WO2021199078A2 - Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. - Google Patents
Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. Download PDFInfo
- Publication number
- WO2021199078A2 WO2021199078A2 PCT/IN2021/050325 IN2021050325W WO2021199078A2 WO 2021199078 A2 WO2021199078 A2 WO 2021199078A2 IN 2021050325 W IN2021050325 W IN 2021050325W WO 2021199078 A2 WO2021199078 A2 WO 2021199078A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- patient
- cannabidiol
- apoptosis
- induction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/658—Medicinal preparations containing organic active ingredients o-phenolic cannabinoids, e.g. cannabidiol, cannabigerolic acid, cannabichromene or tetrahydrocannabinol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/007—Pulmonary tract; Aromatherapy
- A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0002—Galenical forms characterised by the drug release technique; Application systems commanded by energy
- A61K9/0004—Osmotic delivery systems; Sustained release driven by osmosis, thermal energy or gas
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0002—Galenical forms characterised by the drug release technique; Application systems commanded by energy
- A61K9/0007—Effervescent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
- A61K9/0056—Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
- A61K9/2004—Excipients; Inactive ingredients
- A61K9/2022—Organic macromolecular compounds
- A61K9/205—Polysaccharides, e.g. alginate, gums; Cyclodextrin
- A61K9/2054—Cellulose; Cellulose derivatives, e.g. hydroxypropyl methylcellulose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
- A61K9/28—Dragees; Coated pills or tablets, e.g. with film or compression coating
- A61K9/2806—Coating materials
- A61K9/2833—Organic macromolecular compounds
- A61K9/2853—Organic macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyethylene oxide, poloxamers, poly(lactide-co-glycolide)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
Definitions
- the present invention provides pharmaceutical compositions and methods of treating Covid-19 infectious disease.
- the present invention also provides pharmaceutical compositions and methods of prophylaxis or prophylactic treatment of Covid-19 infectious disease.
- SARS-CoV-2 has many variants and some of the variants have i) increased transmissibility, ii) increased virulence, and iii) reduced effectiveness of vaccines.
- the present invention provides pharmaceutical compositions and methods for treating Covid-19 infectious disease comprising administering to patient such pharmaceutical compositions comprising therapeutically effective amount of Cannabidiol wherein such administration of said pharmaceutical composition to the said patient produces an enhancement / augmentation of innate immunity of the patient due to at least one of the following effects, i) infected patient cells undergo apoptosis early after infection; ii) induction of interferon transcription in the patient; iii) induction of interferon-induced antiviral effectors in the patient.
- the present invention also provides pharmaceutical compositions and methods for prophylaxis or prophylactic treatment of Covid-19 infectious disease comprising administering to mammal / human such pharmaceutical compositions comprising therapeutically effective amount of Cannabidiol wherein such administration of said pharmaceutical composition to the said mammal / human produces an enhancement / augmentation of innate immunity of the patient due to at least one of the following effects, i) induction of interferon transcription in the patient; ii) induction of interferon-induced antiviral effectors in the patient.
- the invention provides a pharmaceutical composition and method of administering pharmaceutical composition comprising therapeutically effective amount of Cannabidiol for preventing or reducing mutation of Sars-Cov- 2 virus in a patient by administration of said pharmaceutical composition to the said patient suffering from Covid-19 by causing infected patient cells to undergo apoptosis early after infection which renders them not available to the virus for mutation.
- the invention provides a pharmaceutical composition and methods for administering pharmaceutical composition comprising therapeutically effective amount of Cannabidiol for use in preventing or better preparing for Covid- 19 infectious disease in mammals / humans who are about to get infected wherein administration of said pharmaceutical composition to the mammal / human produces an enhancement / augmentation of innate immunity in such mammal / human due to at least one of the following effects, i) induction of interferon transcription in the mammal / human; iii) induction of interferon-induced antiviral effectors in the mammal / human; wherein such induction is not associated with apoptosis of cells in the beginning enabling cells to get primed / prepared for viral threat and wherein such cells are better able to prepare for infection including increase in the infectious dose of virions than usual dose and wherein the cells undergo apoptosis early after infection which renders the cells not available to the virus for replication and / or mutation.
- Figures 1 - 5 depict cell proliferation rates which were measured by incorporating and quantifying bromodeoxyuridine (BrdU) into DNA of actively proliferating cells.
- the absorbance values are measured by ELISA assay with a BioTek Synergy HI Hybrid Multi-Mode Microplate reader assay at 370 nm (reference wavelength: approx. 492 nm).
- HEK293 human embryonic kidney cells were seeded in 96 well plates, then transfected with plasmids expressing an empty control vector (pCMV-3Tag-3a) or vectors expressing the viral Orf8, OrflO or M proteins. Untransfected control cells have also been tested, but did not differ significantly from pCMV controls.
- Figure 1 provides a “no treatment” condition where HEK293 (human embryonic kidney) cells are transfected with plasmids expressing an empty control vector (pCMV-3Tag-3a) or vectors expressing the viral Orf8, OrflO or M proteins.
- Untransfected control cells (not shown in the figure) have also been tested but did not differ significantly from pCMV controls.
- Figure 2 provides a “control” condition where HEK293 (human embryonic kidney) cells are transfected with plasmids expressing an empty control vector (pCMV- 3 Tag-3 a) and further treated with Cannabidiol.
- Cannabinoids did not significantly affect the incorporation of BrdU into cells transfected with the control plasmid.
- Figure 3 provides a condition where HEK293 (human embryonic kidney) cells are transfected with plasmids expressing the viral Orf8 protein and are further treated with Cannabidiol.
- Figure 4 provides a condition where HEK293 (human embryonic kidney) cells are transfected with plasmids expressing a vector expressing the viral OrflO protein and further treated with Cannabidiol.
- Figure 5 provides a condition where HEK293 (human embryonic kidney) cells are transfected with plasmids expressing a vector expressing the viral M protein and further treated with Cannabidiol.
- Figure 6 combines data from all figures for ready comparison.
- Figures 7A, 7B and 7C provide BrdU incorporation / cell proliferation, and therefore indicate the level of BrdU incorporation into nuclear DNA normalized to relative cell number in cells transfected with ORF8, ORF10 and M protein, respectively, and treated with or without Cannabidiol.
- Figures 7A, 7B and 7C show that the level of BrdU incorporation per cell was not significantly different between cells transfected with control plasmid or with plasmids expressing ORF8 or ORF10 or M protein, whether treated with CBD or without (vehicle control). This indicates that the rate of HEK293 cell proliferation was not significantly altered by viral proteins or CBD, or a combination of both. It also indicated that in Figures 1 to 6, the decrease in BrdU incorporation was very likely due to a lower number of cells in each well, rather than a decrease in cell proliferation.
- Figures 7D, 7E and 7F respectively provide an assay where adherent cells are stained by crystal violet and hence provide a measure of the relative cell number per well. These figures show that Cannabidiol does not significantly affect the relative number of cells per well when cells only express the control plasmid.
- Figure 7D provides relative cell number when cells are transfected with either a control plasmid or plasmid transfected with ORF8 and treated with or without Cannabidiol.
- Figure 7E provides relative cell number when cells are transfected with either a control plasmid or plasmid transfected with ORF10 and treated with Cannabidiol.
- This figure shows that expression of ORF10 without Cannabidiol treatment does not reduce relative cell numbers, but relative cell numbers are decreased when cells express ORF10 and are treated with Cannabidiol, both in comparison to cells expressing ORF10 but treated with vehicle only, or in comparison to cells transfected with control plasmid and treated with Cannabidiol.
- Cannabidiol combines with this SARS-CoV-2 gene to cause a decrease in relative cell number that is only seen when the viral protein is combined with Cannabidiol.
- Figure 7F provides relative cell number when cells are transfected with either a control plasmid or plasmid transfected with M protein and treated with Cannabidiol .
- This figure shows that expression of Mprotein either with or without Cannabidiol will decrease relative cell numbers per well compared to cells transfected with the control plasmid alone and treated either with or without Cannabidiol, respectively.
- Cannabidiol treatment further enhanced the reduction in relative cell number.
- Figures 8A and 8B provide respectively an early and late apoptosis data of HEK293 (human embryonic kidney) cells transfected with i) control plasmid expressing control vector and ii) plasmid expressing viral protein ORF8; and then treated with Cannabidiol.
- Cannabidiol treated cells which are transfected with control plasmid do not show any significant increase in early as well as late apoptosis but Cannabidiol treated cells which are transfected with plasmid expressing viral protein ORF8 have exhibited significant increases in early apoptosis and late apoptosis, both relative to ORF8-expressing cells treated only with vehicle control, and relative to control vector-expressing cells treated with Cannabidiol, indicating that Cannabidiol augments the cellular pro-apoptotic anti-viral response to ORF8, and this is specific to cells expressing ORF8.
- Figure 9A provides Interferon Lambda 1 mRNA levels produced when cells expressing ORF8 or control vector are treated with Cannabidiol compared to vehicle control.
- Figure 9B provides that CBD augmented the expression of INF -gamma in both control and ORF8-expressing cells, but had a greater effect on this expression in ORF8 expressing cells.
- Figure 10 provides a highly significant increase in the expression of OAS1 (Oligoadenylate synthetases 1) gene in cells transfected with ORF8 protein and treated with Cannabidiol relative to all other groups and treatments.
- Figure 11 provides that Mxl (Dynamin-Like GTPase myxovirus resistance protein 1) another interferon stimulated gene, is more highly expressed when cells transfected with ORF8 protein are treated with Cannabidiol, highlighting that Cannabidiol in combination with this SARS-CoV-2 protein augments this anti-viral response.
- OAS1 Oleadenylate synthetases 1
- Figures 12A and 12B respectively provide early apoptosis and late apoptosis data in cells transfected with a control plasmid or viral plasmid expressing ORF10 and treated with Cannabidiol.
- Cannabidiol induces apoptosis in cells transfected with ORF10 and treated with Cannabidiol to a significantly greater extent than in cells treated with Cannabidiol but expressing only control plasmid, indicating a specific ability of Cannabidiol to augment apoptosis when present in combination with the SARS-CoV-2 ORF10 protein, but not when a non-viral plasmid is present.
- Figure 13 provides that in cells expressing ORF10, CBD significantly increased expression of Interferon gamma which is an indication of augmentation of the innate anti-viral response by cells. Expression of Interferon gamma is also seen in Cannabidiol treated cells transfected with a control plasmid, but to a lesser extent than in Cannabidiol -treated cells transfected with the SARS-CoV-2 gene ORF10.
- Figure 14 provides expression of OAS1 in cells transfected with a control plasmid or plasmid expressing ORF10 and treated with Cannabidiol. Treatment with Cannabidiol significantly increased the induction of OAS1 in cells transfected with ORF10 or control plasmid relative to treatment with vehicle alone (i.e. without Cannabidiol).
- Figures 15A and 15B respectively provide early apoptosis and late apoptosis data in cells transfected with a control plasmid or viral plasmid expressing M protein and treated with Cannabidiol.
- Cells transfected with M protein and treated with Cannabidiol significantly increased both early and late apoptosis compared to cells treated under the same conditions but transfected only with control plasmid.
- Cells transfected with M-protein and treated with Cannabidiol had significantly elevated early and late apoptosis also relative to cells expressing M protein but treated only with vehicle.
- Figures 16A and 16B provide that Cannabidiol induced both INF-lambda 1 and INF-lambda 2/3 in cells expressing M-protein, indicating that CBD augments the interferon response to this SARS-CoV-2 protein and augments this aspect of the innate intracellular anti-viral response.
- Figure 17 provides that cells transfected with both control plasmid and M protein and treated with cannabidiol have exhibited expression of Mxl.
- Cannabidiol induces Mxl gene expression in cells transfected with M-protein and treated with Cannabidiol to a significantly greater extent than in cells treated with Cannabidiol but expressing only control plasmid.
- Figure 18 provides that the cells transfected with either control plasmid or M protein and treated with Cannabidiol have exhibited significantly greater expression of OAS1 gene compared to their respective vehicle-treated cells.
- Figure 19 provides that cannabidiol significantly increases expression of IFIT1 either in cells transfected with M protein or control plasmid, and therefore may help to prime the innate cellular immune system to enhance ability to launch an anti viral defense.
- Viral proteins usually play critical roles in interfering with the host acquired immune response, but can also directly interfere with anti-viral innate immune responses mediated directly within infected cells that are meant to stop viral replication and spread.
- the pandemic of coronavirus disease 2019 (COVID-19) caused by the 2019 novel coronavirus (2019-nCoV or SARS-CoV-2) infection has become a Public Health Emergency of International Concern (PHEIC).
- SARS- CoV-2 is highly pathogenic in human, having posed immeasurable public health challenges to the world.
- SARS CoV-2 is related to an earlier strain that also causes respiratory disease in humans, SARS CoV. Prior characterization of SARS CoV has facilitated decoding the SARS CoV2 genome.
- Genomic products of the SARS CoV-2 genome are designated in lower case letters, in italics (e.g. orflO ), while viral genes are designated in upper case letters (e.g. ORF10).
- coronavirus disease 2019 2019 (COVID-19) caused by the 2019 novel coronavirus (2019-nCoV or SARS-CoV-2) infection has created havoc by infecting more than 127 million individuals across the world and by causing around 3 million deaths as of March 29, 2021, with both the numbers of cases and deaths still climbing. It has been reported that some coronavirus proteins play an important role in modulating innate immunity of the host, but few studies have been conducted on SARS-CoV-2.
- SARS-CoV was identified as the etiologic agent of the 2002-3 international SARS outbreak. Chong-Shan Shi et al in a paper published in Journal of Immunology (2014) provides an insightful study on how SARS evades innate immune responses to cause human disease.
- a protein encoded by SARS -Co V designated as open reading frame-9b (ORF-9b) plays multiple roles as follows: 1. It localizes to mitochondria and causes mitochondrial elongation by triggering ubiquitination and proteasomal degradation of dynamin-like protein (DRPl), a host protein involved in mitochondrial fission;
- DRPl dynamin-like protein
- MAVS mitochondrial-associated adaptor molecule
- PCBP2 poly(C)-binding protein 2
- HECT domain E3 ligase AIP4 E3 ligase AIP4
- All viral proteins of SARS-COV-2 viz. NSP1, NSP2, NSP3, NSP4, NSP5, NSP6, NSP7, NSP8, NSP9, NSP10, NSP11, NSP12, NSP13, NSP14, NSP15, NSP16, S protein, ORF3a, E protein, M protein, ORF6, ORF7a, ORF7b, ORF8, N protein, ORF10 are being extensively researched for development of novel therapeutics to treat Covid -19 (Gordon, D.E et al, 2020).
- Li et al (2020) reports the following mechanism which is triggered upon viral infection. i) Binding of several transcription factors, such as IRF-3 and NF-KB, to the interferon promoter to stimulate type I IFN (IFN-a/b) expression (Garcia-Sastre and Biron, 2006) upon virus infection; ii) Secretion of Interferon and its binding with its receptor; iii) initiation of the JAK/STAT pathway and inducing the nucleus translocation of IFN-responsive transcriptional factors upon binding of interferon with its receptors; iv) activation of genes containing interferon-stimulated response elements (ISREs) in their promoters, resulting in the expression of a set of IFN-stimulated genes (ISGs) establishing an antiviral state (Catanzaro et al., 2020).
- IFN-a/b type I IFN
- Li further states that in response to this powerful selective environment, many viruses from diverse families, including filoviruses, poxviruses, influenza viruses, flaviviruses, and coronaviruses (CoVs), have evolved multiple passive and active mechanisms to avoid induction of the antiviral type I interferon, and they could optimize the intracellular resource for efficient virus replication (Volk et al., 2020).
- Li et al found that the viral ORF6, ORF8 and nucleocapsid proteins were potential inhibitors of the type I interferon signaling pathway, a key component for antiviral response of host innate immunity. All the three proteins showed strong inhibition on type I interferon (IFN-b) and NF-kB -responsive promoters. Further examination by Li revealed that these proteins were able to inhibit the interferon-stimulated response element (ISRE) after infection with Sendai virus, while only ORF6 and ORF8 proteins were able to inhibit the ISRE after treatment with interferon beta.
- ISRE interferon-
- SARS-CoV-2 ORF6, ORF8, N and ORF3b are potent interferon antagonists, and in the early stages of SARS-CoV-2 infection, delayed release of IFNs would hinder the host's antiviral response and then benefit virus replication. This, followed by the rapidly increased cytokines and chemokines attract inflammatory cells, such as neutrophils and monocytes, resulting in excessive immune infiltration causing tissue damage.
- ORFIO Molecular insights into the contagious nature of pandemic novel coronavirus 2019- nCoV ” emphasized on the fact that ORFIO is an unknown protein with no homology to any known protein in organisms present till date. She further conducted immunoinformatics studies through which, it has been observed that among all ten 2019-nCoV proteins, ORFIO presents amongst the highest number of immunogenic, promiscuous CTL epitopes. (Cytotoxic T Lymphocytes).
- ORFIO presents amongst the highest number of immunogenic, promiscuous CTL epitopes. These epitopes are part of a cluster with HTL epitopes, suggesting that there is a high degree of epitope conservation in ORFIO. Conservation of protein sequence across organisms is not seen, and there is no known structural template on which to model and derive a structure to get structural and functional insights. Because there is altogether no conservation of its sequence, or structure, it may be presented as a novel protein to the immune system. Further, the human body may not have been able to utilize any memory B and T cells generated against other microorganisms to target ORFIO and fight this pathogen, contributing to its deadly, contagious nature. ”.
- ORF8 protein is another protein that is not homologous with other proteins in the SARS CoV genome (Xu, J. et ah, Viruses 2020, 12, 244), although it does show very low homology to proteins encoded by other related viruses (Tang, X. et al. National Science Review 2020, 7, 1012-1023).
- the SARS CoV-2 ORF8 protein is of a particular interest due to the recent finding that it is potential inhibitor of type I interferon signaling pathway, a key component for antiviral response of host innate immunity.
- the gene for or 8 (Accession YP 009724396.1, UniProt ID P0DTC8 ⁇ NS8 SARS2), is encoded at the 3’ end of the SARS CoV-2 genome. It results in a protein that is 121 amino acids long, with the N-terminal region forming a predicted signal peptide identifying a cleavage site at aa 15 (Target P-2.0 prediction). The predicted subcellular localization
- ORF8 cellular proteins that potentially interact with ORF8 (www.ebi.ac/uk/interact/interactors/id:P0DTC8) have been identified. These include mitochondrial proteins involved in metabolism, and cardiolipin and lipid synthesis (e.g. mitochondrial glutamate carrier 1, mitochondrial ATP synthase subunits alpha and beta, alpha trifunctional protein, and various dehydratases and enolases), Golgi proteins (e.g. Coatomer subunits a/b/,g, etc), endoplasmic reticulum (ER) proteins (e.g. ER lectin 1, ER membrane protein complex subunit 1, etc), proteasomal proteins (e.g. 26S proteasome non-ATPase regulatory subunit 6, proteasome subunit alpha type-7), nuclear proteins (e.g. EIF3 A, RBP2, etc.), and others.
- mitochondrial proteins involved in metabolism, and cardiolipin and lipid synthesis e.g. mitochondrial glutamate carrier
- ORFIO protein being an unknown protein with no homology to any known protein in organisms present till date, and due to its unique association with SARS-CoV-2, also serves an interesting candidate.
- ORFIO (Accession YP 009725255.1, UniProt ID A0A663DJA2*), is predicted by PSORT II to likely be cytoplasmic (56.5% probability), but also mitochondrial (21.7%), nuclear (13%), secretory system vesicle-associated (4.3%) or ER- associated (4.3%).
- This viral protein is small, at only 38 amino acids, and has a predicted N-terminal transmembrane helix spanning amino acids 5-19.
- Protein interaction data from the IntAct database (https://www.ebi.ac.Uk/intact/interactors/id:A0A663DJA2*) indicates only 30 potential interactors. It is notable, however, that there are several common interactors between ORF8 protein and ORFIO protein, including mitochondrial, Golgi, and endoplasmic reticulum proteins.
- the membrane glycoprotein (M protein, Accession YP 009724393.1)) is a structural protein that is highly conserved across all beta-coronaviruses, but has been found to have some sequence variants in the SARS CoV-2 virus, with at least 7 amino acid substitutions identified thus far (M. Bianchi et al, BioMed Research International Vol 2020 Article ID 4389089).
- the M protein may be important for viral entry, replication, and particle assembly within host cells, as well as for viral budding. Data from an interaction study also suggests that M protein may interfere with mitochondrial metabolism (https://doi.org/10.1038/s41586-020-2286-9) and additional cellular processes.
- the non-structural protein 5 (NSP5) is encoded in open reading frame la (orfla) that produces a polypeptide (Accession# YP_009725295.1) and orflab (polypeptide Accession # YP_009724389.1), which are further processed to yield non-structural proteins including NSP5.
- NSP5 non-structural protein 5
- a recent interaction study has suggested based on protein-protein interactions thatNSP5, which is the main protease of the SARS CoV-2 genome, may affect the ability of proteins to target the mitochondria and cause oxidative stress, and may be targeted therapeutically by anti-oxidant drugs, although this has not yet been shown experimentally.
- SARS-CoV-2 A lack of basic knowledge about SARS CoV-2 is a limiting factor for the development of novel therapeutics to treat this disease.
- SARS-CoV-2 has been observed to share almost 80% of the genome with SARS-CoV (Catanzaro 2020), given that there are differences in the infectivity, host interaction, and pathogenicity between these two viruses (2), ORF8 protein and ORFIO protein are of significant interest, as well as M protein and NSP5, among the other known individual proteins in the SARS CoV-2 genome.
- CBD cannabidiol
- CBD had been found to modulate translocation of various cellular proteins including transcription factors (Huang Y et al, 2019) and membrane cation channels (Hassan S et al, 2014).
- CBD has been found to function in the modulation of mitochondrial calcium metabolism, mitochondrially-mediated apoptosis, mitochondrial ferritin regulation, the electron transport chain, and mitochondrial biogenesis and fission (da Silva VK, 2018; Hao E et al, 2015; McKallip RJ et al, 2006; Ryan D et al, 2009 and Valvassori SS et al, 2013).
- CBD treatment of rats increased complex I, II, III, and IV activity, likely due to enhanced accumulation of calcium inside the mitochondria, which increased the activity of calcium-sensitive dehydrogenases and promoted availability of NADH for oxidative phosphorylation (Valvassori SS et al, 2013).
- Various researchers have shown that CBD shows significant promise for the treatment of numerous cancers, based primarily on evidence of induction of a pro- apoptotic effect (Jeong S et al, 2019; Jeong S, Yun HK et al, 2019; Sultan AS et al, 2018).
- CBD decreases cell death, and has no effect in normal cells (unpublished data). The same is also observed by Olah A et al, 2016; and Solinas M et al, 2012.
- Cell type may also be a factor in determining response.
- mouse forebrain tissues subjected to oxygen-glucose deprivation had a 5 -fold increase in caspase 9 activation that was attenuated nearly 50% by 100 mM CBD (Castillo A et al, 2010), while 5 mM CBD also significantly attenuated apoptosis and oxidative stress in cultured HT22 hippocampal neurons subjected to oxygen -glucose deprivation (Sun S et al, 2017).
- CBD cannabinoids
- cannabidiol and other cannabinoids dose-dependently inhibited cholesterol esterification in cultured human fibroblasts, without affecting triacylglycerol or phospholipid synthesis (Cornicelli JA, et al 1981).
- N-acylethanolamines N-acylethanolamines
- lipid rafts are important sites in cells for physiological and pathophysiological regulation. d. Regulation of lipid rafts may also have specific importance in COVID-19.
- the ACE2 receptor which binds the Spike protein of SARS CoV-2 to initiate cellular entry and infection, is located within cholesterol-rich lipid domains (Lu Y et al, 2008). Since both sphingomyelin and free (i.e. unesterified) cholesterol are significant components of lipid rafts, these reports indicate a potential role for CBD in regulation of these membrane subdomains.
- CANNABIDIOL (CANNABIDIOL) is the main cannabinoid constituent of Cannabis sativa plant. It binds very weakly to CB1 and CB2 receptors. CANNABIDIOL does not induce psychoactive or cognitive effects and is well tolerated without side effects in humans, thus making it a putative therapeutic target. In the United States, the CANNABIDIOL drug Epidiolex was approved by the Food and Drug Administration in 2018 for the treatment of two epilepsy disorders: Dravet Syndrome and Lennox/Gasteaut Syndrome.
- CANNABIDIOL is designated chemically as 2-[(lR,6R)-3-Methyl-6-(l- methylethenyl)-2-cyclohexen-l-yl]-5-pentyl-l,3-benzenediol.
- the chemical structure is as follows.
- the US patent no. US 6410588 discloses the use of CANNABIDIOL to treat inflammatory diseases.
- the PCT publication no. WO2001095899 A2 relates to CANNABIDIOL derivatives and to pharmaceutical compositions comprising CANNABIDIOL derivatives being anti-inflammatory agents having analgesic, antianxiety, anti convulsive, neuroprotective, antipsychotic and anticancer activity.
- CANNABIDIOL (CANNABIDIOL(CANNABIDIOL)) is approved as an anti- seizure drug (Barnes, 2006; Devinsky et al., 2017). CANNABIDIOL lacks adverse cardiac toxicity and ameliorates diabetes/high glucose induced deleterious cardiomyopathy (Cunha et al., 1980; Izzo, Borrelli, Capasso, Di Marzo & Mechoulam, 2009; Rajesh et al., 2010). Detailed Description Of The Invention Definition of terms.
- Cannabidiol and CBD are used synonymously.
- early apoptosis covers early apoptosis as a stage of apoptosis.
- Apoptosis early after infection indicates timepoint when the cells undergo apoptosis after infection. This covers both early and late apoptosis as long as they happen early after infection.
- cells undergo apoptosis at 24 hrs which indicates that Cannabidiol causes Apoptosis early after infection wherein some cells may be in early apoptosis and some cells may be in late stage of apoptosis.
- Cannabidiol has been shown to be effective in protecting endothelial function and integrity in human coronary artery endothelial cells (HCAECs) by Rajesh M et al. They have proposed following action of Cannabidiol by inhibiting
- Cannabinoids the active components of Cannabis sativa, and endogenous cannabinoids mediate their effects through activation of specific cannabinoid receptors known as cannabinoid receptor 1 and 2 (CB1 and CB2).
- the cannabinoid system has been shown both in vivo and in vitro to be involved in regulating the immune system through its immunomodulatory properties.
- Cannabinoids suppress inflammatory response and subsequently attenuate disease symptoms. This property of cannabinoids is mediated through multiple pathways such as induction of apoptosis in activated immune cells, suppression of cytokines and chemokines at inflammatory sites and upregulation of FoxP3 regulatory T cells.
- Cannabinoids have been tested in several experimental models of autoimmune disorders such as multiple sclerosis, rheumatoid arthritis, colitis and hepatitis and have been shown to protect the host from the pathogenesis through induction of multiple anti-inflammatory pathways.
- Vuolo et al has demonstrated Role of Cannabidiol Treatment in Animal Model of Asthma.
- the levels of all 6 cytokines implicated in asthma viz. TNFcr, IL-6, IL-4, IL-13, IL-10, and IL-5 were determined in Control animals, asthma induced animals and asthma induced animals treated with Cannabidiol.
- Induced asthma has increased all 6 cytokines; however, in animal group treated with CBD, levels of all cytokines has been reduced significantly. This action of Cannabidiol is very important not only in asthma but in other conditions where a rise in cytokines is reported. Recent studies by Huang, C. et al.
- Cannabidiol is also proposed as a treatment for Covid-19 due to its ability to reduce cytokines.
- the inventors of the instant invention propose that through multiple known and unknown effects, Cannabidiol will serve as a highly desired therapeutic agent. It is a cardioprotective drug and role of Cannabidiol in reducing LQT is of vital significance.
- Cannabidiol has been reported previously to be effective in protecting endothelial function and integrity in human coronary artery endothelial cells (HCAECs). Cannabidiol has reduced cytokines in induced asthma. Cannabidiol plays multiple roles such as anti-inflammatory, inhibitor of cytokines, agent to reduce LQT and a cardioprotective agent.
- the invention also covers method of treating individuals suffering from any heart condition, any respiratory condition or any infection or condition where rise of cytokine and / or inflammation is observed by administering Cannabidiol compositions alone or with another suitable therapeutic.
- compositions may be consumed in the mono-treatment with Cannabidiol or as a prophylactic or as an adjunct therapy taking the help of a calendar -pack blister card encompassing Cannabidiol tablets along with the afore -mentioned.
- the invention also covers administering Cannabidiol compositions prophylactically under certain circumstances so that any treatment which may be required in immediate future shall not cause LQT, cytokine elevation, inflammation and injury to heart.
- the instant invention provides compositions and methods to enhance safety profile of any treatment including an antiviral treatment particularly including treatment for Covid-19 wherein the treatment includes administration of one or more drugs that may cause drug induced LQTs.
- Cannabidiol would produce beneficial effects in one or more of the following pathogenesis of various disorders including, but not limited to, COVID-19, SARS, MERS, influenza, acquired, induced and drug related long QT syndrome, long QTc syndrome, long QRS syndrome, cardiomyopathy, heart failure, arrhythmia, myocardial ischemia, myocardial infarction (Ml), arrhythmias of ischemic and non ischemic origin, inflammation, vascular dysfunction, cardiomyopathy, cardiac remodelling, maladaptation, anginas of different types, drug induced heart failure, cardiac injury, iatrogenic heart and vascular diseases, or any combination thereof.
- the inventors have previously proposed that Role of Cannabidiol in treating Covid- 19 would be multifold.
- Cannabidiol is considered safe for chronic use and is cardioprotective in nature. It can reduce cytokines and act as anti-inflammatory agent. Most importantly, it reduces LQT and can prevent / rescue hyperexcitability of cardiac ion channels. In this way, it can enhance safety profile of the treatment which recommends administration of drugs for treating Covid -19 but capable of causing LQT and enables masses to receive best possible treatment.
- All viral proteins of SARS-COV-2 viz. NSP1, NSP2, NSP3, NSP4, NSP5, NSP6, NSP7, NSP8, NSP9, NSP10, NSP11, NSP12, NSP13, NSP14, NSP15, NSP16, S protein, ORF3a, E protein, M protein, ORF6, 0RF7a, 0RF7b, ORF8, N protein, ORFIO are being extensively researched for development of novel therapeutics to treat Covid -19 (Gordon, D.E et al, 2020).
- ORF8 and ORFIO novel proteins, ORF8 and ORFIO, have not yet been fully characterized experimentally, and their functions in cells cannot be inferred from prior work.
- the functions of the SARS CoV-2 form of M protein, and NSP5 are poorly understood. Indeed, little is known yet about the proteins that make up the SARS CoV-2 genome, since they all contain differences compared to other known viral proteins.
- Knowledge of the cellular function and pathophysiological roles of these novel proteins in the SARS CoV-2 genome is expected to provide potential new targets for therapeutic intervention.
- the work is initiated on certain compounds which may interfere with the action of these viral proteins and prove to be useful to civilization to fight the pandemic. These compounds are those which may particularly reverse cellular perturbations caused by these viral proteins.
- Initial infection with a virus does not cause severe disease (the estimated infectious dose is 1000 virions). Illness only occurs when the virus enters cells and hijacks the cellular machinery to replicate, forming 1000s or millions of new virions.
- SARS-CoV-2 has many variants, but some are of particular importance due to i) increased transmissibility, ii) increased virulence, and iii) reduced effectiveness of vaccines.
- ORF8 is an accessory protein that has been proposed to interfere with immune responses of host.
- ORF8 is unique in that it maybe dispensible in viral replication but it has a unique role of evading immune surveillance of host cells i.e. it has a role in the way virus evades immunity of host cell.
- the membrane glycoprotein (M protein, Accession YP 009724393.1)) is a structural protein that is highly conserved across all beta-coronaviruses but has been found to have some sequence variants in the SARS CoV-2 virus, with at least 7 amino acid substitutions identified thus far (M. Bianchi et al, BioMed Research International Vol 2020 Article ID 4389089).
- the M protein may be important for viral entry, replication, and particle assembly within host cells, as well as for viral budding. Data from an interaction study also suggests that M protein may interfere with mitochondrial metabolism (https://doi.org/10.1038/s41586-020-2286-9) and additional cellular processes.
- RNA processing When host cells are infected with virus, they transcribe interferons that will block RNA processing, to try to block viral replication. Viruses ‘hijack’ the cellular machinery to make copies of themselves, which requires RNA processing. Interferons are made as a very early response, when a virus particle enters a cell, and they shut down RNA-mediated processes in cells. This stops viruses from replicating. However, this action of interferon may also stop cells from dividing, and can cause them to undergo apoptosis, and die. However, most of the times cells selectively block viral proteins while allowing cellular proteins to continue being made.
- the present invention provides pharmaceutical compositions and methods for treating Covid-19 infectious disease comprising administering to patient such pharmaceutical compositions comprising therapeutically effective amount of Cannabidiol wherein such administration of said pharmaceutical composition to the said patient produces an enhancement / augmentation of innate immunity of the patient due to at least one of the following effects, i) infected patient cells undergo apoptosis early after infection; ii) induction of interferon transcription in the patient; iii) induction of interferon-induced antiviral effectors in the patient.
- the present invention provides compositions and methods of preventing or reducing mutation of Sars-Cov-2 virus in a patient wherein said method comprises administering a pharmaceutical composition comprising therapeutically effective amount of cannabidiol to a patient suffering from Covid-19 by causing infected patient cells to undergo apoptosis early after infection which renders them not available to the virus for mutation.
- the present invention also provides pharmaceutical compositions and methods for prophylaxis or prophylactic treatment of Covid-19 infectious disease comprising administering to mammal / human such pharmaceutical compositions comprising therapeutically effective amount of Cannabidiol wherein such administration of said pharmaceutical composition to the said mammal / human produces an enhancement / augmentation of innate immunity of the patient due to at least one of the following effects, i) induction of interferon transcription in the patient; ii) induction of interferon-induced antiviral effectors in the patient.
- compositions of the present invention are used for prophylaxis or prophylactic treatment of the Covid-19 infectious disease, it has been surprisingly found that no cells of such mammal / human who has not been infected undergo any apoptosis showing that these methods and compositions ‘prime’ the system of mammal / human to respond to virus, but don’t alone cause the system to start to die.
- Cannabidiol compositions and methods thus prepare even heathy individual for threat of the virus without causing harm to any cells.
- induction of interferons or induction of interferon induced anti-viral effectors are observed which also surprisingly do not cause apoptosis of uninfected / healthy cells.
- the interferons most commonly induced in both cases i.e while treating patients and while prophylactically treating mammals / human not infected by the virus include include Type II and Type III interferons.
- the most common interferon induced antiviral effectors found in both cases i.e while treating patients and while prophylactically treating mammals / human not infected by the virus include OAS1, Mxl, IFIT1 genes.
- the present invention also provides compositions comprising therapeutically effective amount of Cannabidiol and methods for mammals and humans who are about to encounter virus or about to get infected due to various reasons. These humans are sometimes at higher risk because they are from a region where wave of pandemic is stronger. They are at higher risk because they are front line workers or health workers or have co-morbidities or they are quarantined because they have come in contact with patient, or they are frequent travelers. This category also includes mammals and humans who are not at higher risk but they are still about to get infected.
- Initial infection with a virus does not cause severe disease (the estimated infectious dose is 1000 virions). Illness only occurs when the virus enters cells and hijacks the cellular machinery to replicate, forming 1000s or millions of new virions.
- the host cells are primed by induction of interferons and higher transcription of interferon induced anti -viral effector such as OAS1, so that they are better prepared to undergo apoptosis once they also encounter virus (but not harmful in the absence of virus). This indicates a potential that CBD ‘primes’ cells to be ready to respond to a viral threat, upon expression of viral genes.
- OAS1 interferon induced anti -viral effector
- the present invention provides a pharmaceutical compositions and methods for administering compositions comprising therapeutically effective amount of Cannabidiol for use in preventing or better preparing for Covid-19 infectious disease in mammals / humans who are about to get infected Covid-19 infectious disease wherein administration of said pharmaceutical composition to the mammal / human produces an enhancement / augmentation of innate immunity in such mammal / human due to at least one of the following effects, i) induction of interferon transcription in the mammal / human; iii) induction of interferon-induced antiviral effectors in the mammal / human; wherein such induction is not associated with apoptosis of cells in the beginning enabling cells to get primed / prepared for viral threat and wherein such cells are better able to prepare for infection including increase in the infectious dose of virions to the organism than usual dose and wherein the cells undergo apoptosis early after infection which renders the cells not available to the virus for replication and / or mutation.
- the present invention includes a number of experiments carried out using a plasmid transfected with viral proteins.
- HEK293 human embryonic kidney cells were chosen for transfecting with various viral proteins.
- HEK293 were seeded in 96 well plates, then transfected with plasmids expressing an empty control vector (pCMV-3Tag-3a) or vectors expressing the viral Orf8, OrflO or M proteins.
- pCMV-3Tag-3a empty control vector
- Orf8 OrflO or M proteins expressing the viral Orf8, OrflO or M proteins.
- a few hours later the cells were treated with 1 mM of the cannabinoid, then grown for 24 hours, and assayed using a colorimetric ELISA that detects BrdU incorporation.
- BrdU is incorporated into the nucleus of dividing cells, and therefore can provide a relative measure of cell proliferation.
- measures of BrdU incorporation can only be interpreted to indicate changes in cell proliferation rate after the data are normalized to the relative number of cells that are present and being measured.
- a decrease in BrdU incorporation could mean that cell proliferation rates are lower, or it could mean that cell proliferation rates are not different, but that there are fewer cells being measured.
- Viral proteins did not have much impact on BrdU incorporation of HEK293 (human embryonic kidney) cells. Although no significant impact was observed, a slight reduction in BrdU incorporation rates of HEK293 (human embryonic kidney) cells was observed with all viral proteins where reduction was higher than that of a reduction where a control plasmid expressing a control vector was used. For HEK293 (human embryonic kidney) cells, even a control plasmid expressing a control vector was a foreign body, but no significant reduction in BrdU incorporation due to the control plasmid was observed.
- the BrdU incorporation level into DNA was measured by incorporating and quantifying bromodeoxyuridine (BrdU) into DNA of actively proliferating cells.
- the absorbance values are measured by ELISA assay with a BioTek Synergy HI Hybrid Multi-Mode Microplate reader assay at 370 nm (reference wavelength: approx. 492 nm).
- Figures 1 - 5 provide results of the tests performed.
- Figure 6 combines data from all figures for ready comparison. The absorbance is expressed as % untreated control and the absorbance values are normalized. The absorbance value reflects the average quantity of BrdU incorporated into nuclei of cells in each well of cells, as DNA of these cells have incorporated bromodeoxyuridine which is measured in the assay.
- pCMV-3Tag-3A The absorbance when cells are transfected with a plasmid expressing an empty control vector (pCMV-3Tag-3a) is taken as a control.
- pCMV-3Tag-3A is a control vector that expresses a very small protein comprised of 3 FLAG tags in tandem (the amino acid sequence is DYKDDDDKDYKDDDDKDYKDDDDK. All absorbance values are to be compared to the control value. A significant deflection from the control value should reflect either reduction or enhancement in BrdU incorporation. It could reflect a difference in cell proliferation, or it could reflect a difference in cell number, indicating enhancement of cell apoptosis, which would reduce the number of cells per well.
- the viral infected cells are simulated by transfecting cells with a plasmid expressing different viral proteins. Transfected cells are grown for 24 hrs in order to allow time for viral protein expression before they are assayed using a colorimetric ELISA that detects BrdU incorporation. No significant deflection but a slight reduction is observed in absorbance values, which indicates that viral proteins alone have no, or only a very small inhibitory effect on BrdU incorporation.
- Cannabidiol The effects of Cannabidiol on viral infected cells are simulated by treating cells transfected with a plasmid expressing different viral proteins with Cannabidiol. Transfected cells are grown for 24 hrs in order to allow time for viral protein expression before they are assayed using a colorimetric ELISA that detects BrdU incorporation. Surprisingly, after treatment with cannabinoids, significant reductions in absorbance are observed.
- Cannabidiol impacted BrdU incorporation levels of HEK293 (human embryonic kidney) cells transfected with all three viral proteins of SARS-CoV-2. There is a significant reduction in each case.
- Cannabidiol in untreated cells as well as in cells transfected with a control plasmid expressing a control vector does not reduce cell proliferation. This is an indication of tremendous potential of Cannabidiol in impacting either cell number or cell proliferation in infected cells.
- Interferons are produced as a response to entry of virus. However, interferons stop cell proliferation and increase apoptosis, which would reduce cell numbers and also reduce BrdU incorporation. Therefore, even when interferons are produced, it is likely to cause a reduction in absorbance. Thus, reduction in absorbance may reflect an enhanced production of interferons, and an increase in the innate intracellular response to these SARS-CoV-2 genes.
- the present study provides such an early defense mechanism, where cells due to presence of Cannabidiol either rapidly produce interferons upon viral protein expression at viral entry or cause apoptosis of infected cells as a result of cellular defense.
- Figures 7A, 7B and 7C provide BrdU incorporation / cell proliferation, where the measure of the relative incorporation of BrdU is normalized to relative cell number per well, for cells transfected with ORF8, ORF10 and M protein respectively and treated with Cannabidiol. It also provides cells transfected with a control plasmid and treated with Cannabidiol. It is noted that there is no significant difference in BrdU incorporation / cell proliferation rate when it is normalized to cell number, i.e. there is no reduction in cell proliferation rate when cells transfected with a control plasmid or with viral protein are treated with Cannabidiol.
- Figure 7E provides relative cell number when cells are transfected with either a control plasmid or plasmid expressing ORFIO and treated with Cannabidiol.
- Figure 7F provides relative cell number when cells are transfected with either a control plasmid or plasmid expressing M protein and treated with Cannabidiol.
- Crystal violet assay provides that for cells transfected with each viral protein and treated with Cannabidiol, there is a significant reduction in relative cell number. This signals at apoptosis of cells treated with Cannabidiol and necessitates apoptosis studies.
- Cannabidiol although it does not exert any significant effect on cells that are transfected with a control plasmid (empty plasmid), exerted unique and significant effects on cells that are transfected with a plasmid expressing the viral Orf8, OrflO or M proteins.
- This study unfolds several avenues for use of Cannabidiol for Covid-19. First, this reflects that the Cannabidiol may be able to differentiate and distinguish between a non-infected and infected cells and act accordingly.
- Apoptotic cell death is a highly regulated process that is characterized by stereotypical and morphological changes of the cellular architecture including Cell shrinkage, plasma membrane blebbing, cell detachment, externalization of phosphatidylserine, nuclear condensation and ultimately DNA fragmentation (Taylor, R. C. et al, 2008 and Henry, C. M., 2013).
- phosphatidylserine concentration rises outside the cell.
- pSIVA is a marker of early apoptosis that binds to phosphatidylserine, which rises in concentration on the outside of cells when apoptosis begins, and fluoresces after binding.
- PI Propidium iodide
- PI can only enter cells when they are in a later stage of apoptosis, where the cell and nuclear membranes have become permeable and begun to fragment, which allows PI to enter into cells.
- This fluorescence is read in a plate reader, which detects pSIVA and PI at different excitation/emission spectra, and so both can be present, but are read separately.
- HEK293 human embryonic kidney cells are chosen for the studies. Cells were seeded in 96-well plates at a density of 10 4 cells per well, then grown to 60-70% confluence. 2. Then cells are either transfected with a control plasmid expressing a control vector viz. pCMV-3Tag-3A, or transfected with plasmids expressing ORF8, ORFIO, or M-protein. These transfections are done in duplicate.
- One side is treated with CBD, and one side is treated with ethanol (0.01% v/v final concentration).
- the pORF8 and pORFlO plasmids express ORF8 or ORFIO, each tagged with 3xFLAG tag (so pCMV-3-Tag-3A is essentially a perfect control), while the M- protein is tagged with green fluorescent protein.
- pCMV-3Tag-3A represents a control plasmid that is a small, foreign DNA, expressing a small, foreign transcript that is not viral in origin.
- the fluorescence readings gives a relative measure of the proportion of cells in a well that are in either the early stage or late stage of apoptosis at 24 hours.
- the experiment is initiated with a fixed number of cells. However, when the experiment is conducted over 24 hrs., due to cell apoptosis, cells get detached and fragmented. Early and late apoptosis markers read adherent cells and hence it is necessary to take a measure of the relative number of cells in a well, when the apoptosis assay is completed.
- the density of cells per well is estimated by staining cells after an assay with a cell- stain like crystal violet. Crystal violet is then eluted from cells, and the absorbance per well is measured. The higher the absorbance, the greater the number of cells.
- the next step is to normalize the measures on apoptosis (i.e. total fluorescence for pSIVA and total fluorescence for PI) to relative cell number, by dividing those fluorescence values by the crystal violet absorbance measures.
- Figures 8A and 8B provide respectively an early and late apoptosis data of HEK293 (human embryonic kidney) cells transfected with i) control plasmid expressing control vector and ii) plasmid expressing viral protein ORF8; and then treated with Cannabidiol.
- Cannabidiol treated cells which are transfected with control plasmid do not show any significant change in early as well as late apoptosis but Cannabidiol treated cells which are transfected with plasmid expressing viral protein ORF8 have exhibited significantly greater early apoptosis and late apoptosis.
- CBD did not increase the proportion of cells entering into early or late stages of apoptosis.
- CBD did significantly enhance apoptosis entry and the proportion of cells found to be in late-stage apoptosis.
- cannabidiol is already present in the human body at the time of virus entry, or is taken at the same time as virus entry, it can even prevent infection due to its early intervention and act prophylactically.
- ORFIO and Apoptosis Figures 12A and 12B provide early apoptosis and late apoptosis data in cells transfected with a control plasmid or viral plasmid expressing ORFIO and treated with Cannabidiol.
- Cannabidiol has provided a greater cellular response to ORFIO than to control plasmid, indicating that CBD helps cells to recognize, and respond to SARS-CoV- 2 genes. Cannabidiol’ s augmentation of the apoptotic response to ORFIO expression relative to vehicle control is not significant.
- Figures 15A and 15B provide early apoptosis and late apoptosis data in cells transfected with a control plasmid or viral plasmid expressing M protein and treated with Cannabidiol.
- Figure 9A provides Interferon Lambda 1 mRNA levels produced when cells expressing ORF8 or a control plasmid are treated with Cannabidiol. It also provides comparison of production of Interferon Lambda 1 levels between the cells expressing ORF8, but not treated with CBD and control treated cells not treated with Cannabidiol.
- CBD significantly increased expression of Interferon lambda 1 at 24 hours versus treatment with vehicle alone, indicating that CBD augments this anti-viral response to ORF8.
- CBD did not significantly affect INF lambdal expression in cells transfected with a control plasmid, indicating that CBD specifically augments the anti -viral response to a SARS-Cov- 2 gene.
- Cannabidiol is certainly augmenting the innate immune response upon transfection with viral proteins by significantly elevating levels of Interferon lambda 1 in just 24 hours. Elevation in levels of interferons is essentially an interesting finding. Interferon elevation in the human body as a response to viral entry stimulates interferon stimulated genes also called as interferon stimulated antiviral effectors. If these genes are found in a human body, it is a confirmation of body’s augmented immune response and a condition where healthy individuals are better able to fight with the infection and patients are better able to handle Covid-19 infection because the situation would not worsen.
- OAS1 levels in a non-infectious state were associated with reduced COVID-19 susceptibility and severity. Further analyses suggested that a Neanderthal isoform of OAS1 in individuals of European ancestry affords this protection. Thus, evidence from MR and a case -control study support a protective role for OAS1 in COVID- 19 adverse outcomes. Available pharmacological agents that increase OAS1 levels could be prioritized for drug development. ”
- OAS1 significant enhancement in levels of OAS1 gene is a confirmation to select Cannabidiol as a therapeutic agent in Drug Development.
- the interferon-stimulated genes are not found to be upregulated upon transfection with ORF8 alone, but only with ORF8 and Cannabidiol, although interferon gamma is significantly upregulated by transfection of cells with a plasmid expressing ORF8, even without added Cannabidiol.
- ORF8 is an accessory protein that has been proposed to interfere with immune responses of the host. The very protein which interferes with the immune response of the host will be unable to exert any effect in the presence of Cannabidiol because in the present case ORF8 is expressed and still, OAS1 has been produced in significant amount.
- OAS1 gene expression is not significantly elevated compared to levels in vehicle-treated cells transfected with control plasmid. This indicates that an individual exposed to viral protein in absence of Cannabidiol is not able to produce interferons and interferon-induced antiviral effectors such as OAS1 in significant amounts. Also, the fact that Cannabidiol either had a lesser effect, or no effect on control -transfected cells, indicates a high margin of safety.
- This OAS1 expression can increase more than 10-fold, more than 20-fold and more than 30-fold when viral protein is introduced to make an individual better ready to fight against Covid-19. Stimulation of Interferons and interferon-stimulated antiviral effectors - ORFIO protein
- CBD significantly increased expression of Interferon gamma which is an indication of augmentation of immunity.
- Expression of Interferon gamma is also seen in Cannabidiol treated cells transfected with a control plasmid. This expression in the absence of viral protein increases 3-4 folds in presence of viral protein ORFIO.
- Cannabidiol significantly augments the innate immune response in cells expressing ORFIO.
- CBD significantly augmented the induction of OAS1 in response to ORFIO, compared to cells treated only with vehicle.
- the OAS1 induction in response to ORFIO plus CBD was lower than the induction in response to CBD plus control plasmid. Nevertheless, CBD did augment this anti -viral response in cells transfected with either plasmid.
- Cannabidiol induced both INF-lambda 1 and INF-lambda 2/3 in cells expressing M-protein, indicating that Cannabidiol augments the interferon response to this SARS-CoV-2 protein and augments the innate immune response. Cannabidiol did not cause an induction of INF-lambda 1, or interferons lambda 2/3 in cells transfected only with control plasmid.
- Mxl is another interferon induced anti-viral effector.
- Cells transfected with M protein and treated with Cannabidiol have higher expression of Mxl than cells transfected with control vector and treated with Cannabidiol. This indicates a potential that CBD ‘primes’ cells to be ready to respond to a viral threat, upon expression of viral genes.
- CBD treatment led to enhanced expression of Mxl in cells expressing M-protein compared to cells overexpressing control plasmid, indicating an enhanced anti-viral response in the presence of this viral gene.
- Cannabidiol augments interferons and interferon-induced anti-viral effectors even in the absence of viral proteins. This is a strong reason to select Cannabidiol as a prophylactic medicine where CBD may help to prime this aspect of the innate immune response.
- IFIT1 interferon-induced protein with tetratricopeptide repeats
- Cells transfected with both control plasmid and M protein and treated with cannabidiol have exhibited elevated expression of IFIT1 relative to cells treated with vehicle alone. This augmentation was lower in the cells expressing M-protein than in cells expressing control plasmid, but it was still a significant augmentation, indicating that CBD may help to prime this aspect of the innate immune response.
- CBD augments early and late apoptosis induction, 24 hours after cells are transfected with viral genes, which suggests that CBD can help cells to fight off an initial infection.
- Infected host cells apoptose and host machinery is not available for viral replication and mutation.
- the induction of apoptosis early after viral transcripts appear in a cell is highly protective against infection. Viruses enter cells, and then ‘hijack’ the cellular machinery to begin producing new virus. This is what results in a wide-spread infection, and it is also the time when mutations can be introduced to the viral genome (i.e. during replication of the viral genome), resulting in the emergence of new variants.
- apoptosis causes fragmentation of the cellular organelles, and eventually the cell.
- ORF8 Early apoptosis in cells expressing ORF8 is highly significant as this very protein is proposed to interfere with immune responses of host. ORF8 is unique in that it maybe dispensible in viral replication but it has a unique role of evading immune surveillance of host cells i.e. it has a role in the way virus evades immunity of host cells.
- CBD does not increase early or late apoptosis in control transfected cells versus vehicle alone, indicating a high degree of safety of CBD and that effects of the combination of CBD and SARS-CoV-2 viral proteins are specific.
- Interferons and Interferons induced anti-viral effectors 4. Induction of interferons results in an innate, intracellular, anti -viral host defense that does not require immune cells, per se.
- interferons There are different types of interferons. Type 1 (alpha and beta) tend to slow down proliferation, and also regulate cell survival. Type II (gamma) tends to also regulate both cell survival and proliferation.
- Type III interferons i.e. Lambda-type interferons
- Type II and III interferons tend to force cells towards apoptosis, much more so than Type I or II.
- CBD treatment played dual roles. It expressed interferons in cells transfected with viral proteins but also in cells transfected with a control plasmid and treated with Cannabidiol. Thus it is seen that CBD prepares host for viral threats even in the absence of virus.
- Some of the interferon induced anti -viral effectors that are expressed during treatment with Cannabidiol include Mxl, IFIT1 and OASl.
- IFIT is short for ‘interferon-induced protein with tetratricopeptide repeats’. It binds to RNAs that lack a signature methylation sequence (indicating foreign (and possibly viral) origin) to inhibit their translation - and therefore is an innate cellular mechanism that functions to help stop viral mRNA from being translated into protein. It also “interacts with other cellular proteins to expand their contribution to regulation of the host antiviral response by modulating innate immune signaling and apoptosis.” Inducing IFIT, therefore, should help to slow viral replication. CBD enhanced IFIT1 transcription in control -transfected cells, and in cells expressing M-protein.
- MX1 Dynamin-Like GTPase myxovirus resistance protein 1
- IFN type I and/or type III i.e. INF lambda
- Mxl inhibits the transcription of viral RNA.
- Bizzotto Juan et al (Bizzotto Juan et al , 2020) reports that MX1 levels increase with increasing viral load in SARS CoV-2 infection. Mxl transcription is enhanced by a combination of CBD and ORF8 or CBD and M-protein. https://pubmed.ncbi.nlm.nih.gov/32989429/ 8.
- OAS1 stands for Oligoadenylate synthetases (OAS), which are a family of interferon-stimulated genes that can induce RNA degradation in virus by activating RNaseL.
- OAS1 transcript levels were significantly enhanced by treatment with CBD in cells expressing control plasmid, or ORF8, ORF10, or M-protein, versus vehicle control treatment. This would be expected to significantly enhance apoptosis in response to viral presence, or to prime cells to be prepared for a viral infection, allowing a more rapid anti-viral, pro-apoptotic response to viral infection. Augmenting induction of OAS1 gene is associated with a dramatic protection against SARS-CoV-2 (and people with higher expression are less likely to get sick).
- Cannabidiol has multiple pathways through which it enhances immune response of the host cells. It prepares host cell for viral threat and can act as a prophylactic medicine. The minor increase in OAS1 expression and INF- gamma in control -transfected cells treated with CBD indicates a potential that CBD ‘primes’ cells to be ready to respond to a viral threat, without actually increasing apoptosis. On the other hand, remarkable increase in interferons and interferon- induced effector genes have been found to enhance immune response of the cell when cells transfected with viral proteins are treated with Cannabidiol. Cannabidiol causes early and late apoptosis in cells transfected with ORF8 and M protein.
- apoptosis is due to Cannabidiol alone or through increased levels of Type III interferons (i.e. Lambda-type interferons), which tend to force cells towards apoptosis, it makes infected host cells not available to the virus to replicate and mutate.
- Type III interferons i.e. Lambda-type interferons
- Cannabidiol can also improve outcomes of existing immunization strategies for COVID-19 including but not restricted to by reducing the chances of transmission of viral particles following vaccination and before a full immune response in the individual is mounted, while also preventing the expansion of the viral gene pool through prevention of mutation.
- SARS-CoV-2 can still generate novel variants when mutation occurs during viral replication, since viral replication occurs during the time between cell infection, and activation of an effective and full humoral acquired (also called adaptive) immune response. This activation can take hours to days, and therefore even vaccinated people can still spread the virus, and produce mutants, during this interval.
- Cannabidiol can prevent viral replication and therefore the formation of novel SARS-CoV-2 variants.
- Cannabidiol can also be candidate for including but not restricted to prophylaxis for travelers, essential workers and other high risk individuals to potentially control the spread of the virus within the host as well as transmission to others. Further the potential to prevent mutations becomes significant, especially for travelers who may be susceptible to introducing non indigenous strains into new geographies which may increase variants.
- Cannabidiol also has regulatory approval for pediatric use in patients as young as 1 year of age for rare forms of epilepsy. Therefore, its potential for use in children who may be asymptomatic carriers and/or reservoirs of Sars-CoV-2 and other viruses, cannot be undermined, for prophylaxis, to reduce chances of community spread and increased variants and mutations. Cannabidiol can potentially be also administered to new born babies as a mono-treatment with Cannabidiol or as a prophylactic or as an adjunct therapy for Sars-CoV-2 and other viruses.
- a suitable dose / therapeutically effective amount of Cannabidiol (CBD) is from 0.00001 mg / kg of body weight to 4000 mg / kg of body weight.
- the suitable dose / therapeutically effective amount of Cannabidiol can also be 0.00001 to 1000 mg / kg of body weight or 0.00001 to 500 mg / kg of body weight.
- the preferred dose / preferred therapeutically effective amount of Cannabidiol can be 0.00001 to 100 mg / kg of body weight or from 0.00001 to 10 mg / kg of body weight.
- dose will depend on the nature and status of human or animal patient health. It will also depend on age and comorbidities if any. Further, dose will depend on type of composition for example, whether oral or parenteral or topical. Following pharmaceutical formulations / compositions are described for better understanding of the invention and they do not limit scope of the invention in any way.
- Suitable oral dosage forms include but are not restricted to tablets - sublingual, buccal, effervescent, chewable; troches, lozenges, dispersible powders or granules and dragees; capsules, solutions, suspensions, syrups, lozenges, medicated gums, buccal gels or patches. Tablets can be made using compression or molding techniques well known in the art.
- the other dosage forms can also be prepared by 3Dimensional (3D) or 4D printing and also by Carbon graphene loaded nano particles and micro-particles.
- Gelatin or non-gelatin capsules can be formulated as hard or soft capsule shells, which can encapsulate liquid, solid, and semisolid fill materials, using techniques well known in the art. Following examples provide various Pharmaceutical compositions of the Cannabidiol (CBD)
- the Oral Spray formulation encompasses the Cannabidiol (CBD) ; each at concentration of 0.00001 mg to 200 mg /ml and have excipients such as diluents viz. Mannitol ranging from 10 - 15 mg / ml; Sweeteners such as sucralose from 5- 10 mg / ml, Flavours as Raspberry, Strawberry from 5-10 mg / ml and tonicity and taste modulators such as sodium chloride and propylene glycol from 0.1-0.5 mg / ml with purified water as the base solvent or carrier.
- the specific gravity of the formulation can be between 1.01 to 1.5 g/ml
- the said Oral Spray may encompass surfactant- solubilizers and gelling agents such as Pluronic FI 27 or Poloxamer 407 in the concentration ranging from 1 - 200 mg / ml.
- This formulation is liquid at temperatures less than 10 degree Celsius and starts gelling at temperature range above 30 degree Celsius. It is a sterile, nonpyrogenic solution.
- the pH range if reconstituted should be 5-9 preferably 6.5-7.5. It can be administered using appropriate spray containers with specialised spray nozzle to facilitate spray below the tongue viz. sublingually or into the buccal or also the nasal cavity.
- the Spray can also be in the form of a micronized or nanosized suspension.
- the Nasal Spray formulation would be devoid of the sweeteners and flavours.
- the specific gravity of the formulation can be between 1.01 to 1.7 g/ml
- the Injection formulation contains the Cannabidiol (CBD); at concentration of 0.00001 mg to 200 mg /ml and solubilizers such as Ethyl alcohol 20% / ml and Propylene glycol 40% / ml and Water for injection -40% / ml.
- CBD Cannabidiol
- solubilizers such as Ethyl alcohol 20% / ml and Propylene glycol 40% / ml and Water for injection -40% / ml.
- the solution should be isotonic and tonicity adjusting salts such as sodium chloride can be used.
- the pH range of 5-9 can be adjusted with suitable bufferants should be 6 - 8 preferably 6.5-7.5. It is a sterile, nonpyrogenic solution.
- the said Injection formulation can be in the form of a solution or micronized or nanosized dispersion.
- the said formulation can also be administered via inhalation with or without the aid of a medical device, metered or unmetered, and/or via nebulization for nasal administration for drug delivery to the lungs - viz. Pulmonary .
- the said formulation can also be administered via the buccal route as buccal drops or as buccal spray using appropriate medical device.
- the said formulation can be administered via the sublingual route as sublingual drops or as sublingual spray using appropriate medical device.
- Another variant of the sterile injectable formulation can also be a lyophilized injection. This injection may also contain sodium citrate dihydrate and citric acid anhydrous; and finally, be as a white to yellow lyophilized powder or plug.
- the solution should be prepared only with 1 to 2 mL of preservative-free Sterile Sodium Chloride Injection, 0.9 percent or preservative-free Sterile Water for Injection.
- the reconstituted solution is clear, slightly yellow and essentially free from visible particles.
- the specific gravity of the formulation can be between 1.01 to 1.7 g/ml.
- the particle size of the liquid droplets can range from 5 micron to 500 micron.
- the Inhalation or Pulmonary Capsule has the Cannabidiol (CBD) concentration of 0.00001 mg to 50 mg/capsule and has excipients such as Magnesium stearate [Inhalation grade] or Lactose [Inhalation grade].
- CBD Cannabidiol
- the core weight of the formulation can range from 25 - 500 mg/ capsule.
- the Aerosol or Pulmonary delivery system has the Cannabidiol (CBD) concentration of 0.00001 mg to 100 mg / actuation and has excipients such as propellent gases, propylene glycol, water, surfactants, anti -foam emulsion and anti freeze excipients.
- CBD Cannabidiol
- the particle size of the liquid droplets can range from 5 micron to 500 micron.
- Sublingual Tablets have the Cannabidiol (CBD); at concentration of 0.00001 mg to 50 mg /tablet and have excipients such as diluents viz. Lactose monohydrate or Mannitol ranging from 10 - 30 mg / tablet;
- CBD Cannabidiol
- Disintegrants such as Starch or Crospovidone from 10- 15 mg / tablet; fillers such as Microcrystalline cellulose from 5-10 mg / tablet and lubricants such as Magnesium stearate from 0.5 - 1 mg / tablet. It may additionally contain or 5-10 mg / tablet of taste modulating or masking agents such as sodium chloride or buffers such as potassium dihydrogen phosphate.
- the core weight of the formulation can range from 50 - 80 mg/ tablet.
- the Orally Dispersible Tablets have the Cannabidiol (CBD) at concentration of 0.00001 mg to 100 mg/tablet and have excipients such as diluents viz. Lactose monohydrate or Mannitol ranging from 10 - 15 mg / tablet; Disintegrants such as Starch or Crospovidone from 10- 15 mg / tablet; fillers such as Microcrystalline cellulose from 5-10 mg / tablet and lubricants such as Magnesium stearate from 0.5 - 1 mg / tablet.
- the core weight of the formulation can range from 50 - 80 mg/ tablet.
- the Buccal Tablets have the Cannabidiol (CBD)at concentration of 0.00001 mg to 100 mg /tablet and have excipients such as polymers viz. polymers of acrylic acid and C10-C30 alkyl acrylate crosslinked with allyl pentaerythritol exemplified by Carbopol 934 ranging from 10 - 15 mg / tablet and or Hydroxy Propyl Methyl Cellulose (HPMC) K4M from 35-40 mg / tablet; Fillers such as Mannitol (directly compressible) from 10- 15 mg / tablet; and lubricants such as Magnesium stearate from 0.5 - 1 mg / tablet.
- the core weight of the formulation can range from 50 - 80 mg/ tablet.
- the Delayed Release Tablets have the Cannabidiol (CBD) at concentration of 0.00001 mg to 200 mg /tablet and have excipients such as Mannitol, Microcrystalline cellulose (MCC PH 102), tri sodium phosphate, Hydroxy Propyl Methyl Cellulose (HPMC 5cps), Hydroxy Propyl Methyl Cellulose (HPMC 15cps) and Crospovidone, Colloidal silicon dioxide, Magnesium stearate as the tablet core coated with a Seal Coating composition encompassing Ethyl cellulose using an appropriate solvent system viz.
- CBD Cannabidiol
- MCC PH 102 Microcrystalline cellulose
- HPMC 5cps Hydroxy Propyl Methyl Cellulose
- HPMC 15cps Hydroxy Propyl Methyl Cellulose
- Crospovidone Colloidal silicon dioxide
- Magnesium stearate as the tablet core coated with a Seal Coating composition encompassing Ethyl cellulose using
- aqueous, non-aqueous preferably non-aqueous ( Iso-propyl alcohol and Dichloromethane) to a 4-5% weight gain on the tablet cores finally coated with an aqueous gastro-resistant coating composition viz. Eudragit L100-55, Triethyl citrate, opacifier and colorant to a total weight gain of 26-30% of the tablet cores.
- the core weight of the formulation can range from 50 - 1200 mg/ tablet.
- the Extended Release Tablets have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /tablet and have excipients such as fillers viz. Microcrystalline cellulose (MCC PH 101); polymers viz Hydroxy Propyl Methyl Cellulose (HPMC K100M) and Hydroxy Propyl Methyl Cellulose (HPMC K15M); binders viz. Povidone (PVP K29/32) and Lubricants viz. Magnesium stearate as the tablet core coated with a Film Coating composition using an appropriate solvent system viz.
- CBD Cannabidiol
- aqueous or non-aqueous preferably non-aqueous (Iso-propyl alcohol and Dichloromethane) to a 2-3% weight gain on the tablet core.
- the core weight of the formulation can range from 50 - 1200 mg/ tablet.
- the Effervescent tablets have the Cannabidiol (CBD) at concentration of 0.00001 mg to 200 mg /tablet and have excipients such as citric acid, sodium bicarbonate, potassium citrate, mannitol, aspartame, strawberry flavour, bufferants, sodium benzoate and polyethylene glycol 6000.
- the core weight of the formulation can range from 50 - 2000 mg/ tablet.
- the Osmotic-controlled Release Oral delivery System (OROS) Tablets have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /tablet and have excipients such as sorbitan monolaurate and Sodium chloride, microcrystalline cellulose (MCC PH 102), polymers viz Hydroxy Propyl Methyl Cellulose (HPMC K100M) and Hydroxy Propyl Methyl Cellulose (HPMC K15M), Colloidal silicon dioxide and Magnesium stearate as the tablet core; a Film coat to the tablet cores to a weight gain of 2.5 to 3.0 % w/w to the tablet core using a non-aqueous medium and a Functional Coat the tablet with Cellulose acetate non-aqueous dispersion in Iso-propyl alcohol to a weight gain of 25-30% w/w of the tablet core finally Laser drilled the tablets with an orifice of 150 - 250 micron.
- the core weight of the formulation can
- the Capsules have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /capsule and have excipients such a microcrystalline cellulose (MCC PH 105), Colloidal silicon dioxide and Magnesium stearate as the core; encompassed in a hard gelatin capsule.
- the core weight of the formulation can range from 30 - 2055 mg/ capsule.
- the Compressed lozenges or Chews or Lollipop have the Cannabidiol (CBD) at concentration of 0.00001 mg to 200 mg /unit and have excipients such as ethoxylated hydrogenated castor oil Polyoxyl 35 Castor oil ( Cremophore EL/ Kolliphor EL), Dextrate, Polyethylene glycol 6000, microcrystalline cellulose (MCC 102), povidone (PVP K29/32) and FD&C Yellow No. 6 and Magnesium stearate as the core.
- the core weight of the formulation can range from 100 - 3000 mg/ unit
- the Soft Gel Capsules have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /capsule and have excipients such as propylene glycol, Poly Ethylene Glycol -400, Polyvinyl pyrrolidone K29/32, Butylated hydroxy toluene and ethanol- water blend as the core material filled into opaque soft gelatin capsules.
- the core weight of the formulation can range from 100 - 800 mg/ capsule.
- the Quick dissolving film - Oral and or Sublingual have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /unit and have excipients such as pullulan, sorbitol, polysorbate 80, sucralose, Monoammonium glycyrrhizinate and peppermint flavour.
- CBD Cannabidiol
- the core weight of the formulation can range from 50 - 800 mg/ unit
- the Oro-Buccal muco-adhesive film - Oral or Sublingual have the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /unit and have excipients such as Hydroxypropyl cellulose, Hydroxyethyl cellulose and Sodium carboxymethyl cellulose, Polyoxyl 35 Castor Oil (Cremophore EL/ Kolliphor EL), Sodium benzoate, Parahydroxybenzoate methyl, Parahydroxybenzoate propyl, Sodium citrate and Sodium saccharine.
- the core weight of the formulation can range from 50 - 80 mg/ unit.
- the Oral Emulsion has the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /g and have excipients such as Polyoxyl 35 Castor Oil (Cremophore EL/ Kolliphor EL), Saccharin Sodium, caramel, colorant, peppermint oil, corn oil, sucrose and water.
- the specific gravity of the formulation can be between 0.5 - 1.5 g/ml
- the Vaginal gel has the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /g and has excipients such as Polyoxyl 35 Castor Oil (Cremophore EL/ Kolliphor EL), ascorbic acid, Glycerin or Propylene glycol, Hydroxypropyl Methylcellulose (HPMC E50), Trisodium Citrate dihydrate and water.
- CBD Cannabidiol
- excipients such as Polyoxyl 35 Castor Oil (Cremophore EL/ Kolliphor EL), ascorbic acid, Glycerin or Propylene glycol, Hydroxypropyl Methylcellulose (HPMC E50), Trisodium Citrate dihydrate and water.
- the specific gravity of the formulation can be between 1.01 - 1.8 g/ml.
- the Eye drop formulation has the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /ml and has excipients such as Polysorbate 20/ 80, Benzalkonium chloride, disodium EDTATE, Sodium Carboxymethyl Cellulose (Na CMC), Citric acid monohydrate, sodium hydroxide, hydrochloric acid and water.
- the final solution is sterile.
- the specific gravity of the formulation can be between 1.01 - 1.8 g/ml.
- the Suppository formulation has the Cannabidiol (CBD)at concentration of 0.00001 mg to 200 mg /g and has excipients such as hard fat, surfactants, and the following inactive ingredients: butylated hydroxy anisole, butylated hydroxytoluene, edetic acid, glycerin, polyethylene glycol 3350, polyethylene glycol 8000, purified water and sodium chloride.
- CBD Cannabidiol
- the core weight of the formulation can range from 200- 3000 mg/ unit
- the bromodeoxyuridine incorporation rate was measured by incorporating and quantifying bromodeoxyuridine (BrdU) into DNA of actively proliferating cells.
- the absorbance values are measured by ELISA assay with a BioTek Synergy HI Hybrid Multi-Mode Microplate reader assay at 370 nm (reference wavelength: approx. 492 nm).
- Figures 1 - 5 provide results of the tests performed. Note, however, that cell proliferation level can only be inferred once the data are normalized to cell number.
- Figure 6 combines data from all figures for ready comparison. The absorbance is expressed as % untreated control. In Figure 7, data are normalized to relative cell number.
- Relative cell numbers were quantified using the crystal violet staining, as previously described by Duncan, R.E., et al [Duncan, R.E., et al, 2004] Briefly, cells seeded in 96-well plates were gently washed with lx phosphate buffered saline (PBS) after BrdU incorporation assay or Apoptosis assay, fixed with 10% methanol 10% acetic acid and stained with crystal violet. Absorbance of the samples was measured in a plate reader at 595 nm.
- PBS lx phosphate buffered saline
- Detection of apoptotic cells was performed using the Apoptosis Assay Kit (Abeam, ab 129817), according to the manufacturer's instructions. Briefly, 24h after transfection, cultured cells seeded in 96-well plates were labelled with Polarity Sensitive Indicator of Viability & Apoptosis (pSIVA, which detects early/ongoing apoptosis) and with Propidium Iodide (PI, which detects late apoptosis). Fluorescence of the samples was measured in a plate reader at 469/525 nm (for the detection of pSIVA) and 53 l/647nm (for the detection of PI).
- pSIVA Polarity Sensitive Indicator of Viability & Apoptosis
- PI Propidium Iodide
- Example 4 Methods for measuring levels of interferons and effectors gene expression
- qPCR quantitative polymerase chain reaction
- RNA samples Quantification of RNA samples was performed using a Nanodrop 2000 Spectrophotometer (Thermo Fisher, Waltham, MA), and 2 pg of RNA was used to synthesize cDNA via oligo(dT) priming using the Superscript II Reverse Transcriptase, according to the manufacturer’s protocol (Invitrogen, Waltham, MA).
- cDNA was diluted 1:4 and 1 pi was added to a master mix with 9 pi of PerfeCTa SYBR® Green supermix (Quanta Bio, Beverly, MA), 0.5 pi forward and reverse primers (25 pM each) of the targeted gene (please see list below), and 3 pi of ddH20.
- IFN-gamma Forward 5'-TGGCTTTTCAGCTCTGCATC-3' IFN-gamma - Reverse5'-CCGCTACATCTGAATGACCTG-3' IFN-epsilon 1 - Forward 5' - GAGGCCCCCAAAAAGGAGTC - 3' IFN-epsilonl - Reverse 5' - AGGTTCCCATCGGCCACATA - 3'
- IFN epsilon 2-3 forward 5'-CTGCCACATAGCCCAGTTCA-3'
- Cannabidiol protects livers against nonalcoholic steatohepatitis induced by high-fat high cholesterol diet via regulating NF-KB and NLRP3 inflammasome pathway. J Cell Physiol. 2019;234(11):21224-34. Hassan S, Eldeeb K, Millns PJ, Bennett AJ, Alexander SP, Kendall DA. Cannabidiol enhances microglial phagocytosis via transient receptor potential (TRP) channel activation. Br J Pharmacol. 2014;171(9):2426-39.
- TRP transient receptor potential
- Ryan D Drysdale AJ, Lafourcade C, Pertwee RG, Platt B. Cannabidiol targets mitochondria to regulate intracellular Ca2+ levels. J Neurosci. 2009;29(7):2053- 63.
- Valvassori SS Valvassori SS, Bavaresco DV, Scaini G, Varela RB, Streck EL, Chagas MH, et al.
- Acute and chronic administration of cannabidiol increases mitochondrial complex and creatine kinase activity in the rat brain.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Virology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Pulmonology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Physiology (AREA)
- Nutrition Science (AREA)
- Zoology (AREA)
- Otolaryngology (AREA)
- Dispersion Chemistry (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3179022A CA3179022A1 (en) | 2020-07-18 | 2021-03-30 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 |
| IL296892A IL296892A (en) | 2020-03-29 | 2021-03-30 | Interaction of sars-cov-2 proteins through a molecular or cellular mechanism of host cells and compounds for the treatment of covid -19 |
| JP2022560025A JP2023528561A (ja) | 2020-03-29 | 2021-03-30 | 宿主細胞の分子および細胞メカニズムとSARS-CoV-2タンパク質との相互作用、およびCOVID-19を治療するための製剤 |
| MX2022012165A MX2022012165A (es) | 2020-03-29 | 2021-03-30 | Interaccion de proteinas de sars-cov-2 con mecanismos moleculares y celulares de celulas huespedes y formulaciones para tratar covid-19. |
| US17/915,862 US20240226120A1 (en) | 2020-03-29 | 2021-03-30 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 |
| AU2021247269A AU2021247269A1 (en) | 2020-03-29 | 2021-03-30 | Interaction of SARS-CoV-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat Covid-19. |
| BR112022019649A BR112022019649A2 (pt) | 2020-03-29 | 2021-03-30 | Interação das proteínas sars-cov-2 com mecanismos moleculares e celulares de células hospedeiras e formulações para tratar o covid-19 |
| EP21781346.8A EP4126913A4 (en) | 2020-03-29 | 2021-03-30 | INTERACTION OF SARS-COV-2 PROTEINS WITH MOLECULAR AND CELLULAR MECHANISMS OF HOST CELLS AND FORMULATIONS FOR THE TREATMENT OF COVID-19 |
| CN202180038369.XA CN115968375A (zh) | 2020-03-29 | 2021-03-30 | SARS-CoV-2蛋白与宿主细胞的分子和细胞机制的相互作用以及治疗COVID-19的制剂 |
| US18/016,762 US20240024337A1 (en) | 2020-07-18 | 2021-07-19 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 |
| AU2021313476A AU2021313476A1 (en) | 2020-07-18 | 2021-07-19 | Interaction of SARS-CoV-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. |
| IL300014A IL300014A (en) | 2020-07-18 | 2021-07-19 | Interaction of SARS-Cov-2 proteins through a molecular or cellular mechanism of host cells and compounds for the treatment of Covid-19 |
| JP2023503508A JP2023537229A (ja) | 2020-07-18 | 2021-07-19 | SARS-CoV-2タンパク質と宿主細胞の分子機構および細胞機構との相互作用、およびCOVID-19を処置するための製剤 |
| EP21845882.6A EP4181917A4 (en) | 2020-07-18 | 2021-07-19 | INTERACTION OF SARS-COV-2 PROTEINS WITH MOLECULAR AND CELLULAR MECHANISMS OF HOST CELLS AND FORMULATIONS FOR TREATING COVID-19 |
| CA3189802A CA3189802A1 (en) | 2020-07-18 | 2021-07-19 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. |
| PCT/IN2021/050699 WO2022018754A1 (en) | 2020-07-18 | 2021-07-19 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN202021013770 | 2020-03-29 | ||
| IN202021013770 | 2020-03-29 | ||
| IN202021030633 | 2020-07-18 | ||
| IN202021030633 | 2020-07-18 | ||
| IN202021054151 | 2020-12-12 | ||
| IN202021054151 | 2020-12-12 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/016,762 Continuation US20240024337A1 (en) | 2020-07-18 | 2021-07-19 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2021199078A2 true WO2021199078A2 (en) | 2021-10-07 |
| WO2021199078A3 WO2021199078A3 (en) | 2021-12-09 |
Family
ID=77927896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IN2021/050325 Ceased WO2021199078A2 (en) | 2020-03-29 | 2021-03-30 | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19. |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20240226120A1 (https=) |
| EP (1) | EP4126913A4 (https=) |
| JP (1) | JP2023528561A (https=) |
| CN (1) | CN115968375A (https=) |
| AU (1) | AU2021247269A1 (https=) |
| BR (1) | BR112022019649A2 (https=) |
| IL (1) | IL296892A (https=) |
| MX (1) | MX2022012165A (https=) |
| WO (1) | WO2021199078A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115531315A (zh) * | 2022-12-05 | 2022-12-30 | 上海惠盾因泰生物科技有限公司 | 重组人干扰素λ1鼻喷雾剂及其用途 |
| EP4186496A4 (en) * | 2020-07-24 | 2024-08-07 | Academy of Military Medical Sciences | USE OF CANNABIDIOL IN THE TREATMENT OF CORONAVIRUS INFECTIONS |
| EP4181917A4 (en) * | 2020-07-18 | 2024-10-30 | Akseera Pharma Corp. | INTERACTION OF SARS-COV-2 PROTEINS WITH MOLECULAR AND CELLULAR MECHANISMS OF HOST CELLS AND FORMULATIONS FOR TREATING COVID-19 |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003080043A1 (en) * | 2002-03-18 | 2003-10-02 | Immugen Pharmaceuticals, Inc. | Topical formulations of resorcinols and cannibinoids and methods of use |
| EP1559423A1 (en) * | 2004-02-02 | 2005-08-03 | Nederlandse Organisatie Voor Toegepast-Natuurwetenschappelijk Onderzoek Tno | Medicinal acidic cannabinoids |
| WO2012012498A2 (en) * | 2010-07-20 | 2012-01-26 | Pulmatrix, Inc. | Use of trp channel agonists to treat infections |
| NL2009671C2 (en) * | 2012-10-19 | 2014-04-23 | Fytagoras B V | New antiviral use for acidic cannabinoids. |
| WO2017011785A1 (en) * | 2015-07-15 | 2017-01-19 | National Concessions Group Inc. | Topical antiviral formulations and methods of using the same |
| WO2020257588A1 (en) * | 2019-06-20 | 2020-12-24 | Shaman Naturals, Llc | Compositions for preventing and treating viral infections |
| CN115916336A (zh) * | 2020-02-19 | 2023-04-04 | 施里玛·麦钱特 | 大麻二酚的组合物和治疗用途 |
| US11338010B2 (en) * | 2020-03-30 | 2022-05-24 | Suzhou Kintor Pharmaceuticals, Inc. | Systems, methods, and kits for diagnostics and treatment of viral respiratory infection |
| US20230181484A1 (en) * | 2020-05-11 | 2023-06-15 | Add Advanced Drug Delivery Technologies Ltd. | Uses and Formulations of Cannabinoids |
| US20230338396A1 (en) * | 2020-05-14 | 2023-10-26 | Augusta University Research Institute, Inc. | Cannabidiol as a therapeutic modality for covid-19 |
| CA3179022A1 (en) * | 2020-07-18 | 2021-10-07 | Akseera Pharma Corp. | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 |
| CN120789031A (zh) * | 2020-07-24 | 2025-10-17 | 中国人民解放军军事科学院军事医学研究院 | 大麻二酚在制备治疗冠状病毒感染的药物中的用途 |
-
2021
- 2021-03-30 EP EP21781346.8A patent/EP4126913A4/en not_active Withdrawn
- 2021-03-30 IL IL296892A patent/IL296892A/en unknown
- 2021-03-30 US US17/915,862 patent/US20240226120A1/en not_active Abandoned
- 2021-03-30 AU AU2021247269A patent/AU2021247269A1/en active Pending
- 2021-03-30 BR BR112022019649A patent/BR112022019649A2/pt not_active IP Right Cessation
- 2021-03-30 MX MX2022012165A patent/MX2022012165A/es unknown
- 2021-03-30 CN CN202180038369.XA patent/CN115968375A/zh active Pending
- 2021-03-30 JP JP2022560025A patent/JP2023528561A/ja active Pending
- 2021-03-30 WO PCT/IN2021/050325 patent/WO2021199078A2/en not_active Ceased
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4181917A4 (en) * | 2020-07-18 | 2024-10-30 | Akseera Pharma Corp. | INTERACTION OF SARS-COV-2 PROTEINS WITH MOLECULAR AND CELLULAR MECHANISMS OF HOST CELLS AND FORMULATIONS FOR TREATING COVID-19 |
| EP4186496A4 (en) * | 2020-07-24 | 2024-08-07 | Academy of Military Medical Sciences | USE OF CANNABIDIOL IN THE TREATMENT OF CORONAVIRUS INFECTIONS |
| CN115531315A (zh) * | 2022-12-05 | 2022-12-30 | 上海惠盾因泰生物科技有限公司 | 重组人干扰素λ1鼻喷雾剂及其用途 |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112022019649A2 (pt) | 2022-12-27 |
| WO2021199078A3 (en) | 2021-12-09 |
| US20240226120A1 (en) | 2024-07-11 |
| MX2022012165A (es) | 2023-01-24 |
| CN115968375A (zh) | 2023-04-14 |
| JP2023528561A (ja) | 2023-07-05 |
| AU2021247269A1 (en) | 2022-12-01 |
| EP4126913A4 (en) | 2024-09-18 |
| IL296892A (en) | 2022-12-01 |
| EP4126913A2 (en) | 2023-02-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Levy et al. | Can phytotherapy with polyphenols serve as a powerful approach for the prevention and therapy tool of novel coronavirus disease 2019 (COVID-19)? | |
| US20240226120A1 (en) | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 | |
| US20180185374A1 (en) | Inhibitors of mtor kinase as anti-viral agents | |
| US20240024337A1 (en) | Interaction of sars-cov-2 proteins with molecular and cellular mechanisms of host cells and formulations to treat covid-19 | |
| Sadri Nahand et al. | Virus, exosome, and MicroRNA: new insights into autophagy | |
| CA3179698A1 (en) | System, method and use of a certain medication for reducing viral replication in the airways mucosae | |
| Guo et al. | Pyroptosis in glioma: current management and future application | |
| Silva et al. | Autophagy modulators in coronavirus diseases: a double strike in viral burden and inflammation | |
| US20230201244A1 (en) | Compositions and methods for preventing and/or treating microbial infections | |
| Große et al. | Evidence that quinine exhibits antiviral activity against SARS-CoV-2 infection in vitro | |
| US11273170B2 (en) | Methods of treating cancer | |
| Randhawa et al. | Modulation of autophagy by SARS-CoV-2: a potential threat for cardiovascular system | |
| EP4351610A1 (en) | Method and composition for preventing and treating covid-19 and long covid | |
| Abdin et al. | Artesunate effect on schistosome thioredoxin glutathione reductase and cytochrome c peroxidase as new molecular targets in Schistosoma mansoni-infected mice | |
| Zhou et al. | Luteolin-borneol complex, a novel pharmaceutical preparation for aquaculture against NNV infection | |
| Cursaro et al. | A Focus on Natural Autophagy Modulators as Potential Host‐Directed Weapons Against Emerging and Re‐Emerging Viruses | |
| US20220323402A1 (en) | Treatment, amelioration or prevention of a viral infection | |
| Jassey et al. | SIRT-1 connects autophagy and release of virus-containing vesicles during picornavirus infection | |
| Cheng et al. | Hesperidin Is a Potential Inhibitor against SARS-CoV-2 Infection. Nutrients. 2021; 13: 2800 | |
| Kandimalla et al. | Exosome-mediated antiviral testing system and identification of Punicalagins and Anthocyanidins as promising antiviral agents against SARS-CoV-2 | |
| Tomar et al. | Potential therapeutic landscape of COVID-19: molecular targets, repurposed drugs, and nano-and cell-based intervention | |
| US20240254489A1 (en) | Compositions and methods of targeting the pax6 signaling pathway to reduce formation of amyloid beta plaques and neurofibrillary tangles | |
| Zhang et al. | AIF-mediated mitochondrial pathway is critical for the protective effect of diazoxide against SH-SY5Y cell apoptosis | |
| Khales et al. | Amlodipine and diltiazem significantly repress human rotavirus infection in vitro | |
| Chang | Exploring the Blocking Capacity of Traditional Chinese Medicine on the Interaction Between Viral Spike Protein and Angiotensin Converting Enzyme II Using COVID-19 Pseudovirus System |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21781346 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2022560025 Country of ref document: JP Kind code of ref document: A Ref document number: 3179022 Country of ref document: CA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112022019649 Country of ref document: BR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021781346 Country of ref document: EP Effective date: 20221031 |
|
| ENP | Entry into the national phase |
Ref document number: 2021247269 Country of ref document: AU Date of ref document: 20210330 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21781346 Country of ref document: EP Kind code of ref document: A2 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112022019649 Country of ref document: BR Free format text: APRESENTAR NOVO CONTEUDO ELETRONICO DE LISTAGEM DE SEQUENCIAS BIOLOGICAS, UMA VEZ QUE O APRESENTADO TEM OMISSAO DE CAMPOS OBRIGATORIOS (CAMPOS 150-151). |
|
| ENP | Entry into the national phase |
Ref document number: 112022019649 Country of ref document: BR Kind code of ref document: A2 Effective date: 20220929 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2021781346 Country of ref document: EP |