaattctgctgtcaaattacag aataatgagcttagtcctgttgcactacgacagatgtcttgtgctgccggtactacacaaactgcttgcactgatgacaatgcgttagctta ctacaacacaacaaagggaggtaggtttgtacttgcactgttatccgatttacaggatttgaaatgggctagattccctaagagtgatgga actggtactatctatacagaactggaaccaccttgtaggtttgttacagacacacctaaaggtcctaaagtgaagtatttatactttattaaa ggattaaacaacctaaatagaggtatggtacttggtagtttagctgccacagtacgtctacaagctggtaatgcaacagaagtgcctgcc aattcaactgtattatctttctgtgcttttgctgtagatgctgctaaagcttacaaagattatctagctagtgggggacaaccaatcactaatt gtgttaagatgttgtgtacacacactggtactggtcaggcaataacagttacaccggaagccaatatggatcaagaatcctttggtggtg catcgtgttgtctgtactgccgttgccacatagatcatccaaatcctaaaggattttgtgacttaaaaggtaagtatgtacaaatacctacaa cttgtgctaatgaccctgtgggttttacacttaaaaacacagtctgtaccgtctgcggtatgtggaaaggttatggctgtagttgtgatcaa ctccgcgaacccatgcttcagtcagctgatgcacaatcgtttttaaacgggtttgcggtgtaagtgcagcccgtcttacaccgtgcggca caggcactagtactgatgtcgtatacagggcttttgacatctacaatgataaagtagctggttttgctaaattcctaaaaactaattgttgtc gcttccaagaaaaggacgaagatgacaatttaattgattcttactttgtagttaagagacacactttctctaactaccaacatgaagaaaca atttataatttacttaaggattgtccagctgttgctaaacatgacttctttaagtttagaatagacggtgacatggtaccacatatatcacgtca acgtcttactaaatacacaatggcagacctcgtctatgctttaaggcattttgatgaaggtaattgtgacacattaaaagaaatacttgtcac atacaattgttgtgatgatgattatttcaataaaaaggactggtatgattttgtagaaaacccagatatattacgcgtatacgccaacttaggt gaacgtgtacgccaagctttgttaaaaacagtacaattctgtgatgccatgcgaaatgctggtattgttggtgtactgacattagataatca agatctcaatggtaactggtatgatttcggtgatttcatacaaaccacgccaggtagtggagttcctgttgtagattcttattattcattgttaa tgcctatattaaccttgaccagggctttaactgcagagtcacatgttgacactgacttaacaaagccttacattaagtgggatttgttaaaat atgacttcacggaagagaggttaaaactctttgaccgttattttaaatattgggatcagacataccacccaaattgtgttaactgtttggatg acagatgcattctgcattgtgcaaactttaatgttttattctctacagtgttcccacctacaagttttggaccactagtgagaaaaatatttgtt gatggtgttccatttgtagtttcaactggataccacttcagagagctaggtgttgtacataatcaggatgtaaacttacatagctctagactt agttttaaggaattacttgtgtatgctgctgaccctgctatgcacgctgcttctggtaatctattactagataaacgcactacgtgcttttcagt agctgcacttactaacaatgttgcttttcaaactgtcaaacccggtaattttaacaaagacttctatgactttgctgtgtctaagggtttcttta aggaaggaagttctgttgaattaaaacacttcttctttgctcaggatggtaatgctgctatcagcgattatgactactatcgttataatctacc aacaatgtgtgatatcagacaactactatttgtagttgaagttgttgataagtactttgattgttacgatggtggctgtattaatgctaaccaa gtcatcgtcaacaacctagacaaatcagctggttttccatttaataaatggggtaaggctagactttattatgattcaatgagttatgaggat caagatgcacttttcgcatatacaaaacgtaatgtcatccctactataactcaaatgaatcttaagtatgccattagtgcaaagaatagagc tcgcaccgtagctggtgtctctatctgtagtactatgaccaatagacagtttcatcaaaaattattgaaatcaatagccgccactagagga gctactgtagtaattggaacaagcaaattctatggtggttggcacaacatgttaaaaactgtttatagtgatgtagaaaaccctcaccttat gggttgggattatcctaaatgtgatagagccatgcctaacatgcttagaattatggcctcacttgttcttgctcgcaaacatacaacgtgtt gtagcttgtcacaccgtttctatagattagctaatgagtgtgctcaagtattgagtgaaatggtcatgtgtggcggttcactatatgttaaac caggtggaacctcatcaggagatgccacaactgcttatgctaatagtgtttttaacatttgtcaagctgtcacggccaatgttaatgcacttt tatctactgatggtaacaaaattgccgataagtatgtccgcaatttacaacacagactttatgagtgtctctatagaaatagagatgttgaca cagactttgtgaatgagttttacgcatatttgcgtaaacatttctcaatgatgatactctctgacgatgctgttgtgtgtttcaatagcacttatg catctcaaggtctagtggctagcataaagaactttaagtcagttctttattatcaaaacaatgtttttatgtctgaagcaaaatgttggactga gactgaccttactaaaggacctcatgaattttgctctcaacatacaatgctagttaaacagggtgatgattatgtgtaccttccttacccaga tccatcaagaatcctaggggccggctgttttgtagatgatatcgtaaaaacagatggtacacttatgattgaacggttcgtgtctttagctat agatgcttacccacttactaaacatcctaatcaggagtatgctgatgtctttcatttgtacttacaatacataagaaagctacatgatgagtta acaggacacatgttagacatgtattctgttatgcttactaatgataacacttcaaggtattgggaacctgagttttatgaggctatgtacaca ccgcatacagtcttacaggctgttggggcttgtgttctttgcaattcacagacttcattaagatgtggtgcttgcatacgtagaccattcttat gttgtaaatgctgttacgaccatgtcatatcaacatcacataaattagtcttgtctgttaatccgtatgtttgcaatgctccaggttgtgatgtc acagatgtgactcaactttacttaggaggtatgagctattattgtaaatcacataaaccacccattagttttccattgtgtgctaatggacaa gtttttggtttatataaaaatacatgtgttggtagcgataatgttactgactttaatgcaattgcaacatgtgactggacaaatgctggtgatta cattttagctaacacctgtactgaaagactcaagctttttgcagcagaaacgctcaaagctactgaggagacatttaaactgtcttatggta ttgctactgtacgtgaagtgctgtctgacagagaattacatctttcatgggaagttggtaaacctagaccaccacttaaccgaaattatgtc tttactggttatcgtgtaactaaaaacagtaaagtacaaataggagagtacacctttgaaaaaggtgactatggtgatgctgttgtttaccg aggtacaacaacttacaaattaaatgttggtgattattttgtgctgacatcacatacagtaatgccattaagtgcacctacactagtgccac aagagcactatgttagaattactggcttatacccaacactcaatatctcagatgagttttctagcaatgttgcaaattatcaaaaggttggta tgcaaaagtattctacactccagggaccacctggtactggtaagagtcattttgctattggcctagctctctactacccttctgctcgcata gtgtatacagcttgctctcatgccgctgttgatgcactatgtgagaaggcattaaaatatttgcctatagataaatgtagtagaattatacct gcacgtgctcgtgtagagtgttttgataaattcaaagtgaattcaacattagaacagtatgtcttttgtactgtaaatgcattgcctgagacg acagcagatatagttgtctttgatgaaatttcaatggccacaaattatgatttgagtgttgtcaatgccagattacgtgctaagcactatgtgt acattggcgaccctgctcaattacctgcaccacgcacattgctaactaagggcacactagaaccagaatatttcaattcagtgtgtagac ttatgaaaactataggtccagacatgttcctcggaacttgtcggcgttgtcctgctgaaattgttgacactgtgagtgctttggtttatgataa taagcttaaagcacataaagacaaatcagctcaatgctttaaaatgttttataagggtgttatcacgcatgatgtttcatctgcaattaacag gccacaaataggcgtggtaagagaattccttacacgtaaccctgcttggagaaaagctgtctttatttcaccttataattcacagaatgctg tagcctcaaagattttgggactaccaactcaaactgttgattcatcacagggctcagaatatgactatgtcatattcactcaaaccactgaa acagctcactcttgtaatgtaaacagatttaatgttgctattaccagagcaaaagtaggcatactttgcataatgtctgatagagacctttat gacaagttgcaatttacaagtcttgaaattccacgtaggaatgtggcaactttacaagctgaaaatgtaacaggactctttaaagattgtag taaggtaatcactgggttacatcctacacaggcacctacacacctcagtgttgacactaaattcaaaactgaaggtttatgtgttgacatac ctggcatacctaaggacatgacctatagaagactcatctctatgatgggttttaaaatgaattatcaagttaatggttaccctaacatgtttat cacccgcgaagaagctataagacatgtacgtgcatggattggcttcgatgtcgaggggtgtcatgctactagagaagctgttggtacca atttacctttacagctaggtttttctacaggtgttaacctagttgctgtacctacaggttatgttgatacacctaataatacagatttttccagag ttagtgctaaaccaccgcctggagatcaatttaaacacctcataccacttatgtacaaaggacttccttggaatgtagtgcgtataaagatt gtacaaatgttaagtgacacacttaaaaatctctctgacagagtcgtatttgtcttatgggcacatggctttgagttgacatctatgaagtatt ttgtgaaaataggacctgagcgcacctgttgtctatgtgatagacgtgccacatgcttttccactgcttcagacacttatgcctgttggcat cattctattggatttgattacgtctataatccgtttatgattgatgttcaacaatggggttttacaggtaacctacaaagcaaccatgatctgta ttgtcaagtccatggtaatgcacatgtagctagttgtgatgcaatcatgactaggtgtctagctgtccacgagtgctttgttaagcgtgttga ctggactattgaatatcctataattggtgatgaactgaagattaatgcggcttgtagaaaggttcaacacatggttgttaaagctgcattatt agcagacaaattcccagttcttcacgacattggtaaccctaaagctattaagtgtgtacctcaagctgatgtagaatggaagttctatgatg cacagccttgtagtgacaaagcttataaaatagaagaattattctattcttatgccacacattctgacaaattcacagatggtgtatgcctatt ttggaattgcaatgtcgatagatatcctgctaattccattgtttgtagatttgacactagagtgctatctaaccttaacttgcctggttgtgatg gtggcagtttgtatgtaaataaacatgcattccacacaccagcttttgataaaagtgcttttgttaatttaaaacaattaccatttttctattactc tgacagtccatgtgagtctcatggaaaacaagtagtgtcagatatagattatgtaccactaaagtctgctacgtgtataacacgttgcaatt taggtggtgctgtctgtagacatcatgctaatgagtacagattgtatctcgatgcttataacatgatgatctcagctggctttagcttgtggg tttacaaacaatttgatacttataacctctggaacacttttacaagacttcagagtttagaaaatgtggcttttaatgttgtaaataagggaca ctttgatggacaacagggtgaagtaccagtttctatcattaataacactgtttacacaaaagttgatggtgttgatgtagaattgtttgaaaat aaaacaacattacctgttaatgtagcatttgagctttgggctaagcgcaacattaaaccagtaccagaggtgaaaatactcaataatttgg gtgtggacattgctgctaatactgtgatctgggactacaaaagagatgctccagcacatatatctactattggtgtttgttctatgactgaca tagccaagaaaccaactgaaacgatttgtgcaccactcactgtcttttttgatggtagagttgatggtcaagtagacttatttagaaatgcc cgtaatggtgttcttattacagaaggtagtgttaaaggtttacaaccatctgtaggtcccaaacaagctagtcttaatggagtcacattaatt ggagaagccgtaaaaacacagttcaattattataagaaagttgatggtgttgtccaacaattacctgaaacttactttactcagagtagaa atttacaagaatttaaacccaggagtcaaatggaaattgatttcttagaattagctatggatgaattcattgaacggtataaattagaaggct atgccttcgaacatatcgtttatggagattttagtcatagtcagttaggtggtttacatctactgattggactagctaaacgttttaaggaatc accttttgaattagaagattttattcctatggacagtacagttaaaaactatttcataacagatgcgcaaacaggttcatctaagtgtgtgtgt tctgttattgatttattacttgatgattttgttgaaataataaaatcccaagatttatctgtagtttctaaggttgtcaaagtgactattgactatac agaaatttcatttatgctttggtgtaaagatggccatgtagaaacattttacccaaaattacaatctagtcaagcgtggcaaccgggtgttg ctatgcctaatctttacaaaatgcaaagaatgctattagaaaagtgtgaccttcaaaattatggtgatagtgcaacattacctaaaggcata atgatgaatgtcgcaaaatatactcaactgtgtcaatatttaaacacattaacattagctgtaccctataatatgagagttatacattttggtg ctggttctgataaaggagttgcaccaggtacagctgttttaagacagtggttgcctacgggtacgctgcttgtcgattcagatcttaatgac tttgtctctgatgcagattcaactttgattggtgattgtgcaactgtacatacagctaataaatgggatctcattattagtgatatgtacgaccc taagactaaaaatgttacaaaagaaaatgactctaaagagggttttttcacttacatttgtgggtttatacaacaaaagctagctcttggag gttccgtggctataaagataacagaacattcttggaatgctgatctttataagctcatgggacacttcgcatggtggacagcctttgttact aatgtgaatgcgtcatcatctgaagcatttttaattggatgtaattatcttggcaaaccacgcgaacaaatagatggttatgtcatgcatgca aattacatattttggaggaatacaaatccaattcagttgtcttcctattctttatttgacatgagtaaatttccccttaaattaaggggtactgct gttatgtctttaaaagaaggtcaaatcaatgatatgattttatctcttcttagtaaaggtagacttataattagagaaaacaacagagttgttat ttctagtgatgttcttgttaacaactaaacgaacaatgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccaga actcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcagga cttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctacc atttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccc tacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaacaac aaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaag gaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaattta gtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgcttt acatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttc tattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttc actgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgccctt ttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctata taattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaa ttagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctg cgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaacctttt gagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatg gtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggac ctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaa agtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacac catgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagt ccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaatag gggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcg gcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgc catacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggt gattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagac aaaaacacccaagaagtttttgcacaagtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattac cagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaata tggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaa atgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgct atgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgct attggcaaaattcaagactcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaaca cgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgca aattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgct aatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctc agtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgat ggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcatt actacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagac tcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaa acattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagc agtatataaaatggccatggtacatttggctaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccag ttgctgtagttgtctcaagggctgttgttcttgtggatctgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaaatt acattacacataaacgaacttatggatttgtttatgagaatcttcacaattggaactgtaactttgaagcaaggtgaaatcaaggatgctact ccttcagattttgttcgcgctactgcaacgataccgatacaagcctcactccctttcggatggcttattgttggcgttgcacttcttgctgtttt tcagagcgcttccaaaatcataaccctcaaaaagagatggcaactagcactctccaagggtgttcactttgtttgcaacttgctgttgttgt ttgtaacagtttactcacaccttttgctcgttgctgctggccttgaagccccttttctctatctttatgctttagtctacttcttgcagagtataaa ctttgtaagaataataatgaggctttggctttgctggaaatgccgttccaaaaacccattactttatgatgccaactattttctttgctggcata ctaattgttacgactattgtataccttacaatagtgtaacttcttcaattgtcattacttcaggtgatggcacaacaagtcctatttctgaacatg actaccagattggtggttatactgaaaaatgggaatctggagtaaaagactgtgttgtattacacagttacttcacttcagactattaccag ctgtactcaactcaattgagtacagacactggtgttgaacatgttaccttcttcatctacaataaaattgttgatgagcctgaagaacatgtc caaattcacacaatcgacggttcatccggagttgttaatccagtaatggaaccaatttatgatgaaccgacgacgactactagcgtgcctt tgtaagcacaagctgatgagtacgaacttatgtactcattcgtttcggaagagacaggtacgttaatagttaatagcgtacttctttttcttgc tttcgtggtattcttgctagttacactagccatccttactgcgcttcgattgtgtgcgtactgctgcaatattgttaacgtgagtcttgtaaaac cttctttttacgtttactctcgtgttaaaaatctgaattcttctagagttcctgatcttctggtctaaacgaactaaatattatattagtttttctgttt ggaactttaattttagccatggcagattccaacggtactattaccgttgaagagcttaaaaagctccttgaacaatggaacctagtaatag gtttcctattccttacatggatttgtcttctacaatttgcctatgccaacaggaataggtttttgtatataattaagttaattttcctctggctgttat ggccagtaactttagcttgttttgtgcttgctgctgtttacagaataaattggatcaccggtggaattgctatcgcaatggcttgtcttgtagg cttgatgtggctcagctacttcattgcttctttcagactgtttgcgcgtacgcgttccatgtggtcattcaatccagaaactaacattcttctca acgtgccactccatggcactattctgaccagaccgcttctagaaagtgaactcgtaatcggagctgtgatccttcgtggacatcttcgtat tgctggacaccatctaggacgctgtgacatcaaggacctgcctaaagaaatcactgttgctacatcacgaacgctttcttattacaaattg ggagcttcgcagcgtgtagcaggtgactcaggttttgctgcatacagtcgctacaggattggcaactataaattaaacacagaccattcc agtagcagtgacaatattgctttgcttgtacagtaagtgacaacagatgtttcatctcgttgactttcaggttactatagcagagatattacta attattatgaggacttttaaagtttccatttggaatcttgattacatcataaacctcataattaaaaatttatctaagtcactaactgagaataaa tattctcaattagatgaagagcaaccaatggagattgattaaacgaacatgaaaattattcttttcttggcactgataacactcgctacttgt gagctttatcactaccaagagtgtgttagaggtacaacagtacttttaaaagaaccttgctcttctggaacatacgagggcaattcaccatt tcatcctctagctgataacaaatttgcactgacttgctttagcactcaatttgcttttgcttgtcctgacggcgtaaaacacgtctatcagttac gtgccagatcagtttcacctaaactgttcatcagacaagaggaagttcaagaactttactctccaatttttcttattgttgcggcaatagtgtt tataacactttgcttcacactcaaaagaaagacagaatgattgaactttcattaattgacttctatttgtgctttttagcctttctgctattccttgt tttaattatgcttattatcttttggttctcacttgaactgcaagatcataatgaaacttgtcacgcctaaacgaacatgaaatttcttgttttcttag gaatcatcacaactgtagctgcatttcaccaagaatgtagtttacagtcatgtactcaacatcaaccatatgtagttgatgacccgtgtcct attcacttctattctaaatggtatattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgaggctggttctaaatca cccattcagtacatcgatatcggtaattatacagtttcctgtttaccttttacaattaattgccaggaacctaaattgggtagtcttgtagtgcg ttgttcgttctatgaagactttttagagtatcatgacgttcgtgttgttttagatttcatctaaacgaacaaactaaaatgtctgataatggaccc caaaatcagcgaaatgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccagaatggagaacgcagtggggcg cgatcaaaacaacgtcggccccaaggtttacccaataatactgcgtcttggttcaccgctctcactcaacatggcaaggaagaccttaa attccctcgaggacaaggcgttccaattaacaccaatagcagtccagatgaccaaattggctactaccgaagagctaccagacgaatt cgtggtggtgacggtaaaatgaaagatctcagtccaagatggtatttctactacctaggaactgggccagaagctggacttccctatggt gctaacaaagacggcatcatatgggttgcaactgagggagccttgaatacaccaaaagatcacattggcacccgcaatcctgctaaca atgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagaagggagcagaggcggcagtcaagcct cttctcgttcctcatcacgtagtcgcaacagttcaagaaattcaactccaggcagcagtaggggaacttctcctgctagaatggctggca atggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttgagagcaaaatgtctggtaaaggccaacaacaacaa ggccaaactgtcactaagaaatctgctgctgaggcttctaagaagcctcggcaaaaacgtactgccactaaagcatacaatgtaacac aagctttcggcagacgtggtccagaacaaacccaaggaaattttggggaccaggaactaatcagacaaggaactgattacaaacattg gccgcaaattgcacaatttgcccccagcgcttcagcgttcttcggaatgtcgcgcattggcatggaagtcacaccttcgggaacgtggt tgacctacacaggtgccatcaaattggatgacaaagatccaaatttcaaagatcaagtcattttgctgaataagcatattgacgcatacaa aacattcccaccaacagagcctaaaaaggacaaaaagaagaaggctgatgaaactcaagccttaccgcagagacagaagaaacag caaactgtgactcttcttcctgctgcagatttggatgatttctccaaacaattgcaacaatccatgagcagtgctgactcaactcaggccta aactcatgcagaccacacaaggcagatgggctatataaacgttttcgcttttccgtttacgatatatagtctactcttgtgcagaatgaattc tcgtaactacatagcacaagtagatgtagttaactttaatctcacatagcaatctttaatcagtgtgtaacattagggaggacttgaaagag ccaccacattttcaccgaggccacgcggagtacgatcgagtgtacagtgaacaatgctagggagagctgcctatatggaagagccct aatgtgtaaaattaattttagtagtgctatccccatgtgattttaatagcttcttaggagaatgacaaaaaaaaaaaaattaattttagtagtgc

(SEQ ID N0:2).

XIII. EXAMPLES

[0142] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

Example 1 Discovery and Validation of SARS-CoV-2 peptides for the development of therapeutics for preventing and treating COVID-19.

[0143] A COVID-19 HLA-A3/A11 restricted peptide was identified through eluting an MHC binding peptide from tumor cells and then performing tandem mass spectrum analysis (FIG. 1). First, the HLA-A3 or HLA-A11 gene was introduced into the MHC class I null cell line, K562, generating K562-A3 or K562-A11 cell lines, respectively. Because the cell lines only express one HLA allele, all naturally processed and presented MHC peptide is HLA-A3- or HLA-A 11 -restricted, which enhances the possibility of identifying additional MHC- restricted peptides, especially peptides that are in low abundance. The cells were lysed with NP-40 lysis buffer and the lysate was cleared and incubated with Sepharose Fast Flow beads coupled with anti-MHC class I antibody (anti-HLA-A, B, C, W6/32 clone). After immune- binding, the non-specific proteins were washed out and then the MHC peptide were eluted with acetic acid. The peptide solution was concentrated and analyzed using tandem mass spectrometry (MS1/MS2). From searching of the vims proteome database, such as with COVID-19 database sequences, high ion scoring peptides that match SARS-CoV-2 peptides can be identified. This experimental plan is further depicted in FIG. 1.

[0144] After searching COVID-19 sequences with the MS raw data, a peptide having the sequence: LQGPPGTGK (SEQ ID NO:l) was identified from K562-A3 and K562-A11 elution. The ion score for this peptide is 41 for K562-A3 elution, and 31 for K562-A11 elution. From the NetMHC HLA binding prediction tool, the binding affinity of this peptide to HLA- A0301 is 1138 nM, to HLA-A1101 is 1755 nM, indicated this peptide would be presented with both HLA-A3 and HLA-A11 allele. Furthermore, according to the blast analysis, this peptide is also present in SARS-CoV. The elution profiles for this peptide are shown in FIG. 2. The peptide of SEQ ID NO:l is located in ORFlb, the amino acid position is from 5604 to 5612 (FIG. 3).

[0145] The peptide identified from MS was pulsed to mature dendritic cells and then co cultured with autologous PBMC from HLA-A1101 positive healthy donor in 48-well plates. After two rounds of stimulation, a portion of the T cells from the each well were collected for flow cytometry detection with tetramer and anti-CD8 staining (FIG. 4, left side). A small CD8+/Tetramer+ population was observed in one of the wells. The T cells in the wells with the tetramer+/CD8+ population were collected and the tetramer+/CD8+ population was sorted and expanded with rapid expansion protocol (REP). After REP for two weeks, high purity CTL (tetramer+ population over 70%) was observed (FIG. 4, right side).

Example 2: Sars-CoV-2 peptide analysis

[0146] To further study SARS-CoV-2 immunogenic peptides, the inventors sought to answer the questions of whether the peptide of SEQ ID NO: 1 is a random hit or whether there is any evidence, in addition to protein-level data, to show that the virus fragments exist in K562/H1299 cell lines.

[0147] This can be explored at the DNA level by looking at the genome of humans infected by virus and/or whole genome sequence for K562/H1299. However, this is an expensive process and not economically feasible in most situations. At the RNA level, one could analyze RNA-seq data, analyze public accessible database (64 data for K562 and 2 data for H1299), analyze, whether the fragment is located in consensus region (motif) of related genomes, whether the fragment exists in ’’normal human tissue,” and whether the fragment exists in SARS-CoV-2 RNA-seq. At the protein level, one could analyze peptides, such as the peptide of SEQ ID NO:l that maps to coronavirus and is shared peptide with Sars-CoV-2.

[0148] The inventors analyzed RNAseq raw data from 64 K562 cell lines and found three transcripts that matched the target fragment (FIG. 5A-C). The inventors performed further analysis to determine whether the target sequence is located in consensus regions of published SARS-CoV-2 genomes. As of March 27, 2020, there are 153 genome versions in total. Based on MSA analysis, the inventors defined 195 consensus regions with length larger than 16 bp (FIG. 6). It was found that the target sequence was located on one of consensus regions (FIG. 7). The inventors also sought to determine whether this target sequence could be found in normal tissue, in particular from human lung or blood normal tissue. They did not find any exact matches to the sequence from normal lung/blood tissue.

[0149] Using the data described herein, the inventors generated customized ref genome map for K562. Based on BLAST search results (columns 2-3), these three transcripts can be found on chromosome 16 and chromosome 7. Also, it was found that Blast against Hm. mRNA (column 5), did not produce any hits for the first two transcripts and produced only one hit for third transcript that is matched to RFC2 (replication factor c subunit 2). It was shown that some of the novel antigen is derived from the remaining intron. It was concluded that this fragment may be hidden in a human intron, if this is in fact a true target instead of a random hit. This is consistent with other mechanisms in cancer that demonstrate that intron retention is a source of neoepitopes in cancers. Table: K562 transcripts mapped to ref genome and mRNA

multiple times from K562 and H1299 cell lines, is annotated with the coronavirus proteome and not the human proteome, is found expressed on K562 RNA-seq data, is located on one of consensus regions on SARS-CoV-2 genomes (n=153), is not exactly matched on normal lung/blood RNA-seq data, and is possible a fragment from human intron (or virus exons). Currently, the inventors are working on validating the targeted epitope of SEQ ID NO:l with SARS-CoV-2 RNA-seq data. 1 1 1

[0151] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Claims

WHAT IS CLAIMED IS:

1. An isolated peptide comprising at least 66% sequence identity to SEQ ID NO:l.

2. The peptide of claim 1, wherein the peptide comprises at least 6 contiguous amino acids of SEQ ID NO:l.

3. The peptide of claim 1, wherein the peptide comprises at least 7 contiguous amino acids of SEQ ID NO:l.

4. The peptide of claim 1, wherein the peptide comprises at least 8 contiguous amino acids of SEQ ID NO:l.

5. The peptide of any one of claims 1-4, wherein the peptide comprises at least 77% sequence identity to SEQ ID NO:l.

6. The peptide of any one of claims 1-5, wherein the peptide comprises at least 88% sequence identity to SEQ ID NO:l.

7. The peptide of any one of claim 1-6, wherein the peptide comprises or consists of SEQ ID NO:l.

8. The peptide of any one of claims 1-7, wherein the peptide is 13 amino acids in length or less.

9. The peptide of claim 8, wherein the peptide consists of 9 amino acids.

10. The peptide of any one of claims 1-9, wherein the peptide is immunogenic.

11. The peptide of any one of claims 1-10, wherein the peptide is modified.

12. The peptide of claim 11 , wherein the modification comprises conjugation to a molecule.

13. The peptide of claim 11 or 12, wherein the molecule comprises an antibody, a lipid, an adjuvant, or a detection moiety.

14. A mammalian cell comprising a coronavirus nucleic acid.

15. The cell of claim 14, wherein the coronavirus is a coronavirus isolated from bats.

16. The cell of claim 15, wherein the coronavirus is SARS-CoV or SARS-CoV-2.

17. The cell of any one of claims 14-16, wherein the nucleic acid comprises DNA.

18. The cell of claim any one of claims 14-17, wherein the cell is a human cell.

19. The cell of any one of claims 14-18, wherein the cell further comprises a heterologous promoter that directs the expression of the nucleic acid.

20. The cell of any one of claims 14-19, wherein the cell comprises a K562 cell.

21. The cell of any one of claims 14-20, wherein the cell comprises a fragment of a coronavirus gene.

22. The cell of any one of claims 14-21 , wherein the cell comprises a polypeptide expressed from the nucleic acid.

23. The cell of any one of claims 14-22, wherein the cell further comprises an HLA-A3 polypeptide or HLA-A11 polypeptide.

24. The cell of claim 23, wherein the HLA-A3 or HLA-A11 polypeptide is expressed from a nucleic acid encoding the HLA-A3 or HLA-A11 polypeptide.

25. The cell of claim 24, wherein the nucleic acid is DNA.

26. The cell of claim 24 or 25, wherein the nucleic acid is integrated into the host genome.

27. The cell of any one of claims 24-27, wherein the cell further comprises a heterologous promoter that directs the expression of the HLA-A3 or HLA-A11 nucleic acid.

28. The cell of any one of claims 19-27, wherein the promoter that directs the expression of the HLA-A3, HLA-A11, and/or the coronavirus nucleic acid is constitutive.

29. The cell of any one of claims 14-28, wherein the nucleic acid comprises a nucleic acid from the ORFlb region of SARS-CoV-2.

30. The cell of any one of claims 14-29, wherein the nucleic acid encodes for a spike or membrane protein from a coronavirus.

31. The cell of any one of claims 14-30, wherein the nucleic acid comprises SEQ ID NO:2 or a fragment thereof, or a gene encoded therein.

32. A method comprising: contacting the cells of any one of claims 14-31, or an extract thereof with an anti-HLA-A, HLA-B, and/or HLA-C antibody.

33. The method of claim 32, wherein the method further comprises lysing the cells.

34. The method of claim 33, wherein the cells are lysed before or after contact of the antibody.

35. The method of any one of claim 32-34, wherein the method further comprises one or more of the following steps: (i) washing components not complexed with the antibody, (ii) separation of components complexed with the antibody from components not complexed with the antibody, and/or (iii) elution of peptides complexed with the antibody.

36. The method of claim 35, wherein the method further comprises elution of peptides complexed with the antibody and wherein the elution comprises elution with acetic acid.

37. The method of claim 36, wherein the method further comprises sequencing of the peptides.

38. The method of claim 37, wherein sequencing of the peptides comprises mass spectrometry.

39. The method of claim 38, wherein the mass spectrometry is tandem mass spectrometry.

40. The method of any of claims 35-39, wherein the cells are K562 cells.

41. A peptide identified by the method of any one of claims 32-39.

42. A composition comprising at least one MHC polypeptide and the peptide of any one of claims 1-13 or 41.

43. The composition of claims 42, wherein the MHC polypeptide is and/or peptide is conjugated to a detection tag.

44. The composition of claim 42 or 43, wherein the MHC polypeptide and peptide are operatively linked.

45. The composition of claim 44, wherein the MHC polypeptide and peptide are operatively linked through a peptide bond.

46. The composition of claim 44, wherein the MHC polypeptide and peptide are operatively linked through van der Waals forces.

47. The composition of any one of claims 44-46, wherein at least two MHC polypeptides are linked to one peptide.

48. The composition of any one of claims 42-47, wherein the average ratio of MHC polypeptides to peptides is 4:1.

49. A composition comprising the peptide of any one of claims 1-13 or 41.

50. The composition of claim 49, wherein the composition is formulated as a vaccine.

51. The composition of claim 49 or 50, wherein the composition further comprises an adjuvant.

52. A nucleic acid encoding for the peptide of any one of claims 1-13 or 41.

53. An expression vector comprising the nucleic acid of claim 52.

54. A host cell comprising the nucleic acid of claim 52 or the expression vector of claim 53.

55. An in vitro isolated dendritic cell comprising the peptide of any one of claims 1-13 or 41, the nucleic acid of claim 52, or the expression vector of claim 53.

56. The dendritic cell of claim 55, wherein the dendritic cell is a mature dendritic cell.

57. The dendritic cell of claim 55 or 56, wherein the cell is a cell with an HLA-A type.

58. The dendritic cell of claim 57, wherein the cell is an HLA-A3 or HLA-A11 type.

59. A method of making a cell comprising transferring the nucleic acid of claim 52 or the expression vector of claim 53 into the cell.

60. The method of claim 59, wherein the method further comprises isolating the expressed peptide or polypeptide.

61. An in vitro method for making a therapeutic T cell vaccine comprising co-culturing T cells with the peptide of any one of claims 1-13 or 41.

62. The method of claim 61, wherein the T cell comprises a CD8+ T cell.

63. The method of claim 61 or 62, wherein the peptide is complexed with MHC.

64. The method of claim 63, wherein the MHC comprises HLA-A type.

65. The method of claim 64, wherein the MHC comprises HLA-A3 or HLA-A 11 type.

66. The method of any one of claims 61-65, wherein the peptides are loaded onto dendritic cells, lymphoblastoid cells, peripheral blood mononuclear cells (PBMCs), artificial antigen presentation cells (aAPC), or artificial antigen presentation surface.

67. A T cell made by the method of any one of claims 61-66.

68. A T cell comprising a TCR that specifically binds to a peptide of SEQ ID NO:l.

69. The T cell of claim 68, wherein the T cell comprises a CD8+ T cell.

70. The T cell of claim 69, wherein the T cell comprises a cytotoxic T lymphocyte.

71. A method of stimulating an immune response in a subject, the method comprising administering an effective amount of the peptide of any one of claims 1-13 or 41, the composition of any one of claims 49-51, the nucleic acid of claim 52, the expression vector of claim 53, the dendritic cell of any one of claims 56-58, or the T cell of any one of claims 67- 70.

72. A method for treating or preventing a coronavirus infection in a subject, the method comprising administering the peptide of any one of claims 1-13 or 41, the composition of any one of claims 49-51, the nucleic acid of claim 52, the expression vector of claim 53, the dendritic cell of any one of claims 56-58, or the T cell of any one of claims 67-70.

73. The method of claim 72, wherein the T cell is autologous.

74. The method of claim 72, wherein the T cell is allogenic.

75. The method of any one of claims 72-74, wherein the subject has been diagnosed with a coronavirus.

76. The method of any one of claims 72-75, wherein the coronavirus comprises a coronavirus isolated from bats.

77. The method of claim 76, wherein the coronavirus is SARS-CoV or SARS-CoV-2.

78. The method of any one of claims 78, wherein the method comprises preventing or treating COVID-19 or SARS.

79. The method of any one of claims 72-78, wherein the subject has been diagnosed with complications relating to a coronavirus.

80. The method of claim 79, wherein the complication comprises pneumonia.

81. The method of any one of claims 72-74, wherein the subject has not been diagnosed with a coronavirus.

82. The method of any one of claims 72-81, wherein the method further comprises administering an additional treatment.

83. The method of any one of claims 72-82, wherein the subject is vaccinated against a coronavirus.

84. A method comprising contacting the composition of any one of claims 43-48 with a composition comprising T cells and detecting T cells with bound peptide and/or MHC polypeptide by detecting a detection tag.

85. The method of claim 84, wherein the method further comprises counting the number of T cells bound with peptide and/or MHC.

86. The method of claim 84 or 85, wherein the composition comprising T cells is isolated from a patient having or suspected of having a coronavirus.

87. The method of claim 86, wherein the coronavirus is a coronavirus isolated from bats.

88. The method of claim 86, wherein the coronavirus is SARS-CoV or SARS-CoV-2.

89. The method of any one of claims 84-88, wherein the method further comprises sorting the number of T cells bound with peptide and/or MHC.

90. The method of claim 89, wherein the method further comprises sequencing one or more TCR genes from T cells bound with peptide and/or MHC.

91. The method of claim 90, wherein the method further comprises grouping of lymphocyte interactions by paratope hotspots (GLIPH) analysis.

92. A method of producing coronavirus -specific immune effector cells comprising:

(a) obtaining a starting population of immune effector cells; and

(b) contacting the starting population of immune effector cells with the coronavirus peptide of any one of claims 1-13 or 41, thereby generating coronavirus -specific immune effector cells.

93. The method of any claim 92, wherein the coronavirus is a coronavirus isolated from bats.

94. The method of claim 92, wherein the coronavirus is SARS-CoV or SARS-CoV-2.

95. The method of any one of claims 92-94, wherein contacting is further defined as co culturing the starting population of immune effector cells with antigen presenting cells (APCs), wherein the APCs present the coronavirus peptide on their surface.

96. The method of claim 95, wherein the APCs are dendritic cells.

97. The method of any one of claims 92-96, wherein the immune effector cells are T cells, peripheral blood lymphocytes, NK cells, invariant NK cells, NKT cells.

98. The method of any one of claims 92-97 , wherein the immune effector cells have been differentiated from mesenchymal stem cell (MSC) or induced pluripotent stem (iPS) cells.

99. The method of claim 97, wherein the T cells are CD8⁺ T cells, CD4⁺ T cells, or gd T cells.

100. The method of claim 97, wherein the T cells are cytotoxic T lymphocytes (CTLs).

101. The method of any one of claims 92-100, wherein obtaining comprises isolating the starting population of immune effector cells from peripheral blood mononuclear cells (PBMCs).

102. The method of any one of claims 92-101, wherein the starting population of immune effector cells is obtained from a subject.

103. The method of claim 102, wherein the subject is a human.

104. The method of claim 103, wherein the subject has a coronavirus infection.

105. The method of claim 104, wherein the coronavirus infection comprises COVID-19 or

SARS.

106. The method of any one of claims 96-105, wherein the method further comprises introducing the coronavirus peptides or a nucleic acid encoding the coronavirus peptides into the dendritic cells prior to the co-culturing.

107. The method of claim 106, where the peptide or nucleic acids encoding the peptide are introduced by electroporation.

108. The method of claim 106, wherein the peptide or nucleic acids encoding the peptide are introduced by adding the peptide or nucleic acid encoding the peptide to the dendritic cell culture media.

109. The method of claim 106, wherein the immune effector cells are co-cultured with a second population of dendritic cells into which the peptide or the nucleic acid encoding the peptide has been introduced.

110. The method of claim 106, wherein a population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells are purified from the immune effector cells following the co-culturing.

111. The method of claim 110, wherein a clonal population of coronavirus-specific immune effector cells are generated by limiting or serial dilution followed by expansion of individual clones by a rapid expansion protocol.

112. The method of claim 111, wherein the method further comprises cloning of a T cell receptor (TCR) from the clonal population of coronavirus-specific immune effector cells.

113. The method of claim 112, wherein cloning of the TCR is cloning of a TCR alpha and a beta chain.

114. The method of claim 112 or claim 113, wherein the TCR is cloned using a 5’-Rapid amplification of cDNA ends (RACE) method.

115. The method of claim 114, wherein the cloned TCR is subcloned into an expression vector.

116. The method of claim 115, wherein the expression vector is a retroviral or lentiviral vector.

117. The method of claim 116, where a host cell is transduced with the expression vector to generate an engineered cell that expresses the TCR.

118. The method of claim 117, wherein the host cell is an immune cell.

119. The method of any one of claims 96-118, wherein the immune cell is a T cell and the engineered cell is an engineered T cell.

120. The method of claim 119, wherein the T cell is a CD8⁺ T cell, CD4+ T cell, or gd T cell and the engineered cell is an engineered T cell.

121. The method of claim 120, wherein the starting population of immune effector cells is obtained from a subject with a coronavirus infection and the host cell is allogeneic or autologous to the subject.

122. The method of claim 121, wherein the subject has SARS or COVID-19.

123. The method of claim 119 or 120, wherein a population of CD8-positive and coronavirus peptide MHC tetramer-positive engineered T cells are purified from the transduced host cells.

124. The method of claim 110, wherein a clonal population of coronavirus -specific engineered T cells are generated by limiting or serial dilution followed by expansion of individual clones by a rapid expansion protocol.

125. A coronavirus -specific engineered T cell produced according to any one of the methods of claims 92-124.

126. A pharmaceutical composition comprising the T cells of claim 125.

127. A method of treating a coronavirus infection in a subject comprising administering an effective amount of the coronavirus-specific T cells of claim 125 to the subject.

128. The method of claim 127, wherein the subject is a human.

129. The method of claim 127 or 128, wherein the coronavirus-specific T cells are autologous or allogeneic.

130. The method of any one of claims 127-129, further comprising administering at least a second therapeutic agent.

131. The method of claim 130, wherein the second therapeutic agent is an antiviral agent.

132. A method of cloning a coronavims T cell receptor (TCR), the method comprising

(a) obtaining a starting population of immune effector cells;

(b) contacting the starting population of immune effector cells with the coronavims peptide of any one of claims 1-13 or 41, thereby generating coronavims -specific immune effector cells;

(c) purifying immune effector cells specific to the coronavims peptide,

(d) isolating a TCR sequence from the purified immune effector cells.

133. The method of claim 132, wherein the coronavims is a coronavims isolated from bats.

134. The method of claim 132, wherein the coronavims is SARS-CoV or SARS-CoV-2.

135. The method of any one of claims 132-134, wherein contacting is further defined as co culturing the starting population of immune effector cells with antigen presenting cells (APCs), wherein the APCs present the coronavims peptide on their surface.

136. The method of claim 135, wherein the APCs are dendritic cells.

137. The method of claim 132, wherein the immune effector cells are T cells, peripheral blood lymphocytes, NK cells, invariant NK cells, NKT cells.

138. The method of claim 132, wherein the immune effector cells have been differentiated from mesenchymal stem cell (MSC) or induced pluripotent stem (iPS) cells.

139. The method of claim 137, wherein the T cells are CD8⁺ T cells, CD4⁺ T cells, or gd T cells.

140. The method of claim 137, wherein the T cells are cytotoxic T lymphocytes (CTLs).

141. The method of any one of claims 132-141, wherein obtaining comprises isolating the starting population of immune effector cells from peripheral blood mononuclear cells (PBMCs).

142. The method of any of claims 132-141, wherein the starting population of immune effector cells is obtained from a subject.

143. The method of claim 142, wherein the subject is a human.

144. The method of claim 143, wherein the subject has a coronavims infection.

145. The method of claim 144, wherein the subject has COVID-19 or SARS.

146. The method of any one of claims 136-145, wherein the method further comprises introducing the coronavims peptide or a nucleic acid encoding the coronavims peptide into the dendritic cells prior to the co-culturing.

147. The method of claim 146, where the peptide or nucleic acid encoding the peptide are introduced by electroporation.

148. The method of claim 146, wherein the peptide or nucleic acid encoding the peptide are introduced by adding the peptide or nucleic acid encoding the peptide to the media of the dendritic cells.

149. The method of claim 146, wherein the immune effector cells are co-cultured with a second population of dendritic cells into which the coronavirus peptide or a nucleic acid encoding the coronavirus peptide has been introduced.

150. The method of claim 146, wherein purifying is defined as purifying a population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells from the immune effector cells following the co-culturing.

151. The method of claim 150, wherein the population of CD8-positive and coronavirus peptide MHC tetramer-positive T cells are purified by fluorescence activated cell sorting (FACS).

152. The method of claim 151, wherein purifying further comprises generation of a clonal population of coronavirus -specific immune effector cells by limiting or serial dilution of sorted cells followed by expansion of individual clones by a rapid expansion protocol.

153. The method of claim 152, wherein isolating is defined as cloning of a T cell receptor (TCR) from the clonal population of coronavirus -specific immune effector cells.

154. The method of any one of claims 132-153, wherein the method further comprises sequencing the TCR alpha and/or beta gene(s) and/or performing grouping of lymphocyte interactions by paratope hotspots (GLIPH) analysis.

155. The method of claim 153 or 154, wherein cloning of the TCR is cloning of a TCR alpha and a beta chain.

156. The method of claim 155, wherein the TCR alpha and beta chains are cloned using a 5 ’-Rapid amplification of cDNA ends (RACE) method.

157. The method of claim 156, wherein the cloned TCR is subcloned into an expression vector.

158. The method of claim 157, wherein the expression vector comprises a linker domain between the TCR alpha sequence and TCR beta sequence.

159. The method of claim 158, wherein the linker domain comprises a sequence encoding one or more peptide cleavage sites.

160. The method of claim 159, wherein the one or more cleavage sites are a Furin cleavage site and/or a P2A cleavage site.

161. The method of claim 160, wherein the TCR alpha sequence and TCR beta sequence are linked by an IRES sequence.

162. The method of any of claims 157-161, wherein the expression vector is a retroviral or lentiviral vector.

163. The method of claim 162, where a host cell is transduced with the expression vector to generate an engineered cell that expresses the TCR alpha and beta chains.

164. The method of claim 163, wherein the host cell is an immune cell.

165. A method for prognosing or diagnosing a patient or for detecting T cell responses in a patient, the method comprising: contacting a biological sample from the patient with the peptide of any one of claims 1-13 or 41.

166. The method of claim 165, wherein the biological sample comprises a blood sample or a fraction thereof.

167. The method of claim 166, wherein the biological sample comprises lymphocytes.

168. The method of claim 167, wherein the biological sample comprises a fractionated sample comprising lymphocytes.

169. The method of any one of claims 165-168, wherein the peptide is linked to a solid support.

170. The method of claim 169, wherein the peptide is conjugated to the solid support or is bound to an antibody that is conjugated to the solid support.

171. The method of claim 169, wherein the solid support comprises a microplate, a bead, a glass surface, a slide, or a cell culture dish.

172. The method of any one of claims 165-171, wherein detecting T cell responses comprises detecting the binding of the peptide to the T cell or TCR.

173. The method of any one of claims 165-172, wherein detecting T cell responses comprises an ELISA, ELISPOT, or a tetramer assay.