WO2021204911A1 - Neoepitope immunotherapy with apc targeting unit - Google Patents
Neoepitope immunotherapy with apc targeting unit Download PDFInfo
- Publication number
- WO2021204911A1 WO2021204911A1 PCT/EP2021/059117 EP2021059117W WO2021204911A1 WO 2021204911 A1 WO2021204911 A1 WO 2021204911A1 EP 2021059117 W EP2021059117 W EP 2021059117W WO 2021204911 A1 WO2021204911 A1 WO 2021204911A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- chemokine
- ligand
- sequence
- neo
- route
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001148—Regulators of development
- A61K39/00115—Apoptosis related proteins, e.g. survivin or livin
- A61K39/001151—Apoptosis related proteins, e.g. survivin or livin p53
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001196—Fusion proteins originating from gene translocation in cancer cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/521—Chemokines
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2851—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
- A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
- C07K2317/526—CH3 domain
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
- C07K2317/53—Hinge
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to cancer therapy, in particular cancer immunotherapy.
- the present invention relates to methods and products for treating cancer by administration of specific fusion polypeptides or nucleic acids encoding such fusion polypeptides.
- Treatment of malignant neoplasms in patients has traditionally focussed on eradication/removal of the malignant tissue via surgery, radiotherapy, and/or chemotherapy using cytotoxic drugs in dosage regimens that aim at preferential killing of malignant cells compared to killing of non-malignant cells.
- lymphocytes recognize and eliminate autologous cells - including cancer cells - that exhibit altered antigenic determinants, and it is today generally accepted that the immune system inhibits carcinogenesis to a high degree. Nevertheless, immunosurveillance is not 100% effective and it is a continuing task to device cancer therapies where the immune system's ability to eradicate cancer cells is sought improved/stimulated.
- nucleic acid vaccination also termed DNA vaccination
- DNA vaccination DNA vaccination
- DNA vaccination DNA vaccination
- the encoded material is immunogenic polypeptide(s), which upon production by the somatic cells will be able to induce an immune response.
- This approach is appealing as it avoids the need of producing the protein immunogen in clinical grade purity using expensive recombinant expression systems.
- Antigen-presenting cells are vital for effective adaptive immune response and are cells that display antigen complexed with major histocompatibility complexes (MHCs) on their surfaces.
- the cells include macrophages, B cells and dendritic cells, and present foreign antigens to helper T cells.
- virus- infected cells or cancer cells can present antigens originating inside the cell to cytotoxic T cells. Consequently, targeting antigen-presenting cell offers opportunities to induce superior immune responses.
- nucleic acid vaccines that can effectively target neo-antigens and induce clinically significant immune responses in vaccinated human beings.
- the present inventors have designed novel and improved polypeptides constructs and nucleic acid molecules encoding such polypeptide constructs generating a next generation DNA neoepitope immunotherapy with an antigen presenting cell (APC) - targeting unit.
- APC antigen presenting cell
- targeting of APC may be used to enhance the immunotherapeutic effects while maintaining antitumor activity of a neo-epitope vaccine, which enable a superior anti-tumor effect eliciting even higher T cell responses than known vaccines.
- the present invention relates to fusion polypeptides comprising i) at least one antigenic unit, which comprises a sequence of amino acids of at least one neo epitope of the patient's neoplastic cells; ii) at least one antigen presenting cell (APC) targeting unit; iii) optionally a multimerization, such as a dimerization unit, which unit provides for the multimerization of said fusion polypeptide to comprise two or more antigenic units and two or more antigen presenting cell (APC) targeting units.
- at least one antigenic unit which comprises a sequence of amino acids of at least one neo epitope of the patient's neoplastic cells
- APC antigen presenting cell
- optionally a multimerization such as a dimerization unit, which unit provides for the multimerization of said fusion polypeptide to comprise two or more antigenic units and two or more antigen presenting cell (APC) targeting units.
- the present invention relates to an expression vector, which comprises a sequence of nucleotides encoding a fusion polypeptide according to the present invention.
- the present invention relates to a system of at least two expression constructs comprising i) a first expression construct comprising a sequence of nucleotides encoding at least one antigenic unit, which antigenic unit comprises a sequence of amino acids of at least one neo-epitope of the patient's neoplastic cells, and ii) a second expression construct comprising a sequence of nucleotides encoding at least one antigen presenting cell (APC) targeting unit.
- APC antigen presenting cell
- the present invention relates to a method for the treatment of a neoplasm, such as a malignant neoplasm or for inducing a therapeutic or ameliorating immune response against such neoplasm, in a mammalian patient, wherein the neoplasm exhibits T-cell epitopes (neo-epitopes) that are not exhibited by non-neoplastic cells in the patient, the method comprising administering an immunogenically effective amount of a composition comprising a fusion polypeptide according to the present invention, or which composition is comprising at least one expression vector which comprises a sequence of nucleotides encoding a fusion polypeptide according to the present invention, whereby somatic cells in the patient are brought to express the sequence of nucleotides contained within the expression vector; the method optionally further comprising administering a pharmaceutically acceptable carrier, diluent, or excipient.
- a neoplasm such as a malignant neoplasm or for inducing
- the patient is a human being.
- the immunogenically effective amount of a composition is administered parenterally, such as via the intramuscular route, the intradermal route, transdermal route, the subcutaneous route, the intravenous route, the intra-arterial route, the intratechalintrathecal route, the intramedullary route, the intrathecal route, the intraventricular route, the intraperitoneal, the intranasal route, the vaginal route, the intraocular route, or the pulmonary route; is administered via the oral route, the sublingual route, the buccal route, or the anal route; or is administered topically.
- the pharmaceutically acceptable carrier, diluent, or excipient is an aqueous buffered solution.
- the aqueous buffered solution is Tyrode's buffer.
- the Tyrode's buffer has the composition 140 mM NaCI, 6 mM KCI, 3 mM CaCI2, 2 mM MgCI2, 10 mM 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid (Hepes) pH 7.4, and 10 mM glucose.
- the concentration of Tyrode's buffer is about 35% v/v.
- the aqueous buffer is phosphate-buffered saline (PBS) buffer.
- the method comprises administering an immunogenically effective amount of a composition comprising at least one expression vector as defined in any one of claims 10-15 with an effective dosage between 0.1 ⁇ g and 25 mg of the expression vector, such as between 0.5 ⁇ g and 20 mg, between 5 ⁇ g and 15 mg, between 50 ⁇ g and 10 mg, and between 500 ⁇ g and 8 mg, in particular about 0.0001, about 0.0005, about 0.001, about 0.005, about 0.01, about 0.05, about 0.1, about 0.5, about 1, about 2, about 3, about 4, about 5, about 6, about 7 and about 8 mg.
- an effective dosage between 0.1 ⁇ g and 25 mg of the expression vector, such as between 0.5 ⁇ g and 20 mg, between 5 ⁇ g and 15 mg, between 50 ⁇ g and 10 mg, and between 500 ⁇ g and 8 mg, in particular about 0.0001, about 0.0005, about 0.001, about 0.005, about 0.01, about 0.05, about 0.1, about 0.5, about 1, about 2, about 3, about 4, about 5, about 6, about 7 and about 8 mg.
- the method comprises administering an immunogenically effective amount of a composition which composition further comprises an effective amount of an amphiphilic block co-polymers comprising blocks of poly(ethylene oxide) and polypropylene oxide), such as Kolliphor® P188.
- Fig. 1 Illustration of one suggested design of a suitable fusion polypeptide and DNA encoding it.
- the construct contains an APC targeting unit being CCL3 or other cytokine/chemokine; a dimerization unit containing Hinge (hi and h4) and CH3 from IgG3; and antigenic units being neo-epitopes.
- Fig. 2 Illustration of mechanism of action for the DNA vaccine as illustrated in Fig. 1.
- FIG. 3 Illustration of different APC targeting units for fusion polypeptide designs according to the invention.
- A) illustrates the constructs of example 1
- B) illustrates the constructs of example 2.
- Fig. 4 Plasmid map of pUMVC4 from Aldevron.
- Fig. 5 Plasmid map of pUMVC4 mCCL19 S16A as example of an APC targeting design.
- the pUMVC4 vector is containing an insert encoding a kozak sequence, murine CCL19 as APC targeting unit, hinge 1, hinge 4 and Ch3 from human IgG followed by the 5 neoepitopes C22, C23, C38, C25, C30.
- Fig. 6 Tumour volume reduction in mice vaccinated with Kolliphor ® and vaccine plasmids. APC targeting vaccines as compared to control groups (untreated mice or mice treated with empty mock plasmid). *: p ⁇ 0.05 (Kruskal-Wallis test). See example 1 for details.
- Fig. 7 Diagram shows detection of C22 MHC I multimers.
- the graph shows the frequency of murine CD8+ T cells reactive with the C22 peptide upon vaccination of mice with experimental DNA vaccines. See example 1 for details.
- Fig. 8 IFN-y production in T cells from mice vaccinated with Kolliphor ® and vaccine plasmids. See example 1 for details.
- Fig. 8A Intracellular cytokine staining (ICS on stimulated splenocytes). See example 1 for details.
- Fig. 9 Tumour volume reduction in mice vaccinated with Kolliphor ® and vaccine plasmids.
- Fig. 10 Diagram shows detection of C22 MHC I multimers.
- the graph shows the frequency of murine CD8+ T cells reactive with the C22 peptide upon vaccination of mice with experimental DNA vaccines. See example 2 for details.
- Fig. 11 IFN-y production in T cells from mice vaccinated with Kolliphor® and vaccine plasmids. See example 2 for details.
- Fig. 12 Tumour volume reduction in mice vaccinated with Kolliphor® and vaccine plasmids. See example 3 for details
- Fig. 13 Diagram shows detection of C22 MHC I multimers.
- the graph shows the frequency of murine CD8+ T cells reactive with the C22 peptide-loaded MHCI tetramer upon vaccination of mice with experimental DNA vaccines. See example 3 for details.
- Fig. 14 IFN-y production in T cells from mice vaccinated with Kolliphor® and vaccine plasmids. See example 3 for details.
- Fig. 15 Illustration of DNA designs encoding the separate units of the fusion protein according to the invention. Illustrates the constructs of example 4.
- Fig. 16 Tumour volume reduction in mice vaccinated with Kolliphor® and vaccine plasmids. See example 4 for details
- Fig. 17 Diagram shows detection of C22 MHC I multimers.
- the graph shows the frequency of murine CD8+ T cells reactive with the C22 peptide-loaded MHCI tetramer upon vaccination of mice with experimental DNA vaccines. See example 4 for details.
- Fig. 18 DNA designs according to the invention.
- Fig. 19 Results from restimulation of splenic cells with 27 mer neopeptides.
- A Schematic depiction of constructs used for immunization.
- Fig. 20 Schematic representation of designs for selected APC targeting candidates.
- Fig. 21 Plasmid maps of pTVG4 based constructs A: Empty backbone vector.
- B Empty backbone vector with inserted Notl and BamHi restriction sites and murine CCL19 encoding sequence
- C Vector as in B, but with coding region for neoepitopes inserted between Notl and BamHI sites - this construct is also termed mEVX-03.
- Fig. 22 Schematic overview of DNA cassettes tested in Example 5.
- Fig 23 Graphs showing tumour growth in mice immunized with the constructs tested in Example 5.
- A Graph showing area under curve (AUC) for tumour volume in treated groups.
- Fig. 24 Graphs showing percentage of C22 specific CD8+ T cells in whole blood at days 2 (A) and day 6 (B) in treated groups from Example 5.
- Fig. 25 Plasmid map of mEVX-02 used for comparison in Example 6.
- Fig. 26 Graphs comparing tumour volumes in mice immunized with different doses of plasmid.
- A Immunization with mEVX-02.
- AUC Area-under-curve
- Fig. 27 Graphs showing dose titration of EVX-02 and -03.
- A Relative to tumour reduction.
- B Relative to AUC.
- Fig. 28 Graphs showing induction of CD8+ T cells in whole blood by EVX-02 and -03.
- Fig. 29 Graphs showing dose titration of EVX-02 and -03 relative to CD8 cell induction. A: On day 6 post challenge.
- a DNA neo-epitope immunotherapy containing an APC targeting element is expected to have superior anti-tumor effect and may elicit higher T cell responses, than a DNA technology without, due to either i) directing and assisting in APC uptake of the neo-epitopes, and/or ii) activation of the APC followed by cytokine cascade.
- the fusion polypeptide constructs according to the present invention comprise epitopes (neo epitopes), such as T cell epitopes that are not exhibited by non-neoplastic cells in the patient.
- epitopes such as T cell epitopes that are not exhibited by non-neoplastic cells in the patient.
- a "neo-epitope” is an antigenic determinant (typically an MHC Class I or II restricted epitope), which does not exist as an expression product from normal somatic cells in an individual due to the lack of a gene encoding the neo-epitope, but which exists as an expression product in mutated cells (such as cancer cells) in the same individual.
- a neo-epitope is from an immunological viewpoint truly non-self in spite of its autologous origin and it can therefore be characterized as a tumour specific antigen in the individual, where it constitutes an expression product.
- a neo-epitope Being non-self, a neo-epitope has the potential of being able to elicit a specific adaptive immune response in the individual, where the elicited immune response is specific for antigens and cells that harbour the neo-epitope.
- Neo-epitopes are on the other hand specific for an individual as the chances that the same neo-epitope will be an expression product in other individuals is minimal.
- tumour specific antigens the latter will typically be found in a plurality of cancers of the same type (as they can be expression products from activated oncogenes) and/or they will be present - albeit in minor amounts - in non-malignant cells because of over-expression of the relevant gene(s) in cancer cells.
- a “neo-peptide” is a peptide (i.e. a polyamino acid of up to about 50 amino acid residues), which includes within its sequence a neo-epitope as defined herein.
- a neo-peptide is typically "native", i.e. the entire amino acid sequence of the neo-peptide constitutes a fragment of an expression product that can be isolated from the individual, but a neo-peptide can also be “artificial”, meaning that it is constituted by the sequence of a neo-epitope and 1 or 2 appended amino acid sequences of which at least one is not naturally associated with the neo-epitope.
- the appended amino acid sequences may simply act as carriers of the neo-epitope, or may even improve the immunogenicity of the neo-epitope (e.g. by facilitating processing of the neo-peptide by antigen-presenting cells, improving biologic half-life of the neo-peptide, or modifying solubility).
- a "neo-antigen” is any antigen, which comprises a neo-epitope.
- a neo-antigen will be constituted by a protein, but a neo-antigen can, depending on its length, also be identical to a neo-epitope or a neo-peptide.
- amino acid sequence is the order in which amino acid residues, connected by peptide bonds, lie in the chain in peptides and proteins. Sequences are conventionally listed in the N to C terminal direction.
- the fusion polypeptide constructs according to the present invention further comprise at least one antigen presenting cell (APC) targeting unit.
- APC antigen presenting cell
- Antigen-presenting cells are cells that displays antigen complexed with major histocompatibility complexes (MHCs) on their cell surfaces, a process known as antigen presentation.
- Specialized antigen-presenting cells include macrophages, B cells and dendritic cells, which present foreign antigens to helper T cells, while virus-infected cells (or cancer cells) can present antigens originating inside the cell to cytotoxic T cells.
- An antigen presenting cell (APC) targeting unit is any molecule or ligand that is suitable for the specific targeting to these APC, such as by specifically targeting different surface molecules on APCs.
- Suitable targeting units to be used according to the invention includes the following as well as the corresponding human sequence:
- Suitable targeting units to be used according to the invention is disclosed in any one of Takashi Sato et al. Blood. 2011 Mar 24; 117(12): 3286-3293; Cagan Gurer et al. Blood. 2008 Aug 15; 112(4): 1231-1239; Wan-Lun Yan et al. Immunotherapy (2017) 9(4), 347- 360; Gerty Schreibelt et al. BLOOD, 8 MARCH 2012, VOLUME 119, NUMBER 10; and Zhongyi Yan et al. Oncotarget, Vol. 7, No. 26, May 2016, p. 40437.
- linker refers to any compound suitable for assembly of the two or more different or identical linear peptide sequences or subunits into a multimeric polypeptide.
- the term includes any linker found useful in peptide chemistry. Since the multimeric polypeptide or fusion polypeptide may be assembled or connected by standard peptide bonds in a linear way, the term linker also includes a "peptide spacer", also referred to as a "spacer”.
- linkers may be used both to separate encoded neo-epitopes in the fusion polypeptides of the invention, or linkers may be used to separate the neo-epitope units of the fusion polypeptide from the antigen presenting cell (APC) targeting unit of the fusion polypeptide.
- APC antigen presenting cell
- a linker may be "rigid”, meaning that it does substantially not allow the two amino acid sequences that it connects to move freely relative to each other. Likewise, a “flexible” linker allows the two sequences connected via the linker to move substantially freely relative to each other. In encoded expression products that contain more than one neo-epitope, both types of linkers are useful.
- Linkers of interest which can be encoded by an expression vector used in the invention, are listed in the following table:
- the linker is a peptide sequence.
- the linker is not a peptide sequence.
- the linker is not a branched peptide sequence.
- the linker does not itself contain a peptide sequence derived from or identical to the neo-epitope sequence and/or the antigen presenting cell (APC) targeting unit.
- APC antigen presenting cell
- the linker is derived from an immunoglobulin molecule (Ig), such as from IgG.
- Ig immunoglobulin molecule
- the linker is or comprises a hinge region, such as a flexible hinge region, such as a hinge region derived from an immunoglobulin molecule (Ig), such as from IgG.
- a hinge region such as a flexible hinge region, such as a hinge region derived from an immunoglobulin molecule (Ig), such as from IgG.
- Ig immunoglobulin molecule
- the linker comprises or consists of a hinge region derived from IgM, and/or comprises or consists of a dimerization motif derived from a sequence encoded by SEQ ID NO:51.
- the linker comprises or consists of a trimerisation domain, such as a Collagen trimerisation domain, such as a trimerisation domain derived from a sequence encoded by SEQ ID NO:52.
- the linker comprises or consists of a dimerization motif derived from hMHD2 or dHXL, optionally further comprising a hinge region such as HI described herein.
- the linker comprises or consists of a tetramerization domain, such as a domain derived from p53, such as a tetraimerization domain derived from a sequence encoded by SEQ ID NO:53, optionally further comprising a hinge region such as HI described herein.
- Suitable linkers to be used according to the invention is also described in any one of: Ana Alvarez-Cienfuegos et al, Scientific Reports 2016, 6:28643
- An immunogenic carrier or “pharmaceutically acceptable carrier” as used herein is a molecule or moiety to which an immunogen or a hapten can be coupled in order to enhance or enable the elicitation of an immune response against the immunogen/hapten.
- Immunogenic carriers are in classical cases relatively large molecules (such as tetanus toxoid, KLH, diphtheria toxoid etc.) which can be fused or conjugated to an immunogen/hapten, which is not sufficiently immunogenic in its own right - typically, the immunogenic carrier is capable of eliciting a strong T-helper lymphocyte response against the combined substance constituted by the immunogen and the immunogenic carrier, and this in turn provides for improved responses against the immunogen by B-lymphocytes and cytotoxic lymphocytes. More recently, the large carrier molecules have to a certain extent been substituted by so-called promiscuous T-helper epitopes, i.e. shorter peptides that are recognized by a large fraction of HLA haplotypes in a population, and which elicit T-helper lymphocyte responses.
- promiscuous T-helper epitopes i.e. shorter peptides that are recognized by a large fraction of HLA haplotypes in a population, and
- T-helper lymphocyte response is an immune response elicited on the basis of a peptide, which is able to bind to an MHC class II molecule (e.g. an HLA class II molecule) in an antigen-presenting cell and which stimulates T-helper lymphocytes in an animal species as a consequence of T-cell receptor recognition of the complex between the peptide and the MHC Class II molecule presenting the peptide.
- MHC class II molecule e.g. an HLA class II molecule
- immunogen is a substance of matter which is capable of inducing an adaptive immune response in a host, whose immune system is confronted with the immunogen.
- immunogens are a subset of the larger genus "antigens", which are substances that can be recognized specifically by the immune system (e.g. when bound by antibodies or, alternatively, when fragments of the antigens bound to MHC molecules are being recognized by T-cell receptors) but which are not necessarily capable of inducing immunity - an antigen is, however, always capable of eliciting immunity, meaning that a host that has an established memory immunity against the antigen will mount a specific immune response against the antigen.
- a "hapten” is a small molecule, which can neither induce or elicit an immune response, but if conjugated to an immunogenic carrier, antibodies or TCRs that recognize the hapten can be induced upon confrontation of the immune system with the hapten carrier conjugate.
- An “adaptive immune response” is an immune response in response to confrontation with an antigen or immunogen, where the immune response is specific for antigenic determinants of the antigen/immunogen - examples of adaptive immune responses are induction of antigen specific antibody production or antigen specific induction/activation of T helper lymphocytes or cytotoxic lymphocytes.
- a "protective, adaptive immune response” is an antigen-specific immune response induced in a subject as a reaction to immunization (artificial or natural) with an antigen, where the immune response is capable of protecting the subject against subsequent challenges with the antigen or a pathology-related agent that includes the antigen.
- prophylactic vaccination aims at establishing a protective adaptive immune response against one or several pathogens.
- Stimulation of the immune system means that a substance or composition of matter exhibits a general, non-specific immunostimulatory effect.
- a number of adjuvants and putative adjuvants (such as certain cytokines) share the ability to stimulate the immune system.
- the result of using an immunostimulating agent is an increased "alertness" of the immune system meaning that simultaneous or subsequent immunization with an immunogen induces a significantly more effective immune response compared to isolated use of the immunogen.
- polypeptide is in the present context intended to mean both short peptides of from 2 to 50 amino acid residues, oligopeptides of from 50 to 100 amino acid residues, and polypeptides of more than 100 amino acid residues. Furthermore, the term is also intended to include proteins, i.e. functional biomolecules comprising at least one polypeptide; when comprising at least two polypeptides, these may form complexes, be covalently linked, or may be non-covalently linked.
- the polypeptide(s) in a protein can be glycosylated and/or lipidated and/or comprise prosthetic groups.
- fusion polypeptide is in the present context intended to mean a polypeptide containing polypeptide elements or amino acid sequences having intended different functions.
- the different polypeptide elements or amino acid sequences are connected through a linker, which may be just another amino acid sequence, or the different polypeptide elements or amino acid sequences of the fusion polypeptide may just be connected by standard peptide bonds in a linear way.
- the expression vector used according to the present invention is typically and preferably comprised in or constituted by a plasmid, but other expression vectors can be employed.
- the composition of the present invention aims at ensuring delivery of "naked" DNA to cells, i.e.
- a vector useful in the present compositions and methods can thus be circular or linear, single-stranded or double stranded and can in addition to a plasmid also be e.g. a cosmid, mini-chromosome or episome.
- Each coding (and expressible) region can be present on the same or on separate vectors; however, it is to be understood that one or more coding regions can be present on a single vector, and these coding regions can be under the control of a single or multiple promoters.
- the expression vector can encode a separate peptide expression product for each encoded fusion polypeptide or that the expression vector can encode a plurality of peptide expression products, where at least some exhibit(s) several encoded fusion polypeptide, of which at least some optionally are separated by peptide linkers.
- the expression vector expresses at least or about 5, such as at least or about 10, at least or about 15, at least or about 20, at least or about 25, at least or about 30 proteinaceous expression products.
- peptide linkers to separate encoded neo-epitope expression products provides spatial separation between epitopes in the expression product of the fusion polypeptide. This can entail several advantages: linkers can ensure that each neo-epitope is presented in an optimized configuration to the immune system, but use of appropriate linkers can also minimize the problem that irrelevant immune responses are directed against "junctional epitopes" which emerge in the regions constituted by the C-terminal end of one neo-epitope and the adjacent N-terminal end of the next neo-epitope in a multi-epitope containing expression product. Encoded peptide linkers can be either "flexible” or "rigid", cf.
- linker(s) used in the invention in some embodiments can be cleavable, that is, include (a) recognition site(s) for endopeptidase(s), e.g. endopeptidases such as furin, caspases, cathepsins etc.
- the neo-epitopes encoded by the expression vector can be identified in a manner known per se: "deep sequencing" of the genome of the malignant cells and of the genome of healthy cells in the same individual or a standard healthy genome can identify expressed DNA sections that provide for potentially immunogenic expression products unique to the malignant cells.
- the identified DNA sequences can thereafter be codon-optimized (typically for expression by human cells) and included in the expression vector - either as separate expression regions of as part of larger chimeric constructs.
- any of the prediction methods available for this purpose are in practice useful.
- One example of a state of the art prediction algorithm is NetMHCpan-4.0 (www.cbs.dtu.dk/services/NetMHCpan-4.0/; Jurtz V et al., J Immunol (2017), jil700893;
- a peptide-MHC Class II interaction prediction method is also disclosed in a recent publication Garde C et al., Immunogenetics, DOI: doi.org/10.1007/s00251-019-01122-z.
- naturally processed peptides eluted from MHC Class II are used as part of the training set and assigned the binding target value of 1 if verified as ligands and 0 if negative.
- ANNs artificial neural networks
- Quantification of non-linear correlations is not an easy task, since it is difficult to calculate by simple calculation. This is primarily due to non-linear correlations described with more parameters than linear correlations and probably first appear when all features are considered collectively. Hence it is needed to take all features into account in order to catch the dependency across features.
- nucleic acid vaccine vectors that include optimized recombinant polynucleotides can be delivered to a human to induce a therapeutic or prophylactic immune response.
- Plasmid and other DNA vectors are typically more efficient for gene transfer to muscle tissue.
- the potential to deliver DNA vectors to mucosal surfaces by oral administration has also been reported and DNA plasmids have been utilized for direct introduction of genes into other tissues than muscle.
- DNA vaccines have been introduced into animals primarily by intramuscular injection, by gene gun delivery, by jet injection (using a device such as a Stratis® device from PharmaJet), or by electroporation; each of these modes of administration apply to the presently disclosed method.
- the plasmids After being introduced, the plasmids are generally maintained episomally without replication. Expression of the encoded proteins has been shown to persist for extended time periods, providing stimulation of both B and T cells.
- the physician evaluates vector toxicities, progression of the cancer to be treated, and the production of anti-vector antibodies, if any.
- Administration can be accomplished via single or divided doses and typically as a series of time separated administrations.
- the effective human dose per immunization in a time-separated series is between 0.1 ⁇ g and 500 mg, with dosages between 0.1 ⁇ g and 25 mg of the expression vector being preferred.
- dosages of between 0.5 ⁇ g and 20 mg in humans are typically used, and dosages are normally between 5 ⁇ g and 15 mg, between 50 ⁇ g and 10 mg, and between 500 ⁇ g and 8 mg, and particular interesting dosages are of about 0.0001, about 0.0005, about 0.001, about 0.005, about 0.01, about 0.05, about 0.1, about 0.5, about 1, about 2, about 3, about 4, about 5, about 6, about 7 and about 8 mg.
- a series of immunizations with effective dosages will typically constitute a series of 2, 3, 4, 5, 6, or more dosages. Multiple (e.g. >6) dosages may for instance be relevant in order to keep a malignant neoplasm in check for a prolonged period and in such a situation the exact choice of encoded neo-epitopes in the vaccine vector can be changed over time in response to changes in the genome and proteome of the malignant cells. When and if new neo epitopes are produced by the malignant cells these can conveniently be included as targets for the vaccine.
- the vaccine used in the method disclosed herein comprises one or more expression vectors; for instance, the vaccine may comprise a plurality of expression vectors each capable of autonomous expression of a nucleotide coding region in a mammalian cell to produce at least one immunogenic polypeptide.
- An expression vector often includes a eukaryotic promoter sequence, such as the nucleotide sequence of a strong eukaryotic promoter, operably linked to one or more coding regions.
- the compositions and methods herein may involve the use of any particular eukaryotic promoter, and a wide variety are known; such as a CMV or RSV promoter.
- the promoter can be heterologous with respect to the host cell.
- the promoter used may be a constitutive promoter.
- the promoter used may include an enhancer region and an intron region to improve expression levels, such as is the case when using a CMV promoter.
- nucleic acid vaccines Numerous plasmids known in the art may be used for the production of nucleic acid vaccines. Suitable embodiments of the nucleic acid vaccine employ constructs using the plasmids VR1012 (Vical Inc., San Diego Calif.), pCMVI.UBF3/2 (S. Johnston, University of Texas), pTVG4 (Johnson et al., 2006, Vaccine 24(3); 293-303), pVAXl (Thermo Fisher Scientific, see above and the Examples below), or pcDNA3.1 (InVitrogen Corporation, Carlsbad, Calif.) as the vector.
- VR1012 Vical Inc., San Diego Calif.
- pCMVI.UBF3/2 S. Johnston, University of Texas
- pTVG4 Johnson et al., 2006, Vaccine 24(3); 293-303
- pVAXl Thermo Fisher Scientific, see above and the Examples below
- pcDNA3.1 InVitrogen Corporation, Carlsbad
- the vector construct can according to the present invention advantageously contain immunostimulatory sequences (ISS).
- ISS immunostimulatory sequences
- the aim of using such sequences in the vaccine vector is to enhance T-cell response towards encoded neo-epitopes, in particular Thl cell responses, which are elicited by adjuvants that incorporate agonists of the toll-like receptors TLR3, TLR7-TLR8, and TLR9. and/or cytosolic RNA receptors such as, but not limited to, RIG- 1, MDA5 and LGP2 (Desmet et al. 2012. Nat. Rev. Imm. 12(7), 479-491)
- ISS is to mimic a bacterial infection activating TLR9 by stimulating with unmethylated CG-rich motifs (so-called CpG motifs) of six bases with the general sequence NNCGNN (which have a 20-fold higher frequency in bacterial DNA than in mammalian DNA) either as directly administered small synthetic DNA oligos (ODNs), which contain partially or completely phosphorothioated backbones, or by incorporating the CpG motifs in the DNA vector backbone.
- CpG motifs unmethylated CG-rich motifs
- NNCGNN which have a 20-fold higher frequency in bacterial DNA than in mammalian DNA
- ODNs directly administered small synthetic DNA oligos
- Immunostimulatory CpGs can be part of the DNA backbone or be concentrated in an ISS where the CpG sequence(s) typically will be positioned between the stop codon in the neo-epitope coding sequence and the poly-A tail encoding sequence (i.e. the ISS is located between the stop codon and the polyadenylation signal).
- the CpG sequences exert an effect irrespectively of their position in a longer DNA molecule, their position could in principle be anywhere in the vaccine vector as long as the presence of the CpG motif does not interfere with the vector's ability to express the coding regions of the vaccine antigen.
- CpG motif containing oligonucleotides are typically to be co administered/formulated together with the DNA vaccine by the selected delivery technology and will typically constitute hexamers or longer multimers of DNA comprising the sequence NNCGNN or the reverse complementary sequence.
- Useful ODNs for this purpose are e.g. commercially available from InivoGen, 5 Rue Jean Rodier, F-31400, Toulouse, France, which markets a range of Class A, B, and C ODNs. Examples are:
- ODN1585 (5'-ggGGTCAACGTTGAgggggg-3'), SEQ ID NO: 14
- ODN2216 (5'-ggGGGACGATCGTCgggggg-3') , SEQ ID NO: 15
- ODN2336 (5'- gggGACGACGTCGTGgggggg -3'), SEQ ID NO: 16
- ODN1668 (5'-tccatgacgttcctgatgct-3'), SEQ ID NO: 17
- ODN1826 (5'-tccatgacgttcctgacgtt-3'), SEQ ID NO: 18
- ODN2007 (5'- tcgtcgttgtcgttttgtcgtcgtcgtcgttttgtcgttt -3'), SEQ ID NO:20
- ODNBW006 (5'-tcgacgttcgtcgttcgtcgtcgtcgtttcgtttc-3'), SEQ ID NO:21
- ODN D-SL01 (5'-tcgcgacgttcgcccgacgttcggta-3'), SEQ ID NO:22
- ODN2395 (5'-tcgtcgttttcggcgcgcgcccg-3'), SEQ ID NO:23
- ODN M362 (5'-tcgtcgtcgttcgttcgaacgacgttgat-3'), SEQ ID NO:24
- ODN D-SL03 (5'-tcgcgaacgttcgccgcgttcgaacgcgg-3'), SEQ ID NO:25
- upper case nucleotides are phosphodiesters
- lower case nucleotides are phosphorothioates
- underlining denotes palindromic sequences.
- any number of possible NNGCNN or NNCGNN sequences can according to the invention be present, either as identical sequences or in the form of non-identical sequences of the CpG motif, or in the form of palindromic sequences that can form stem-loop structures.
- the following CpG motifs are of interest: AACGAC and GTCGTT, but also CTCGTT, and GCTGTT.
- An example of the use of such CpG encoding sequences is the following sequence excerpt from the commercially available pTVG4 vaccine vector backbone
- RNA molecules can be encoded in the DNA vector backbone, which will be transcribed into RNA after vaccination - in this case the DNA vaccine hence encodes the immunological adjuvant.
- This approach can include DNA sequences that encode hairpin RNA with lengths of up to 100 base pairs, where the sequence is unspecific. Also the DNA can simultaneously include ODNs and encode ORNs of known sequences; the DNA can thus both be transcribed into a double stranded RNA capable of activating TLR3 and/or cytosolic RNA receptors such as RIG-1, MDA5, and LGP2 while comprising an ODN to activate TLR9.
- DNA sequences that include/encode immune stimulating CpG and dsRNA are for instance 5'-GGTGCATCGA TGCAGGGGGG-3' (SEQ ID NO:27) and 5'-GGTGCATCGA TGCAGGGGGG TATATATATA TTGAGGACAG GTTAAGCTCC CCCCAGCTTA ACCTGTCCTT CAATATATA TATA-3' (SEQ ID NO:28) (ref: Wu et al.2011, Vaccine 29(44): 7624-30).
- ISS When ISS are present in the DNA vaccine vector, it is possible - and advantageous - to combine the approach of using CpG motifs to activate TLR9 with the presence of coding sequences for immune stimulating RNA to activate TLR3 and /or cytosolic RNA receptors such as RIG-1, MDA5, and LGP2; cf. Grossmann C et al. 2009, BMC. Immunology 10:43 and Desmet et al. 2012. Nat. Rev. Imm. 12(7), 479-491. Likewise, incorporation of ORNs and ODNs in the vaccine as separate adjuvants (alone or in combination) may be combined with the incorporation of ISS of both types in the DNA vaccine vector.
- the DNA encoding the immune stimulatory RNA ISS will preferably be present between the stop codon and the polyadenylation signal but can be present in any part of the vector as long as this does not impair the production of the intended polypeptide expression product.
- ISS is/are comprised in the vaccine compositions, and in particular embodiments this is achieved by incorporating an immunologically active and pharmaceutically acceptable amount of poly I:C and/or poly IC:U12.
- Poly I:C is constituted by a mismatched double-stranded RNA (dsRNA) with one strand being a polymer of inosinic acid and the other strand a polymer of cytidylic acid.
- Poly IC:U12 is a variant of poly I:C where uridine is introduced into the Poly I:C strand.
- uridine is introduced into the Poly I:C strand.
- These two substances will in that context function as immunological adjuvants, i.e. substances that themselves do not elicit a specific adaptive immune response, but which enhances the specific adaptive immune response against the vaccine antigen (or in the present case, the encoded antigen).
- Poly I:C or poly IC:U12 (such as Ampligen®) will preferably be present in the composition so as to arrive at an administered dosage of between 0.1 and 20 mg per administration of the effective dosage of the expression vector; that is, the amount present in the composition is adjusted so as to arrive at such dosages per administration.
- the administered dosage of poly I:C or poly IC:U12 is between 0.2 and 15 mg per administration of the effective dosage of the expression vector, such as between 0.3 and 12, 0.4 and 10 and 0.5 and 8 mg, preferably about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7,
- the vaccine composition may comprise a amphiphilic block co polymers comprising blocks of poly(ethylene oxide) and polypropylene oxide), such as poloxamers, i.e. nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)).
- poloxamers i.e. nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)).
- poloxamers i.e. nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)).
- poloxamer 188 Kerphor® P188 from BASF.
- the administered dosage of amphiphilic block co-polymers may be between 0.2% w/v and 20% w/v per administration of the effective dosage of the expression vector, such as between 0.2% w/v and 18% w/v, such as between 0.2% w/v and 16% w/v, such as between 0.2% w/v and 14% w/v, such as between 0.2% w/v and 12% w/v, such as between 0.2% w/v and 10% w/v, such as between 0.2% w/v and 8% w/v, such as between 0.2% w/v and 6% w/v, such as between 0.2% w/v and 4% w/v, such as between 0.4% w/v and 18% w/v, such as between 0.6% w/v and 18% w/v, such as between 0.8% w/v and 18% w/v, such as between 1% w/v and 18% w/v, such as between 2% w/v and 18
- the vaccine composition according to the present invention such as a DNA vaccine composition may comprises a pharmacologically acceptable amphiphilic block co polymer comprising blocks of poly(ethylene oxide) and polypropylene oxide, which is described in detail in the following:
- amphiphilic block co-polymer is described more generally under the definition heading, but the preferred the amphiphilic block co-polymer is a poloxamer or a poloxamine. Poloxamers only vary slightly with respect to their properties, but preferred are poloxamer 407 and 188, in particular poloxamer 188.
- the amphiphilic block co-polymer is poloxamine
- the preferred type is a sequential poloxamine of formula (PEO-PPO)4-ED, where PEO is poly(ethylene oxide), PPO is polypropylene oxide) and ED is an ethylenediaminyl group.
- PEO-PPO poly(ethylene oxide)
- PPO polypropylene oxide
- ED is an ethylenediaminyl group.
- PEO-PPO poly(ethylene oxide)
- PPO polypropylene oxide
- ED is an ethylenediaminyl group.
- Particularly preferred poloxamines are those marketed under the registered trademarks Tetronic® 904, 704, and 304, respectively.
- Tetronic® 904 has a total average molecular weight of 6700, a total average weight of PPO units of 4020, and a PEO percentage of about 40%.
- Tetronic® 704 has a total average molecular weight of 5500, a total average weight of PPO units of 3300, and a PEO percentage of about 40%; and Tetronic® 304 has a total average molecular weight of 1650, a total average weight of PPO units of 990, and a PEO percentage of about 40%.
- the concentration of the amphiphilic block co polymer in the vaccine composition may preferably between 2 and 5% w/v, such as about 3% w/v.
- a “PEO-PPO” or amphiphilic block co-polymer” as used herein is a linear or branched co polymer comprising or consisting of blocks of poly(ethylene oxide) (“PEO”) and blocks of polypropylene oxide) (“PPO”).
- PEO-PPO amphiphilic block co polymers have the general structures PEO-PPO-PEO ("poloxamers”), PPO PEO PPO, (PEO PPO-)4ED (a "poloxamine”), and (PPO PEO-)4ED (a "reverse poloxamine”), where "ED” is a ethylenediaminyl group.
- a “poloxamer” is a linear amphiphilic block copolymer constituted by one block of poly(ethylene oxide) (“PEO") coupled to one block of polypropylene oxide) (“PPO”) coupled to one block of PEO, i.e. a structure of the formula EOa-POb-EOa, where EO is ethylene oxide, PO is propylene oxide, a is an integer ranging between 2 and 130, and b is an integer ranging between 15 and 67.
- Poloxamers are conventionally named by using a 3-digit identifier, where the first 2 digits multiplied by 100 provides the approximate molecular mass of the PPO content, and where the last digit multiplied by 10 indicates the approximate percentage of PEO content.
- Polyxamer 188 refers to a polymer comprising a PPO block of MW!»1800 (corresponding to b ⁇ 31 PPO) and approximately 80% (w/w) of PEO (corresponding to a ⁇ 82).
- the values are known to vary to some degree, and commercial products such as the research grade Lutrol® F68 and the clinical grade Kolliphor® P188, which according to the producer's data sheets both are Poloxamer 188, exhibit a large variation in molecular weight (between 7,680 and 9,510) and the values for a and b provided for these particular products are indicated to be approximately 79 and 28, respectively. This reflects the heterogeneous nature of the block co-polymers, meaning that the values of a and b are averages found in a final formulation.
- a "poloxamine” or “sequential poloxamine” (commercially available under the trade name of Tetronic®) are X-shaped block copolymers that bear four PEO-PPO arms connected to a central ethylenediamine via bonds between the free OH groups in the PEO-PPO- groups and the primary amine groups in ethylenediamine, and "reverse poloxamine are likewise X- shaped block copolymers that bear four PPO-PEO arms connected to a central ethylenediamine via bonds between the free OH groups in the PPO-PEO- groups and the primary amine groups in ethylenediamine.
- the nucleic acid vaccine can also encode a fusion product containing one or more immunogenic polypeptides containing neo-epitopes.
- Plasmid DNA can also be delivered using attenuated bacteria as delivery system, a method that is suitable for DNA vaccines that are administered orally. Bacteria are transformed with an independently replicating plasmid, which becomes released into the host cell cytoplasm following the death of the attenuated bacterium in the host cell.
- DNA vaccines including the DNA encoding the desired antigen, can be introduced into a host cell in any suitable form including, the fragment alone, a linearized plasmid, a circular plasmid, a plasmid capable of replication, an episome, RNA, etc.
- the gene is contained in a plasmid.
- the plasmid is an expression vector. Individual expression vectors capable of expressing the genetic material can be produced using standard recombinant techniques.
- Routes of administration include, but are not limited to, intramuscular, intranasal, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as topically, transdermally, by inhalation or suppository or to mucosal tissue such as by lavage to vaginal, rectal, urethral, buccal and sublingual tissue.
- the route of administration can be selected from any one of parenteral routes, such as via the intramuscular route, the intradermal route, transdermal route, the subcutaneous route, the intravenous route, the intra-arterial route, the intrathecal route, the intramedullary route, the intrathecal route, the intraventricular route, the intraperitoneal, the intranasal route, the vaginal route, the intraocular route, or the pulmonary route; is administered via the oral route, the sublingual route, the buccal route, or the anal route; or is administered topically.
- parenteral routes such as via the intramuscular route, the intradermal route, transdermal route, the subcutaneous route, the intravenous route, the intra-arterial route, the intrathecal route, the intramedullary route, the intrathecal route, the intraventricular route, the intraperitoneal, the intranasal route, the vaginal route, the intraocular route, or the pulmonary route; is administered via the oral route, the sublingual route
- Typical routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection.
- Genetic constructs may be administered by means including, but not limited to, traditional syringes, needleless injection devices, "microprojectile bombardment gene guns", or other physical methods such as electroporation ("EP”), "hydrodynamic method", or ultrasound.
- DNA vaccines can be delivered by any method that can be used to deliver DNA as long as the DNA is expressed and the desired antigen is made in the cell.
- a DNA vaccine composition disclosed herein is delivered via or in combination with known transfection reagents such as cationic liposomes, fluorocarbon emulsion, cochleate, tubules, gold particles, biodegradable microspheres, or cationic polymers.
- Cochleate delivery vehicles are stable phospholipid calcium precipitants consisting of phosphatidyl serine, cholesterol, and calcium; this nontoxic and noninflammatory transfection reagent can be present in a digestive system.
- Biodegradable microspheres comprise polymers such as poly(lactide-co-glycolide), a polyester that can be used in producing microcapsules of DNA for transfection.
- Lipid-based microtubes often consist of a lipid of spirally wound two layers packed with their edges joined to each other.
- the nucleic acid can be arranged in the central hollow part thereof for delivery and controlled release into the body of an animal.
- a DNA vaccine can also be delivered to mucosal surfaces via microspheres.
- Bioadhesive microspheres can be prepared using different techniques and can be tailored to adhere to any mucosal tissue including those found in eye, nasal cavity, urinary tract, colon and gastrointestinal tract, offering the possibilities of localized as well as systemic controlled release of vaccines.
- Application of bioadhesive microspheres to specific mucosal tissues can also be used for localized vaccine action.
- an alternative approach for mucosal vaccine delivery is the direct administration to mucosal surfaces of a plasmid DNA expression vector which encodes the gene for a specific protein antigen.
- the DNA plasmid vaccines disclosed are formulated according to the mode of administration to be used.
- the DNA plasmid vaccines are injectable compositions, they are sterile, and/or pyrogen free and/or particulate free.
- an isotonic formulation is preferably used.
- additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
- isotonic solutions such as phosphate buffered saline are preferred; one preferred solution is Tyrode's buffer.
- stabilizers include gelatine and albumin.
- a stabilizing agent that allows the formulation to be stable at room or ambient temperature for extended periods of time, such as LGS or other poly-cations or poly-anions is added to the formulation.
- the second constituent in the composition disclosed herein is the pharmaceutically acceptable carrier, diluent, or excipient, which is preferably in the form of a buffered solution.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose and sodium chloride, lactated Ringer's or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like.
- Preservatives and antimicrobials include antioxidants, chelating agents, inert gases and the like.
- Preferred preservatives include formalin, thimerosal, neomycin, polymyxin B and amphotericin B.
- the buffered solution is the one known as "Tyrode's buffer", and in preferred embodiments the Tyrode's buffer has the composition 140 mM NaCI, 6 mM KCI,
- the concentration of the Tyrode's buffer (or alternatives) is typically about 35% v/v, but depending on the water content of suspended plasmids, the concentration may vary considerably - since the buffer is physiologically acceptable, it can constitute any percentage of the aqueous phase of the composition.
- the buffered solutions is the PBS, and in preferred embodiments the PBS has composition of composition 0.28mg Potassium dihydrogen phosphate, 1.12 mg Disodium hydrogen phosphate dihydrate and 9.0 Sodium chloride per 1 ml solution.
- Additional carrier substances may be included and can contain proteins, sugars, etc.
- Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous carriers are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline.
- the present invention relates to fusion polypeptide comprising i) at least one antigenic unit, which comprises a sequence of amino acids of at least one neo-epitope of the patient's neoplastic cells; ii) at least one antigen presenting cell (APC) targeting unit; iii) optionally a multimerization, such as a dimerization unit, which unit provides for the multimerization of said fusion polypeptide to comprise two or more antigenic units and two or more antigen presenting cell (APC) targeting units.
- at least one antigenic unit which comprises a sequence of amino acids of at least one neo-epitope of the patient's neoplastic cells
- APC antigen presenting cell
- optionally a multimerization such as a dimerization unit, which unit provides for the multimerization of said fusion polypeptide to comprise two or more antigenic units and two or more antigen presenting cell (APC) targeting units.
- the APC targeting unit consist of or comprises an antibody binding region with specificity for target surface molecules on antigen presenting cells, such as HLA, HLA-DP, CD14, CD40; or Toll-like receptor, such as Toll-like receptor 2; ligands, such as soluble CD40 ligand; CLEC9A Fv fragments, DEC205 Fv fragments, GM-CSF, natural ligands like chemokines, such as a chemokine of the CC chemokine family, such as any one selected from chemokine ligand 3, chemokine ligand 4, chemokine ligand 5, chemokine ligand 19, chemokine ligand 20, chemokine ligand 21, or similar; or a chemokine of the CXC chemokine family, such as any one selected from chemokine (C-X-C motif) ligand 1 (CXCL1), or similar, RANTES or bacterial antigens, such as flagellin or a part
- the APC targeting unit consist of or comprises a ligand, such as soluble CD40 ligand; CLEC9A peptide ligand, DEC205 ligand, FLT3L, GM-CSF, natural ligands like chemokines, such as a chemokine of the CC chemokine family, such as any one selected from chemokine ligand 3, chemokine ligand 4, chemokine ligand 5, chemokine ligand 19, chemokine ligand 20, chemokine ligand 21, or similar; or a chemokine of the CXC chemokine family, such as any one selected from chemokine (C-X-C motif) ligand 1 (CXCL1), or similar, such as RANTES or Chemokine ligand 3 (CCL3/MIP-la) or CCL19; or bacterial antigens, such as flagellin or a part thereof.
- chemokines such as a chemokine of the CC
- the antigenic unit is connected to the targeting unit through a linker, such as GS linker, such as linker with the amino acid sequence GSGSGSGSGS (SEQ ID NO: 13), or a linker derived from an immunoglobulin molecule (Ig), such as IgG, such as a linker which contributes to the multimerization through the formation of an interchain covalent bond.
- this linker is or comprises a hinge region, such as an Ig, such as an IgG-derived hinge region and contributes to the multimerization through the formation of an interchain covalent bond, such as a disulfide bridge.
- this linker comprises a carboxyterminal C domain (CH3 domain), such as the carboxyterminal C domain of Ig (Cy3 domain), or a sequence that is substantially homologous to said C domain, such as the CH3 domain of IgG3.
- this hinge and CH3 domain are connected by a sequence of amino acids GlyGlyGlySerSer (SEQ ID NO:66), such as in triplicate sequence of the amino acids GlyGlyGlySerSer.
- this linker comprises a dimerization motif or any other multimerization domain, which participate in the multimerization through hydrophobic interactions, such as through a CH3 domain.
- this linker comprises a hinge region comprising hl + h4 or h4 derived from IgG, such as an IgG2 or IgG3.
- the at least one antigenic unit consist of or comprises at least or about 5, such as at least or about 10, at least or about 15, at least or about 20, at least or about 25, and at least or about 30 neo-epitopes.
- the at least one neo-epitope includes a neo-epitope, which exhibits an MHC binding stability, which is above average, such as in the top quartile, among neo epitopes identified in the neoplastic cells.
- the multimerization such as a dimerization unit, enables the formation of dimers, trimers, tetramers, pentamers, or multimers of higher order.
- the present invention further relates to an expression vector, which comprises a sequence of nucleotides encoding a fusion polypeptide of the invention.
- sequence of nucleotides is a cDNA sequence.
- sequence of nucleotides is an RNA sequence encoding the fusion polypeptide of the invention.
- the sequence further comprises or encodes at least one immune stimulating sequence (ISS).
- ISS is an oligodeoxyribonucleotide (ODN) comprising at least one CpG motif, and wherein the ODN preferably includes phosphorothioate groups.
- ODN oligodeoxyribonucleotide
- the ISS is or comprises an oligoribonucleotide.
- sequence further comprises a secretion signal.
- the present invention further relates to system of at least two expression constructs comprising i) a first expression construct comprising a sequence of nucleotides encoding at least one antigenic unit, which antigenic unit comprises a sequence of amino acids of at least one neo-epitope of the patient's neoplastic cells, and ii) a second expression construct comprising a sequence of nucleotides encoding at least one antigen presenting cell (APC) targeting unit.
- APC antigen presenting cell
- the first expression construct comprising a sequence of nucleotides encoding at least one antigenic unit consist of or comprises at least or about 5, such as at least or about 10, at least or about 15, at least or about 20, at least or about 25, and at least or about 30 neo-epitopes.
- the first expression construct comprising a sequence of nucleotides encoding least one neo-epitope, which includes a neo-epitope, which exhibits an MHC binding stability, which is above average, such as in the top quartile, among neo-epitopes identified in the neoplastic cells.
- the second expression construct comprises a sequence of nucleotides encoding at least one antigen presenting cell (APC) targeting unit which consist of or comprises an antibody binding region with specificity for target surface molecules on antigen presenting cells, such as HLA, HLA-DP, CD14, CD40; or Toll-like receptor, such as Toll-like receptor 2; ligands, such as soluble CD40 ligand; CLEC9A Fv fragment, DEC205 Fv fragment, natural ligands like chemokines, such as a chemokine of the CC chemokine family, such as any one selected from chemokine ligand 3, chemokine ligand 4, chemokine ligand 5, chemokine ligand 19, chemokine ligand 20, chemokine ligand 21, or similar; or a chemokine of the CXC chemokine family, such as any one selected from chemokine (C-X-C motif) ligand 1 (CXCL1), or similar,
- the second expression construct comprises a sequence of nucleotides encoding at least one antigen presenting cell (APC) targeting unit which consist of or comprises a ligand, such as soluble CD40 ligand; CLEC9A peptide ligand, DEC205, FLT3L, GM-CSF, natural ligands like chemokines, such as a chemokine of the CC chemokine family, such as any one selected from chemokine ligand 3, chemokine ligand 4, chemokine ligand 5, chemokine ligand 19, chemokine ligand 20, chemokine ligand 21, or similar; or a chemokine of the CXC chemokine family, such as any one selected from chemokine (C-X-C motif) ligand 1 (CXCL1), or similar, such as RANTES or Chemokine ligand 3 (CCL3/MIP-la) or CCL19; or bacterial antigens, such as flag
- the first expression construct comprising a sequence of nucleotides encoding at least one antigenic unit further comprises a sequence of nucleotides encoding a multimerization, such as a dimerization unit, which unit provides for the multimerization of said at least one antigenic unit.
- the at least two expression constructs is expressed on the same expression vector, such as under the control of two different promotors.
- the at least two expression constructs is expressed by at least two different vectors.
- the objectives of the study were to test the ability of the invention, an APC targeting DNA vaccine, to induce neo-peptide specific T cells, reduce tumor growth and to monitor the impact of the vaccine on the wellbeing of vaccinated mice.
- Plasmids for DNA vaccination were based on the commercially available pUMVC4TM vector available from Aldevron.
- pUMVC4TM is according to the manufacturer's documentation a 4479 kb plasmid vector, which allows high-copy number replication in E. coli and high-level transient expression of encoded protein of interest in most mammalian cells.
- the vector (see Fig. 4) contains the following elements:
- CMV human cytomegalovirus immediate-early
- an immunostimulatory sequence from ampicillin resistance gene, which makes it ideal for eliciting an immune response in vivo
- the entire sequence of the pUMVC4TM plasmid is set forth in SEQ ID NO:29.
- the five S16A neoepitopes were first identified by whole exome sequencing of the mouse colon cancer cell line CT26 and normal tissue samples from BALB/c mice and by selecting peptides found only in the cancer cells. In the experiment, the ability of the mice to generate immune responses against the identified neoepitopes was evaluated.
- pUMVC4 APC-targeting S16A was constructed by ligating a DNA insert containing an APC targeting unit (SEQ IDs 36-43), human IgG3 hinge 1, hinge 4 and CH3 domain (SEQ ID NO:31, 32 and 34) and codon-optimized (for expression in mice) DNA encoding a peptide containing the sequentially coupled 5 neo-epitopes C22, C23, C25, C30, and C38 (SEQ ID NOs: 61-65) into the pUMVC4 expression cassette, see Fig. 5.
- SEQ IDs 36-43 APC targeting unit
- human IgG3 hinge 1, hinge 4 and CH3 domain SEQ ID NO:31, 32 and 34
- codon-optimized for expression in mice
- a pUMVC4 plasmid containing an insert without an APC targeting unit was used (SEQ ID NOs: 61-65).
- the inserts also included a Kozak consensus sequence to effectively initiate translation.
- the 5 neoepitope amino acid sequences used in the experiments are set forth in the following table:
- Plasmids pUMVC4 mCCL3 S16A, pUMVC4 mCCL4 S16A, pUMVC4 mCCL5 S16A, pUMVC4 mCCL19 S16A, pUMVC4 mXcll S16A and (empty) pUMVC4 solubilised in sterile water were each mixed with poloxamer 188 (Kolliphor® from BASF) and Tyrode's buffer to obtain a composition of 3% w/v poloxamer 188 and 0,05 ⁇ g/ ⁇ l plasmid in Tyrode's buffer.
- Kolliphor ® P188 (Or just referred to as Kolliphor in the present disclosure, or Lutrol® F 68), of the general formula:
- mice received immunizations with the test vaccines on days -16, -9, -3, 5, and 12 relative to the CT26 tumour inoculation on day 0. Each immunization consisted of injection of 50 ⁇ l vaccine in the left and right tibia, respectively. Blood samples for C22 MHC I testing in a tetramer assay were obtained from the test animals on day 7 after inoculation. 6 groups of 14 mice received the following vaccine compositions respectively:
- mice An eight group of na ⁇ ve mice included 5 animals.
- the tetramer assay was carried out as follows:
- MHC class I molecules are produced and loaded with a stabilizing peptide that is exchanged with the C22 epitope by exposing the molecules to UV light.
- the MHC I molecules are multimerized by coupling to fluorescently labelled Streptavidin.
- Streptavidin To identify neo-peptide positive CD8 + T cells, cells are co-stained with the multimers and fluorophore conjugated anti-CD3, anti-CD4 and anti-CD8 antibodies. Samples are then analyzed by flow cytometry and the fraction of MHC:C22 positive CD8 + is calculated
- Splenocytes were stimulated with the 5 vaccine-containing neo-peptides.
- antigen presenting cells process the neo-peptides and subsequently present them to T cells, leading to activation of cognate CD4 + and CD8 + T cells.
- the activated T cells increase cytokine synthesis, including interferon y (IFN-y) and TNFa.
- IFN-y as well as TNF ⁇ alpha producing T cells were detected by either ELISpot analysis og by flowcytometric analysis.
- Fig. 6 Prophylactic immunizations resulted in 50-100% lower tumour volume for mice receiving 5 ⁇ g pUMVC4 APC targeting S16A plasmid vector with co-polymers Kolliphor.
- the tumor reduction was significantly improved in the group treated with 5 ⁇ g pUMVC4 mCCL19 S16A with Kolliphor as compared to 5 ⁇ g pUMVC4 with no APC targeting S16A with Kolliphor.
- Whole blood from all mice where collected at day 7 post tumour inoculation and stained with fluorophore labelled C22 MHC I tetramers.
- Double-cytokine (INFy and TNFa) producing CD8+ andCD4+ T cells were observed in groups immunized with all constructs harbouring neoepitopes. Immunization with a version of the fusion protein not containing an APC targeting unit induced lover levels of double positive CD4+ T cells when compared to the targeted versions. Low or no signal was detected in negative control samples comparable to lower than background. See Fig. 8A.
- DNA vaccines were well-tolerated by the mice; no signs of adverse effects were observed, and the body weight of the mice continuously increased throughout the study as evident from the increase of body weight change, indicative of healthy and unaffected mice.
- the Kolliphor delivered pUMVC4 plasmid vectors containing different APC targeting units and the S16A neoepitopes resulted in CT26 anti-tumour effects and circulating C22 neoepitope specific CD8+ T cells.
- a dose as low as 5 ⁇ g of DNA resulted in highly significant tumour volume reduction compared to control groups, demonstrating the high efficacy of the APC targeting DNA vaccine.
- S16A neo-peptide re-stimulation showed similar T cell immunogenicity profiles in splenocytes across groups that received S16A Plasmid vector independent on the APC targeting unit.
- mice The vaccines were well-tolerated by the mice; no signs of adverse effects were observed, and the body weight of the mice continuously increased throughout the study, indicative of healthy and unaffected mice.
- Plasmids for DNA vaccination were based on the commercially available pUMVC4TM vector available from Aldevron.
- mice received immunizations with the test vaccines on days -15, -8, -1, 6, and 13 relative to the CT26 tumour inoculation on day 0. Each immunization consisted of injection of 50 ⁇ l vaccine in the left and right tibia, respectively. Blood samples for C22 MHC I testing in a tetramer assay were obtained from the test animals on day -2 and 8 after inoculation.
- mice A tenth group of na ⁇ ve mice included 5 animals.
- Fig. 9 Prophylactic immunizations resulted in 50-100% tumor size reduction for mice receiving 5 ⁇ g pUMVC4 APC targeting S16A plasmid vector with co-polymers Kolliphor compared to 5 ⁇ g pUMVC4 with Kolliphor.
- Immunizations with the C22 encoding pUMVC4 APC targeting S16A vaccine induced C22 neo-peptide specific CD8 + T cells at high frequencies (average from 0.3 to 0.6 frequency). See Fig. 10. The effect was markedly better than the control empty vector (average under 0.1 frequency) without neoepitopes.
- DNA vaccines were well-tolerated by the mice; no signs of adverse effects were observed, and the body weight of the mice continuously increased throughout the study, as evident from the increase on body weight change, indicative of healthy and unaffected mice.
- the Kolliphor delivered pUMVC4 plasmid vectors containing different APC targeting units and the S16A neoepitopes resulted in CT26 anti-tumour effects and circulating C22 neoepitope specific CD8+ T cells.
- a dose as low as 5 ⁇ g of DNA resulted in tumour volume reduction compared to control groups, demonstrating the high efficacy of the APC targeting DNA vaccine.
- S16A neo-peptide re-stimulation showed similar T cell immunogenicity profiles in splenocytes across groups that received S16A Plasmid vector independent on the APC targeting unit.
- the DNA vaccines were well-tolerated by the mice as assessed by body weight change during the experiment.
- Plasmids for DNA vaccination were based on the commercially available pUMVC4TM vector available from Aldevron.
- mice received immunizations with the test vaccines on days -14, -7, 1, 8, and 15 relative to the CT26 tumour inoculation on day 0. Each immunization consisted of injection of 50 mI vaccine in the left and right tibialis anterior, respectively. Blood samples for C22 MHC I testing in a tetramer assay were obtained from the test animals on day 7 after inoculation.
- mice An eighth group of na ⁇ ve mice included 4 animals.
- Read-outs of the experiment were body weight change relative to the weight at the first immunization, tumour volume reduction, measurement of neo-epitope-specific CD8 + T cells in circulation and functional neo-epitope-specific T cells isolated from spleens.
- Fig. 12 The effect on tumour growth of the immunizations is shown in Fig. 12: Prophylactic immunizations resulted in 50-100% tumor size reduction for all groups of mice receiving 5 ⁇ g plasmid vector pUMVC4 mCCL19 containing the neoepitopes S16A in combination with Kolliphor compared to 5 ⁇ g empty plasmid with Kolliphor.
- the groups receiving a DNA design with a multimerization unit that was of Ig origin or collagen performed the best.
- Whole blood from all mice where collected at day 7 and stained with fluorophore labelled C22 MHC I tetramers.
- DNA vaccines were well-tolerated by the mice; no signs of adverse effects were observed, and the body weight of the mice continuously increased throughout the study, as evident from the increase in body weight change, indicative of healthy and unaffected mice.
- the Kolliphor delivered pUMVC4 plasmid vectors containing mCCL19, different multimerization units and the S16A neoepitopes resulted in CT26 anti-tumour effects from 50-100%.
- the groups receiving a DNA design with a multimerization unit that was of Ig origin or collagen performed the best.
- the neoepitope specific CD8+ T cell response at day 7 corresponded to the antitumor effects and the level of functional T cells at endpoint (as measured by IFNy secretion) was comparable between groups receiving a DNA design containing neoepitopes.
- the DNA vaccines were well-tolerated by the mice as assessed by body weight change during the experiment.
- Plasmids for DNA vaccination were based on the commercially available pUMVC4TM vector available from Aldevron.
- mice received immunizations with the test vaccines on days -14, -7, 1, 8, and 15 relative to the CT26 tumour inoculation on day 0. Each immunization consisted of injection of 50 mI vaccine in the left and right tibialis anterior, respectively. Blood samples for C22 MHC I testing in a tetramer assay were obtained from the test animals on day 9 after inoculation.
- a ninth group of na ⁇ ve mice included 4 animals.
- Read-outs of the experiment were body weight change relative to the weight at the first immunization, tumour volume, and measurement of neo-epitope-specific CD8 + T cells in circulation. Also, a re-stimulation experiment was carried out assessing the presence of CD8 + and CD4 + cells producing IFNy and TNFa.
- Fig. 16 Prophylactic immunizations resulted in tumour size reduction for all groups of mice receiving mCCL19 and neoepitopes, independent of if the components are encoded as a fusion protein or as separate protein products.
- Splenic cells were re-stimulated with five of 27mer neo-peptides (C22, C23, C25, C30, C38) corresponding to the neo-epitope content of the S16A vector.
- Double-cytokine (INFy and TNFa producing CD8+ T and CD4+ cells were observed in groups immunized with a construct or combination of constructs harbouring neoepitopes. Immunization with a monomeric version of the fusion protein induces similar levels double positive CD8+ and CD4+ T cells when compared to the dimeric version.
- the Kolliphor delivered pUMVC4 plasmid vectors containing mCCL19, different multimerization units and the S16A neoepitopes resulted in CT26 anti-tumour effects from 50-100%.
- the groups receiving a DNA design with a multimerization unit that was of Ig origin or collagen performed the best.
- the neoepitope specific CD8+ T cell response at day 7 corresponded to the antitumor effects and the level of functional T cells at endpoint (as measured by IFNy secretion) was comparable between groups receiving a DNA design containing neoepitopes.
- the DNA vaccines were well-tolerated by the mice.
- the efficacy of the APC targeting constructs was tested in an alternative vector backbone (the pTVG4 plasmid). It was further tested whether the inclusion of additional neoepitopes (to arrive at 13 in total) has any impact on the efficacy. Finally, it was investigated whether minor changes - such as addition of a restriction site upstream of the neoepitope encoding region - affect the transcription and in vivo efficacies.
- the vector used in this experiment (pTVG4, see Fig. 21A) is, as is the case for pUMVC4, build on the basis of pUMVC3.
- a version of pTVG4 was engineered by addition of murine CCL19 encoding material (SEQ ID NO: 39) and of BamHI and Notl restriction sites surrounding the site for introducing the neoepitope coding region (cf. Figs. 21B and 21C where the vector is shown without and including the S16T13 epitope encoding insert).
- a corresponding vector was also produced where the murine CCL19 encoding sequence was exchanged for the human counterpart (encoded protein: Uniprot entry no. Q99731). See Fig. 21D.
- the DNA cassettes tested are schematically depicted in Fig. 22.
- One pUMVC4-based construct is compared to a number of pTVG4 constructs.
- the 13 epitopes are, from the N-terminus, C22, C23, C38, C25, C30, C37, EV85, C40, C41, C29, EV22, EV105, and AA427 (cf. the sequences set forth below).
- CT26 mice were immunized according to the following sheme
- Immunizations were administered i.m. on days -13, -6, 1, 8, and 15 relative to challenge with CT26 tumour cells (day 0). Blood was withdrawn from the tail vein on days 2 and 5. At the end of the experiment (day 21) mice where euthanized and spleens recovered and tumours excised.
- Read-outs were 1) change in body weight (BW) from the time of first immunization, 2) tumour volume (TV), and 3) C22 neo-epitope specific T-cells in circulation.
- the pTVG4 backbone performs just as well (or better) as the pUMVC4 backbone in affecting tumour growth and the addition of the restriction sites does not negatively affect the antitumor effect.
- Antitumour activity is not negatively affected by addition of further neo-epitopes and the human CCL19 as targeting unit is as efficient as murine CCL19 in the CT26 mouse tumour model.
- CD8+ T cells specific to CT26 neopeptide C22 (H-2Kd minimal binder KFKASRASI; SEQ ID NO: 61) were observed in tail vein blood at study day 2 and 6 in mice immunized with pUMVC4 vector containing the S16A neoepitopes and in pTVG4 constructs containing S16A or S16T13 neoepitopes.
- the pTVG4 backbone was shown to performs as well as the pUMVC4, and restriction site introduction did not negatively affect the antitumor effect or T cell response. Furthermore, addition of 13 neoepitopes instead of 5 does not affect the antitumor effect. Finally, it also can be concluded the human CCL19 for use as targeting unit is as efficient as murine CCL19 in the CT26 mouse tumour model.
- the objective was to perform a direct comparison between two plasmid constructs (mEVX-03 and mEVX-02; see Figs, and 21C, respectively), which are both based on the pTVG4 vector backbone, in a mouse model to investigate the antigen targeting unit's effect on anti-tumour effect and T cell response induction.
- BW Body weight
- TV Tumor volume
- Fig. 26A (EVX-02) and 26B (EVX-03).
- Fig. 26C The highest dose of mEVX-02 elicited a significant anti-tumour response, whereas all tested doses of mEVX-03 elicited a significant anti-tumour response.
- the mEVX-03 When evaluated vs. dosing of the plasmid constructs, the mEVX-03 also exhibited an clear (albeit insignificant) improvement over mEVX-02, cf. Figs. 27A and 27B: at all doses tested, EVX-03 was more effective than EVX-02.
- the animals tolerated the DNA immunizations well.
- a head-to-head comparison between immunization with two constructs distinguished only in the presence of an antigen presenting cell targeting unit according to the present invention confirms that the inclusion of the APC targeting unit allows for use of lower dosages of plasmid.
- SEQ ID NO: 18 tccatgacgttcctgacgtt
- SEQ ID NO: 26 agatctaacg acaaaacgac aaaacgacaa ggcgccagat ctggcgtttc gttttgtcgt tttgtcgttta gatct
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Engineering & Computer Science (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21715937.5A EP4132959A1 (en) | 2020-04-07 | 2021-04-07 | Neoepitope immunotherapy with apc targeting unit |
| JP2022561133A JP2023521722A (ja) | 2020-04-07 | 2021-04-07 | Apc標的化単位を用いたネオエピトープ免疫療法 |
| CN202180037341.4A CN115698051A (zh) | 2020-04-07 | 2021-04-07 | 用apc靶向单元进行新表位免疫治疗 |
| US17/995,601 US20230147574A1 (en) | 2020-04-07 | 2021-04-07 | Neoepitope immunotherapy with APC targeting unit |
| AU2021253641A AU2021253641A1 (en) | 2020-04-07 | 2021-04-07 | Neoepitope immunotherapy with APC targeting unit |
| CA3174417A CA3174417A1 (en) | 2020-04-07 | 2021-04-07 | Neoepitope immunotherapy with apc targeting unit |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP20168405.7 | 2020-04-07 | ||
| EP20168405 | 2020-04-07 | ||
| EP20207528 | 2020-11-13 | ||
| EP20207528.9 | 2020-11-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021204911A1 true WO2021204911A1 (en) | 2021-10-14 |
Family
ID=75339769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2021/059117 Ceased WO2021204911A1 (en) | 2020-04-07 | 2021-04-07 | Neoepitope immunotherapy with apc targeting unit |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20230147574A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4132959A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2023521722A (cg-RX-API-DMAC7.html) |
| CN (1) | CN115698051A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2021253641A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3174417A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021204911A1 (cg-RX-API-DMAC7.html) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022013277A1 (en) * | 2020-07-14 | 2022-01-20 | Evaxion Biotech A/S | Apc targeting units for immunotherapy |
| WO2022248531A1 (en) | 2021-05-26 | 2022-12-01 | Evaxion Biotech A/S | Vaccination targeting intracellular pathogens |
| WO2023111306A1 (en) | 2021-12-17 | 2023-06-22 | Evaxion Biotech A/S | Personalized cancer therapy targeting normally non-expressed sequences |
| WO2024126758A3 (en) * | 2022-12-14 | 2024-07-25 | Ultimovacs Ab | A nucleic acid molecule and a chimeric polypeptide |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011161244A1 (en) * | 2010-06-25 | 2011-12-29 | Vaccibody As | Homodimeric protein constructs |
| WO2017106638A1 (en) | 2015-12-16 | 2017-06-22 | Gritstone Oncology, Inc. | Neoantigen identification, manufacture, and use |
| WO2017118695A1 (en) * | 2016-01-08 | 2017-07-13 | Vaccibody As | Therapeutic anticancer neoepitope vaccine |
| WO2017192924A1 (en) * | 2016-05-04 | 2017-11-09 | Fred Hutchinson Cancer Research Center | Cell-based neoantigen vaccines and uses thereof |
| WO2018195357A1 (en) | 2017-04-19 | 2018-10-25 | Gritstone Oncology, Inc. | Neoantigen identification, manufacture, and use |
| WO2019048928A1 (en) * | 2017-09-07 | 2019-03-14 | University Of Oslo | VACCINE MOLECULES |
| WO2019075112A1 (en) | 2017-10-10 | 2019-04-18 | Gritstone Oncology, Inc. | IDENTIFICATION OF NEO-ANTIGENS USING HOT POINTS |
| WO2019104203A1 (en) | 2017-11-22 | 2019-05-31 | Gritstone Oncology, Inc. | Reducing junction epitope presentation for neoantigens |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2335730A1 (en) * | 2009-12-18 | 2011-06-22 | Deutsches Krebsforschungszentrum | Fusion polypeptides and their use for prevention and treatment of cancer |
| AU2019215031C1 (en) * | 2018-01-31 | 2026-02-26 | Novartis Ag | Combination therapy using a chimeric antigen receptor |
-
2021
- 2021-04-07 US US17/995,601 patent/US20230147574A1/en active Pending
- 2021-04-07 WO PCT/EP2021/059117 patent/WO2021204911A1/en not_active Ceased
- 2021-04-07 AU AU2021253641A patent/AU2021253641A1/en active Pending
- 2021-04-07 EP EP21715937.5A patent/EP4132959A1/en active Pending
- 2021-04-07 CA CA3174417A patent/CA3174417A1/en active Pending
- 2021-04-07 CN CN202180037341.4A patent/CN115698051A/zh active Pending
- 2021-04-07 JP JP2022561133A patent/JP2023521722A/ja active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011161244A1 (en) * | 2010-06-25 | 2011-12-29 | Vaccibody As | Homodimeric protein constructs |
| WO2017106638A1 (en) | 2015-12-16 | 2017-06-22 | Gritstone Oncology, Inc. | Neoantigen identification, manufacture, and use |
| US10055540B2 (en) | 2015-12-16 | 2018-08-21 | Gritstone Oncology, Inc. | Neoantigen identification, manufacture, and use |
| WO2017118695A1 (en) * | 2016-01-08 | 2017-07-13 | Vaccibody As | Therapeutic anticancer neoepitope vaccine |
| WO2017192924A1 (en) * | 2016-05-04 | 2017-11-09 | Fred Hutchinson Cancer Research Center | Cell-based neoantigen vaccines and uses thereof |
| WO2018195357A1 (en) | 2017-04-19 | 2018-10-25 | Gritstone Oncology, Inc. | Neoantigen identification, manufacture, and use |
| WO2019048928A1 (en) * | 2017-09-07 | 2019-03-14 | University Of Oslo | VACCINE MOLECULES |
| WO2019075112A1 (en) | 2017-10-10 | 2019-04-18 | Gritstone Oncology, Inc. | IDENTIFICATION OF NEO-ANTIGENS USING HOT POINTS |
| WO2019104203A1 (en) | 2017-11-22 | 2019-05-31 | Gritstone Oncology, Inc. | Reducing junction epitope presentation for neoantigens |
Non-Patent Citations (19)
| Title |
|---|
| "Uniprot", Database accession no. Q99731 |
| AGNETE BRUNSVIK FREDRIKSEN ET AL: "Chemokine-idiotype fusion DNAvaccines are potentiated by bivalency and xenogeneic sequences", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 110, 1 January 2007 (2007-01-01), pages 1797 - 1805, XP007915509, ISSN: 0006-4971, [retrieved on 20070531], DOI: 10.1182/BLOOD-2006-06-032938 * |
| ANA ALVAREZ-CIENFUEGOS ET AL., SCIENTIFIC REPORTS, vol. 6, 2016, pages 28643 |
| CAGAN GURER ET AL., BLOOD, vol. 112, no. 4, 15 August 2008 (2008-08-15), pages 1231 - 1239 |
| DESMET ET AL., NAT. REV. IMM., vol. 12, no. 7, 2012, pages 479 - 491 |
| GARDE C ET AL., IMMUNOGENETICS |
| GERTY SCHREIBELT ET AL., BLOOD, vol. 119, no. 10, 8 March 2012 (2012-03-08) |
| GROSSMANN C ET AL., BMC. IMMUNOLOGY, vol. 10, 2009, pages 43 |
| GUNNVEIG GRODELAND ET AL: "Antigen Targeting to Human HLA Class II Molecules Increases Efficacy of DNA Vaccination", THE JOURNAL OF IMMUNOLOGY, vol. 197, no. 9, 26 September 2016 (2016-09-26), US, pages 3575 - 3585, XP055432075, ISSN: 0022-1767, DOI: 10.4049/jimmunol.1600893 * |
| JOHNSON ET AL., VACCINE, vol. 24, no. 3, 2006, pages 293 - 303 |
| JORG WILLUDA ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 17, 2001, pages 14385 - 14392 |
| JURTZ V ET AL., J IMMUNOL, 2017, pages ji1700893 |
| OLIVER SEIFERT ET AL., PROTEIN ENGINEERING, DESIGN & SELECTION, vol. 25, no. 10, 2012, pages 603 - 612 |
| RASMUSSEN M ET AL., ACCEPTED FOR J OF IMMUNOL, June 2016 (2016-06-01) |
| TAKASHI SATO ET AL., BLOOD, vol. 117, no. 12, 24 March 2011 (2011-03-24), pages 3286 - 3293 |
| VICTOR J. SANCHEZ-AREVALO LOBO ET AL., INT. J. CANCER, vol. 119, 2006, pages 455 - 462 |
| WAN-LUN YAN ET AL., IMMUNOTHERAPY, vol. 9, no. 4, 2017, pages 347 - 360 |
| WU ET AL., VACCINE, vol. 29, no. 44, 2011, pages 7624 - 30 |
| ZHONGYI YAN ET AL., ONCOTARGET, vol. 7, 26 May 2016 (2016-05-26), pages 40437 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022013277A1 (en) * | 2020-07-14 | 2022-01-20 | Evaxion Biotech A/S | Apc targeting units for immunotherapy |
| WO2022248531A1 (en) | 2021-05-26 | 2022-12-01 | Evaxion Biotech A/S | Vaccination targeting intracellular pathogens |
| WO2023111306A1 (en) | 2021-12-17 | 2023-06-22 | Evaxion Biotech A/S | Personalized cancer therapy targeting normally non-expressed sequences |
| WO2024126758A3 (en) * | 2022-12-14 | 2024-07-25 | Ultimovacs Ab | A nucleic acid molecule and a chimeric polypeptide |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4132959A1 (en) | 2023-02-15 |
| CN115698051A (zh) | 2023-02-03 |
| US20230147574A1 (en) | 2023-05-11 |
| JP2023521722A (ja) | 2023-05-25 |
| CA3174417A1 (en) | 2021-10-14 |
| AU2021253641A1 (en) | 2022-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7535489B2 (ja) | 治療用抗癌ネオエピトープワクチン | |
| AU2020234003B2 (en) | Nucleic acid vaccination using neo-epitope encoding constructs | |
| WO2021204911A1 (en) | Neoepitope immunotherapy with apc targeting unit | |
| CN111148533A (zh) | 用于嵌合抗原受体t细胞疗法的组合物及其用途 | |
| US20230355733A1 (en) | APC targeting units for immunotherapy | |
| Li et al. | Effective induction of CD8+ T-cell response using CpG oligodeoxynucleotides and HER-2/neu-derived peptide co-encapsulated in liposomes | |
| US20020187131A1 (en) | Enhanced antigen delivery and modulation of the immune response therefrom | |
| US10328134B2 (en) | Gastrin peptide immunogenic composition | |
| JP2022130623A (ja) | がんの治療のためのmica/bアルファ3ドメインによるワクチン接種 | |
| ES3035198T3 (en) | Cpg amphiphiles and uses thereof | |
| AU2019351458A1 (en) | Immunity-inducing agent comprising antigen peptide-adjuvant nucleotide conjugate and pharmaceutical composition comprising same | |
| US20230072079A1 (en) | Nucleic acid vaccination using neo-epitope encoding constructs | |
| HK40026581A (en) | Compositions for chimeric antigen receptor t cell therapy and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21715937 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 3174417 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2022561133 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2021253641 Country of ref document: AU Date of ref document: 20210407 Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021715937 Country of ref document: EP Effective date: 20221107 |