WO2021220137A2 - Inhibiteurs de pannexine-1 pour le traitement de la covid-19 de patients infectés par le sras-cov-2 avec ou sans syndrome respiratoire aigu associé - Google Patents

Inhibiteurs de pannexine-1 pour le traitement de la covid-19 de patients infectés par le sras-cov-2 avec ou sans syndrome respiratoire aigu associé Download PDF

Info

Publication number
WO2021220137A2
WO2021220137A2 PCT/IB2021/053426 IB2021053426W WO2021220137A2 WO 2021220137 A2 WO2021220137 A2 WO 2021220137A2 IB 2021053426 W IB2021053426 W IB 2021053426W WO 2021220137 A2 WO2021220137 A2 WO 2021220137A2
Authority
WO
WIPO (PCT)
Prior art keywords
ihumi
probenecid
egcg
pannexin
combination
Prior art date
Application number
PCT/IB2021/053426
Other languages
English (en)
Other versions
WO2021220137A3 (fr
Inventor
Laurent Lecanu
Original Assignee
Sapir Pharmaceuticals Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sapir Pharmaceuticals Inc. filed Critical Sapir Pharmaceuticals Inc.
Publication of WO2021220137A2 publication Critical patent/WO2021220137A2/fr
Publication of WO2021220137A3 publication Critical patent/WO2021220137A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin

Definitions

  • the present invention relates to the use of agents that inhibits the target pannexin-1 for the treatment of SARS-CoV-2 infection. More particularly, the invention relates to a use of probenecid and other pannexin-1 blockers in the treatment of infectious disease caused by the novel coronavirus-2 (SARS-CoV-2) in Coronavirus disease (COVID-19) infected human subjects with or without an associated acute respiratory syndrome.
  • SARS-CoV-2 novel coronavirus-2
  • COVID-19 Coronavirus disease
  • the invention further describes methods, compositions and pharmaceutical compositions useful in inhibiting pannexin-1, and in treating infected human subjects suffering from SARS-CoV- 2 causing COVID-19 disease.
  • Coronaviruses are large, enveloped, plus-stranded RNA viruses. They cause the common cold in all age groups accounting for approximately 15% of all colds. Coronaviruses have been implicated in the etiology of gastrointestinal disease in infants. They also cause economically important diseases in animals (e.g. avian infectious bronchitis and porcine transmissible gastroenteritis). Coronaviruses get their name because in electron micrographs the envelope glycoproteins appear to form a halo or corona around the periphery of the virion. The coronaviruses are also interesting because they are the only plus-strand RNA viruses with a helical nucleocapsid. Coronaviruses are a major cause of common colds in the winter months.
  • the virus is found throughout the world. Antibodies begin to appear in childhood, and are found in more than 90% of adults. The frequency of coronavirus respiratory infections is highly variable from year to year. The highest incidence occurs in years when rhinovirus colds are lowest. Coronavirus colds tend to occur in defined outbreaks.
  • Coronaviruses have the largest genomes of all RNA viruses and replicate by a unique mechanism which results in a high frequency of recombination. Virions mature by budding at intracellular membranes, and infection with some coronaviruses induces cell fusion. All the viruses, SARS-COV-1 as well as MERS-CoV share a similar protein-cutting enzyme, called the “main protease” in coronavirus and the ‘3C protease’ in enterovirus, that is essential for viral replication. (Zhang et al., J. Med. Chem. Feb, 2020).
  • main protease of coronaviruses and 3C protease of enterovirus share a similar active-site architecture and a unique requirement for glutamine in the PI position of the substrate. Because of their unique specificity and essential role in viral polyprotein processing, these proteases are suitable targets for development of anti-viral drugs.
  • flavonoids like quercetin have been shown to inhibit MERS-CoV 3C-like protease (Jo et al., Chem. Biol Drug. Des. (2019): vol. 00, pages 1-8).
  • EGCG Epigallocatechin gallate
  • EGCG has been shown to interact with the catalytic triad (His51, Asp75, Serl35) of the active site (Yadav et al., 2020 J. Biomol Struct. Dyn. 1-13).
  • EGCG decreased H1N1 replication by increasing interferon IFN- ⁇ 2 secretion in human lung epithelial BEAS-2B cells (Zhu et. al, 2020 J. Thorac. Dis. 12: 989- 997, 2020.
  • EGCG decreased cytokine storm, lung tissue damage and protected respiratory function in a mouse model of H9N2 swine flu virus.
  • EGCG (10 mg/kg, gavage, 5 days) reduced immune infiltration and IL-1 ⁇ and TNF- ⁇ levels in bronchoalveolar fluid.
  • increased mice survival rate Xu et al., 2017 Int. Immunopharmacol 52: 24-33.
  • the effect of EGCG has been extensively studied on hepatitis-C virus.
  • EGCG has been demonstrated to block HCV entry in human liver cells Huh-7 and to prevent cell-to- cell transmission (Calland et al., 2012 Hepatology 55: 720-729).
  • This effect may be due, at least in part, to ECGC binding onto the viral protein NS5B (Roh and Jo 2011 Talanta 85: 2639-2642) and/or repressing CD81 expression (Mekky et al., 2019 Arch. Virol 164: 1587-
  • EGCG also demonstrated an antiviral effect against dengue (Ismail et. al, 2017 Interdiscip Sci 9: 499-511 - Raekiansyah et. al, 2011 Arch. Virol 163: 1649-1655), HBV (Lai et al., 2018 BMC Complement. Altern. Med. 18: 248), Japanese encephalitis (Wang et. al., 2018 Virus. Res. 253: 140-146) and chikungunya viruses (Lu et. al., 2017 Biochem. Biophys. Res. Commun. 491: 595-602 - Weber et. al., 2015 Antiviral Res. 113: 1-3).
  • Pneumonia infection leads to a massive inflammatory reaction, called ‘cytokines storm’, that is well documented in the context of viral lung infection (Short et. al, Lancet Infect. Dis.
  • Panx-1 channels appears to be at the crossroad of upstream receptor like vanilloid TRPV and downstream ATP receptors like P2Y and P2X, all described as key actors of lung inflammation. Therefore, blocking ATP release through Panx-1 will offer the advantage of an upstream MoA capable of altering the course of pulmonary hyperinflammation, neurogenic bronchoconstriction and cough reflex.
  • pandemic Covid-19 disease has become a serious threat to the global public health due to unavailability of drugs or vaccines to treat this infectious disease.
  • novel drugs and new approaches to develop them are urgently needed.
  • de novo drug discovery and drug repurposing have been used in the search for an effective antiviral drug.
  • drug repurposing can reduce the time, cost and risk associated with drug innovation.
  • probenecid has been used for other clinical indications, till date it has not been repurposed for the treatment of Covid-19 infectious disease with or without an associated acute respiratory syndrome either alone or in combination with other drugs and flavonoids like quercetin.
  • the present invention discloses the therapeutic use of probenecid and other pannexin-1 blockers for the treatment of novel coronavirus infection with or without an associated acute respiratory syndrome.
  • the probenecid can be administered either alone or in combination with drugs interfering with the viral replication like, but not limited to, RNA- dependent RNA polymerase inhibitors, with drug interfering with the virus cell entry or with drugs interfering the lung hyperinflammation like, but not limited to, IL-6 pathway inhibitors.
  • the present invention includes the use of probenecid in combination with EGCG, a green tea flavonoid described to interfere with the virus cell entry or quercetin, a flavonoid described, like EGCG, to reduce lung hyperinflammation, IL-6 production, lung tissue damage and bronchoconstriction.
  • the probenecid either alone or with combination of other drugs can be administered by oral or parenteral or aerosol or intranasal routes.
  • the said formulation may optionally contain other conventional pharmaceutical aids such as pharmaceutically acceptable carrier, additive or excipients such as stabilizers, preservatives, or buffering agents.
  • the present invention relates to the use of probenecid and other pannexin-1 blockers for the treatment of novel coronavirus infection with or without an associated acute respiratory syndrome.
  • Probenecid maybe administered by oral, parenteral, aerosol or intranasal route.
  • Probenecid may be administered either alone or in combination with drugs interfering with the viral replication like, but not limited to, RNA-dependent RNA polymerase inhibitors or with the drugs interfering with the lung hyperinflammation like, but not limited to, IL-6 pathway inhibitors.
  • the present invention includes the use of probenecid in combination with quercetin, a flavonoid described to reduce lung hyperinflammation, IL- 6 production and bronchoconstriction.
  • Probenecid is an OATP-3 solute transporter antagonist (Hagos et al., Xenobiotica (2017): vol. 47(4), pages 346-353) and a pannexin-1 ATP channel blocker (Silverman et al.., Am J Physiol Cell Physiol (2008): vol.295(3), pages C761-767).
  • Probenecid blocks the replication of the influenza virus strain H1N1 in infected mice during in vitro and in vivo studies (Perwitasari et al.., Antimicrob Agents Chemother (2013): vol. 57(1), pages 475-483).
  • the solute transporter OAT-3 is necessary to the replication of the influenza virus in lung epithelial cells.
  • Probenecid is a known OAT-3 antagonist in the kidney and constitute its mechanism of action for a gout treatment. Blocking OAT-3 in lung epithelial cells may results in a reduction of viral titer and related respiratory syndrome.
  • Probenecid decrease OAT-3 expression and decreases H1N1 replication during in vitro studies in human A549 lung epithelial cells and during in vivo studies in infected mice (Perwitasari et al.., 2013).
  • Probenecid administered to H1N1 infected mice following a prophylactic or a therapeutic regimen resulted in a decrease of the lung viral titer and an increase of the survival curve of the animals.
  • Antiviral effects were observed at doses of 10 and 25 mg/kg intraperitoneally, of which corresponding Human Equivalent Dose falls within the therapeutic range. This explains the effect of probenecid on viral replication.
  • NCDB probenecid derivative N-(3-chlorophenyl)-4-(N,N-diethylsulfamoyl)- benzamide
  • ATP has been shown to trigger mast cells degranulation, bronchoconstriction and mucus production during in vitro and in vivo studies.
  • ATP is a well-known pro-inflammatory molecules in the lung epithelium in asthma, allergen reactivity, cough and smoking-related COPD and its release through Panx-1 channels is now evident (Lommatzsch et al., Am. J. Resp. Crit. Care Md (2010): vol. 181, pages 928-934).
  • pro-inflammatory vanilloid receptors TRPV-1 and TRPV-4 triggers ATP release in epithelial airway though Panx-1 channels in human COPD lung tissue.
  • Probenecid inhibits ATP release from human bronchoepithelial cells which are exposed to cigarette smoke (Baxter et al., Thorax (2014): vol. 69, pages 1080-1089).
  • Probenecid reduces lung inflammation in mice infected with Pseudomonas aeruginosa (Wonnenberg et al., Int. J. Med Microbiol (2014): vol. 304, pages 725-729).
  • probenecid when administered through oral route at the dose of 80 mg/kg for two days significantly decreased the lung inflammation and the concentration of pro- inflammatory chemokines IL-1 ⁇ and TNF- ⁇ in the bronchoalveolar fluid of mice infected with Pseudomonas aeruginosa.
  • the therapeutic dose of probenecid falls within the Human Equivalent Dose range used in clinic.
  • Probenecid reduces lung airways hyperinflammation and increases survival in mice infected with the influenza virus strain H1N1 and H3N2 (Rosli et al., Br. J Pharmacol (2019): vol. 176, 3834-3844). It is disclosed that probenecid when given by intranasal route (40 mg/kg every 2 days over 9 days) inhibited the activation of the NLRP3 inflammasome shown by a significant reduction of immune cells infiltration and a lower concentration of the proinflammatory chemokines IL-1b, IL-6 and TNFa in the bronchoalveolar fluid of mice infected with either H3N2 or H1N1 flu virus. This reduction of the lung hyperinflammation was accompanied by a dramatic increase of the mice survival. This therapeutic effect was equivalent in magnitude to the one obtained with
  • probenecid and other pannexin-1 blockers are formulated in several dosage forms and used for the treatment of novel coronavirus infection with or without an associated acute respiratory syndrome.
  • the present invention includes the use of probenecid in combination with quercetin, a flavonoid described to reduce lung hyperinflammation, IL-6 production and bronchoconstriction (Micek et aL, Molecules (2016): vol. 21(5), pages E623).
  • Probenecid is administered either alone or in combination with drugs interfering with the viral replication like, but not limited to, RNA-dependent RNA polymerase inhibitors or with drugs interfering the lung hyperinflammation like, but not limited to, IL-6 pathway inhibitors.
  • present invention includes the use of probenecid in combination with quercetin, a flavonoid described to reduce lung hyperinflammation, IL-6 production and bronchoconstriction.
  • present invention includes the use of probenecid in combination with Epigallocatechin gallate (EGCG).
  • EGCG Epigallocatechin gallate
  • epigallocatechin-3-gallate EGCG is the ester of epigallocatechin and gallic add, and is a type of catechin.
  • EGCG the most abundant catechin in tea is a polyphenol under basic research for its potential to affect human health and disease.
  • EGCG has been reported to exert antiviral properties against various harmful viruses in preclinical and clinical setups.
  • EGCG at doses corresponding to Human Equivalent Doses relevant to human use, reduced lung hyperinflammation, cytokines storm and secretion of IL-6 in the bronchoalveolar fluid and lung tissue in a mouse model paraquat intoxication (Shen et al. , 2017 Life. Sci. 170: 25- 32).
  • EGCG also at doses corresponding to Human Equivalent Doses relevant to its use in humans, decreased the production of pro- inflammatory cytokines TNF- ⁇ , IL-1 ⁇ and IL-6 in the bronchoalveolar fluid of a mouse model of lung inflammation and injury triggered by the bacterial toxin LPS.
  • COVID-19 use angiotensin- converting enzyme 2 (ACE2) to bind onto the cell and the serine protease TMPRSS2 to prime its S- protein (Hoffmann et al., 2020 Cell 181(2): 271-280).
  • ACE2 angiotensin- converting enzyme 2
  • TMPRSS2 serine protease
  • the present invention proposes a combination of Probenecid and EGCG.
  • Mechanism of action of Probenecid mainly involves interfering with the cytokines storm that takes place in the lung upon infection and preventing any loss of respiratory function from happening.
  • Probenecid acts at the host level.
  • EGCG binds onto viral proteins and block the virus capacity to interact with the host cells. It blocks virus cell entry and replication.
  • EGCG mainly acts at the virus level. By combining both active compounds, the newly created combination drug acts on the host response and on the virus capacity to interact with the host, both mechanisms of action complementing each other, hence potentializing the therapeutic response.
  • probenecid and other pannexin-1 blockers are formulated in several dosage forms and administered for the treatment of novel coronavirus infection with or without an associated acute respiratory syndrome.
  • the probenecid alone or with combination of other drugs can be administered by oral or parenteral or aerosol or intranasal routes.
  • the formulation optionally contains other conventional pharmaceutical aids such as pharmaceutically acceptable carrier, additive or excipients such as stabilizers, preservatives, or buffering agents.
  • the present invention thus provides use of probenecid and other pannexin-1 blockers for the treatment of coronavirus-2 (SARS-CoV-2) infection alone or as a combo with drugs interfering with the viral replication like, but not limited to, RNA-dependent RNA polymerase inhibitors.
  • composition may include drugs interfering with the lung hyperinflammation like, but not limited to, IL-6 pathway inhibitors.
  • the present invention includes the use of probenecid in combination with quercetin, a flavonoid described to reduce lung hyperinflammation, IL-6 production and bronchoconstriction.
  • Probenecid may be administered by oral route, injectable, aerosol, intranasal.
  • Probenecid is an already marketed drug with favorable toxicological profile.
  • Probenecid alone or with combination of other drugs is proposed to be developed as a sterile injectable solution, an aerosol or a solution for intranasal instillation.
  • the present invention provides a method of treating novel coronavirus infection with or without an associated acute respiratory syndrome comprising administering an effective amount of at least one Pannexin-1 inhibitor to a human subject; wherein, said coronavirus infection is a severe acute respiratory syndrome-related coronavirus-2 (SARS-CoV-2) causing novel coronavirus disease (COVID-19); said Pannexin-1 inhibitor is Probenecid, pharmaceutical salts and/or alternative salts thereof; and said Pannexin-1 inhibitor is co- administered in combination with an additional polyphenol in an amount effective to treat a coronavirus infection in a human subject or optionally with at least one flavonoid.
  • SARS-CoV-2 severe acute respiratory syndrome-related coronavirus-2
  • COVID-19 novel coronavirus disease
  • said Pannexin-1 inhibitor is Probenecid, pharmaceutical salts and/or alternative salts thereof
  • said Pannexin-1 inhibitor is co- administered in combination with an additional polyphenol in an amount effective to treat a coronavirus infection in a
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a combination of an amount of a Pannexin- 1 inhibitor with an additional polyphenol in an amount effective to treat a coronavirus infection in a human subject in combination with a pharmaceutically acceptable carrier, additive or excipient; wherein, said Pannexin-1 inhibitor is Probenecid, pharmaceutical salts and/or alternative salts thereof; and said polyphenol includes Epigallocatechin gallate (EGCG).
  • EGCG Epigallocatechin gallate
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a combination of an amount of a Pannexin-1 inhibitor with an additional flavonoid in an effective amount to treat a coronavirus infection in a human subject in combination with a pharmaceutically acceptable carrier, additive or excipient; wherein said Pannexin-1 inhibitor is Probenecid, pharmaceutical salts and/or alternative salts thereof; and said flavonoid is quercetin or its pharmaceutical salts and/or alternative salts thereof.
  • the composition is in a dosage form selected from a non-limiting group of inhalation dosage form, oral dosage form, intranasal dosage form, or parenteral dosage form.
  • the probenecid and other pannexin-1 blockers are used for the treatment of SARS-CoV-2 infection alone or as a combination with drugs interfering with the viral replication like, but not limited to, RNA-dependent RNA polymerase inhibitors and with the lung hyperinflammation like, but not limited to, IL-6 pathway inhibitors.
  • pannexin-1 inhibitors probenecid and the green tea catechin EGCG resulted in a signification inhibition of the viral replication of several viral strains. The degree of inhibition depended on the type of strain and concentration. Both the pannexin-1 inhibitors successfully inhibited more than 50% the replication of SARS-CoV-2 UK strain as depicted in Table 1 and 2.
  • Test Articles EGCG is procured from Taiyo Kagaku Japan, batch 002211 and Probenecid is procured from Teva Generics Society, batch 2307-01219.
  • Test articles concentrations EGCG: 10, 20 and 30 ⁇ ;
  • Viral strain IHUMI 3, 4 th passage
  • VERO C10008 cells are plated in 96-well plates at 5.10 5 cells/ml in 200 ⁇ l (1.105 cells/well). 8 wells per experimental condition (viral strain and test article concentration) are prepared.
  • test articles at corresponding concentrations and controls are added to the wells and pre-incubated at 37°C under 5% CO 2 for 4 hours.
  • 100 ⁇ l is sampled from 1 well corresponding to each experimental condition and constitute the HO control. Plates are incubated at 37°C under 5% CO 2 for 48 hours. RT-PCR is then performed on 100 ⁇ l of each well.
  • RNA is extracted from corresponding samples using QIAamp 96 Virus
  • QIAcube HT kit Qiagen. Real-time RT-PCR is carried out specifically targeting the N gene of the SARS-CoV-2 virus.
  • the primers used are forward GACCCCAAAATCAGCGAAAT, reverse TCTGGTTACTGCCAGTTGAATCTG and probe FAM-
  • the RT-PCR is conducted using the Superscript III Platinium One-Step Quantitative RT-PCR systems with ROX kit (Invitrogen). The final concentration is 320 nM primer and 200 nM probe in a volume of 25 ⁇ l containing 2 ⁇ l RNA. The equipment used is a LightCycler 480i (Roche Diagnostics). The percentage of inhibition of the viral replication is calculated using the 2 ⁇ (-deIta deIta Ct) method, as follow:
  • DCt control mean [Ct untreated H48 - mean Ct H0 ]

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne l'utilisation de probénécide et d'autres bloqueurs de pannexine-1 pour le traitement d'une nouvelle infection à coronavirus avec ou sans syndrome respiratoire aigu associé. Le probénécide peut être administré seul ou en combinaison avec des médicaments interférant avec la réplication virale comme, mais sans s'y limiter, des inhibiteurs d'ARN polymérase dépendant de l'ARN ou avec les médicaments interférant avec une hyperinflammation pulmonaire comme, mais sans s'y limiter, des inhibiteurs de la voie IL-6. En particulier, la présente invention fait appel à l'utilisation de probénécide en combinaison avec de la quercétine, un flavonoïde décrit pour réduire l'hyperinflammation pulmonaire, la production d'IL-6 et la bronchoconstriction. En outre, la présente invention concerne une composition pharmaceutique comprenant une combinaison d'une quantité d'un inhibiteur de pannexine-1 avec un polyphénol supplémentaire en une quantité efficace pour traiter une infection à coronavirus chez un sujet humain en combinaison avec un véhicule, un additif ou un excipient pharmaceutiquement acceptables, le polyphénol comprenant du gallate d'épigallocatéchine (EGCG).
PCT/IB2021/053426 2020-04-27 2021-04-26 Inhibiteurs de pannexine-1 pour le traitement de la covid-19 de patients infectés par le sras-cov-2 avec ou sans syndrome respiratoire aigu associé WO2021220137A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063015960P 2020-04-27 2020-04-27
US63/015,960 2020-04-27

Publications (2)

Publication Number Publication Date
WO2021220137A2 true WO2021220137A2 (fr) 2021-11-04
WO2021220137A3 WO2021220137A3 (fr) 2021-12-09

Family

ID=78332338

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/053426 WO2021220137A2 (fr) 2020-04-27 2021-04-26 Inhibiteurs de pannexine-1 pour le traitement de la covid-19 de patients infectés par le sras-cov-2 avec ou sans syndrome respiratoire aigu associé

Country Status (1)

Country Link
WO (1) WO2021220137A2 (fr)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257852A1 (en) * 2003-04-10 2006-11-16 Chiron Corporation Severe acute respiratory syndrome coronavirus
US8795693B2 (en) * 2003-08-04 2014-08-05 Foamix Ltd. Compositions with modulating agents
EP1694829B1 (fr) * 2003-12-02 2010-08-04 Institut Pasteur Nouvelle souche de coronavirus associe au sras et ses applications.
GB0418830D0 (en) * 2004-08-24 2004-09-22 Astrazeneca Ab Novel compounds
MX2021014742A (es) * 2019-06-05 2022-02-11 Univ Emory Peptidomimeticos para el tratamiento de infecciones por coronavirus y picornavirus.

Also Published As

Publication number Publication date
WO2021220137A3 (fr) 2021-12-09

Similar Documents

Publication Publication Date Title
Huang et al. A review of therapeutic agents and Chinese herbal medicines against SARS-COV-2 (COVID-19)
Yousefi et al. Repurposing existing drugs for the treatment of COVID-19/SARS-CoV-2 infection: A review describing drug mechanisms of action
Oo et al. Deciphering the potential of baicalin as an antiviral agent for Chikungunya virus infection
Kim et al. Inhibition of influenza virus replication by plant-derived isoquercetin
Chen et al. Activity of andrographolide and its derivatives against influenza virus in vivo and in vitro
Wu et al. Developments towards antiviral therapies against enterovirus 71
Liu et al. Antiviral activity and possible mechanisms of action of pentagalloylglucose (PGG) against influenza A virus
Saadh et al. Inhibitory effects of epigallocatechin gallate (EGCG) combined with zinc sulfate and silver nanoparticles on avian influenza A virus subtype H5N1.
Tan et al. Combination treatment with remdesivir and ivermectin exerts highly synergistic and potent antiviral activity against murine coronavirus infection
Kumar et al. Battling COVID-19: using old weapons for a new enemy
Duan et al. Current and future therapeutical approaches for COVID-19
Zhirnov Molecular targets in the chemotherapy of coronavirus infection
KR20240108337A (ko) 유행성 rna 바이러스 감염질환의 예방 또는 치료용 약제학적 조성물
Ikeda et al. In vitro and in vivo inhibition of ortho-and paramyxovirus infections by a new class of sulfonic acid polymers interacting with virus-cell binding and/or fusion
Beheshtirouy et al. Investigational antiviral drugs for the treatment of COVID-19 patients
Kucukoglu et al. What are the drugs having potential against COVID-19?
Wang et al. Drugs targeting structural and nonstructural proteins of the chikungunya virus: A review
CN111053892B (zh) 一种广谱抗肠道病毒的蛋白类药物及其应用
WO2021220137A2 (fr) Inhibiteurs de pannexine-1 pour le traitement de la covid-19 de patients infectés par le sras-cov-2 avec ou sans syndrome respiratoire aigu associé
CN114786659A (zh) 用于治疗汉坦病毒感染的mek抑制剂
CN113491699A (zh) 霉酚酸或含霉酚酸的组合制剂在抗冠状病毒中的应用
US11197912B2 (en) Prevention and treatment of viral infection and viral infection-induced organ failure
CN113440527B (zh) 萘酚喹或含萘酚喹的组合制剂在抗冠状病毒中的应用
JP2023517639A (ja) ＳＡＲＳ－ＣｏＶ－２ウイルスによって引き起こされるウイルス感染を処置するためのジルチアゼムを含む組成物
Rohde Drug targets in rhinoviral infections

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21795768

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21795768

Country of ref document: EP

Kind code of ref document: A2