WO2021217554A1 - Drug targets for hair follicle stem cell loss and use - Google Patents

Abstract

Provided is mechanical change sensed by mechanosensitive ion channel Piezo1 mediates niche atrophy caused hair follicle stem cell loss through apoptosis. The decreased niche size causes hair cycle dependent ectopic hair follicle stem cell apoptosis, which can be completely rescued by re-expanding the three-dimensional niche space alone. In vivo pharmacological compound screen and intravital Ca²⁺ imaging indicate stem cells rely on mechanosensitive calcium channels to sense niche size decrease. Guided by transcriptome screen, epithelial specific disruption of mouse Piezo1 and compound activation experiments show that Piezo1 is necessary and sufficient to mediate niche size regulated hair follicle stem cell survival. Stretch activated Piezo1 confers sensitivity to catagen specific death signal TNFα on otherwise resistant stem cells. Pathological niche atrophy caused stem cell loss in the pure hair and nail ectodermal dysplasia disease model is rescued by loss of epithelial Piezo1.

Description

Drug Targets for Hair Follicle Stem Cell Loss and Use Background

Tissue resident stem cells occupy a three dimensional niche space and tailor their regenerative activity by incorporating signals from the microenvironment to maintain tissue homeostasis. In the context of tissue pathology and aging process, niche physiologies often exhibit substantial decrease in overall physical size accompanied by loss of stem cell population, for example skeletal muscle atrophy responding to systematic diseases, intestine mucosal atrophy after long-term starvation, gastric niche atrophy during infection triggered inflammation, and testis niche atrophy during aging. Despite the common association between decreases in stem cell number and the overall physiological niche size, the causal relationship between niche atrophy and stem cell loss is not clear. Hair follicle stem cells (HFSCs) reside in a niche environment call bulge. The three-dimensional space of resting phase telogen bulge is filled by hair shaft in the center, Krt6+ companion layer cells in the middle and HFSCs at the outmost layer. Bulge size decrease resulting from hair shaft miniaturization often occurs during aging, androgenic alopecia, and genetic hair follicle related pathologies. Accompanied by the shrinkage in overall bulge size is the loss of HFSC population and regenerative activity. Similar to other tissues, it is not clear which change has the causal effect. Although mechanical force is a major physiological parameter sensed by many cell types in vivo, whether it is involved in mediating the cross talk between niche atrophy and stem cell loss is unknown.

Summary of the Invention

In the first place, the present invention provides a drug target for hair follicle stem cells loss. The drug target is a factor triggered or activated by the niche atrophy.

Preferably, the hair follicle stem cells loss results from abnormal stem cell death. Preferably, the abnormal stem cell death is hair cycle dependent. Preferably, the abnormal stem cell death happens in the catagen stage or catagen-telogen transition stage.

Preferably, the niche atrophy refers to the shrinkage in physical niche size or the shrinkage of the three-dimensional niche space. Normally, the specific niche atrophy includes two main aspects: decrease in Krt6+ companion layer cells and shrinkage of the three-dimensional niche space. The inventors of the present invention conducted the “pluck+refill” experiment and found that lacking of Krt6+ companion layer cells is not the reason behind niche atrophy caused hair cycle dependent HFSCs loss, but only restoring the physical niche size has complete rescue effect. This experiment also excluded many other potential hair plucking induced effects.

Preferably, the drug target is intracellular Ca ²⁺ and/or intercellular Ca ²⁺. The inventors of the present invention found that both intracellular Ca ²⁺ chelator and intercellular Ca ²⁺ chelator  significantly rescued the ectopic HFSC apoptosis induced by niche atrophy.

Preferably, the drug target is the mechanosensitive ion channel and/or the factor involved in the mechano-calcium signaling pathway. The inventors of the present invention found that mechanosensitive ion channel inhibitor significantly rescued niche atrophy induced HFSC loss and intracellular Ca ²⁺ concentration increased in HFSCs after niche size decreased, which suggest intracellular Ca ²⁺ increase mediated by mechanosensitive ion channels is involved in inducing niche atrophy triggered stem cell loss through apoptosis.

Preferably, the mechanosensitive ion channel is expressed in the epithelial layer. Preferably, the mechanosensitive ion channel or the ion channel involved in the mechano-calcium signaling pathway is the epithelial expressed mechanosensitive ion channel Piezo1. The inventors of the present invention got some genetic evidences, which suggest HFSCs expressed mechanosensitive ion channel Peizo1 senses the decrease in niche space and mediates hair cycle dependent abnormal HFSC apoptosis. Moreover, the inventors of the present invention also conducted loss-of-function and gain-of-function experiments, which conclusively show that epithelial expressed Piezo1 is necessary and sufficient to mediate niche size regulated HFSCs survival.

Preferably, the drug target is TNFα or the factor involved in the TNFα signaling pathway. The inventors of the present invention found that loss of TNF receptor almost completely blocked the ectopic apoptosis in HFSCs, which suggest TNFα is required for inducing niche atrophy triggered hair cycle dependent abnormal HFSC apoptosis.

Preferably, the TNFα or the factor involved in the TNFα signaling pathway is hair cycle specific, which preferably is catagen or catagen-telogen transition stage specific. The inventors of the present invention examined the expression patter of TNFα during different hair cycle stages and found that TNFα mRNA was not detectible in anagen or telogen HFs but rather during catagen. This expression pattern fits the speculated catagen specific signal that could collaborate with increased intracellular Ca ²⁺ to induce HFSC apoptosis. Moreover, combined treatment of mechanical stretch and TNFα induced cell death in a mechanical stretch dosage dependent manner, and the effect of mechanical stretch was lost upon knockout of mechanosensitive ion channel Piezo1 in keratinocytes.

Preferably, the drug target for hair follicle stem cells loss comprises: (1) intracellular Ca ²⁺, intercellular Ca ²⁺, the mechanosensitive ion channel and/or the factor involved in the mechano-calcium signaling pathway, and (2) TNFα and/or the factor involved in the TNFαsignaling pathway. Preferably, the mechanosensitive ion channel or the ion channel involved in the mechano-calcium signaling pathway is the epithelial expressed mechanosensitive ion channel Piezo1. Preferably, the TNFα or the factor involved in the TNFα signaling pathway is catagen or catagen-telogen transition stage specific.

Preferably, the niche atrophy, which triggers above drug targets, is directly caused by or relates with aging, androgenic alopecia, and/or genetic hair follicle related pathologies.  Preferably, the genetic hair follicle related pathology refers to pure hair and nail ectodermal dysplasia.

In the second place, the present invention provides a method for establishing hair follicle stem cells loss animal model, or a hair follicle stem cells loss induction method in an animal, comprising inhibiting the function or reducing the amount of at least one of the following: intracellular Ca ²⁺, intercellular Ca ²⁺, mechanosensitive ion channel, factor involved in the mechano-calcium signaling pathway, TNFα, and factor involved in the TNFα signaling pathway. Preferably, the model may be the animal (such as mouse, rat, canine, pig or cat) , the tissue (such as the skin) , or the cell isolated from the tissue.

In the third place, the present invention provides a hair follicle stem cells loss animal model induced through inhibiting the function or reducing the amount of at least one of the following: intracellular Ca ²⁺, intercellular Ca ²⁺, mechanosensitive ion channel, factor involved in the mechano-calcium signaling pathway, TNFα, and factor involved in the TNFαsignaling pathway. Preferably, the model may be the animal (such as mouse, rat, canine, pig or cat) , the tissue (such as the skin) , or the cell isolated from the tissue.

In the fourth place, the present invention provides a method for screening candidate drugs for preventing or treating hair follicle stem cells loss using the said drug target or animal model.

In the fifth place, the present invention provides a method for manufacturing a medicament for preventing or treating hair follicle stem cells loss using the said drug target or animal model.

In the sixth place, the present invention provides a method for diagnosing hair follicle stem cells loss using the said drug target or animal model.

In the seventh place, the present invention provides a method for evaluating the therapeutic effects of hair follicle stem cells loss using the said drug target or animal model.

In the eighth place, the present invention provides a method for prognosis evaluation of hair follicle stem cells loss using the said drug target or animal model.

In the nineth place, the present invention provides drug for hair follicle stem cell loss, comprising at least one of the following: chelator of intracellular Ca ²⁺, chelator of intercellular Ca ²⁺, inhibitor of mechanosensitive ion channel, inhibitor of mechano-calcium signaling, inhibitor of TNFα, blocker of TNFα receptor and inhibitor of TNFα signaling. The mentioned inhibitor or blocker may be chemical compounds or biological molecules (such as the polynucleotide, peptide, antibody etc. ) .

In the tenth place, the present invention provides a method of preventing or treating hair follicle stem cell loss using the said drug.

Brief Description of Drawings

Figure 1. Shrinkage in physical niche size triggers hair cycle dependent abnormal stem cell death. Scale bars, 30 μm. All data reflect mean ± SD from 3 mice in 3 independent experiments. *p < 0.1, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 2. Intracellular Ca ²⁺ increase mediated by mechanosensitive ion channels is involved in inducing niche atrophy caused abnormal stem cell death. All data reflect mean ± SD from 3 mice in 3 independent experiments. Scale bars, 30 μm. *p < 0.1, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 3. Epithelial expressed mechanosensitive ion channel Piezo1 mediates niche atrophy triggered abnormal stem cell death. All data reflect mean ± SD from 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, bulge. Scale bars, 30 μm. ****p < 0.0001.

Figure 4. Hair cycle dependent TNFα collaborates with Piezo1 activation to induce niche atrophy triggered abnormal stem cell death. All data reflect mean ± SD from 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, bulge. Scale bars, 30 μm.

Figure 5. Pathological niche atrophy induces hair cycle dependent abnormal stem cell death through mechanosensitive ion channel Piezo1. All data reflect mean ± SD from 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, bulge. Scale bars, 30 μm.

Examples

The examples herein are provided by way of illustration only and not by way of limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Methods

Mice

Mouse experiments were performed according to the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Biological Sciences. All the animals were handled according to the guidelines of the Chinese law regulating the usage of experimental animals and the protocols (M0020) approved by the Committee on the Ethics of Animal Experiments of the National Institute of Biological Sciences, Beijing. Nfatc1CreER mice were generated and provided by Dr. Bin Zhou. The Sox9CreER, ShhCreER, Hoxc13 KO, Trpv4 KO have been described previously. K14Cre mice (Stock: 004782) , Rosa-stop-mTmG mice (Stock: 007576) , Ai14 mice (Stock: 007914) , Piezo1 fl/fl (Stock: 029213) ,  GCaMP6s (Stock: 024106) , Tnfrsf1a1b (Stock: 003243) are from The Jackson Laboratory. Hoxc13 fl/fl mice were generated by inserting LoxP in exon2 of Hoxc13. LoxP1 insert site is position 7895, and LoxP2 insert site is position 8601.

Hair shaft plucking experiments

Tail skin hair follicles are arranged in triplets, the middle hair follicle of the triplet was used. For catagen hair shaft plucking experiment, the middle one-third section along both the length and width of dorsal tail skin from P9 mice were used. For telogen hair shaft plucking experiment, the middle one-third section along both the length and width of dorsal tail skin from P14 mice were used. Correct plucking of catagen or telogen hair shaft was verified by light microscope examining of the plucked hair shaft morphology. Individual hair shaft was gently plucked out using tweezers. For pluck and refill experiment, after plucking of hair shaft, use scalpel to cut off the club end with attached Krt6+ cells. Use tweezers to re-insert the short shaft into the plucked hollow hair follicle channel. The success of the pluck and refill procedure is examined at 4 days later using wholemount immunofluorescent and light field images.

Intravital Ca ²⁺ Imaging

Sox9CreER: : GCaMP6s: : Ai14 mice were used for intravital Ca ²⁺ imaging. Before imaging, tamoxifen was injected intraperitoneally daily from P11-13 to label HFSCs. In tail skin, hair follicles are arranged in triplets. At P14, pluck the hair shafts of the right one of the triplets along tail skin dorsal midline. The left hair follicle of the same triplet serves as un-plucked internal control. Mouse was anesthetized by isoflurane, and the tail was immobilized by tape in custom table for imaging. Ca ²⁺ imaging was performed using Nikon two-photon microscope with 25X water-immersion objective lens with a numerical aperture of 1.02 (Olympus, UIS2) . To image GCaMP6s signals, laser was tuned at 910 nm wavelength with 40%intensity. To image tdTomato signals, laser was tuned at 1040 nm wavelength with 10%intensity. Images were acquired at 1 frame per 10 sec for 10 min using Nikon software. To calculate normalize GCaMP6s intensity, for each frame background-subtracted GCaMP6s fluorescence value was divided by background-subtracted tdTomato fluorescence values for the same region of interest. Relative GCaMP6s signal change F/F _b (t) for each frame (t) was calculated. Baseline F _b was the mean value of the lowest 10 ^th percentile of fluorescence intensities during the imaging period of the same cell. Ca ²⁺ flash was defined based on amplitudes that were at least 2-fold above the baseline noise. Ca ²⁺ intensity track, max F/F _b and Ca ²⁺ flash number were analyzed using GraphPad Prism.

Animal Treatments

To label hair follicle stem cells, Nfatc1CreER: : mTmG mice were used. Pregnant mouse was injected with a single dose of tamoxifen at E17.5 intraperitoneally. For Ca ²⁺ imaging, Sox9CreER: : GCaMP6s: : Ai14 mouse was injected with tamoxifen once a day from P11 to P13. For Hoxc13 conditional knockout, nursing mom of ShhCreER: : Hoxc13 fl/fl: : Ai14 mouse was injected with tamoxifen once a day from P3 to P9. For inhibitors experiment, C57BL/6J mice were plucked at P9 and injected with inhibitors once a day from P9-P12 intracutaneously in the middle 1/3 part of tail skin. In vivo inhibitors used were as follows: Taxol (Selleck, S1150, 10 μM) , Cytochalasin D (Abcam, ab143484, 50 μM) , BAPTA-AM (Sigma, A1076, 200 μM) , BAPTA (Sigma, A4926, 200 μM) , GsMTx4 (R&D, 4912, 1 μM) . For Yoda1 injection in different hair cycle, 7.5 μM Yoda1 was injected once a day for three days intracutaneously in the middle 1/3 part of tail skin. For anagen to catagen stage, Yoda1 was injected from P10 to P12 and side (right or left) hair follicle of the triplet was used. For catagen to telogen stage, Yoda1 was injected from P10 to P12  and center hair follicle of the triplet was used. For telogen to early anagen stage, Yoda1 was injected from P13 to P15. For early anagen to late anagen stage, Yoda1 was injected from P15 to P17. For in vivo Yoda1+TNFα injection experiment, 7.5 μM Yoda1 and 0.1 μg/mL TNFα was injected intracutaneously in 1/3 middle part of tail skin once a day from P12 to P14.

In vitro Stretch Experiments

In vitro stretch device of an equiaxial strain cell culture system has been described previously. To assemble the stretch device, use a rubber O-ring to fix the Matrigel coated silicone membrane to the bottom of the custom-made cylinder holder, then place the indenter ring in the middle space of the cylinder holder (item#1) . The assembled device (item#1) is placed between a screw-top metal ring and a screw-bottom metal ring. Cells were plated on the silicone membrane and inside the indenter ring. The screw-top metal ring can be turned down to pressure the indenter ring that then stretches the silicone membrane. By calculation, the screw-top metal ring rotating by 1.5 turn means 10%degree of membrane stretch, 3 turn rotate means 20%degree of membrane stretch, and 5 turn rotate means 30%degree of membrane stretch. For stretch experiment, coat the silicone membrane with Matrigel for 2 hours at 37℃ and plate keratinocytes on membrane at D1. At D2, stretch membrane every 30 min for 4 hours with different stretch degree with or without TNFα.

Cell Culture Experiments

To establish the C57 and Piezo1 cKO cell line, newborn dorsal skin was removed and placed dermis side down in Dispase (Life Technologies, 0.4 mg/mL in PBS) for 1h at 37℃. The epidermis was separated from dermis and digested in 0.25%trypsin solution (Gibco) at 37℃. When most of keratinocytes had dissociated, cells were collected by centrifugation and cultured in 0.05mM Ca ²⁺ E-medium. All the cell lines were cultured at 37℃ in a cell incubator with 5%CO ₂. For in vitro TNFα and stretch experiment, keratinocytes were treated 100ng/mL TNFα with or without stretch of different degree (0%, 10%, 20%, 30%) for 4 hours. To detect apoptotic event in live cells, DEVD assay was used (CellEvent Caspase-3/7 Green Detection Reagent, C10423) . Dilute the DEVD detection reagent to a final concentration of 2 μM. Remove the media from the cells, then add the diluted reagent and Hoechst 33342 to the cells. Incubate the cells at 37℃ for 30 min before imaging. For cleaved caspase3 western blot, plate 20, 000 keratinocytes into a well of 6 well plate. 20 hours later, treat the cells with TNFα of different concentration (0, 0.01, 0.1 ug/mL) and Yoda1 of different concentration (0, 2.5, 7.5 μM) . 20 hours later, cells were collected for western blot. The following antibodies were used in western blot: anti-cleaved-caspase3 (Cell signaling, D175, 1: 1000) , anti-Actin-HRP (MBL, PM053-7) .

Immunofluorescence Staining, Confocal Microscopy and Imaging Processing

For section staining, tissues were embedded in O. C. T compound (Tissue-Tek) , frozen on dry ice and cryosectioned (20-30 μm) . Sections were fixed for 10 min in 4% (vol/vol) paraformaldehyde in PBS, permeabilized for 15 min in 0.5%Triton (PBST) and blocked for 1 hour in blocking buffer (2%normal donkey serum, 1%BSA and 0.5%Triton in PBS) . The primary antibodies were incubated overnight at 4℃, then washed with PBS for 15 min three times. The second antibodies were incubated at room temperature for 1 hour and washed with PBS for 15 min three times. For H&E staining, skin samples were cytosectioned (10μm) and fixed for 10 min in 4%paraformaldehyde in PBS. Sections were stained in Hematoxylin (Sigma) for 20s and then rinsed in water and 0.3%acid alcohol, then stained in Eosin (Sigma) for 30s. H&E staining were imaged with a VS120 microscope. Immunofluorescence staining were imaged  on a Nikon A1-R confocal microscope (Olympus Life Science) . Microscope data was analyzed using ImageJ and Bitplane Imaris. RGB images were assembled and labeled with Adobe Illustrator CS6. The following antibodies were used: anti-P-cad (R&D, BAF761; 1: 500) , anti-active-caspase3 (Cell signaling, D175, 1: 1000) , anti-Krt6 (Chen Ting Lab, 1: 1000) , anti-Hoxc13 (Chen Ting Lab, 1: 1000) , anti-GFP (Abcam, ab13970, 1: 1000) , anti-CD34 (ebioscience, 50-0341, 1: 500) , anti-Ki-67 (eBioscience, 1: 1000) .

Whole Mount Tail Skin Staining

Full thickness tail skin was removed from the tail and cut into 1 cm x 0.5 cm size. Then tail skin was treated in 25mM ETDA for 2 hours in 37℃, at 150 r/min on a shaker. Epidermis with hair follicles and dermis was separated using tweezers. The epidermis was fixed in 4%paraformaldehyde for 7 min, then washed with PBS for 30 min three times. When necessary unwanted long anagen hair follicles blocking the view of shorter hair follicles were removed using tweezers under stereoscopic microscope. Then the epidermis was processed for immunofluorescent staining and imaging.

Fluorescent RNA in Situ Hybridization

Tissues were fixed in freshly prepared 4%PFA for 24 hours at 4℃, dehydrated with 10%, 20%, 30%sucrose, then frozen in OCT embedding media with dry ice. Section the blocks by cutting 10 μm thick sections. Sections were air-dried at room temperature and processed for fluorescent RNA in situ detection by referring to RNAscope Multiplex Fluorescent Reagent Kit v2 Assay. RNAscope probes used were as follows: TNFα (NM_013693, region 41-1587) , Ppib (NM_011149.2, region 98-856) .

RNA Isolation and Real-Time PCR

Whole tail skin was treated in 25mM ETDA for 2 hours in 37℃, at 150 r/min on a shaker. Epidermis was separated with dermis, then treated in 0.25%trypsin for 30 min. Dissociated keratinocytes were collected by centrifugation. Total RNA was isolated with Trizol (Life Technologies) followed by extraction using a direct-Zol RNA mini prep kit (Zymo research) . To get the cDNA, equal amounts of RNA were added to reverse-transcriptase reaction mis (Vazyme, R222-01) . Real-time PCR was conducted using CFX96TM Real-Time system (Bio-Rad) with Power SYBR Green PCR Master Mix (Life Technologies) . Primers were designed for the following cycling condition: 10 min at 95℃ for initial denaturing, 40 cycles of 10 sec at 95℃ for denaturing, 30 sec at 61℃ for annealing and 10 sec at 65℃ for extension. The primers used were as follows: PPIB F, GTGAGCGCTTCCCAGATGAGA; PPIB R, TGCCGGAGTCGACAATGATG; Peizo1 F, CGTCGGGAACCAGAGGG; Piezo1 R, ACCAGCGAGAGAGCATTGAA; Trpv4 F, CCACCCCAGTGACAACAAG; Trpv4 R, GGAGCTTTGGGGCTCTGT.

Statistical Analysis

Data are presented as mean value ± the standard deviation (SD) . All statistical graphs were prepared in GraphPad Prism. Significant analysis was performed using unpaired two-tailed Student’s test in Prism. P value was calculated with a confidence interval of 95%to indicate the statistical significance between groups. A P value <0.05 was considered statistically significant. Statistically significant difference between groups are noted with asterisks (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001) .

Example 1: Shrinkage in physical niche size triggers hair cycle dependent abnormal  stem cell death.

During normal hair cycle regression phase catagen, hair shaft retracts and moves upward followed by an epithelial strand that undergoes apoptosis. The docking of hair shaft and Krt6+ companion layer cells at the bulge marks the end of catagen and apoptosis events. To investigate whether or not the decrease in three-dimensional niche size causes HFSC loss, we plucked out the hair shaft and attached Krt6+ companion layer cells at morphogenesis catagen prior to their docking at bulge and followed the fate of HFSCs at the subsequent catagen-telogen stages (Figure 1a) . In un-plucked control HFs, active-caspas3+ apoptotic cells only exist in the retracting epithelial strand of the catagen HFs. The outer root sheath cells including the HFSCs that wrapped around the hair shaft do not undergo apoptosis. Once the retracting hair shaft and Krt6+ companion layer cells stop at the bulge area and get in contact with the HFSCs, all apoptosis events cease. At one day (D1) after plucking of catagen hair shaft, active-caspas3+ apoptotic cells still only exist in the retracting epithelial strand of lower HF. At D2 after plucking, since there is no hair shaft inside the HF, there is a noticeable shrinkage of the HF diameter and remarkable spreading of the apoptosis events from lower HF to upper HF including some bulge cells. At D3 as the HF further shortens, both lower and upper bulge cells show ectopic apoptosis that persist until D4. But not all bulge cells will disappear from apoptosis, at D5 the secondary hair germ starts to enlarge and initiate the next round of anagen similar to control un-plucked HFs (Figure 1b) . To quantify the observed spatiotemporal changes, we divided the bulge into upper (Bu1) and lower (Bu2) portions. The diameter of Bu2 starts to decrease in plucked HFs at D2 and reaches the lowest level at D3, which is ～50%lower in plucked HFs compared to control HFs. In correlation to the gradual decrease in bulge diameter, Bu2 starts to have ectopic apoptotic cells at D2 in plucked HFs, and then peaks at D3. Subsequently the diameter of Bu1 starts to decrease slightly in plucked HFs at D3 and reaches the lowest level at D4. Correlatively Bu1 starts to show ectopic apoptosis at D3 in plucked HFs, and then peaks at D4 (Figure 1c-d) .

The upward spreading of apoptosis events is not induced by damage inflicted by plucking of the hair shaft per se. Because when we plucked the hair shaft at telogen, even though we also removed both the hair shaft and Krt6+ companion layer cells from the telogen bulge, we did not detect any active-caspas3+ apoptotic cells in bulge region afterwards (Figure 1d) . At D4 after plucking of telogen hair shaft, the HFs have entered into anagen similar to previous observations. This result indicates that hair shaft plucking alone cannot induce abnormal HFSC apoptosis. And indeed plucking of catagen hair shaft causes hair cycle dependent abnormal HFSC apoptosis. To determine if this will result in HFSC loss, we used lineage tracing to follow the HFSC number. HFSCs were labeled as mGFP+ cell using Nfatc1CreER: : mTmG mice by injecting tamoxifen at morphogenesis anagen. At D1 after plucking of catagen hair shaft, the number of HFSCs between plucked and un-plucked control HFs remain the same, indicating plucking did not remove HFSCs directly. But at D4 there is a significant decrease of HFSCs in plucked HFs compared to control HFs (Figure 1e) . Together these results conclusively show that plucking of catagen hair shaft decreases bulge sized and triggers hair cycle dependent abnormal HFSC apoptosis, which results in HFSC loss.

Particularly, the figure 1a showed the schematic diagram of catagen hair shaft plucking assay  and the figure 1b showed the immunofluorescent whole mount images of tail skin hair follicles at different time points during catagen-telogen transition stages, with or without plucking of catagen hair shaft as depicted in figure 1a. In figure 1b, D1-5 indicate time points after plucking of catagen hair shaft, which span catagen to telogen to anagen. Active-caspase 3 staining indicates apoptotic cells. Pcad staining marks epithelial cells. Bulge is divided into upper (Bu1) and lower (Bu2) portions for quantification to indicate the sequential change in bulge diameter and apoptotic events. Note the spreading of apoptotic events from the lower portion to upper portion of bulge after hair shaft was plucked at catagen. SG, sebaceous gland; Bu, bulge. Moreover, figure 1c and figure 1d respectively showed the quantification of bulge diameters at indicated time points and conditions and quantification of cell death in bulge area at indicated time points and conditions. And figure 1e showed the quantification of stem cell number at indicated time points and conditions.

Example 2: Restoring the physical niche size rescues the hair cycle dependent abnormal  stem cell death.

The sequential associations of bulge diameter decrease and ectopic apoptosis increase in Bu1 and Bu2 suggest niche atrophy is the likely cause of the hair cycle dependent abnormal HFSC death. The specific niche atrophy we referred here includes two main aspects: decrease in Krt6+ companion layer cells and shrinkage of the three-dimensional niche space. Krt6+companion layer cells are known to secrete factors regulating HFSC quiescence. In order to distinguish the contribution of Krt6+ companion layer cells vs. change in physical niche size to the observed phenomenon, we conducted the “pluck+refill” experiment: after plucking of the catagen hair shaft, a hair shaft without attached Krt6+ companion layer cells was subsequently re-inserted into its position to re-expand the decreased physical niche space (Figure 1f) . If lacking of Krt6+ companion layer cells is the main reason behind the niche atrophy caused hair cycle dependent HFSCs loss, then this procedure wouldn’ t have any rescue effect. However if decrease in physical niche size is the main cause, this procedure should be able to rescue the phenomenon. As a control for the pluck+refill experimental procedure, we plucked the catagen hair shaft and subsequently re-inserted a hair shaft without attached Krt6+ companion layer cells just above the sebaceous gland, to avoid re-expanding the decreased physical niche space caused by plucking. This is termed the “pluck+SG refill” experiment. Whole mount immunofluorescent staining and bright field images revealed the successful execution of the experiments described above. To help distinguish the original hair shaft and the re-inserted hair shaft we used pigmented hair shafts for re-insertion on plucked hair follicle (Figure 1g) . In control telogen bulge we can clearly detect the hair shaft and Krt6+ companion layer cells inside the bulge, but lack of any apoptosis in HFSCs. At D4 after plucking of catagen hair shaft, there are no hair shaft and Krt6+ companion layer cells in the telogen bulge, but abundant ectopic HFSCs apoptosis. Strikingly, just by re-inserting a hair shaft without attached Krt6+ companion layer into the bulge position after plucking of catagen hair shaft, we can completely stop the spreading of apoptosis from lower HF into bulge. Similar procedure but re-inserting a hair shaft without attached Krt6+ companion layer above bulge fails to have any rescue effect. The quantification of apoptosis in bulge showed completely rescue by the pluck+refill experiment, but no effect at all by the pluck+SG refill  experiment (Figure 1h) . The quantification of bulge diameter showed that the pluck+refill procedure re-expanded the decreased bulge size, while the pluck+SG refill procedure did not (Figure 1i) . Since by only restoring the physical niche size without any Krt6+ companion layer cells has complete rescue effect, we can conclude lacking of Krt6+ companion layer cells is not the reason behind niche atrophy caused hair cycle dependent HFSCs loss. Hair plucking has been shown to recruit immune cells to the skin. Since any hair plucking induced response will still occur in the pluck+refill experiment, and yet by only restoring the physical niche size has complete rescue effect, this experiment also excluded many other potential hair plucking induced effects.

Particularly, the figure 1f showed the schematic diagram of catagen hair shaft pluck+refill assay. The figure 1g showed the immunofluorescent and bright field whole mount images of tail skin hair follicles at indicated conditions, in which the yellow arrowhead marks hair shaft and Krt6 staining marks the companion layer cells hugging the end of hair shaft. The figure 1h showed the quantification of cell death in bulge under indicated conditions and the figure 1i showed the quantification of bulge diameters under indicated conditions.

Example 3: Ca ²⁺ chelators and mechanosensitive ion channel inhibitor rescues the  ectopic HFSC apoptosis induced by niche atrophy.

Next we want to understand how change in physical niche size can trigger the hair cycle dependent HFSC death. After plucking of catagen hair shaft, the remaining HF does not stay as an hollow channel, but instead it gradually condenses inwardly from the bottom up as if it is being squeezed to form a solid column. The HF is wrapped by a sheet of elastic dermal sheath cells on the outside that could contribute to this effect. There are a myriad of potential mechanisms that HFSCs can sense the change in physical niche size and accompanied mechanical force: glycocalyx, lipid raft, cell adhesion structure, and mechanosensitive ion channels etc. We noticed the ectopic HFSC apoptosis induced by niche atrophy is not dependent on basement membrane attachment, since both basal and superbasal bulge cells undergo ectopic apoptosis. So instead of focusing on cell-cell or cell-basement membrane adhesion molecules, we decided to examine intracellular mechanotransduction factors first: actin filaments, microtubule network and Ca ²⁺ signal. To determine their functional relevance, we intradermally injected multiple inhibitors after plucking of catagen hair shaft to see which one can rescue HFSC apoptosis: Taxol stabilizes microtubules; Cytochalasin D is an inhibitor of actin polymerization; BAPTA-AM is a chelator of intracellular Ca ²⁺ and BAPTA is a chelator of intercellular Ca ²⁺. Among these 4 different treatments, both Ca ²⁺ chelators significantly rescued the ectopic HFSC apoptosis induced by niche atrophy, while the cytoskeletal modulators did not. Since these results pinpointed to the potential role of mechanosensitive ion channels, we tested the rescue effect of GsMTx4, which is a mechanosensitive ion channel inhibitor. It has similar rescue effect to both Ca ²⁺ chelators (Figure 2a) . To determine if this will result in HFSC number rescue as well, we used lineage tracing to follow the HFSC number after treatment. HFSCs were labeled as mGFP+ cell using Nfatc1CreER: : mTmG mice by injecting tamoxifen at morphogenesis anagen, then after plucking of catagen hair shaft we intradermally injected GsMTx4 and quantified the HFSC  number 4 days later. Compared to vehicle treatment, GsMTx4 significantly rescued niche atrophy induced HFSC loss (Figure 2b) . Together these functional evidences suggest mechanosensitive ion channels mediated intracellular Ca ²⁺ increase is involved in niche atrophy triggered HFSC loss.

Particularly, the figure 2a showed the quantification of cell death in bulge with different inhibitor treatments after plucking of catagen hair shaft. Taxol is a stabilizer of microtubule. Cytochalasin D is an inhibitor of actin polymerization. BAPTA-AM is a chelator of intracellular Ca2+ and BAPTA is a chelator of intercellular Ca ²⁺. GsMTx4 is a mechanosensitive ion channel inhibitor. And figure 2b showed immunofluorescent whole mount images and quantification of tail skin hair follicle stem cell number at indicated conditions. Hair follicle stem cells are labeled as membrane GFP+ cells using Nfatc1CreER: : mTmG mice.

Example 4: Intracellular Ca ²⁺ increase mediated by mechanosensitive ion channels is  involved in inducing niche atrophy caused abnormal stem cell death.

If this is indeed correct we should be able to visualize intracellular Ca ²⁺ concentration increase in HFSCs after niche size decrease. To test this we used Sox9CreER: : GCaMP6s: : Ai14 mice to live image Ca ²⁺ influx in HFSCs in vivo. GCaMP6s is a green fluorescent Ca ²⁺ indicator that shows high sensitivity and slow decay kinetics. After tamoxifen injection at morphogenesis anagen, HFSCs express GCaMP6s and stable RFP from the Ai14 allele. Then at different time points after plucking of catagen hair shaft, we used two-photon microscope to do intravital imaging of HFSCs in intact skin of anesthetized live mice (Figure 2c) . In control un-plucked HFs, HFSCs show stable fluorescent levels of both RFP and GCaMP6s during the live imaging period. RFP signal serves as internal control, and the ratio of GFP/RFP was used to normalize GCaMP6s intensity. In HFSCs of control HFs, the GCaMP6s intensity stays constant indicating no change in intracellular Ca ²⁺ level. On the other hand, at D4 after plucking of catagen hair shaft, HFSCs still show stable RFP fluorescent level during the live imaging period, but at the same time the GCaMP6s demonstrates very dynamic signal spikes, with flashes of increased GFP signals randomly appear in individual HFSCs of the plucked HFs. The normalized GCaMP6s signal shows distinct high intensity loci demonstrating pulses of intracellular Ca ²⁺ increase in HFSCs of plucked HFs. To quantify these observed dynamic changes, fluorescent intensity (F) of normalized GCaMP6s signal from individual cells was divided by F _b, which represents the mean value of the lowest 10%fluorescent intensity from that cell during the imaging time period (Figure 2d) . The F/F _b responses over time from HFSCs in control HFs show flat tracks, while tracks from HFSCs in plucked HFs give rise to various signal peaks. We then used the maximum F/F _b from the tracks to compare Ca ²⁺ influx at different time points after plucking of catagen hair shaft (Figure 2e) . For control un-plucked HFs, the levels of maximum F/F _b stay close to 1 in all time points, indicating lack of intracellular Ca ²⁺ increase in these HFSCs. For plucked HFs, at D2 and 3 after plucking of catagen hair shaft, the levels of maximum F/F _b are the same to control HFs, but at D4 there are striking increases. This suggests only at D4 after plucking of hair shaft there are dynamic intracellular Ca ²⁺ increases in HFSCs. The  same temporal difference was evident when we quantified the number of Ca ²⁺ flashes during the imaging period, which was defined by the number of F/F _b peaks in the tracks (Figure 2f) . Only at D4 after plucking of hair shaft there are significant increase of Ca ²⁺ flashes numbers in HFSCs. The maximum imaging depth of the two-photon microscope limited our observation to the bulge region immediately below the sebaceous gland, which corresponds to the Bu1 region we defined in Figure 1c. Based on our quantification, the diameter of Bu1 only decreases substantially at D4. Concomitantly Bu1 ectopic apoptosis peaks at D4 in plucked HFs. So the temporal change of Ca ²⁺ influx at Bu1 correlates with the decrease in bulge diameter and increase in HFSC apoptosis.

Particularly, figure 2c showed schematic diagram of intravital Ca ²⁺ imaging strategy and representative images of in vivo time-lapse recording of Ca ²⁺ flash in hair follicle stem cells using Sox9CreER: : GCaMP6s: : Ai14 reporter mice. Intact tail skin of anesthetized mice was directly imaged using 2-photon microscope. The imaged area corresponds to the upper bulge (Bu1) region depicted in Figure 1b. Ai14 allele expressed RFP marks hair follicle stem cells with stable fluorescent signal during live imaging. Dynamic green GCaMP6s signal flashes indicate intracellular Ca ²⁺ increases. Pseudo color images represent the ratio of GCaMP6s fluorescence to RFP fluorescence. Yellow arrowhead highlights individual cells shown dynamic Ca ²⁺ flash. Scale bars, 30 μm. Figure 2d showed representative tracks of calcium intensity in hair follicle stem cells from control and plucked hair follicles shown in (c) . Figure 2e showed the quantification of maximum F/Fb in upper bulge region at indicated conditions. C represent un-plucked control hair follicles, P represents plucked hair follicles. And figure 2f showed the quantification of Ca ²⁺ flash number in the 10-min imaging time window at indicated conditions.

Example 5: Epithelial expressed mechanosensitive ion channel Piezo1 mediates niche  atrophy triggered abnormal stem cell death.

A number of proteins have been reported to function as mechanosensitive ion channels in mammalian system. First we examined the expression level of these identified mechanosensitive ion channels in the HFSCs. Among the 8 of them, Trpv4 and Piezo1 showed robust expression level, while the others either do not express at all or have very low expression level (Figure 3a) . So next we used genetic experiments to test the functional relevance of Trpv4 and Piezo1. K14Cre: : Piezo1 fl/fl mice were used to conditionally ablate Piezo1 in skin epithelial cells including HFSCs; and Trpv4 KO mice were used to ablate Trpv4 in all cells (Figure 3b) . Both Piezo1 cKO and Trpv4 KO HFs do not exhibit abnormal morphology and ectopic apoptosis in bulge (Figure 3c-d) . When we plucked catagen hair shaft and quantified apoptosis at D4, wild type (Wt) HFSCs showed robust ectopic apoptosis induced by niche atrophy; loss of Piezo1 significantly decreased the ectopic apoptosis in HFSCs while loss of Trpv4 did not (Figure 3c-d) . These genetic evidences suggest HFSCs expressed mechanosensitive ion channel Peizo1 senses the decrease in niche space and mediates hair cycle dependent abnormal HFSC apoptosis. Piezo1 has been reported to function in mechanical force regulated vascular architecture, inflammatory response in innate immunity, aging in central nervous system, differentiation of midgut stem cell, and cell  extrusion in epithelia. To investigate whether activation of Piezo1 is sufficient to induce HFSC apoptosis even in the absence of niche size change, we intradermally injected a Piezo1 specific activator Yoda1 at different hair cycle stages and quantified apoptosis in HFSCs (Figure 3e) . Similar to vehicle treatment, Yoda1 treatments do not induce apoptosis in HFSCs during anagen-catagen, telogen-anagen and anagen-anagen transition stages. However Yoda1 treatment alone can induce robust HFSC apoptosis during catagen-telogen transition stage. This effect is mediated by epithelial expressed Piezo1 because Yoda1 treatment cannot induce ectopic apoptosis in Piezo1 cKO HFSCs during catagen-telogen transition stage. Together these loss-of-function and gain-of-function experiments conclusively show that epithelial expressed Piezo1 is necessary and sufficient to mediate niche size regulated HFSCs survival.

Particularly, figure 3a showed the expression level of mechanosensitive ion channels from RNA-seq analysis of hair follicle stem cells. Note Piezo1 and Trpv4 are both highly expressed. Figure 3b showed the QPCR validation of Piezo1 knockout efficiency using K14Cre: : Piezo1 mice; and Trpv4 knockout efficiency in Trpv4 KO mice. Figure 3c and figure 3d showed the quantification and representative immunofluorescent whole mount images of cell death in bulge under indicated conditions. At D4 after plucking of catagen hair shaft, niche atrophy triggered stem cell death can be significantly rescued by loss of epithelial cell expressed Piezo1, but not loss of Trpv4. And figure 3e showed the immunofluorescent whole mount images and quantification of cell death in hair follicle stem cells from tail skin with or without treatment of Piezo1 specific activator Yoda1 at different hair cycle stages. Yoda1 were intradermally injected for 3 days prior to analysis. Note only Yoda1 treatment at catagen-telogen transition stage can induce abnormal cell death in bulge region. This hair cycle dependent stem cell death induced by Yoda1 is dependent on epithelial cell expressed Piezo1, since this effect is completely absent in K14Cre: : Piezo1 fl/fl mice skin.

So far our data suggests change in three-dimensional niche size activates the mechanosensitive ion channel Peizo1 on HFSCs, and the resulting influx of Ca ²⁺ collaborates with certain catagen specific “death signal” leading to ectopic apoptosis and loss of HFSCs. Since Yoda1 treatment cannot cause HFSCs ectopic apoptosis during early catagen but rather catagen to telogen transition stage, this result suggests the catagen specific signal is not present in the bulge region during early catagen, but rather getting close to bulge as the catagen epithelial strand retracts upward. Next we want to identify this catagen specific signal that collaborates with increased intracellular Ca ²⁺ to induce HFSC apoptosis.

Example 6: Loss of TNF receptor blocks the ectopic apoptosis in HFSCs.

Previous studies have identified TNFα as a major catagen cell death related signal. First we performed RNA in situ to examine the expression patter of TNFα during different hair cycle stages (Figure 4a) . TNFα mRNA is not detectible in anagen or telogen HFs. During catagen TNFα is expressed by lower HF epithelial cells including the retracting epithelial strand. This expression pattern fits the speculated catagen specific signal that could collaborate with increased intracellular Ca ²⁺ to induce HFSC apoptosis. To test the functional relevance of TNFα, we used the Tnfrsf1a1b double KO mice to see if lack of the ability to respond to  TNFα would have any rescue effect (Figure 4b) . When we plucked catagen hair shaft and quantified apoptosis at D4, Wt HFSCs showed robust ectopic apoptosis induced by niche atrophy; loss of TNF receptor 1a and 1b almost completely blocked the ectopic apoptosis in HFSCs. This genetic experiment suggests catagen specific TNFα is required for inducing niche atrophy triggered hair cycle dependent abnormal HFSC apoptosis. To investigate whether TNFα is sufficient to collaborate with increase intracellular Ca ²⁺ to induce HFSC apoptosis in a hair cycle independent manner, we intradermally injected TNFα with or without the Piezo1 specific activator Yoda1 at telogen (Figure 4c) . Individual treatment of TNFα or Yoda1 at telogen cannot induce HFSC apoptosis, but strikingly combined treatment of TNFα and Yoda1 at telogen results in robust HFSCs apoptosis. To further test the collaborative effect of TNFα and Yoda1, we used in vitro cultured keratinocytes and western blot to detect cell death (Figure 4d) . Treatment of TNFα or Yoda1 alone cannot induce cleaved caspase-3 in keratinocytes in vitro, combined treatments of TNFα and Yoda1 induce the 19kd and 17kd forms of cleave caspase-3 in a concentration dependent manner. The effect of Yoda1 is dependent on Piezo1, because in Piezo1 KO keratinocytes combined treatment of TNFα and Yoda1 can only induce the inactive 19kd form of cleaved caspase3.

Particularly, figure 4a showed the in situ analysis of TNFα expression pattern in different hair cycle stages. Note TNFα show catagen specific expression in the epithelial strand of retracting hair follicle. Figure 4b showed the immunofluorescent whole mount images and quantification of cell death in bulge under indicated conditions. At D4 after plucking of catagen hair shaft, hair cycle dependent stem cell death can be significantly rescued by loss of Tnfrsf1a and 1b. Figrue 4c showed the immunofluorescent whole mount images and quantification of cell death in hair follicle stem cells from tail skin treated with or without Piezo1 activator Yoda1 and/or TNFα. Treatment of Yoda1 or TNFα alone cannot induce hair follicle stem cell death in telogen, however combined Yoda1 and TNFα treatment is sufficient to induce hair cycle independent hair follicle stem cell death. And figure 4d showed the western blot of cleaved caspase3 in cultured keratinocytes under indicated conditions. Treatment of Yoda1 or TNFα alone cannot induce cleaved caspase3 in cultured keratinocytes, however combined Yoda1 and TNFα treatment is sufficient to induce cleaved caspase3 (both 19kd and 17kd) in a dosage dependent manner. In Piezo1 KO cell line, combined Yoda1 and TNFα treatment can only induce the inactive 19kd form of cleaved caspase3.

Example 7: Hair cycle dependent TNFα collaborates with Piezo1 activation to induce  niche atrophy triggers abnormal stem cell death.

To further verify TNFα functions in mechanical force induced cell death, we designed an in vitro cell stretch assay (Figure 4e) . Keratinocytes were cultured on elastic silicone membrane attached to a stretch apparatus. Different levels of mechanical force can be applied to the keratinocytes by stretching the membrane to various degrees. Keratinocytes apoptosis were quantified by adding fluorescent DEVD peptide to detect active-caspase3 activity. Treatments of mechanical stretch or TNFα alone cannot induce keratinocytes apoptosis in vitro. However combined treatment of mechanical stretch and TNFα induced cell death in a mechanical stretch dosage dependent manner. The effect of mechanical stretch is lost upon knockout of  mechanosensitive ion channel Piezo1 in keratinocytes.

Particularly, the figure 4e showed schematic diagram and quantification of cell death in cultured keratinocytes under indicated conditions. Keratinocytes were cultured on elastic silicone membrane attached to a stretch apparatus. Applied mechanical stretch sensitizes keratinocytes to TNFα induced cell death in a stretch dosage dependent manner. The effect of mechanical stretch is lost upon knockout of mechanosensitive ion channel Piezo1 in keratinocytes.

Together these loss-of-function and gain-of-function experiments conclusively show that TNFα is the catagen specific factor that is both necessary and sufficient to collaborate with Piezo1 activation to induce HFSCs apoptosis. During normal hair cycle, HFSCs remain insensitive to catagen specific TNFα, but niche size decrease activated Peizo1 sensitize HFSCs to TNFα resulting in cell death and number decrease.

Example 8: Blocking the function of epithelial expressed mechanosensitive calcium  channel Piezo1 or loss of the Piezo1 rescues the hair cycle dependent abnormal HFSC  loss.

To investigate the pathological relevance of our finding, we employed the pure hair and nail ectodermal dysplasia (PHNED) disease model. PHNED is a congenital condition characterized by hypotrichosis and nail dystrophy. It is caused by loss of Hoxc13, which is a transcription factor specifically expressed in anagen matrix cells and functions in regulating terminal hair shaft differentiation and formation. We examined the expression pattern of Hoxc13 by immunofluorescent staining and confirmed that it is only expressed by anagen matrix cell but not HFSCs (Figure 5a) . We used Shh-CreER: : Hoxc13 fl/fl: : Ai14 mice to conditionally ablate Hoxc13 in part of matrix cells (Figure 5b) . Shh-CreER only targets half of the matrix cells and not the HFSCs. The overall HF development is normal in this Hoxc13 cKO mice. But during catagen the hair shaft appears smaller and some Krt6+ cell detach from the retracting hair shaft club end (Figure 5c) . When the hair shaft and Krt6+ companion cells reaches bulge, the resulting telogen bulge is ～20%smaller in dimension compared to Wt HFs (Figure 5d) . Then we quantified the HFSC number using CD34 staining, the Hoxc13 cKO HFs have ～25%less HFSCs compared to Wt HFs (Figure 5e) . Since the Hoxc13 cKO did not directly affect the HFSCs, we examined whether ectopic apoptosis induced by niche atrophy is the reason behind the HFSC decrease (Figure 5f) . In both Wt and Hoxc13 cKO HFs, active-caspas3+ apoptotic cells only exist in the retracting epithelial strand of the catagen HFs. At the catagen to telogen transition stage, HFSCs in Wt skin are refrained from apoptosis. However HFSCs in Hoxc13 cKO skin show significantly ectopic apoptosis. Then in anagen all apoptosis ceases in Hoxc13 cKO skin. To test whether or not this hair cycle dependent HFSC apoptosis is also caused by niche atrophy activated Piezo1, we used the K14Cre: : Piezo1 fl/fl: : Hoxc13 KO mice (Figure 5g) . HFSCs in Hoxc13 KO skin show hair cycle dependent ectopic apoptosis. Upon loss of epithelial expressed Piezo1 in Hoxc13 KO skin, this phenotype is significantly rescued. To determine if this will result in HFSC number rescue as well, we quantified CD34+ HFSC in different genotype mice (Figure 5h) . Since  Hoxc13 KO is a complete knockout of Hoxc13 in skin the HFSC number in this mutant is ～40%less compared to WT. Loss of epithelial expressed Piezo1 in Hoxc13 KO skin leads to significant rescue of the HFSC number decrease. Together our results showed that pathological niche atrophy caused hair cycle dependent abnormal HFSC loss is mediated by the activated mechanosensitive calcium channel Peizo1 on HFSCs. Blocking this process can efficiently rescue the loss of HFSC.

Particularly, figure 5a showed immunofluorescent image of Hoxc13 staining in anagen hair follicle. Figure 5b showed schematic diagram of knockout strategy and immunofluorescent images of Hoxc13 staining in ShhCreER: : Hoxc13 fl/fl: : Ai14 mice. Figrue 5c showed the immunofluorescent whole mount images of Krt6 staining in catagen hair follicles from ShhCreER: : Hoxc13 fl/fl: : Ai14 and Wt mice. Arrowhead shows Krt6+ cell detaches from the club end of retracting catagen hair shaft in Hoxc13 cKO but not Wt. Figure 5d showed the immunofluorescent whole mount images and quantification of bulge diameter in telogen hair follicles from ShhCreER: : Hoxc13 fl/fl: : Ai14 and Wt mice. Note the significant decrease of bulge diameter in Hoxc13 cKO but not Wt hair follicles. Figure 5e showed the immunofluorescent whole mount images and quantification of stem cell number in telogen hair follicles from ShhCreER: : Hoxc13 fl/fl: : Ai14 and Wt mice. CD34 marks hair follicle stem cells. Figure 5f showed the immunofluorescent whole mount images and quantification of tail skin hair follicles from catagen to anagen in ShhCreER: : Hoxc13 fl/fl: : Ai14 and Wt mice. Active-caspase 3 staining indicates apoptotic cells. RFP indicates progeny of the cKO cells, which is only in hair shaft but not in companion layer cells or hair follicle stem cells. Pcad marks epithelial cells. Figure 5g showed the immunofluorescent whole mount images and quantification of tail skin telogen hair follicles in Hoxc13 KO, Piezo1 cKO, Hoxc13 KO:: Piezo1 cKO and Wt mice. Note the significant rescue of abnormal hair follicle stem cell apoptosis in Hoxc13 KO by loss of Piezo1. And figure 5h showed the immunofluorescent whole mount images and quantification of stem cell number in tail skin telogen hair follicles in Hoxc13 KO, Piezo1 cKO, Hoxc13 KO: : Piezo1 cKO and Wt mice.

Although mechanical force is a major physiological parameter sensed by many cell type in vivo, whether it is involved in mediating the cross talk between niche atrophy and stem cell loss is completely unknown. Our results reveal a mechanical force sensory axis that mediates niche atrophy triggered stem cell loss through apoptosis. Mechanical force associated with three-dimensional niche size decrease activates mechanosensitive ion channel Piezo1, the resulting intracellular Ca ²⁺ increase sensitize HFSC to catagen specific TNFα and leads to apoptosis. Our mechanistic finding could be important for development of pharmacological therapies against pathological and aging related stem cell loss.

Claims (20)

1. A drug target for hair follicle stem cells loss, wherein the drug target is a factor triggered or activated by the niche atrophy.
2. The drug target according to claim 1, wherein the hair follicle stem cells loss results from abnormal stem cell death.
3. The drug target according to claim 2, wherein the abnormal stem cell death is hair cycle dependent.
4. The drug target according to claim 3, wherein the abnormal stem cell death happens in the catagen stage or catagen-telogen transition stage.
5. The drug target according to claim 1, wherein the niche atrophy refers to the shrinkage in physical niche size.
6. The drug target according to any of claim 1-5, wherein the drug target is intracellular Ca ²⁺, intercellular Ca ²⁺, the mechanosensitive ion channel and/or the factor involved in the mechano-calcium signaling pathway.
7. The drug target according to claim 6, wherein the mechanosensitive ion channel or the ion channel involved in the mechano-calcium signaling pathway is the epithelial expressed mechanosensitive ion channel Piezo1.
8. The drug target according to any of claim 1-5, wherein the drug target is TNFα or the factor involved in the TNFα signaling pathway.
9. The drug target according to any of claim 8, wherein the TNFα or the factor involved in the TNFα signaling pathway is hair cycle specific.
10. The drug target according to any of claim 1-5, wherein the drug target comprises: (1) intracellular Ca ²⁺, intercellular Ca ²⁺, the mechanosensitive ion channel and/or the factor involved in the mechano-calcium signaling pathway, and (2) TNFα and/or the factor involved in the TNFα signaling pathway.
11. The drug target according to claim 1, wherein the niche atrophy is directly caused by or relates with aging, androgenic alopecia, and/or genetic hair follicle related pathologies.
12. A method for establishing hair follicle stem cells loss animal model, or a hair follicle stem cells loss induction method in an animal, comprising inhibiting the function or reducing the amount of at least one of the following: intracellular Ca ²⁺, intercellular Ca ²⁺, mechanosensitive ion channel, factor involved in the mechano-calcium signaling pathway, TNFα, and factor involved in the TNFα signaling pathway.
13. A hair follicle stem cells loss animal model induced through inhibiting the function or reducing the amount of at least one of the following: intracellular Ca ²⁺, intercellular Ca ²⁺, mechanosensitive ion channel, factor involved in the mechano-calcium signaling pathway, TNFα, and factor involved in the TNFα signaling pathway.
14. A method for screening candidate drugs for preventing or treating hair follicle stem cells loss using the drug target according to any of claim 1-11 or the animal model according to claim 13.
15. A method for manufacturing a medicament for preventing or treating hair follicle stem cells loss using the drug target according to any of claim 1-11 or the animal model according to claim 13.
16. A method for diagnosing hair follicle stem cells loss using the drug target according to any of claim 1-11 or the animal model according to claim 13.
17. A method for evaluating the therapeutic effects of hair follicle stem cells loss using the drug target according to any of claim 1-11 or the animal model according to claim 13.
18. A method for prognosis evaluation of hair follicle stem cells loss using the drug target according to any of claim 1-11 or the animal model according to claim 13.
19. A drug for hair follicle stem cell loss, comprising at least one of the following: chelator of intracellular Ca ²⁺, chelator of intercellular Ca ²⁺, inhibitor of mechanosensitive ion channel, inhibitor of mechano-calcium signaling, inhibitor of TNFα, blocker of TNFα receptor and inhibitor of TNFα signaling.
20. A method of preventing or treating hair follicle stem cell loss using the drug according to claim 19.

Images