WO2021218249A1 - Spinosyn derivative as argininosuccinate synthetase activator and application thereof - Google Patents

Abstract

Spinosyn A and a derivative thereof as activators of argininosuccinate synthetase 1 (ASS1) and mutant ASS1 G362V and an application thereof, the Spinosyn derivative having the general structural formula (I). Spinosyn and the derivative thereof can be used as a drug for the treatment of citrullinemia type I and as an anti-tumor drug by targeting the activation of ASS1 and mutant ASS1 G362V.

Description

Spinosyn derivatives as arginine succinate synthase activator and application thereof Technical field

The present invention relates to spinosyn A (Spinosyn A) and its derivatives which can regulate and activate Argininosuccinate synthetase (Argininosuccinate synthesis 1, ASS1). Such compounds can be used as treatments for diseases related to succinate synthase deficiency, such as anti-tumor and citrullinemia, and belong to the field of medicine.

Background technique

Argininosuccinate synthase (Argininosuccinate synthase, ASS1; EC 6.3.4.5) was first found in the liver, and was later considered to be a ubiquitous enzyme in mammals. The ASS1 gene is located on chromosome 9q34.11, the gene length is 56kb, the open reading frame length is 1239bp, with 16 exons, it encodes 412 amino acids, and the molecular weight is 46kDa. ASS1 catalyzes citrulline and aspartic acid to produce arginine succinate under the condition of ATP function. The compound is further decomposed into arginine and fumaric acid under the action of arginine succinate lyase. Among them, arginine Amino acid further enters the urea cycle or is used in metabolic processes such as protein synthesis. Among them, the urea cycle can convert toxic ammonia into non-toxic urea to be excreted from the body, which is the main way to detoxify ammonia in the body. If ASS1 expression is down-regulated or mutated, its enzyme catalytic activity decreases or lacks, which will block the urea cycle and increase the level of citrulline. Arginine succinate synthase (is a key enzyme of the urea cycle (see Figure 2). At the same time, aspartic acid is one of the key substrates of ASS1, and the level of ASS1 expression and its activity will determine its use in the urine cycle. The utilization of aspartic acid. Low expression of ASS1 will limit the utilization of aspartic acid.

Citrullinemia (Citrullinemia, CTLN) is an autosomal recessive inherited disorder of the urea cycle. The main clinical manifestations are increased citrullinemia and hyperammonemia. According to the different pathogenesis, it is divided into type Ⅰ and Ⅱ type. Citrullinemia type I (Citrullinemia type 1, CTLN 1) is caused by ASS1 gene defect, with an incidence rate of about 1/250,000, which is the third largest urea cycle disorder; type II citrullinemia (Citrullinemia type 1) 2. CTLN 2) It is caused by the mutation of Citrin gene. CTLN1 is mainly a toxic phenomenon of hyperammonemia in clinical manifestations. It is divided into classic type and delayed type according to the time of onset and the severity of the disease. Typical citrullinemia occurs in the neonatal period, which is characterized by hyperammonemia accompanied by neurological function decline, poor prognosis, and high mortality; delayed-onset citrullinemia has a later onset and mild symptoms. May exhibit recurring neurological symptoms, such as drowsiness, mental retardation, etc. Some patients have no symptoms and only the biochemical phenotype detected during newborn screening.

There are many mutations that cause defects in the arginine succinate synthase gene of CTLN1. There are 137 mutations that have been reported, mainly missense mutations. In addition, a few cases have nonsense mutations, abnormal splicing and deletion mutations. The first eight most frequently occurring mutation types are p.Gly390Arg, p.Trp179Arg, p.Gly362Val, p.Arg363Trp, p.Gly324Ser, p.Arg157His, p.Arg304Trp, and p.Val263Met, corresponding to 124, 27, and p.Val263Met. 24, 17, 16, 14, 13, and 12 cases. Some studies have expressed partial mutant ASS1 in vitro by constructing an in vitro expression vector and tested its enzyme activity. Among the first eight mutations with the highest mutation rate, the mutations p.Gly390Arg, p.Arg157His, and p.Gly324Ser were shown in in vitro experiments. For complete inactivation, the mutant p.Trp179Arg, p.Val263Met, and p.Gly362Val still retain partial enzyme activity in vitro. This result is basically consistent with other reports of clinical manifestations of patients with these mutations. But so far, the correlation between the genotype and phenotype of type I citrullinemia has not been clarified. It has been reported that some patients do not develop severe hyperammonemia until they are in a high catabolic state (during and postoperative, postpartum or fever).

Citrullinemia is a disease of chromosomal abnormalities. There is currently no cure. The treatment is mainly low-protein diet and blood ammonia-lowering treatment. If the symptoms are more serious or the blood ammonia is too high, it depends on blood or Abdominal dialysis treatment. Therefore, the invention of drugs for the treatment of citrullinemia has very important clinical value.

Tumor cells proliferate fast and require more energy and nutrients, including nucleotides, proteins, lipids, etc. CAD [Carbamoylphosphate synthetase II (CPSase), Aspartate transcarbamoylase (ATCase) and Dihydroorotate hydrogenase (DHOase)] are pyrimidines The key rate-limiting enzyme for de novo nucleotide synthesis. The de novo biosynthesis of pyrimidine nucleotides is as follows: glutamine and carbon dioxide are powered by ATP in the cytosol, and carbamoyl phosphate synthase II is catalyzed to generate carbamoyl phosphate. The latter is catalyzed by aspartate transcarbamylase to transfer the carbamoyl group to the amino group of aspartic acid to generate carbamoyl aspartic acid. Carbamyl aspartic acid is dehydrated and cyclized to produce dihydroorotic acid, which is then dehydrogenated to form orotic acid. Orotic acid is an essential precursor of pyrimidine nucleotides. It can be seen that aspartic acid is also a key substrate of CAD. If tumor cells proliferate abnormally, more aspartic acid must be involved in the synthesis of nucleotides.

Aspartic acid contains two carboxyl groups and is highly polar. It is difficult for exogenous aspartic acid such as food to enter cells. The source of intracellular aspartic acid depends on its endogenous biosynthesis. The catabolic pathway of aspartic acid determines its role and function in cells. Aspartic acid is the common substrate of ASS1 and CAD, therefore, both ASS1 and CAD use aspartic acid competitively.

If the tumor cell ASS1 is down-regulated or defective, it will lead to more use of its substrate aspartic acid for the synthesis of pyrimidine nucleotides and promote cell proliferation. ASS1 is closely related to tumor growth. In some tumors, ASS1 expression is down-regulated or defective, including breast cancer, melanoma, hepatocellular carcinoma, prostate cancer, bladder cancer, mesothelioma, ovarian cancer, kidney cancer, and pancreatic malignancies , Nasopharyngeal carcinoma, osteosarcoma and myxofibrosarcoma. There is an obvious correlation between ASS1 deficiency and poor prognosis of cancer. It is considered to be a tumor suppressor protein, which suggests that ASS1 has a tumor suppressor function in a variety of tumors. Especially in ASS1-deficient tumors, activating ASS1 can inhibit aspartic acid Pathway to synthesize pyrimidine nucleotides necessary for tumor cell proliferation. Therefore, we believe that ASS1 protein can become a potential direct target of anti-tumor drugs. So far, there is no public report in the literature about small chemical molecules that can modulate the activity of ASS1.

Spinosyn is an intracellular secondary metabolite produced by Saccharoplyspora spinosa through aerobic fermentation. It is a macrolide antibiotic with insecticidal activity. Spinosyn is traded under the name Spinosad (SP), and its main active ingredients are A (Spinosyn A, SPA, 85-90%) and D (Spinosyn D, 10-15%). Spinosyn contains a unique four-ring structure that connects Two different six-membered sugars. As a broad-spectrum biological pesticide, SP mainly controls Lepidoptera and Thysanoptera pests. The chronic toxicity test in mammals shows that SP has no carcinogenic, teratogenic, mutagenic or neurotoxicity, and the acute toxicity test shows that it has low toxicity to mammals (mice oral (mg/kg) LD50=3783-5000; mouse skin ( mg/kg)LD50>2000).

The present invention discloses spinosyn derivatives as ASS1 activators, which can activate ASS1 and mutant ASS1 ^G362V enzyme activities, and are used in drugs for treating diseases related to ASS1 deficiency, especially citrullinemia and anti-tumor.

Summary of the invention

The technical problem solved by the present invention is to provide a new use of a class of compounds, which belong to spinosyn derivatives and can be used as arginine succinate synthase (ASS1) activators.

The technical solution of the present invention is to provide a spinosyn derivative and a medically acceptable salt thereof as an activator of arginine succinate synthase (ASS1). The spinosyn derivative has a structure General formula (I):

Wherein, R1 is selected from the following II-Ⅷ groups:

R8 and R9 are all independently selected from hydrogen, 1-20 carbon atoms (preferably 2-16 carbon atoms, more preferably 2-10 carbon atoms), 1-20 carbon atoms Haloalkyl (preferably 2-16 carbon haloalkyl, more preferably 2-10 carbon haloalkyl), 1-10 carbon atom alkyl substituted by 1-6 carbon alkylamino group (preferably 2-6 Alkyl with carbon atoms), hydroxyalkyl with 1-10 carbon atoms substituted by acyloxy (preferably hydroxyalkyl with 2-6 carbon atoms), arylmethyl, phosphoryl, 1-10 carbon atoms Alkanoyl (preferably alkanoyl with 2-6 carbon atoms), aroyl,

Wherein, J is selected from halogen atoms, R19R20N-, tetrahydropyrrolyl, piperidinyl, morpholinyl, piperazinyl,

Wherein R16 is selected from hydrogen, an alkyl group of 1-10 carbon atoms (preferably an alkyl group of 1-6 carbon atoms);

R10, R11, and R12 are all independently selected from hydrogen, 1-20 carbon alkyl group (preferably 2-16 carbon atom alkyl group), 1-20 carbon alkenyl group (preferably 2-16 carbon atom Alkenyl, more preferably alkenyl with 2-10 carbon atoms), arylmethyl;

R13 is selected from hydrogen, R14R15N-, nitrogen-containing heterocycle, oxygen-containing heterocycle, sulfur-containing heterocycle, and phosphorus-containing heterocycle;

R14, R15, R19, and R20 are all independently selected from hydrogen, an alkyl group of 1 to 6 carbon atoms, and an alkyl group of 1 to 10 carbon atoms substituted by an amino group;

R2 is selected from ethyl, propyl, butyl, 3-4 carbon alkenyl;

R3 is selected from hydrogen and methyl;

R4 is selected from hydrogen, hydroxylamino, -S-R17; wherein, R17 is selected from hydrogen, substituted alkyl with 1-6 carbons, alkenyl with 1-6 carbons, arylmethyl, aryl, -(CH ₂ )qCH ₂ YR18; In -(CH ₂ )qCH ₂ YR18, R18 is selected from H, 1-6 carbon alkyl, aroyl, substituted aroyl, arylcarbamoyl, aromatic heterocyclic acyl, 1- 5-carbon alkyl acyl, arylalkanoyl, N,N-substituted carbamoyl, alkoxyformyl, Y is an oxygen or nitrogen atom, -q=1, 2, or 3;

R5, R6, and R7 are all independently selected from hydrogen, 1-3 carbon alkyl, acetyl, propionyl;

R21 is selected from

AB is selected from CH ₂ -CH ₂ , CH=CH;

M-Q is selected from CH-CH, C=CH;

W is selected from CH ₂ , O, NH, S;

X is an anion;

X is an anion, chlorine, bromine, iodine, sulfate, hydrogen sulfate, phosphate, methanesulfonate, benzenesulfonate, p-toluenesulfonate, hydroxide;

n is an integer of 0-4, and m is an integer of 0-20.

Further, the R2 is ethyl.

Further, the R4 is hydrogen.

Further, the R5, R6, and R7 are all independently selected from methyl or ethyl.

Further, the W is selected from O, NH, NCH ₃ , and S.

Further, the nitrogen-containing heterocycle, oxygen-containing heterocycle, sulfur-containing heterocycle, and phosphorus-containing heterocycle respectively mean that the heteroatoms in the heterocycle are nitrogen, oxygen, sulfur, and phosphorus.

Further, the heteroatoms in the nitrogen-containing heterocycle are nitrogen atoms, and the number is 1-3.

Further, the nitrogen-containing heterocyclic ring is tetrahydropyrrolyl, piperidinyl, morpholinyl, piperazinyl,

Wherein R16 is selected from alkyl groups of 1-10 carbons.

Further, the spinosad derivative has the structure:

The present invention relates to the compound of general formula (I), which is characterized by spinosyns and derivatives thereof involved in patents CN201610355188.0, ZL201010123056.8, CN201610356840.0 and US6001981.

In addition, the present invention also provides the application of the small molecule composition comprising the general formula (I) as an arginine succinate synthetase. The compound may also contain one or more pharmaceutically acceptable carriers or excipients

The pharmaceutical composition of the present invention contains spinosyn and its derivatives represented by the general structural formula (I), and may also contain one or more pharmaceutically acceptable carriers or excipients.

The carrier or excipient may include glycerol, ethanol, buffered saline, physiological saline, and combinations thereof. The pharmaceutical composition may also include penetration enhancers, antioxidants, and the like.

On the other hand, the present invention provides the use of spinosyn and its derivative LM-2I as represented by the general formula (I) in the prevention and treatment of diseases associated with low ASS1 expression or mutant ASS1G362V. Among them, ASS1 low expression or mutant ASS1G362V related diseases include but are not limited to type I citrullinemia and related cancers.

The present invention uses the biotin probe method to identify small molecule targets, and finds that the target of the compound of the general structural formula (I) is ASS1. The inventors synthesized and discovered spinosyn A-biotin probes, such as Xn-03-17A (abbreviated as 17A), and found that it has good anti-tumor proliferation activity and can replace drugs for target experiments. We used Xn-03-17A for target identification, and the results showed that the target of spinosyn derivatives was the protein ASS1. The ASS1 monoclonal antibody was used for Western blot analysis and combined with mass spectrometry to confirm that it was ASS1.

The present invention determines the ASS1 activation activity of spinosyn derivatives according to the principle and method of arginine succinate synthetase (ASS1) activity measurement. The principle of ASS1 activity detection is: ASS1 catalyzes the reaction of citrulline and aspartic acid to produce arginine succinic acid. This reaction consumes ATP to generate pyrophosphate (PPi), and the generated PPi is produced under the catalysis of pyrophosphatase. Phosphoric acid, phosphoric acid reacts with ammonium molybdate to generate phosphomolybdenum heteropoly acid, which is reduced by vitamin C to generate blue phosphomolybdenum blue, which has a characteristic absorption peak at OD660. The results showed that spinosyn derivatives can increase the enzyme activity of ASS1 to varying degrees. Compared with the positive control of ASS1, the enzyme activity increased by 5.85-203.86%.

In the present invention, the MTT experiment is used to screen the activity of spinosyn derivatives on a variety of human tumor cells. The low expression of ASS1 is related to the low overall survival rate and low disease-free survival rate of breast cancer patients. ASS1 is an independent prognostic factor of breast cancer overall survival rate and disease-free survival rate, and can be used as a new candidate molecular marker for breast cancer.

The present invention found that spinosyn and its derivative LM-2I can increase the ASS1 ^G362V enzyme activity to varying degrees through the ASS1 in vitro enzyme activity experiment.

The beneficial effects of the present invention: Spinosyn and its derivatives are the first discovered mutant arginine succinate targeting the tumor suppressor protein arginine succinate synthase 1 (ASS1) and type I citrullinemia A type of activator of acid synthase ASS1 ^G362V . Because ASS1 is generally down-regulated or defective in tumors, spinosyn and its derivatives have significant anti-tumor effects. While for congenital genetic diseases due -I citrullinemia type ASS1 ^ASS1 G362V mutation resulting difficult to cure, spinosyn and derivatives thereof can also be used as orphan drugs by reversing and restoring functional activity ^ASS1 G362V play a significant effect . Spinosyn and its derivatives are mainly used as drugs for the treatment of diseases related to ASS1 deficiency, especially for type I citrullinemia and anti-tumor therapy.

Description of the drawings

Figure 1 shows the general structural formula of spinosyn derivatives;

Figure 2 shows the catalytic reaction process of arginine succinate synthase 1 (ASS1);

Figure 3 shows the pathway of aspartic acid metabolism;

Figure 4 shows the identification of the target of the compound; in the figure, 1A) Silver staining result of Pull-down product in cell lysate; 1B) Western blot detection of ASS1 antibody;

Figure 5 shows the mass spectrometry identification probe Biotin-SPA bound protein as ASS1;

Figure 6 shows the relative catalytic activity of different compounds on ASS1;

Figure 7 shows Coomassie brilliant blue staining after purification of ^{ASS1 WT} and ASS1 ^{G362V proteins;}

Figure 8 shows the effects of spinosyn A (SPA) and LM-2I on the activity of mutant ASS1;

Figure 9 shows that there are differences in the expression of ASS1 in multiple breast cancer cell lines. (a) Western blot detects the expression of ASS1 in a variety of breast cancer cell lines, and the software Image J performs a grayscale scan of the band, and uses the lowest expression MDA-MB-231 as a reference, defined as 1, for relative quantification , Get the relative expression profile of ASS1 (b);

Figure 10 shows that the proliferation rate of breast cancer multi-cell lines is significantly negatively correlated with the expression of ASS1. MTT method was used to detect the 48h proliferation rate of multi-cell lines (a), (b) the correlation analysis between cell proliferation rate and ASS1 expression;

Figure 11 shows the detection of drug sensitivity after knockdown or overexpression of ASS1. MDA-MB-231ASS1 overexpression cell line (a) or MCF-7 ASS1 knockdown cell line (b) were treated with SPA or LM-2I for 48h, and cell survival rate was detected by MTT. Each experiment was repeated three times (mean±s.d.; n=3), *** means p<0.001.

Figure 12 shows that SPA and LM-2I inhibit tumor volume growth. SPA (10mg/kg/d) and LM-2I (5m/kg/d) were administered for 18 days, every other day, and the longest diameter and shortest diameter of the tumor were recorded, and the tumor volume was calculated by the formula, where Vehicle is a solvent control. The experimental results are calculated by mean±sd, n=7, * means p<0.05, ** means p<0.01.

Figure 13 Knockout of ASS1 can significantly reduce the anti-tumor activity of SPA and LM-2I. CRISPR/Cas9 was used to knock out ASS1(a), SPA(b) and LM-2I(c) in MDA-MB-231 cells for 48h, and the survival rate was detected by crystal violet staining. Each experiment was repeated three times.

Figure 14 SPA and LM-2I inhibit the growth of tumor volume. SPA (10mg/kg/d) and LM-2I (5m/kg/d) were administered for 28 days, every other day, and the longest diameter and shortest diameter of the tumor were recorded, and the tumor volume was calculated by the formula, where Vehicle is a solvent control. The number of mice in each sample group is 8 and the statistics are performed by one-way analysis of variance. * means P<0.05, *** means P<0.001.

Detailed ways

In the following, the present invention will be further described in conjunction with embodiments.

Example 1

Target identification and confirmation experiment

The specific test steps are as follows:

1) Synthesis of a biotin-based spinosyn probe spinosyn-biotin complex Xn-03-17A.

(1) Synthesis of N-(3-bromohexyl) spinosyn: Add 1g (1.39mmoL) of spinosyn B, 20ml of acetonitrile and 385mg (1.39mmol) of potassium carbonate to a 100mL single-necked round bottom flask, and finally add 2.14mL (13.9mmoL) of 1,6-dibromohexane, stirred at 45°C for 48h. The resulting solid was removed by suction filtration, the solvent was removed, and the mixture was extracted with 50 mL of water and EA (3×60 mL). The organic phases were combined and dried with anhydrous sodium sulfate. After the solvent was removed, the silica gel column layer V (ethyl acetate): V (petroleum ether) = 4:1 to obtain 840 mg of white solid, the yield was 73%. mp95～98℃; HRMS calcd.forC ₄₆ H ₇₄ BrNO ₁₀ 880.4574, found 880.4602.

(2) Synthesis of Spinosyn-Hexyl-Biotin (Xn-03-17A): Add DMF1.5mL, compound 5100mg (0.11mmoL), and biotin 31mg (0.13mmoL) to a 50mL single-neck round bottom flask Finally, _{16 mg of K 2} CO ₃ (0.11 mmoL) was added, and the mixture was stirred at room temperature for 12 hours. 15 ml of water was added to the reaction solution, a large amount of white precipitate was precipitated, and it was extracted with EA (3×25 mL), and the organic phases were combined and dried with anhydrous sodium sulfate. After removing the solvent, it was purified by silica gel column chromatography V (ethyl acetate): V (methanol) = 20:1, and then recrystallized with V (n-hexane): V (isopropanol) = 6:1 to obtain 68 mg of white powder. Yield 57%, mp124～129°C; ¹ HNMR (500MHz, CDCl ₃ ) δ: 6.78 (s, 1H), 5.90 (d, J = 9.7 Hz, 1H), 5.82 (m, 1H), 5.22 (s, 1H), 4.97(s,1H), 4.87(d,J=1.3Hz,1H),4.73-4.64(m,1H),4.57-4.50(m,1H),4.44(d,J=6.6Hz,1H ), 4.38-4.28 (m, 2H), 4.08 (t, J = 6.7Hz, 2H), 3.68-3.61 (m, 1H), 3.59-3.56 (m, 4H), 3.54-3.46 (m, 10H), 3.33-3.27 (m, 1H), 3.20-3.11 (m, 3H), 3.06-2.99 (m, 1H), 2.96-2.92 (m, 1H), 2.91-2.86 (m, 1H), 2.77 (d, J =12.8Hz, 1H), 2.43-2.33 (m, 5H), 2.30-2.25 (m, 2H), 2.19 (s, 3H), 1.99-1.92 (m, 2H), 1.74-1.61 (m, 10H), 1.59-1.53 (m, 4H), 1.52-1.45 (m, 6H), 1.39-1.32 (m, 6H), 1.30 (d, J = 6.2 Hz, 4H), 1.26-1.25 (m, 3H), 1.20 ( d, J = 6.8 Hz, 4H), 0.95-0.88 (m, 1H), 0.84 (t, J = 7.5 Hz, 3H); HRMS calcd. for C ₅₆ H ₈₉ N ₃ O ₁₃ S 1044.6194, found 1044.6234.

2) Probe Xn-03-17A to search for interacting proteins (pull-down experiment).

Incubate with Xn-03-17A and MCF-7 cell lysate at 4°C overnight, then add streptavidin magnetic beads and incubate at room temperature for 4 hours. Set the non-addition, 10 times and 20 times drug competition groups, magnetic field adsorption magnetic beads, use After washing the magnetic beads with IP lysis solution 4 times, adding SDS-loading buffer and boiled for 10 minutes, after SDS-PAGE, silver nitrate staining, the experiment was repeated three times independently and the results were consistent (n=3). The results in Figure 4 show that the Xn-03-17A lane has a specific binding band, while the 10-fold and 20-fold drug groups can compete without bands. MS identification of specific bands showed that the target of spinosyn and its derivatives was the protein ASS1. Figure 4A is the result of silver staining of Pull-down product from MCF-7 cell lysate using Xn-03-17A probe. Figure 4B is a Western blot detection image using ASS1 antibody. This issue clearly proves that ASS1 is the target of spinosyn derivatives.

3) Subsequently, we cut the specific bands, digested in the gel, and analyzed by MS/MS mass spectrometry. By comparing the protein database, we found that the most reliable is ASS1. We detected specific peptides and specificity. The map covers 117 amino acids. ASS1 contains 412 amino acids. The detected peptides account for 28.4%, and the molecular weight is 47kDa (Figure 3), which matches the silver staining result. In order to confirm the results of mass spectrometry, we used ASS1 specific monoclonal antibody to detect the pull-down products by Western blot. After cutting the gel and enzymatic digestion of the specific bands obtained in Figure 3, we performed mass spectrometry analysis, and compared the database. It was found that ASS1 identified the most peptides and had the highest score. The red marker in the figure represents the identified peptides (Figure 5). The results indicate that the dragged protein is indeed ASS1.

Example 2

The effect of drugs on the enzyme activity of protein ASS1

The principle of ASS1 activity detection is: ASS1 catalyzes the reaction of citrulline and aspartic acid to produce arginine succinic acid. This reaction consumes ATP to generate pyrophosphate (PPi), and the generated PPi is produced under the catalysis of pyrophosphatase. Phosphoric acid, phosphoric acid reacts with ammonium molybdate to generate phosphomolybdenum heteropoly acid, which is reduced by vitamin C to generate blue phosphomolybdenum blue, which has a characteristic absorption peak at OD660.

Enzyme activity calculation formula:

The enzyme activity is: [(drug+ASS1)OD ₆₆₀ -NCOD ₆₆₀ ]/(ASS1OD ₆₆₀ -NCOD ₆₆₀ )×100%.

(Drug + ASS1) OD ₆₆₀ : the absorbance of the solution when the drug and ASS1 are added (wavelength 660nm); ASS1OD ₆₆₀ : the absorbance of the solution when ASS1 is added, the absorbance of the solution (wavelength 660nm); NCOD ₆₆₀ : the absorbance of the blank reference solution (wavelength 660nm).

1) Prokaryotic expression of ASS1

(1) Construction of prokaryotic expression vector

The total RNA of human breast cancer cell line MCF-7 cell line was extracted, and the ASS1 gene was amplified by RT-PCR, using primers (5′-3′):

ASS1-F: ACCCTCGAGGGATCCGAATTCATGTCCAGCAAAGGCTCC (SEQ ID NO10);

ASS1-R: AGACTGCAGGTCGACAAGCTTTTATTTGGCAGTGACCTT

(SEQ ID NO 11).

The pET-28a plasmid was extracted, digested with restriction enzymes, and recovered by the gel. According to the method of homologous recombination, the ASS1 gene was integrated into the pET-28a plasmid.

Transformation: Transform the constructed pET-28a plasmid into Escherichia coli DH5a, select positive clones and send them for sequencing. After the clones with correct sequencing are expanded and cultured, the plasmids are extracted and transformed into the BL21(DE3) strain. The positive clones are identified by PCR and confirmed The band size is between 1.0-1.5kb and is sent for sequencing. Select the correctly sequenced strains to preserve the bacteria at -80°C and use them for later use.

(2) Prokaryotic expression: Take out the constructed ASS1BL21(DE3) strain stored at -80℃ and restore it to OD660 to 0.4-0.6, add IPTG to a final concentration of 1mM and induce 4h, collect the bacterial solution by centrifugation, and store at -80℃ spare.

Protein extraction: Thaw the bacteria liquid stored at -80℃ on ice, add 2-5mL per gram of lysis buffer to resuspend the bacteria, add lysozyme to a final concentration of 1mg/mL, place on ice for 30 minutes, and ultrasonically break the wall , Centrifuge, take the supernatant, set aside on ice.

(3) Protein purification: add 1mL 50% Ni-NTA filler per 4mL lysate, add fillers, rotate at 4℃ and incubate for 60min, load the mixture into the column, wash the buffer twice, 1mL each time, and wash the buffer for 4 times. Collect the eluted liquid four times, 1 mL each time.

(4) Desalting and storage of protein: Put the eluate into an ultrafiltration tube, centrifuge to remove the salt, adjust the storage buffer according to the nature of the protein, and adjust the buffer volume according to the required concentration.

(5) Divide and store: Divide the protein with the measured protein concentration into 10-20μL each, and store it at -80℃ after quick freezing in liquid nitrogen.

2) 0.5μM ASS1 and 20μM drug were incubated overnight at 4°C, and the buffer was added at 37°C and incubated for 1min. Then an equal volume of Molybdate buffer was added for 3min color development, 37°C, and the absorbance was detected by OD660. The ASS1 group without drug incubation was used as a positive control, and the reagent group without ASS1 was NC. The buffer components are: 20mM Tris ^. HCl (pH 7.8), 2mM ATP, 10mM citrulline, 10mM aspartic acid, 6mM MgCl2, 20mM KCl, 0.2U pyrophosphatase. Molybdate buffer components are: 10mM vitamin C, 2.5mM ammonium molybdate, 2% (V/V) sulfuric acid (enzyme activation results are shown in Figure 6 and Table 1).

Table 1 The relative activity of spinosyn derivatives in activating arginine succinate synthase

The results show that spinosyn derivatives can increase the enzyme activity of ASS1 to varying degrees. Compared with the positive control of ASS1, the enzyme activity increases by 5.8-203.9%. The half activation concentration AC _{50 of} SPA and LM-2I were 18.6 and 2.0 μM, respectively.

Example 3

The effect of drugs on the enzyme activity of ^{protein ASS1 and ASS1 G362V}

In order to detect the effect of SPA and its derivative LM-2I on the ^{enzyme activity of protein ASS1 and ASS1 G362V} , we constructed the ASS1 pET28a plasmid through homologous recombination technology, and on this basis, used gene-directed mutagenesis technology to construct the ASS1 ^G362V pET28a plasmid. The constructed plasmid was transformed into BL21 (DE3) for prokaryotic expression and purified protein ASS1 and ASS1 ^G362V .

The specific steps are:

3.1 ASS1 and ASS1 ^G362V amino acid sequence

The amino acid sequence of ASS1 is:

ASS1 ^G362V amino acid sequence:

ASS1 is G ^{at position 362, and ASS1G 362V is V} in brackets at position 362.

3.2 Construction of ASS1-pET-28a Plasmid

(1) Extract the total RNA of human breast cancer cell line HCC1806 cell line, and amplify the ASS1 gene by RT-PCR, using primers (5′-3′):

ASS1-F: ACCCTCGAGGGATCCGAATTCATGTCCAGCAAAGGCTCC (SEQ ID NO 3);

ASS1-R: AGACTGCAGGTCGACAAGCTTTTATTTGGCAGTGACCTT (SEQ ID NO 4).

(2) The pET-28a plasmid was extracted, and the ASS1 gene was integrated into the pET-28a plasmid according to the method of homologous recombination after the digested gel was recovered.

(3) Transformation: Transform the constructed pET-28a plasmid into Escherichia coli DH ₅ a, and select positive clones for sequencing. After the clones with correct sequencing are expanded and cultured, the plasmids are extracted and transformed into BL21(DE ₃ ) strain. The positive clones were identified by PCR, and the band size was determined to be between 1.0-1.5 kb and sent for sequencing.

Among them, the nucleotide sequence of ASS1 is exactly the same as the CDS sequence of ASS1variant 1 (ACCESSION: NM_000050) in the NCBI database. When translated into amino acids, its sequence is exactly the same as the ASS1 sequence in the Uniprot database. Therefore, the prokaryotic expression of ASS1 we constructed The carrier can be used for subsequent research. Select the correctly sequenced strains to preserve the bacteria at -80°C and use them for later use.

3.3 Construction of ASS1 ^G362V -pET-28a expression plasmid

Use the MutExpress II Fast Mutagenesis Kit V2 kit of Nanjing Novazan Biotechnology Co., Ltd., and the specific operations are as follows:

Design point mutation primers, and design mutation primers based on the principle of homologous recombination:

ASS1 ^G362V -F: TACATCCTCGTCCGGGAGTCCCCACTGTCTCTCTACAAT (SEQ ID NO 5)

ASS1 ^G362V- R: GGACTCCCGGACGAGGATGTACACCTGGCCCTTGAGGAC (SEQ ID NO 6)

PCR amplification: use mutant primers to amplify the pet28a-ASS1 plasmid; digest the amplified product with Dpnl to remove the methylated template plasmid; perform homologous recombination, transformation, and sequencing for identification.

3.4 Protein expression and purification

(1) Prokaryotic expression: Take out the constructed ASS1BL21(DE ₃ ) strain stored at -80°C and restore it to OD ₆₆₀ to 0.4-0.6, add IPTG to a final concentration of 1 mM for induction for 4 hours, and collect the bacterial solution by centrifugation, -80 Store at ℃ for later use.

(2) Protein extraction: Thaw the bacteria liquid stored at -80°C on ice, add 2-5 mL of Lysis buffer per gram to resuspend the bacteria, add lysozyme to a final concentration of 1 mg/mL, and place on ice for 30 minutes. Ultrasonic break the wall, centrifuge, take the supernatant, and set aside on ice.

(3) Protein purification: add 1mL 50% Ni-NTA filler per 4mL lysate, add fillers, rotate at 4℃ and incubate for 60min, load the mixture into the column, wash the buffer twice, 1mL each time, and wash the buffer for 4 times. Collect the eluted liquid four times, 1 mL each time.

(4) Desalting and storage of protein: Put the eluate into an ultrafiltration tube, centrifuge to remove the salt, adjust the storage buffer according to the nature of the protein, and adjust the buffer volume according to the required concentration.

(5) Divide and store: Divide the protein with the measured protein concentration into 10-20μL each, and store it at -80℃ after quick freezing in liquid nitrogen.

Among them: Lysis buffer (1L) (add protease inhibitor before use, add 5mM mercaptoethanol before use): 50mM Tris.HCl, 500mM NaCl, 10mM imidazole, Adjust pH to 8.0 using NaOH;

Wash buffer (1L) (without protease inhibitor, add 5mM mercaptoethanol before use): 50mM Tris.HCl, 500mM NaCl, 20mM imidazole, Adjust pH to 8.0 using NaOH;

Elution buffer (1L) (no protease inhibitor, no 5mM mercaptoethanol): 50mM Tris.HCl, 500mM NaCl, 250mM imidazole, Adjust pH to 8.0 using NaOH

After elution, desalinate and change to (20mM Tris.HCl+100-300mM NaCl), add the final concentration of 1mM TCEP ultrafiltration and concentrate to 100μM (the higher the better), 10μL each aliquoted, liquid nitrogen after quick freezing -80℃ save.

After purification, Coomassie brilliant blue was used to detect the ^{expression and purification of ASS1 and ASS1 G362V} (Figure 7). The results showed that both ASS1 and ASS1 ^G362V proteins were expressed in the supernatant, dissolved in water, and the purity after purification was above 90%.

3.5 In vitro enzyme activity experiment

The concentration of ASS1 and ASS1 ^G362V is 0.5μM, and the concentration of spinosyn and its derivative LM-2I is 10μM. Incubate overnight at 4°C, add buffer, incubate at 37°C for 1 min, and then add an equal volume of Molybdate buffer to develop color for 3 min. At 37°C, the absorbance was detected by _{OD 660.} The ASS1 group without drug incubation was used as a positive control, and the reagent group without ASS1 was NC.

The relative enzyme activity is: [ASS1 ^G362V OD ₆₆₀ -NCOD ₆₆₀ ]/(ASS1OD ₆₆₀ -NCOD ₆₆₀ )×100%.

The buffer components are: 20mM Tris.Hcl (pH 7.8), 2mM ATP, 10mM citrulline, 10mM aspartic acid, 6mM MgCl2, 20mM KCl, 0.2U pyrophosphatase. Molybdate buffer components are: 10mM vitamin C, 2.5mM ammonium molybdate, 2% (V/V) sulfuric acid.

Through the in vitro enzyme activity experiment of ASS1, it was found that SPA and LM-2I can restore the activity of mutant ASS1. The reaction concentration of ASS1 and ASS1 ^G362V was 0.5μM, the concentration of Spinosyn A (SPA) and its derivatives LM-2I was 10μM, and the reaction time was 1 min. ASS1 alone was a positive control. The results showed that spinosyn and its derivatives LM-2I can increase the ^{enzyme activity of ASS1 G362V} to varying degrees, in which ASS1 is the positive control, and its enzyme activity is standardized to 100±6.49%, the ^{enzyme activity of ASS1 G362V} is 60.43±3.64%, and the enzyme activity of ^{ASS1 G362V after 10μM SPA treatment is 70.8±} 4.22%, compared with the ^{enzyme activity of ASS1 G362V} itself, the activity increased by 10.37%, not significant; compared with the enzyme activity of ASS1, significantly decreased. ^{The enzyme activity of ASS1 G362V} treated with 10μM LM-2I was 94.12±1.83%. Compared with the ^{enzyme activity of ASS1 G362V} itself, the activity increased by 33.69%, which was a significant increase; compared with the enzyme activity of ASS1, it was basically the same (Figure 8).

Example 4

Effects of compounds on tumor cell activity with different expression levels of ASS1

1 Construction of lentiviral overexpression vector and shRNA interference vector

The overexpression vector and shRNA interference vector of ASS1 were purchased from Gemma Gene. There are two shRNAs, the sequences are (5′-3′):

ASS1 shRNA1:

ASS1 shRNA2:

The negative control shRNA sequence:

The ASS1 overexpression sequence is obtained by a fully synthetic method, and its sequence is the CDS sequence of human ASS1 variant 1 (ACCESSION: NM_000050).

2 lentivirus packaging

1) Resuscitate the 293T tool cells and culture them until they are in good condition, trypsinize them, inoculate them in a 10cm petri dish, and culture them overnight. When the cells grow to 90% confluence, perform lentivirus packaging.

2) Take two 1.5mL sterile centrifuge tubes, add 600μL serum-free DMEM medium to one, add the target plasmid and packaging plasmid (pGag/Pol, pRev, pVSV-G) in proportion, mix well, and add to the other tube 600μL of serum-free DMEM medium, and then add 120μL RNAi-Mate, mix well, leave it at room temperature for 5 minutes, then mix the two tubes, and leave it at room temperature for 20 minutes.

3) Replace the complete medium in the petri dish with serum-free DMEM medium, add the configured transfection system dropwise to the petri dish, gently shake back and forth to mix, and continue culturing in the incubator.

4) After culturing for 6 hours, remove the serum-free DMEM medium, change to complete medium, and continue culturing for 72 hours.

5) Collect the supernatant in the culture dish into a 50 mL centrifuge tube, which is the virus stock solution, centrifuge the virus stock solution at low temperature and low speed at 4° C., 4000 rpm, 15 min, and then filter the supernatant in the centrifuge tube with a 0.45 μm filter.

6) Ultracentrifuge the filtered virus solution at 4°C, 20000rpm, 2h, remove the supernatant, add an appropriate amount of medium to dissolve the virus, distribute it to 1.5mL centrifuge tubes, label them, and store at -80°C .

3 Detection of lentivirus titer (GFP fluorescence counting method)

1) 293T tool cells were cultured to 90% confluence, trypsinized, resuspended after centrifugation, and counted.

2) Inoculate a 96-well plate with 3×104 cells/well per well, and continue to culture for 24 hours after mixing.

3) Dilute 10 μL of the lentivirus stock solution with complete medium 10 times in 5 gradients, and add Polybrene at a final concentration of 5 μg/mL to increase the infection efficiency.

4) Remove the original medium in the 96-well plate, add virus medium with different concentration gradients, continue culturing for 24 hours, and set a blank control.

5) Remove the virus-containing medium, replace it with complete medium and continue culturing for 72 hours.

6) Observe the GFP fluorescence with a fluorescence microscope, count the fluorescent cells, and calculate the virus titer according to the dilution factor.

4Lentiviral infection and monoclonal screening

1) Resuscitate MDA-MB-231 and MCF-7 cells, culture them in a 10cm petri dish until they are in good condition. When the cells grow to be 90% confluent, digest, centrifuge and count, MDA-MB-231 (1×10 ⁶ /dish) Passage with MCF-7 (1.5×10 ⁶ /dish), and when the cell density reaches 40-50%, perform the lentivirus infection experiment.

2) According to the number of cells, calculate the amount of virus required (the MOI value of the two cell strains are both 50) and the volume of virus required, add Polybrene with a final concentration of 5μg/mL, replenish the volume with complete medium to 8mL, and mix well .

3) Remove the original cell culture medium, add virus-containing medium and continue culturing for 24 hours, remove the virus-containing medium after 24 hours, and change to complete medium to continue culturing for 72 hours.

4) Digest the infected cells for passage, add Puromycin at a final concentration of 2 g/mL to select positive cells, and keep the culture medium containing 2 g/mL puromycin in the subsequent culture process.

5) The surviving cells are digested, counted, and 0.5 cells per well are seeded into a 96-well plate for monoclonal screening. The grown monoclonal trypsin is digested and then inoculated into a 6-well plate. When it grows to about 80-90%, half is used for passaging, and half is used for protein extraction and Western blot to detect the expression of the target protein. The single clones that meet the requirements are amplified and cultured, stored in liquid nitrogen, and MTT experiments are performed.

6) MTT method cell experiment: use ASS1 knockdown or overexpression cell line to detect the drug sensitivity of spinosyn A (SPA) or LM-2I, and the same concentration of SPA or LM-2I can simultaneously treat MCF-7 ASS1 sh and MCF-7 NC or MDA-MB-231 ASS1 OE and MDA-MB-231 NC cells for 48h.

The results show that: as shown in Figure 9a, the expression level of ASS1 varies greatly in different cell lines. The expression is the lowest in MDA-MB-231 and the highest in MCF-7. In order to facilitate statistics, we use Image J to The band was scanned with gray scale, with the lowest expression level of ASS1 MDA-MB-231 as the reference, defined as 1, and relative quantification was performed to obtain the relative expression profile of ASS1 (Figure 9b), with a numerical range between 1-11.16±0.57.

Using the MTT method, with 0h as the reference, the relative proliferation rate of breast cancer cell lines at 48h was detected. As shown in Figure 10, we were surprised to find that the relative expression of ASS1 and the cell proliferation rate showed a significant negative correlation (Spearman'sρ =-0.783, p=0.003) (Figure 10). The above results suggest that ASS1 may play a role as a tumor suppressor in breast cancer.

The results showed that in the MDA-MB-231 cell line (Figure 11), the same concentration of SPA or LM-2I treatment, compared with NC, the survival rate of ASS1OE cells was significantly increased, and the drug sensitivity decreased; on the contrary, in MCF In the -7 cell line (Figure 11-2b), compared with NC, the survival rate of ASS1 sh cells was significantly reduced, and drug sensitivity was enhanced. Obviously, spinosyn derivatives have better sensitivity to tumors with low ASS1 expression, and can be used as individualized therapeutic drugs for tumors with low ASS1 expression. Tumors with low ASS1 expression are not limited to breast cancer, such as melanoma, hepatocellular carcinoma, prostate cancer, bladder cancer, mesothelioma, ovarian cancer, kidney cancer, pancreatic malignancies, nasopharyngeal carcinoma, osteosarcoma and myxofibrosarcoma.

Example 5

In vivo tumor suppressor effect

The triple-negative breast cancer MDA-MB-231 cell line with low ASS1 expression, high malignancy, easy metastasis, poor prognosis, and lack of targeted drug therapy was selected as a representative to construct a nude mouse xenograft model for in vivo experiments.

Purchase four-week-old immunodeficient nude mice BALB/c(nu/nu), and after one week of adaptive breeding in an SPF animal room, each nude mouse was injected with 5×10 ⁶ MDA-MB-231 cells into the armpit of the mouse. After 4-7 days, it will grow into a rice grain-sized tumor. The tumor is about 100mm ³ , which means that the modeling is successful. The solvent group is a negative control. The concentration of the SPA treatment group is 10 mg/kg/d, and the concentration of the LM-2I treatment group is 5 mg/kg.d. The administration is administered every other day, 10 times, and the living conditions of the mice are observed every day. Weigh the body weight before administration, measure the long diameter a and short diameter b of the tumor, and use the formula for tumor volume: V=1/2ab2mm ³ .

After 18 days of administration, the tumor volume of Vehicle group was 841.52±420.81mm ³ ; the volume of SPA (10mg/kg/d) was 386.27±77.06mm ³ , which was 54.10% lower than that of Vehicle, which was statistically different; LM-2I (5mg/kg /d) The volume of the group was 306.41±79.08mm ³ , which was reduced by 63.60% compared with Vehicle, which was statistically different. From the point of view of the inhibitory effect, LM-2I (5mg/kg/d) is better than SPA (10mg/kg/d), and the drug concentration of LM-2I is only half of that of SPA (Figure 12).

Experimental results confirm that SPA and its derivative LM-2I can effectively inhibit the growth of tumors with low ASS1 expression. Spinosyn and its derivatives can be used for individualized treatment of defective tumors such as low expression of ASS1.

Example 6

SPA and LM-2I exert anti-tumor effects by targeting ASS1

1. CRISPR/Cas9 ASS1 gene knockout (Knock Out, KO) vector construction

Design two pairs of sgRNA primers about 100bp downstream of the ATG initiation code of ASS1:

ASS1-sgRNA1:

F: CACCGCAGCCACACGAGGATGCACG (SEQ ID NO 12);

R: AAACCGTGCATCCTCGTGTGGCTGC (SEQ ID NO 13);

ASS1-sgRNA2:

F: CACCGCGAGGATGCACGAGGTGTCC (SEQ ID NO 14);

R: AAACGGACACCTCGTGCATCCTCGC (SEQ ID NO 15);

The designed paired primers are annealed to form a double-strand for use. The gene knockout plasmid lentiCRISPR v2 is digested with BsmBI-v2, electrophoresis, and the gel is recovered and ligated with the paired primers. The constructed plasmid is transferred to Stab13, and the sequence is correct for use;

The experimental group using ASS1-sgRNA1 primer to knock out ASS1 is ASS1-KO1 MDA-MB-231; the experimental group using ASS1-sgRNA2 primer to knock out ASS1 is ASS1-KO2 MDA-MB-231; the blank experimental group without ASS1 knocking out It is ASS1-NC (Negative Control) MDA-MB-231 cells. Two pairs of different primers were used to construct knockout ASS1 vectors, which fully verified the accuracy of the test.

2. Virus packaging, refer to Example 4 for specific test steps;

3. Titer detection, refer to Example 4 for specific test steps;

4. MTT detection, refer to Example 4 for specific test steps;

The results showed that using CRISPR/Cas9 technology to knock out ASS1 in MDA-MB-231 cells (Figure 13a), SPA (Figure 13b) and LM-2I (Figure 13c) were used to treat ASS1-KO1 (Knock Out) MDA-MB- 231, ASS1-KO2 MDA-MB-231 and ASS1-NC (Negative Control) MDA-MB-231 cells, the results show that after ASS1 knockout, compared with ASS1-NC MDA-MB-231 cells, ASS1-KO1 MDA -MB-231 and ASS1-KO2 MDA-MB-231 cells do not respond or have very low sensitivity to SPA or LM-2I treatment, indicating that SPA and LM-2I exert anti-tumor effects by targeting ASS1.

Example 7

Detection of anti-tumor effect of SPA and LM-2I in vivo

1. Nude mice tumor formation experiment

The entire nude mouse tumorigenesis experiment was completed in the Experimental Animal Department of Central South University. BALB/c nude mice were purchased from SJA Laboratory Animal Co., Ltd (Hunan), and they were all 4-6 week old female mice, weighing 18-22 g.

(1) The purchased mice were raised in an SPF environment at 23-24°C, and fed with sterilized feed and water. After feeding for 3-4 days, the mice in good condition were marked.

(2) MDA-MB-231 cells were cultured to logarithmic growth phase, 0.25% trypsinization, 800rpm centrifugation, room temperature for 10 minutes, after collecting the cells, wash the cells with serum-free DMEM/F12 (1:1) medium for 3 times After centrifugation at 800 rpm, the cells were collected for 10 minutes at room temperature, and then a small amount of serum-free DMEM/F12 (1:1) medium was added to resuspend the cells. After counting, the cell density was adjusted to 5×10 ⁷ cells/mL.

(3) Inoculate 0.1 mL (5×10 ⁶ cells) of cell suspension in the armpit of the right limb of the mouse. In order to prevent the injected cell suspension from leaking, the needle inlet should be kept at a distance of about 1 cm from the site of tumor formation. In about 5-7 days, the tumor volume reaches about 100mm ³ . Observe whether there is a stable nodule formation. If there is, it means that the model is successfully constructed, and subsequent experiments can be carried out.

(4) The mice with little difference in body weight and tumor size were randomly divided into Vehicle group, SPA group and LM-2I group, each with 8 mice.

(5) According to the results of the preliminary experiment, we determined the dosage of SPA as 10mg/kg/d, LM-2I as 5mg/kg/d, subcutaneous injection, taking into account the poor water solubility of SPA, the solvent we used It is DMSO: Tween 80 (1:1), each administration dose is 0.1mL, administered every other day, and measure the weight of the mouse and the length of the tumor, observe the life of the mouse and record whether there is any abnormality. Click the formula to calculate the tumor

Body volume:

(a is the longest diameter of the tumor, b is the shortest diameter).

(6) When the tumor volume of the mice in the Vehicle group was ≥1000 mm ³ , the administration was ended, and the mice were euthanized by injection of sodium pentobarbital the next day.

The results showed that after 28 days of administration, the tumor volume of Vehicle group was 1076.65±230.41mm ³ ; the volume of SPA (10mg/kg/d) was 259.48±88.82mm ³ , which was reduced by 75.90% compared with Vehicle, with statistical difference; LM-2I( The volume of 5mg/kg/d) group was 143.91±70.42mm ³ , which was reduced by 86.63% compared with Vehicle, which was statistically different. In terms of the inhibitory effect, LM-2I (5mg/kg/d) is better than SPA (10mg/kg/d), and the drug concentration of LM-2I is only half of that of SPA (Figure 14).

Experimental results confirm that SPA and its derivative LM-2I can effectively inhibit the growth of tumors with low ASS1 expression. Spinosyn and its derivatives can be used for individualized treatment of defective tumors such as low expression of ASS1.

Claims (10)

1. The use of spinosyn derivatives and their medically acceptable salts as arginine succinate synthase (ASS1) activators, characterized in that the spinosyn derivatives have the general structural formula (I):

   

   Wherein, R1 is selected from the following II-Ⅷ groups:

   

   R8 and R9 are independently selected from hydrogen, alkyl groups of 1-20 carbon atoms, haloalkyl groups of 1-20 carbons, alkyl groups of 1-10 carbon atoms substituted by 1-6 carbon alkylamino groups, acyloxy 1-10 carbon atoms alkyl, arylmethyl, phosphoryl, 1-10 carbon alkanoyl, aroyl,

   

   

   Wherein, J is selected from halogen atoms, R19R20N-, tetrahydropyrrolyl, piperidinyl, morpholinyl, piperazinyl,

   

   Wherein R16 is selected from hydrogen, 1-10 carbon alkyl groups;

   R10, R11, and R12 are all independently selected from hydrogen, 1-20 carbon alkyl, 1-20 carbon alkenyl, and arylmethyl;

   R13 is selected from hydrogen, R14R15N-, nitrogen-containing heterocycle, oxygen-containing heterocycle, sulfur-containing heterocycle, and phosphorus-containing heterocycle;

   R14, R15, R19, and R20 are all independently selected from hydrogen, an alkyl group of 1 to 6 carbon atoms, and an alkyl group of 1 to 10 carbon atoms substituted by an amino group;

   R2 is selected from ethyl, propyl, butyl, 3-4 carbon alkenyl;

   R3 is selected from hydrogen and methyl;

   R4 is selected from hydrogen, hydroxylamino, -S-R17; wherein, R17 is selected from hydrogen, substituted alkyl with 1-6 carbons, alkenyl with 1-6 carbons, arylmethyl, aryl, -(CH ₂ )qCH ₂ YR18; In -(CH ₂ )qCH ₂ YR18, R18 is selected from H, 1-6 carbon alkyl, aroyl, substituted aroyl, arylcarbamoyl, aromatic heterocyclic acyl, 1- 5-carbon alkyl acyl, arylalkanoyl, N,N-substituted carbamoyl, alkoxyformyl, Y is an oxygen or nitrogen atom, q = 1, 2, or 3;

   R5, R6, and R7 are all independently selected from hydrogen, 1-3 carbon alkyl, acetyl, propionyl;

   R21 is selected from

   

   AB is selected from CH ₂ -CH ₂ , CH=CH;

   M-Q is selected from CH-CH, C=CH;

   W is selected from CH ₂ , O, NH, NCH ₃ , S;

   X is an anion; X is selected from chlorine, bromine, iodine, sulfate, hydrogensulfate, phosphate, methanesulfonate, benzenesulfonate, p-toluenesulfonate, and hydroxide.

   n is an integer of 0-4, m is an integer of 0-20, and k is an integer of 0-20.
2. The application according to claim 1, wherein said R2 is ethyl; said R5, R6, and R7 are all independently selected from methyl or ethyl; and said W is selected from O, NH, NCH ₃ , S.
3. The application according to claim 1, wherein the heteroatoms in the nitrogen-containing heterocycle are nitrogen atoms, and the number is 1-3.
4. The application according to claim 1, wherein the nitrogen-containing heterocyclic ring is tetrahydropyrrolyl, piperidinyl, morpholinyl, piperazinyl,

   

   Wherein R16 is selected from alkyl groups of 1-10 carbons.
5. The application according to claim 1, wherein the spinosyn derivative has the following structural formula:

   

   

   

   
6. The use of spinosyn derivatives and their medically acceptable salts according to any one of claims 1 to 5 in the preparation of drugs for treating diseases related to arginine succinate synthase (ASS1).
7. The application according to claim 6, wherein the argininosuccinate synthetase (ASS1) is specifically the protein ASS1 and ASS1 ^G362V ; the preparation method of the protein ASS1 and ASS1 ^G362V is: construct by homologous recombination technology ASS1 pet28a plasmid, and then using gene-directed mutagenesis technology to construct ASS1 ^G362V pet28a plasmid, the two constructed plasmids were respectively transferred into E. coli DH ₅ a for prokaryotic expression and purification of the proteins ASS1 and ASS1 ^G362V .
8. The application according to claim 7, wherein the steps of preparing ^{the proteins ASS1 and ASS1 G362V include:}

   S1, ASS1-pET-28a plasmid construction

   (1) Extract the total RNA of human breast cancer cell line HCC1806 cell line, and amplify the ASS1 gene by RT-PCR, using primers (5′-3′):

   ASS1-F: ACCCTCGAGGGATCCGAATTCATGTCCAGCAAAGGCTCC (SEQ ID NO 3);

   ASS1-R: AGACTGCAGGTCGACAAGCTTTTATTTGGCAGTGACCTT (SEQ ID NO 4);

   (2) Extract pET-28a plasmid, digest with restriction enzymes, recover from electrophoresis gel, and integrate ASS1 gene into pET-28a plasmid according to the method of homologous recombination;

   (3) Transformation: Transform the constructed pET-28a plasmid into Escherichia coli DH ₅ a, and select positive clones for sequencing. After the clones with correct sequencing are expanded and cultured, the plasmids are extracted and transformed into BL21(DE ₃ ) strain. Identify positive clones by PCR, confirm that the band size is between 1.0-1.5kb, and send for sequencing; select the strains with correct sequencing to keep the bacteria at -80°C for use;

   Construction of S2, ASS1 ^G362V -pET-28a expression plasmid

   Design point mutation primers, and design mutation primers based on the principle of homologous recombination:

   ASS1 ^G362V -F: TACATCCTCGTCCGGGAGTCCCCACTGTCTCTCTACAAT (SEQ ID NO 5)

   ASS1 ^G362V- R: GGACTCCCGGACGAGGATGTACACCTGGCCCTTGAGGAC (SEQ ID NO 6)

   PCR amplification: use mutant primers to amplify the pET 28a-ASS1 plasmid; Dpnl digestion of the amplified product to remove the methylated template plasmid; perform homologous recombination, transformation, and sequencing identification;

   S3, protein expression and purification

   (1) Prokaryotic expression: Take out the spare ASS1 BL21(DE ₃ ) strain and resume cultivation to an OD ₆₆₀ to 0.4-0.6, add a final concentration of 1mM IPTG for 4h, collect the bacterial liquid by centrifugation, and store it at -80℃ for later use;

   (2) Protein extraction: Thaw the bacteria liquid stored at -80°C, add Lysis buffer solution to resuspend the bacteria, add lysozyme and place on ice, ultrasonically break the wall, centrifuge, take the supernatant, and set aside on ice;

   (3) Protein purification: Ni-NTA filler was added to the supernatant, and the mixture was loaded on a column after incubation, eluted, and collected the eluate;

   (4) Desalting and storage of protein: ultrafiltration and centrifugation of the eluate to desalt and dilute;

   (5) Packing and storage: Determine the concentration of the diluted protein, and pack it, and store it at -80°C after quick freezing in liquid nitrogen.
9. The use of spinosyn derivatives and their medically acceptable salts according to any one of claims 1 to 5 in the preparation of drugs for the treatment of tumors related to arginine succinate synthase (ASS1).
10. The spinosyn derivatives in use according to any one of claims 1 to 5 and their medically acceptable salts are used in the preparation and treatment of type I citrullinemia associated with argininosuccinate synthase (ASS1) Application in medicine.

Images