WO2021195325A1

WO2021195325A1 - Anti-coronavirus compositions, assays, and methods related thereto

Info

Publication number: WO2021195325A1
Application number: PCT/US2021/024071
Authority: WO
Inventors: Brian Murphy; Sarah Elizabeth COOK; Niels Pedersen; Mark Olsen
Original assignee: The Regents Of The University Of California
Priority date: 2020-03-25
Filing date: 2021-03-25
Publication date: 2021-09-30

Abstract

Materials, including antiviral compounds and compositions, and methods for treating a coronavirus infection are provided. The methods include administering two or more compounds with antiviral activity which target the virus via different mechanisms and/or exhibit different pharmacokinetic properties, and thereby provide improved therapeutic outcomes as compared with monotherapy. Methods for identifying mammalian coronavirus therapies, such as therapies for treating feline infectious peritonitis virus infections are also provided.

Description

ANTI-CORONA VIRUS COMPOSITIONS, ASSAYS, AND METHODS RELATED

THERETO

SEQUENCE LISTING

[0001] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 23, 2021, is named 7020_003PCTl_SL.txt and is 1,207 bytes in size.

BACKGROUND

[0002] The world is racing for assays, treatments, and vaccines for coronavimses, particularly SARS-CoV-2 (aka COVID 19). Previous methods have proven useful in identifying anti-coronavims therapies including protease inhibitors (Pedersen et ah, J Feline Med Surg. 2018;20(4):378-392) and nucleoside polymerase inhibitors (Pedersen et ah, J Feline Med Surg. 2019;21(4):271-281). Other recent efforts at discovering therapies to treat or prevent Covid-19 have identified: GS-5734 (Remdevisir) (Holshue, et ah, NEJM 2020; 382:929-936): chloroquine (e.g., clinicaltrials.gov/ct2/show/NCT04303507), combinations of GS-5734 (Remdesivir) and chloroquine (Wang et al. Cell Res. 2020; 30(3):269-271); and other possible therapies (see, e.g., possible Covid-19 treatments reviewed in Guangdi Li & Erik De Clercq, Nature Reviews Drug Discovery 19, 149-150 (2020)). GS-5734 (Remdevisir) was previously identified as a possible Ebola Vims treatment (Warren et al. Nature. 2016;531(7594):381-385). Many coronavimses have no approved treatments. Consequently, there is an urgent and unmet need for the identification of therapeutic interventions for the treatment of coronavimses.

SUMMARY

[0003] The present disclosure features materials and methods for treating a coronavims infection, including methods of reducing viral load, reducing the time to viral clearance, and also reducing morbidity or mortality in the clinical outcomes, in patients infected by a coronavims or suffering from a coronavims infection. Compositions for the treatment of a coronavims infection are provided. The present disclosure further provides methods of reducing the risk that an individual will develop a pathological coronavims infection that has clinical sequelae and/or the risk that an individual will transmit coronavims to others.

[0004] The present disclosure also features compositions providing a combination of compounds with antiviral activity, which target the virus via different mechanisms and/or exhibit different pharmacokinetic properties, and thereby provide improved therapeutic outcomes. The compositions can increase viral RNA inhibition and decrease RNA copy number associated with coronavims infections. The compositions disclosed herein are surprisingly effective at reducing viral load compared to the activity of the compounds when administered as monotherapies.

[0005] The present disclosure also features a method for identifying mammalian coronavims therapies, such as therapies for treating feline infectious peritonitis vims infections.

[0006] In a first aspect, the present disclosure features a composition including: (a) at least one protease inhibitor (PI), or a pharmaceutically-acceptable salt or prodrug thereof; and (b) at least one a nucleoside polymerase inhibitor (NPI), or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier, optionally the molar ratio of PLNPI in the composition is within the range of about 40000:1 to 5:1. The composition can further include at least one selective estrogen receptor modulator (SERM), or a pharmaceutically-acceptable salt or prodrug thereof, optionally the molar ratio of SERM:NPI is about 20:1 to 5:1. The at least one PI can be selected from the group consisting of K777, 3C protease inhibitors, 3C-like protease inhibitors, GC376, lopinavir, ritonavir, grazoprevir and nelfinavir, or a pharmaceutically- acceptable salt or prodrug thereof. The at least one NPI can be GS441524, or a pharmaceutically- acceptable salt or prodrug thereof. The at least one SERM can be selected from the group consisting of clomiphene, tamoxifen, raloxifene, ospemifene, and toremifene, or a pharmaceutically-acceptable salt or prodmg thereof.

[0007] In another aspect, the present disclosure features a composition including: (a). At least one protease inhibitor (PI) with anti-viral activity, or a pharmaceutically-acceptable salt or prodmg thereof; and (b) at least one anti-malarial with anti-viral activity, or a pharmaceutically acceptable salt or prodmg thereof, in a pharmaceutically acceptable carrier, optionally the molar ratio of the PI: anti-malarial in the composition is within the range of about 4000:1 to 0.5:1. The composition can further include at least one selective estrogen receptor modulator (SERM) with anti-viral activity, or a pharmaceutically-acceptable salt or prodmg thereof, optionally the molar ratio of the SERM:PI in the composition is within the range of about 1:4000 to 1:0.5. The at least one SERM with anti-viral activity can be clomiphene or toremifene, or a pharmaceutically- acceptable salt or prodrug thereof. The at least one PI with anti- viral activity can be selected from the group consisting of K777, 3C protease inhibitors, 3C-like protease inhibitors, GC376, lopinavir, ritonavir, grazoprevir and nelfinavir, or a pharmaceutically-acceptable salt or prodrug thereof. The composition can include at least one nucleoside polymerase inhibitor with anti-viral activity selected from the group consisting of: GC376, lopinavir, ritonavir, grazoprevir and nelfinavir or a pharmaceutically-acceptable salt or prodrug thereof.

[0008] In another aspect, the present disclosure features a composition including GC376, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of GS-441524, amodiaquine, K777, toremifene, nelfinavir and ritonavir; or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier. The composition can include GS-441524, optionally the molar ratio of GC376:GS-441524 in the composition is within the range of about 40000:1 to 500:0. The composition can include amodiaquine, optionally the molar ratio of GC376:amodiaquine in the composition is within the range of about 4000:1 to 50:0. The composition can further include toremifene, optionally the molar ratio of GC376:toremifene in the composition is within the range of about 4000:1 to 50:0. The composition can include nelfinavir mesylate, optionally the molar ratio of GC376: nelfinavir mesylate in the composition is within the range of about 4000: 1 to 50:0.

[0009] In another aspect, the present disclosure features a composition including GS- 441524, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of GC376, amodiaquine, K777, toremifene, nelfinavir, and ritonavir; or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier. The compound can be GC376. The compound can be amodiaquine, optionally the molar ratio of GC -441524: amodiaquine in the composition is within the range of about 20: 1 to 0.5. The composition can further include toremifene, optionally the molar ratio of GC- 441524 Toremifene in the composition is within the range of about 20:1 to 0.5.

[0010] In another aspect, the present disclosure features a composition including K777, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of lopinavir and toremifene, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier. The compound can be lopinavir, optionally the molar ratio of K777: lopinavir in the composition is within the range of about 10:1 to 0.1:1. [0011] In another aspect, the present disclosure features a composition including lopinavir, or a pharmaceutically-acceptable salt or prodrug thereof, and ritonavir, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier, optionally the molar ratio of lopinavinritonavir in the composition is within the range of about 10:1 to 0.1:1. The composition can further include toremifene, optionally the molar ratio of lopinavir: toremifene in the composition is within the range of about 10:1 to 0.1:1.

[0012] In another aspect, the composition according to any one of the aspects and embodiments above can be formulated for intravenous, subcutaneous, ocular, dermal, mucosal, oral, rectal, or parenteral administration.

[0013] In another aspect, the composition according to any one of the aspects and embodiments above can further include at least one anti-coronavims agent selected from the group consisting of: 3C-like protease inhibitor, 3C protease inhibitor, non-steroidal selective estrogen receptor modulator, anti-malarial, and nucleoside polymerase inhibitor.

[0014] In another aspect, the composition according to any one of the aspects and embodiments above can further include at least one anti-malarial agent selected from the group consisting of quinine, a quinine derivative, chloroquine, a chloroquine derivative, artemisinin, and an artemisinin derivative.

[0015] In another aspect, the composition according to any one of the aspects and embodiments above can include 0.01 to 98% by weight active agent.

[0016] In another aspect, the pharmaceutically acceptable carrier of the composition according to any one of the aspects and embodiments above can include an excipient selected from the group consisting of water, hydro alcoholic solvents, organic solvents, cosolvents, osmotic agents, pH buffering agents, complexation agents, solubility enhancers, suspending agents, bulking agents, viscosity modifiers, antimicrobial agents, sustained release agents, and preservatives.

[0017] In another aspect, the present disclosure features a method to limit coronavims replication in a subject in need thereof including administering the composition according to any one of the aspects and embodiments above to said subject in a replication-limiting effective amount, optionally the subject is a human.

[0018] In another aspect, the present disclosure features a method to inhibit coronavims in a subject in need thereof including administering the composition according to any one of the aspects and embodiments above to said subject in a coronavims-inhibiting effective amount, optionally the subject is a human.

[0019] In another aspect, the present disclosure features a method of treating a coronavirus infection in a subject in need thereof including administering: a composition including a therapeutically effective amount of a first protease inhibitor (PI), or a pharmaceutically acceptable salt or prodrug thereof; and a composition including a therapeutically effective amount of one or more of a second protease inhibitor (PI), a selective estrogen receptor modulator (SERM), an antimalarial agent, and a nucleoside polymerase inhibitor (NPI), or a pharmaceutically acceptable salt or prodrug thereof, wherein the first and second Pis are not the same, optionally the subject is a wild or domesticated felid. The coronavirus infection can cause feline infectious peritonitis (FIP). The subject can be a cat at least 12 months old. The cat can have neurologic FIP. The cat can have FlP-associated ocular disease. The FIP is a wet form of FIP. The first PI can be selected from the group consisting of GC376, K777, and lopinavir, or a pharmaceutically acceptable salt or prodrug thereof. A dose of 10 mg/kg to 50 mg/kg GC376 can be administered every 12 hours. The first and second Pis, or pharmaceutically effective salts or prodmgs thereof can be administered in combination, and the second PI can be selected from the group consisting of K777, nelfinavir, lopinavir, and ritonavir, or a pharmaceutically acceptable salt or prodrug thereof. The method can further include administering the composition comprising the SERM, or pharmaceutically effective salts or prodrugs thereof. The compositions can include the first PI and the antimalarial agent, or the pharmaceutically acceptable salts or prodrug thereof are administered, and the antimalarial agent can be amodiaquine or pharmaceutically effective salts or prodmgs thereof. The method can further include administering the composition that includes the SERM, optionally the SERM is toremifene. The compositions including the first PI and the NPI, or the or pharmaceutically acceptable salts or prodrug thereof can be administered in combination, and the NPI can be GS-441524, and optionally 1.0 to 4.0 mg/kg GS-441524 can be administered every 24 hours. The administration can be oral, buccal, nasal, mucosal, rectal, subcutaneous, ocular, intraperitoneal, pulmonary, or intrathecal administration. The administration can achieve at least a 100,000-fold reduction in viral titer in 24 hours. The first PI, or pharmaceutically acceptable salts or prodrug thereof, can be administered daily for at least two weeks. The composition including GC376, or a pharmaceutically acceptable salt or prodrug thereof can be administered with a composition including GS-441524, amodiaquine, K777, toremifene, or a pharmaceutically acceptable salt or prodrug thereof. Compositions comprising GC376, amodiaquine, and toremifene, or pharmaceutically acceptable salts or prodrugs thereof can be administered together. [0020] In another aspect, the present disclosure features a method of identifying an anti- coronavirus therapy, the method including: identifying a plurality of putative anti-coronavirus compounds with known mechanisms of antiviral activity; contacting a cell with the identified anti- coronavirus compound in vitro to identify active compounds producing no more than low cytotoxicity; combining at least one identified active compound having a first mechanism of anti viral activity and at least one identified active compound having a second mechanism of anti-viral activity to form a putative combined anti-coronavirus therapy (CACT), wherein the first and second mechanisms are not the same; and identifying an effective CACT by contacting a coronavirus infected cell in vitro with the putative CACT, collecting the RNA from the cell, and quantifying the level of RNA replication inhibition, wherein the effective CACT produces a greater level of inhibition than the sum of the identified active compounds contained therein. The method can further include administering the effective CACT to a subject in need of anti- coronavirus therapy. The step of identifying a putative anti-coronavirus compound can include viral plaquing, optionally with feline infectious peritonitis virus (FIPV). The cytotoxicity can be assessed in a feline cell, optionally a feline renal cell line. The coronavirus infected cell can be a FIPV infected cell, optionally a feline renal cell.

BRIEF DESCRIPTION OF THE FIGURES

[0021] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0022] This written disclosure describes illustrative embodiments that are non-limiting and non-exhaustive. The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments discussed in the present document.

[0023] Reference is made to illustrative embodiments that are depicted in the figures, in which:

[0024] FIG. 1 is a pie chart showing total compounds screened categorized by drug category (left) and compounds identified with anti-FIPV activity by drug category (right), according to one or more embodiments of the present disclosure. [0025] FIGs. 2A-B are color images showing efficacy of test compounds for cellular protection from viral cytopathic effect based on crystal violet staining intensity (viral plaquing assay): (A). Sample screening plate; (B) Results with compounds of interest, according to one or more embodiments of the present disclosure.

[0026] FIGs. 3A-B describe the EC50 for compounds identified by the colorimetric assay: (A) shows a table identifying the drug name, drug class, and EC50 of some of the identified compounds; (B) shows a non-linear EC50 regression curve for Elbasvir.

[0027] FIG. 4 is a bar graph showing the results of viral RNA knock-down assays to quantify FIPV replication inhibition by the listed compounds, according to one or more embodiments of the present disclosure.

[0028] FIGs. 5A-D shows cell morphology for infected CRFK cells that received elbasvir treatment (C) relative to uninfected, normal CRFK cells (A, B), and infected CRFK cells (D). [0029] FIGs. 6A-C show results of viral RNA knock-down assays to quantify the FIPV replication inhibition for identified anti-coronavims compounds, according to one or more embodiments of the present disclosure. (A) includes the fold reduction in viral titre and compares these results to the additive reduction based on the single compound approach in (B); (C) is a bar graph showing specific combinations that exhibit an improvement relative to monotherapy that is greater than additive.

[0030] FIG. 7 shows results of viral RNA knock-down assays to quantify the FIPV replication inhibition of combinations that did not exhibit an improvement relative to monotherapy.

[0031] FIG. 8 is a flowchart describing method 100 for identifying anti-coronavirus agents for monotherapy and also effective for combined anti-coronavims therapy, according to one or more embodiments of the present disclosure.

DETAILED DESCRIPTION

[0032] Broadly, the assays, compositions of matter, and related methods herein have usefulness in coronavims therapy identification, treatment, and diagnosis.

Definitions

[0033] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, primates, including simians and humans.

[0034] It will be appreciated that therapeutic and prophylactic methods described herein are applicable to humans as well as any suitable animal, including, without limitation, companion animals, dogs, cats, and other pets (e.g., ferrets), wild and zoo animals (e.g., felids), livestock (e.g., mink) as well as, laboratory animals, rodents, primates, horses, cattle, pigs, etc. The methods can be also applied for clinical research and/or study.

[0035] As used herein, the term “coronavirus” includes any member of the family Coronaviridae, including, but not limited to, any member of the genus Coronavirus, and any member of the genus Torovirus. The term “coronavirus” further includes naturally-occurring (e.g., wild-type) coronavirus; naturally-occurring coronavirus variants; and coronavirus variants generated in the laboratory, including variants generated by selection, variants generated by chemical modification, and genetically modified variants (e.g., coronavirus modified in a laboratory by recombinant DNA methods).

[0036] As used herein, the terms “treatment,” “treating,” and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The terms “therapeutic” or “treat,” as used herein, refer to processes that are intended to produce a beneficial change in an existing condition (e.g., viral infection, disease, disorder) of a subject, such as by reducing the severity of the clinical symptoms and/or effects of the infection, and/or reducing the duration of the infection/symptoms/effects .

[0037] The terms “prophylactic” or “prevent,” as used herein, refer to processes that are intended to inhibit or ameliorate the effects of a future viral infection or disease to which a subject may be exposed (but is not currently infected with).

[0038] As used herein, a “therapeutically effective” amount refers to the amount that will elicit the biological or medical response of a tissue, system, or subject that is being sought by a researcher or clinician, and in particular elicit some desired therapeutic or prophylactic effect as against the viral infection by preventing and/or inhibiting viral replication. One of skill in the art recognizes that an amount may be considered therapeutically “effective” even if the condition is not totally eradicated or prevented, but it or its symptoms and/or effects are improved or alleviated partially in the subject. In some embodiments, the composition will comprise from about 5% to about 95% by weight of an antiviral compound described herein, and preferably from about 30% to about 90% by weight of the antiviral compound, based upon the total weight of the composition taken as 100% by weight. In some embodiments, combinations of more than one type of the described antiviral compounds can be included in the composition, in which case the total levels of all such compounds will preferably fall within the ranges described above.

[0039] The term “dosing event” as used herein refers to administration of an antiviral agent to a patient in need thereof, which event may encompass one or more releases of an antiviral agent from a drug dispensing device.

[0040] “Continuous delivery” as used herein (e.g., in the context of “continuous delivery of a substance to a tissue”) is meant to refer to movement of drug to a delivery site, e.g., into a tissue in a fashion that provides for delivery of a desired amount of substance into the tissue over a selected period of time, where about the same quantity of drug is received by the patient each minute during the selected period of time.

[0041] “Controlled release” as used herein (e.g., in the context of “controlled drug release”) is meant to encompass release of substance (e.g., one or more of the anti-coronaviral agents of the present disclosure) at a selected or otherwise controllable rate, interval, and/or amount, which is not substantially influenced by the environment of use. “Controlled release” thus encompasses, but is not necessarily limited to, substantially continuous delivery, and patterned delivery (e.g., intermittent delivery over a period of time that is interrupted by regular or irregular time intervals). [0042] “Patterned” or “temporal” as used in the context of drug delivery is meant delivery of drug in a pattern, generally a substantially regular pattern, over a pre-selected period of time (e.g., other than a period associated with, for example a bolus injection). “Patterned” or “temporal” drug delivery is meant to encompass delivery of drug at an increasing, decreasing, substantially constant, or pulsatile, rate or range of rates (e.g., amount of drug per unit time, or volume of drug formulation for a unit time), and further encompasses delivery that is continuous or substantially continuous, or chronic.

[0043] The term “controlled drug delivery device” is meant to encompass any device wherein the release (e.g., rate, timing of release) of a drug or other desired substance contained therein is controlled by or determined by the device itself and not substantially influenced by the environment of use, or releasing at a rate that is reproducible within the environment of use. [0044] By “substantially continuous” as used in, for example, the context of “substantially continuous infusion” or “substantially continuous delivery” is meant to refer to delivery of drug in a manner that is substantially uninterrupted for a pre-selected period of drug delivery, where the quantity of drug received by the patient during any 8 hour interval in the pre-selected period never falls to zero. Furthermore, “substantially continuous” drug delivery can also encompass delivery of drug at a substantially constant, pre-selected rate or range of rates (e.g., amount of drug per unit time, or volume of drug formulation for a unit time) that is substantially uninterrupted for a pre selected period of drug delivery.

[0045] “GC376” refers to the 3C and 3C-like protease inhibitor described in US 9,474,759

B2, having the chemical structure below:

(Chemical Name: Sodium (2S)-2-((S)-2-(((benzyloxy)carbonyl)amino)-4-methylpentanamido)- l-hydroxy-3-(2-oxopyrrolidin-3-yl)propane-l-sulfonate; CiikLoN^NaOxS; Mol. Wt.: 507.53; CAS No: 1416992-39-6; Storage Condition: 0 °C (short term), -20 °C (long term), desiccated; Solubility: H₂0; Purity 98% by HPLC; Synonym: GC376, GC-376, GC 376, GC376 sodium;

InChl Key: BSPJDKCMFIPBAW-JPBGFCRCSA-M; InChl Code: lS/C21H31N308S.Na/cl- 13(2)10-16(24-21(28)32-12-14-6-4-3-5-7-14)19(26)23-17(20(27)33(29,30)31)11-15-8-9-22- 18(15)25;/h3-7,13,15-17,20,27H,8-12H2,l-2H3,(H,22,25)(H,23,26)(H,24,28)(H,29,30,31); /q;+l/p-l/tl5?,16-,17-,20?;/m0./sl; SMILES CODE: 0=S(C(0)[C@ @H](NC([C@ @H]

(NC(0CC1=CC=CC=C1)=0)CC(C)C)=0) CC2C(NCC2)=0)([0-])=0.[Na+]; References:

Pedersen NC, et al. Efficacy of a 3C-like protease inhibitor in treating various forms of acquired feline infectious peritonitis. J Feline Med Surg. 2018 Apr;20(4):378-392 and Takahashi D, et al. Structural and inhibitor studies of norovirus 3C-like proteases. Vims Res. 2013 Dec

26;178(2):437-44). [0046] “Amodiaquine” also known as Amodiaquin, Flavoquine, and Camoquine, is an anti- malarial agent having the chemical structure shown below:

(4- [(7 -chloroquinolin-4-yl)amino] -2-(diethylaminomethyl)phenol; Active Ingredient:

Amodiaquine Hydrochloride; Proprietary Name: Camoquin Hydrochloride; Dosage Form: Tablet; Route of Administration: Oral; Strength EQ 200MG Base; Reference Listed Drug: No; Reference Standard: No; Application Number: N006441; Product Number: 001; Approval Date: Approved Prior to Jan 1, 1982; Applicant Holder Full Name: Parke Davis Div Warner Lamber Co; Marketing Status: Discontinued (From Orange Book - Approved Drug Products)).

[0047] “GS-441524” refers a nucleoside polymerase inhibitor known as l'-cyano 4-aza-

7,9-dideazaadenosine C-adenosine nucleoside analogue, which is described in US 10,251,904, and has the chemical structure below:

(hydroxymethyl)tetrahydrofuran-2-carbonitrile; Molecular Formula: C12H13N5O4; Mol. Wt. 291.27; CAS No: 1191237-69-0; Storage Condition: 0°C (short term), -20 °C (long term), desiccated; Solubility: DMSO; Purity 98% by HPLC; Synonym: GS-441524; GS 441524; GS441524; Remdesivir-metabolite, GS-5734-metabolite; GS5734-metabolite; GS 5734- metabolite; IUP AC/Chemical Name: (2R,3R,4S,5R)-2-(4-aminopyrrolo[2,l-f][l,2,4]triazin-7- yl)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-carbonitrile; InChl Key:

B RD WIEO J O W J CLU -LT GWCKQ J S A-N ; InChl Code: lS/C12H13N504/cl3-4-

12(10(20)9(19)7(3- 18)21-12)8-2- 1-6- 11(14) 15-5- 16- 17(6)8/hl-2, 5, 7, 9- 10, 18-20H,3H2, (H2,14,15,16)/t7-,9-,10-,12+/ml/sl; SMILES Code: N#C[C@ @]1(C2=CC=C3C(N)=

NC=NN32)0[C@H](C0)[C@@H](0)[C@H]10; References: Pedersen NC, Perron M, Bannasch M, Montgomery E, Murakami E, Liepnieks M, Liu H., J Feline Med Surg. 2019 Apr;21(4):271-281 and Murphy BG, Perron M, Murakami E, Bauer K, Park Y, Eckstrand C, Liepnieks M, Pedersen NC., Vet Microbiol. 2018 Jun;219:226-233).

[0048] “GS-5734” refers to the nucleoside polymerase inhibitor (i.e., nucleoside analogue) having the chemical structure set forth below:

(Synonym: Remdesivir; GS-5734; Prodrug of GS-441524; IUP AC/Chemical Name: 2- ethylbutyl ((S)-(((2R,3S,4R,5R)-5-(4-aminopyrrolo[2,l-f][l,2,4]triazin-7-yl)-5-cyano-3,4- dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate

InChl Key: RWWYLEGWBNMMLJ-YSOARWBDSA-N; InChl Code: lS/C27H35N608P/cl-

4-18(5-2)13-38-26(36)17(3)32-42(37,41-19-9-7-6-8-10-19)39-14-21-23(34)24(35)27(15-28,40-

21)22- 12- 11-20-25(29)30- 16-3 l-33(20)22/h6- 12, 16- 18, 21, 23-24, 34-35H, 4-5, 13- 14H2,1-

3H3,(H,32,37)(H2,29,30,31)/tl7-,21+,23+,24+,27-,42-/m0/sl; SMILES Code: C[C@H]

(N[P @ @ ](OC 1 =CC=CC=C 1 )(OC [C@H]20[C@@] (C#N)(C3=CC=C4C(N)=NC=NN43)

[C@H](0)[C@@H]20)=0)C(0CC(CC)CC)=0). [0049] “K777”, also known as APC-3316, CRA-3316, and K- 11777, refers to the vinyl sulfone cysteine protease inhibitor having the chemical structure shown below:

(TV- [(2S)-1 -[[(£, 3S)-1 -(benzenesulfonyl)-5-phenylpent- 1 -en-3 -yl] amino] - 1 -oxo-3 -phenylpropan- 2-yl] -4-methylpiperazine- 1 -carboxamide) .

[0050] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0051] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0052] As used herein, the phrase “and/or”, when used in a list of two or more items, means that any one of the listed items can be employed by itself or any combination of two or more of the listed items can be employed. For example, if a composition is described as containing or excluding components A, B, and/or C, the composition can contain or exclude A alone; B alone; C alone; A and B in combination; A and C in combination; B and C in combination; or A, B, and C in combination.

[0053] It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a dose” includes a plurality of such doses and reference to “the method” includes reference to one or more methods and equivalents thereof known to those skilled in the art, and so forth.

[0054] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0055] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

A. Assays for identifying an anti-coronavirus therapy

[0056] The present disclosure features assays for identifying anti-RNA vims effective agents. For example, through rapid screening of a slate of putative antiviral compounds selected based on their efficacy in treating other RNA-viruses, the inventors identified a subset of compounds with strong anti-FIPV activity and characterized their safety and efficacy profiles in vitro.

[0057] In addition to identifying antiviral monotherapies, the inventors have developed methods to screen potential combinational therapy. Concurrently targeting FIPV at different steps of the virus life cycle with a combined anti-coronaviral therapy (CACT) showed a greater level of success than has been achieved with monotherapies alone.

[0058] Assays for the identification of antivirals with synergistic effect also provides valuable translatable applications towards treating other challenging or emerging viral diseases. [0059] The present invention describes the development of a set of in vitro assays enabling:

• rapid screening and identification of potential anti-coronaviral compounds,

• assessment of safety profiles, and

• determination of efficacy and quantify viral RNA inhibition.

Prior to the present the development of this assay, whether differing mechanisms of action would demonstrate antiviral activity with synergistic and superior anti-coronaviral efficacy compared to their use as sole agents was unknown.

[0060] RNA viruses like HIV, HCV and coronavirus have high viral mutation rates that sometimes results in the virus escaping from pharmacologic control. Drugs cocktail, such as the combination compositions described herein, simultaneously attack the virus at multiple steps of its lifecycle and reduce the ability of the virus to escape from pharmacologic control via mutation. Further, as a result of agent- specific pharmacokinetics and tissue distribution, antivirals used as monotherapies necessarily have limited distribution throughout the body. This is particularly true of limited and variable penetration of the central nervous system (brain and spinal cord) and eye (blood-brain and blood-eye barriers). Different antiviral compounds with variable tissue distribution used concurrently ideally have improved overall distribution throughout the body. [0061] An exemplary method 100 for identifying an anti-coronavirus therapy is provided in the flowchart in FIG. 8. In the method described herein, potential antivirals are initially screened as sole agents; successful agents with different mechanisms of action are then combined and the antiviral effects of the combination are assessed (CACT). Putative coronavirus-inhibiting compounds are initially selected based upon evidence of antiviral activity against other RNA viruses (e.g. human immunodeficiency virus, Dengue virus, hepatitis C virus, SARS coronavirus, MERS coronavirus). Thus, step 102 involves includes retrieving the evidence from one or more sources to identify a putative anti-coronavirus compound. Such evidence can be anecdotal, a case study in a medical journal, a presentation at a conference, a grant award publication, or a clinical trial, and obtained by database searches, internet searches, or by word of mouth. Step 104 includes performing an in vitro assay for anti-coronaviral activity. In some cases, the individual efficacies of putative compounds are assessed in vitro using feline infectious peritonitis virus (FIPV) in viral plaquing (96 well colorimetric assay, EC50) and viral RNA knock down assays (real time RT- PCR). In step 106, compounds showing in vitro efficacy are screened for cytotoxicity. For example, the compounds can be assessed for cytotoxicity in feline cells (e.g., feline (Felis catus) renal cell line (CRFK)), using a cytotoxicity assay (e.g., CellTox Green, Promega). In step 108, potent compounds having an EC50 < 15 micromolar with limited or no cytotoxicity (e.g., at 20 micromolar concentration) are grouped together based on the mechanism of action (i.e., the protease inhibitors including 3C-like or cysteine protease inhibitors can form one group and the NS5A inhibitors can form another group). In step 110, two or more compounds from different groups are combined (e.g., protease inhibitor combined with a nucleoside analog) to provide a putative CACT composition. In step 112, the combination is assessed (i.e., compounds are tested simultaneously (CACT)) for the ability to inhibit viral RNA replication (e.g., using a viral RNA knock down assay), and the combined effect is compared to the effect produced by each compound separately. Sometimes, the results for two or more antiviral agents used simultaneously can be expressed as fold reduction in viral titer, and compared to the fold reduction in of the monotherapy. Optionally, the results of any one of steps 106 and 112 can be validated in vivo in step 114. For example, CACTs in which the fold reduction in viral titer is greater than the additive effects of the monotherapies used alone (i.e., a synergistic combination) can be advanced to in vivo CACT studies in a coronavirus infected subject or patient. For example, a newly identified monotherapy or CACT with efficacy inhibiting FIPV replication or feline coronavirus replication can be tested in or used to treat FIPV infected cats.

B. Anti-coronavirus compositions and methods of treatment

[0062] The present disclosure features compositions for treating a viral infection from a coronavirus in a subject. In some cases, treatment with a composition described herein may prevent the development of observable morbidity from viral infection (i.e., near 100% prevention). In other cases, treatment may only partially prevent and/or lessen the extent of morbidity due to the viral infection (i.e., reduce the severity of the symptoms and/or effects of the infection, and/or reduce the duration of the infection/symptoms/effects). In some embodiments, the subject is afflicted with or suffering from a condition (e.g., infection, disease, or disorder) before the compounds are administered. Thus, the method can be useful for treating the condition and/or ameliorating the effects of the condition. In one or more embodiments, the methods are useful for reversing progression of the disease or condition. In other embodiments, the subject is free of a given condition before administering the compound, and the methods are useful for preventing the occurrence or incidence of the condition and/or preventing the effects of the condition (e.g., neurological FIP).

[0063] In use, a therapeutically-effective amount of an antiviral compound having anti- coronavirus activity (e.g., one or more antiviral agents identified using method 100) is administered to a subject. In some embodiments, a composition comprising a therapeutically- effective amount of an antiviral compound is administered to a subject. The compound or pharmaceutically acceptable salt or prodrug thereof will preferably be administered to the subject in an amount sufficient to provide active antiviral compound levels (independent of salt, if any) of from about 0.1 mg to about 1,000 mg of compound per kg of body weight of the subject, preferably from about 1 mg/kg to about 100 mg/kg of body weight of the subject, and more preferably from about 10 mg/kg to about 50 mg/kg of body weight of the subject. For a feline subject, the dosage can be about 0.0001 to about 100 mg/kg body weight per day; typically, from about 0.01 to about 10 mg/kg body weight per day; more typically, from about .01 to about 5 mg/kg body weight per day; most typically, from about .05 to about 0.5 mg/kg body weight per day. If the antiviral compound is in the form of a compound salt, for example, the compound may be administered in amounts greater than the above ranges to provide sufficient levels of the active compound. In one or more embodiments, treatment protocols include oral or parenteral administration, including intravenous, subcutaneous, intrathecal, and intramuscular routes, of at least one antiviral compound one to four times per day with a total daily dosage of from about 1 to about 200 mg/day per kg of the subject’s body weight for up to 24 weeks. Administration can be for from 1 day to 100 days, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, or 90 days. The administration can also be for from 1 week to 15 weeks, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 weeks. Longer periods of administration are also contemplated.

[0064] While it is possible for the active ingredients to be administered alone it may be preferable to present them as pharmaceutical formulations. The composition can include ingredients other than the active compound, such as adjuvants, other active agents, preservatives, buffering agents, salts, other pharmaceutically-acceptable ingredients known in the art of compounding or formulation. In this case “adjuvant”, refers to excipients generally (i.e., additives) but also to refer to substances that have immunopotentiating effects and are added to or co formulated in a therapeutic composition in order to enhance, elicit, and/or modulate the innate, humoral, and/or cell-mediated immune response against the active ingredients.

[0065] The active compounds described herein are formulated with conventional carriers and excipients, which will be selected in accord with ordinary practice. For example, generally, tablets will contain excipients, glidants, fillers, binders and the like. Aqueous formulations are prepared in sterile form, and when intended for delivery by other than oral administration generally will be isotonic. The pH of the formulations ranges from about 3 to about 11, but is ordinarily about 7 to 10. In some embodiments, the pH of the formulations ranges from about 2 to about 5, but is ordinarily about 3 to 4. The amount of each active ingredient that may be combined with the carrier material to produce a single dosage form will vary depending upon the subject, patient, or host being treated as well as the route or mode of administration. For example, a time-release formulation intended for oral administration to may contain approximately 1 to 1000 mg of each active agent or total active agent compounded with an appropriate and convenient amount of carrier material which may vary from about 0.1 to about 95% of the total compositions (by weight). The pharmaceutical composition can be prepared to provide easily measurable amounts for administration. For example, an aqueous solution intended for intravenous infusion may contain from about 3 to 500 pg of the active ingredient per milliliter of solution in order that infusion of a suitable volume at a rate of about 30 mL/hr can occur.

[0066] Formulations for veterinary are within the scope of the present disclosure and may comprise at least one active ingredient, as above defined, together with one or more acceptable carriers therefor and optionally other therapeutic ingredients. The carrier(s) must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and physiologically innocuous to the recipient thereof.

[0067] Pharmaceutical formulations containing the active ingredient may be in any form suitable for the intended method of administration. When used for oral use for example, tablets, troches, lozenges, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, syrups or elixirs may be prepared. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents including sweetening agents, flavoring agents, coloring agents and preserving agents, in order to provide a palatable preparation. Tablets containing the active ingredient in admixture with non-toxic pharmaceutically acceptable excipient which are suitable for manufacture of tablets are acceptable. These excipients may be, for example, inert diluents, such as calcium or sodium carbonate, lactose, calcium or sodium phosphate; granulating and disintegrating agents, such as maize starch, or alginic acid; binding agents, such as starch, gelatin or acacia; and lubricating agents, such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or may be coated by known techniques including microencapsulation to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate alone or with a wax may be employed.

[0068] A tablet is made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface active or dispersing agent. Molded tablets may be made by molding, in a suitable machine, a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets may optionally be coated or scored and optionally are formulated so as to provide slow or controlled release of the active ingredient therefrom.

[0069] The formulations include those suitable for the foregoing administration routes. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0070] Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be administered as a bolus, electuary or paste.

[0071] Formulations for oral use may be also presented as hard gelatin capsules where the active ingredient is mixed with an inert solid diluent, for example calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.

[0072] For infections of the eye or other external tissues e.g. mouth and skin, the formulations can be applied as a topical ointment or cream containing the active ingredient(s) in an amount of, for example, 0.075 to 20% w/w (including active ingredient(s) in a range between 0.1 % and 20% in increments of 0.1 % w/w such as 0.6% w/w, 0.7% w/w, etc.), preferably 0.2 to 15% w/w and most preferably 0.5 to 10% w/w. When formulated in an ointment, the active ingredients may be employed with either a paraffinic or a water- miscible ointment base.

[0073] Alternatively, the active ingredients may be formulated in a cream with an oil-in- water cream base. If desired, the aqueous phase of the cream base may include, for example, at least 30% w/w of a polyhydric alcohol, i.e. an alcohol having two or more hydroxyl groups such as propylene glycol, butane 1 ,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol (including PEG 400) and mixtures thereof. The topical formulations may desirably include a compound which enhances absorption or penetration of the active ingredient through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethyl. The oily phase of the emulsions of this invention may be constituted from known ingredients in a known manner. While the phase may comprise merely an emulsifier (otherwise known as an emulgent), it desirably comprises a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil. In some cases, a hydrophilic emulsifier is included together with a lipophilic emulsifier which acts as a stabilizer. In other embodiments, the phase includes both an oil and a fat. Together, the emulsifier(s) with or without stabilizer(s) make up the so-called emulsifying wax, and the wax together with the oil and fat make up the so- called emulsifying ointment base which forms the oily dispersed phase of the cream formulations.

[0074] Emulgents and emulsion stabilizers suitable in creams, for example, include Tween® 60, Tween® 80, Span® 80, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl mono stearate and sodium lauryl sulfate.

[0075] Selection of a suitable oil or fat for a cream formulation is based on achieving the desired cosmetic properties. The cream can be a non-greasy, non-staining and washable product with suitable consistency to avoid leakage from tubes or other containers. Straight or branched chain, mono- or dibasic alkyl esters such as di-isoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate or a blend of branched chain esters known as Crodamol CAP may be used. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and/or liquid paraffin or other mineral oils are used.

[0076] Aqueous suspensions containing the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions are also suitable for use with the methods described herein. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally-occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., poly oxy ethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethyleneoxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., poly oxy ethylene sorbitan monooleate). The aqueous suspension may also contain one or more preservatives such as ethyl or n-propyl p-hydroxy-benzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin. Further non-limiting examples of suspending agents include Cyclodextrin and Captisol (Sulfobutyl ether beta- cyclodextrin; SEB-beta-CD). In some cases, a cyclodextrin can enhance the solubility and/or stability of the active agent within the suspension. The suspension can also be used to prepare freeze-dried composition that are suitable for reconstitution.

[0077] Oil suspensions may be formulated by suspending the active ingredient in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oral suspensions may contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents, such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an antioxidant such as ascorbic acid.

[0078] Dispersible powders and granules of the invention suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent, and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those disclosed above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.

[0079] The pharmaceutical compositions of the invention may also be in the form of oil-in- water emulsions. The oily phase may be a vegetable oil, such as olive oil or arachis oil, a mineral oil, such as liquid paraffin, or a mixture of these. Suitable emulsifying agents include naturally- occurring gums, such as gum acacia and gum tragacanth, naturally-occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan monooleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. The emulsion may also contain sweetening and flavoring agents. Syrups and elixirs may be formulated with sweetening agents, such as glycerol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, a flavoring or a coloring agent.

[0080] The pharmaceutical compositions of the invention may be in the form of a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to the known art using the suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1,3-butane-diol or prepared as a lyophilized powder. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils may conventionally be employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid may likewise be used in the preparation of injectables. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution isotonic sodium chloride solution, and hypertonic sodium chloride solution.

[0081] Controlled release pharmaceutical formulations containing as active ingredient one or more antiviral compounds are also provided. A controlled release formulation can control the release of one or more active ingredients is to allow less frequency dosing or to improve the pharmacokinetic or toxicity profile of a given active ingredient.

[0082] The formulations described above can include two or more antiviral compounds. For example, the compounds can have different mechanisms of antiviral activity and/or different bioavailability. Thus, a protease inhibitor antiviral could be co-formulated with a nucleoside polymerase inhibitor, or a second protease inhibitor capable of crossing the blood brain barrier. However, methods of treatment that include administering two or more compositions each containing a single active agent, simultaneously or sequentially, are within the scope of this disclosure.

[0083] In some embodiments, the compound or compositions can be provided in unit dosage form in a suitable container. A unit dosage form is a physically discrete unit suitable as a unitary dosage for human or animal use. Each unit dosage form may contain a predetermined amount of one or more anti-coronavirus compounds (and/or other active agents) in the carrier calculated to produce a desired effect. Sometimes, the compound can be provided separate from the carrier (e.g., in its own vial, ampule, sachet, or other suitable container) for on-site mixing before administration to a subject. A kit for combined anticoronavirus therapy (CACT) comprising the antiviral compounds is also disclosed herein. The kit can include instructions for preparing the antiviral compounds for administration to a subject, including for example, instructions for dispersing the compounds in a suitable carrier and/or administering the combination of active agents to a subject and/or.

[0084] The compounds or formulations described in the present disclosure are administered by any route appropriate to the condition to be treated. Suitable routes include oral, rectal, nasal, pulmonary, topical (including buccal and sublingual), vaginal and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural), and the like, and may vary with the condition of the recipient.

[0085] The compounds or formulations described in the present disclosure can be administered at any time to a subject who may come into contact with a host of a coronavirus such as community member (e.g., including herds, packs, and feral colonies), a family member or healthcare professional who is already infected, but asymptomatic, or suffering from a coronavirus infection. Administration of the compounds or formulations of the present invention can be to subjects that test positive for coronavirus infection but not yet showing symptoms of a coronavirus infection, or upon commencement of symptoms of a coronavirus infection.

[0086] Each reference provided herein is incorporated by reference in its entirety to the same extent as if each reference was individually incorporated by reference. Where a conflict exists between the instant application and a reference provided herein, the instant application shall dominate.

[0087] In the examples below, while various specific and preferred embodiments and techniques have been described, one skilled in the art will understand that many variations and modifications may be made while remaining within the spirit and scope of the invention.

EXAMPLES

Introduction

[0088] Through rapid screening of a slate of putative antiviral compounds selected based on their efficacy in treating other RNA-viruses, subset of compounds with strong anti-FIPV activity have been identified and their safety and efficacy profiles characterized in vitro. The methods permit screening of potential combinational therapy. The results show that concurrently targeting FIPV at different steps of the virus life cycle with a combined anti-coronaviral therapy (CACT) provides a greater level of success than has been achieved with monotherapies alone. Moreover, identification of antivirals with synergistic effect also provides valuable translatable applications towards treating other challenging or emerging viral diseases.

[0089] This example details a set of in vitro assays enabling:

• rapid screening and identification of potential anti-coronaviral compounds,

• assessment of safety profiles,

• determination of efficacy and quantify viral RNA inhibition.

[0090] RNA viruses like HIV, HCV and coronavims have high viral mutation rates that sometimes results in the vims escaping from pharmacologic control. A combination therapy may simultaneously block the virus at multiple steps of its lifecycle and reduce the ability of the virus to escape from pharmacologic control via mutation. Further, as a result of agent- specific pharmacokinetics and tissue distribution, antivirals used as monotherapies necessarily have limited distribution throughout the body. This is particularly true of limited and variable penetration of the central nervous system (brain and spinal cord) and eye (blood-brain and blood-eye barriers). Assays described herein can identify different antiviral compounds with variable tissue distribution, which can be used concurrently and ideally have improved overall distribution throughout the body.

Materials and Methods FIPV Propagation and titering

[0091] Crandell-Reese feline kidney cells (CRFK, ATCC) were cultured in T150 flasks (Coming), inoculated with serotype II FIPV (WSU-79-1146, GenBank DQ010921) and propagated in 50 mL of Dulbeco’s Modified Eagle’s Medium (DMEM) with 4.5g/L glucose (Coming) and 10% fetal bovine serum (Gemini Biotec). After 72 hours of incubation at 37 °C, there was extensive cytopathic effect (CPE) and large areas of cell clearing. At this time, flasks were flash frozen at -70 °C for 8 minutes, thawed at room temperature and the cells and supernatant were centrifuged at 1500Xg for 5 minutes followed by a second centrifugation at 4000Xg for 5 minutes. Supernatant containing the viral stock was divided into 0.5 and 1.0 ml aliquots in 1.5 ml cryotubes (Nalgene) and archived at -70 °C. After freezing, a single tube was thawed and titered using both bioassay (TCID50) and real-time RT PCR methods.

[0092] The tissue culture infectious dose-50 (TCID50) was determined using a viral plaquing assay. CRFK cells were grown in a 96 well tissue culture plate (Genesee Scientific) until the CRFK cells were at -75-85% confluency. Progressive rows of cells were either not infected or infected with progressive 10-fold dilutions of the viral stock extending from 10 ¹ to 10⁸. At 72 hours post-infection, the cells were fixed with methanol and stained with crystal violet (Sigma- Aldrich). Wells were evaluated for virus-induced CPE and the TCID50 was determined based upon the equation logioTCID50 = [CPE total/# replicates] + 0.5 to reflect infectious virions per milliliter of supernatant (REFERENCE).

[0093] Cell-free viral RNA was isolated from the viral stock using the QIAamp Viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions. The isolated RNA was DNase treated (Turbo DNase, Invitrogen) and subsequently reverse transcribed using the High-Capacity RNA- to-cDNA Kit (Applied Biosystems) following the manufacturers’ protocols. The copy number of FIPV and feline GAPDH cDNA were determined using Applied Biosystems’ QuantStudio 3 Real- Time PCR System and PowerUp SYBR Green Master Mix (Applied Biosystems), following the manufacturer’s protocol for a 10 pL reaction. Each PCR was performed in triplicate with water template as a negative control and plasmid DNA as a positive control. A control reaction excluding reverse transcriptase was included in each real-time PCR assay. Cycling conditions for both FIPV and GAPDH amplicons were as follows- 50 °C for 2 min, 250 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 30 s, 72 °C for 1 min. The final step included a dissociation curve to evaluate specificity of the reaction. cDNA templates were amplified using the FIPV forward primer, 5 ’ -GGAAGTTTAGATTTGATTTGGCAATGCTAG (SEQ ID NO:l), and the FIPV reverse primer, 5 ’ - AAC AATC ACT AGATCC AGACGTTAGCT (SEQ ID NO:2) (3’ end of FIPV genome (serotype II FIPV WSU-79-1146 (GenBank DQ010921), as reported in Murphy et ah, Veterinary Microbiology, 219: 226-233 (2018)). Real-time PCR for the GAPDH housekeeping gene was performed concurrently using the primers, 5 GAPDH, 5’- AAATTCCACGGCACAGTCAAG (SEQ ID NOG), and 3 GAPDH, 5’- TGATGGGCTTTCCATTGATGA (SEQ ID NO:4). FIPV and GAPDH copy number was calculated based on standard curves generated in our laboratory. Copies of FIPV cDNA determined via real-time RT PCR were normalized per 10⁶ copies of feline GAPDH cDNA.

Viral plaquing assay

[0094] In order to initially identify compounds with antiviral activity, infected CRFK cells were treated with a library of compounds in 6 well replicates.

CRFK cells were grown in 96 well tissue culture plates (Genesee Scientific) containing 200 mE culture media. At -75-85% cell confluency, the media in the uninfected control wells was aspirated and replaced with 200 mE of fresh media. The media in the infected wells was aspirated and replaced with media inoculated with FIPV at a multiplicity of infection (MOI) of 0.004 infectious virions :cell. The tissue culture plate was incubated for 1 hour with periodic gentle agitation (figure eight rotations) performed every 15 minutes. At 1 hour post-infection, the putative antiviral compounds were added to six FIPV infected wells (to assess compound antiviral efficacy) and six uninfected control wells (to screen for compound cytotoxicity).

All compounds were initially screened at 10 mM, except for the “chemical fragment” compounds supplied by M. Olsen (Midwestern University) which were assessed at 50 mM. The tissue culture plates were incubated for 72 hours at 37 °C and subsequently fixed with methanol and stained with crystal violet. Plates were scanned for absorbance at 620 nm using an EFISA plate reader.

[0095] For agents that demonstrated antiviral efficacy in the initial screening, the EC50 was determined by performing a progressive 2-fold compound dilution series in the viral plaquing assay. CRFK cells were grown in 96 well culture plates similarly to that performed for the compound screening assay. Aside from the uninfected control wells, all remaining wells were infected with the FIPV as described above. For the remaining plate and in six well replicates, compounds with identified anti-FIPV activity from the screening assay were evaluated using a 2 fold dilution series ranging from 20 to 0 mM. For both the screening and EC50 assays, GS-441524 acted as a positive control at 5 mM based on previously published data. Plates were scanned for absorbance at 620 nm using an EFISA plate reader.

Viral RNA knock-down assay

[0096] In order to quantify the FIPV replication inhibition for compounds identified with the screening assay, FlPV-infected CRFK cells were treated with the drug of interest and subsequent use of RT-qtPCR. CRFK cells were cultured in a 6 well tissue culture plate (Genesee Biotek) with culture media. At -75-85% confluency, the culture media was replaced with fresh media and the cells were infected with FIPV at an MOI of 0.2, based upon the TCID50 bioassay. Plates were incubated for one hour, with periodic gentle agitation every 15 minutes. At one-hour post-infection, the triplicate culture wells were treated with one (monotherapy) or more (combined anticoronaviral therapy) of the antiviral compounds. Compound dosage was based upon the compounds’ EC50 and ranged from 1-10 mM. Three culture wells with FIPV infected and untreated CRFK cells acted as virus-infected controls. The cultures were subsequently incubated for 24 hours. At 24 hours, cell-associated total RNA was isolated using Invitrogen’s PureLink™ RNA mini kit. The total RNA was DNAse treated, reverse transcribed to cDNA and viral cDNA and feline GAPDH cDNA were measured using real time RT-PCR, as described above.

Cytotoxicity Determination

[0097] Compound cytotoxicity in feline cells was assessed using the commercially available kit (CellTox Green Cytotoxicity Assay, Promega) according to the manufacturer’s instructions. Untreated CRFK cells were used as a negative control and a cytotoxic solution provided by the manufacturer was used as the positive toxicity control. Compound cytotoxicity was quantified by the intensity of fluorescence based on the selective binding of dye to the DNA of apoptotic/necrotic cells. Briefly, CRFK cells were plated in a 96-well plate at increasing concentrations of the compound of interest and incubated for 72 hours. After 72 hours, the DNA binding dye was applied to all wells, incubated shielded from light for 15 minutes and subsequently read for fluorescence intensity at 485-500nmEx/520-530nmEm.

Results

Compound Screening

[0098] To identify compounds with antiviral activity against FIPV, we screened a compilation of 104 compounds from differing drug classes and with differing mechanisms of action. Screened compounds included nucleoside polymerase inhibitors, protease inhibitors, NS5A inhibitors, non-nucleoside polymerase inhibitors, chemical “fragments” from a collaborator, and a small subset of compounds with uncertain antiviral mechanisms of action (“other”) (See FIG. 1). Compounds that demonstrated cellular protection from viral cytopathic effect (CPE) due to FIPV infection include ribavirin, velpatasvir, toremifene citrate, daclatasvir, elbasvir, lopinavir, ritonavir, nelfinavir mesylate, K777, grazoprevir, and amodiaquine, in addition to the previously identified compounds, GS-441524 and GC-376, tested by our laboratory.

EC50 and Cytotoxicity Determination]

[0099] All compounds with anti-FIPV activity identified in the initial screening process were carried forward for additional assays including determining the 50% effective concentrations (EC50) and ensuring high safety profiles. EC50 values ranged from 0.16 uM to 13.47 uM (see Table 1 and FIGs. 2A-B).

Table 1. Compounds with anti-FIPV activity

* SERM = Selective estrogen receptor modulator.

**Fold decrease is FIPV inhibition of compound-treated CRFK cells relative to CRFK cells inoculated with virus alone (no drug). [0100] For this same set of compounds, cytotoxicity was determined using the commercially available CellTox™ Green Cytotoxicity Assay (Promega). The cytotoxicity of selected antiviral compounds is shown in TABLE 2.

Table 2. Cytotoxicity results of selected putative antiviral compounds

Quantification ofFIPV Inhibition with RT-qtPCR [Fold decrease monotherapies]

[0101] The colorimetric (e.g., Crystal violet) screening and EC50 assays rely on staining intensity to reflect cell protection from CPE but does not provide any quantification of the drug’s ability to inhibit FIPV replication. In order to do so, inhibition of FIPV replication was also measured by RT-qtPCR in CRFK cells infected with FIPV-79-1146, followed by treatment with a compound one hour later, then incubated for 24 hours (FIGs. 4A-B).

[0102] At 10 uM, GS-441524 inhibits FIPV replication completely and, thus, in order to quantify a fold decrease in FIPV RNA copies, particularly in combination therapies, GS-441524 was used at 1 uM in quantification experiments.

[0103] Especially interesting was a finding relating to elbasvir, which repeatedly demonstrated excellent CRFK protection from FIPV -induced cell death and the lowest EC50 of any compounds we have evaluated in our laboratory. (FIGs. 3A-B). However, when FIPV replication inhibition was quantified with RT-qtPCR, we did not detect any difference between virus RNA copies for the wells receiving elbasvir treatment and those lacking treatment (FIGs. 4A-B). Further microscopic examination of cell morphology for infected CRFK cells that received elbasvir treatment showed atypical morphology relative to uninfected, normal CRFK cells, although were still in a confluent monolayer (FIGs. 5A-D).

Quantification of FIPV Inhibition with Combined Therapy

[0104] FIPV replication was also measured by RT-qtPCR in CRFK cells infected with FIPV-79-1146, followed by treatment with a combination of compounds one hour later, then incubated for 24 hours (FIGs. 6A-C).

[0105] At 10 mM, GS-441524 inhibits FIPV replication completely and, thus, in order to quantify a fold decrease in FIPV RNA copies, particularly in combination therapies, GS-441524 was used at 1 mM in quantification experiments.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising: a. at least one protease inhibitor (PI), or a pharmaceutically-acceptable salt or prodrug thereof; and b. at least one a nucleoside polymerase inhibitor (NPI), or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier, optionally wherein the molar ratio of PLNPI in the composition is within the range of about 40000:1 to 5:1.

2. The composition of claim 1, further comprising at least one selective estrogen receptor modulator (SERM), or a pharmaceutically-acceptable salt or prodrug thereof, optionally wherein the molar ratio of SERM:NPI is about 20:1 to 5:1.

3. The composition of claim 1, wherein the at least one PI is selected from the group consisting of K777, 3C protease inhibitors, 3C-like protease inhibitors, GC376, lopinavir, ritonavir, grazoprevir and nelfinavir, or a pharmaceutically-acceptable salt or prodrug thereof.

4. The composition of claim 1, wherein the at least one NPI is GS441524, or a pharmaceutically-acceptable salt or prodrug thereof.

5. The composition of claim 1, wherein the at least one SERM is selected from the group consisting of clomiphene, tamoxifen, raloxifene, ospemifene, and toremifene, or a pharmaceutically-acceptable salt or prodrug thereof.

6. A composition comprising: a. at least one protease inhibitor (PI) with anti- viral activity, or a pharmaceutically- acceptable salt or prodrug thereof; and b. at least one anti-malarial with anti-viral activity, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier, optionally wherein the molar ratio of the PI: anti-malarial in the composition is within the range of about 4000:1 to 0.5:1.

7. The composition of claim 6, further comprising at least one selective estrogen receptor modulator (SERM) with anti- viral activity, or a pharmaceutically-acceptable salt or prodrug thereof, optionally wherein the molar ratio of the SERM:PI in the composition is within the range of about 1:4000 to 1:0.5.

8. The composition of claim 7, wherein the at least one SERM with anti-viral activity is clomiphene or toremifene, or a pharmaceutically-acceptable salt or prodrug thereof.

9. The composition of claim 6, wherein the at least one PI with anti-viral activity is selected from the group consisting of K777, 3C protease inhibitors, 3C-like protease inhibitors, GC376, lopinavir, ritonavir, grazoprevir and nelfinavir, or a pharmaceutically-acceptable salt or prodrug thereof.

10. The composition of claim 6, further comprising at least one nucleoside polymerase inhibitor with anti-viral activity selected from the group consisting of: GC376, lopinavir, ritonavir, grazoprevir and nelfinavir or a pharmaceutically-acceptable salt or prodrug thereof.

11. A composition comprising GC376, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of: GS-441524; amodiaquine; K777; toremifene; nelfinavir and ritonavir; or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier.

12. The composition of claim 11, comprising GS-441524, optionally wherein the molar ratio of GC376:GS-441524 in the composition is within the range of about 40000:1 to 500:0.

13. The composition of claim 11, comprising amodiaquine, optionally wherein the molar ratio of GC376:amodiaquine in the composition is within the range of about 4000:1 to 50:0.

14. The composition of claim 13, further comprising toremifene, optionally wherein the molar ratio of GC376:toremifene in the composition is within the range of about 4000:1 to 50:0.

15. The composition of claim 11, comprising nelfinavir mesylate, optionally wherein the molar ratio of GC376:nelfinavir mesylate in the composition is within the range of about 4000:1 to 50:0.

16. A composition comprising GS-441524, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of GC376, amodiaquine, K777, toremifene, nelfinavir, and ritonavir, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier.

17. The composition of claim 16, wherein said compound is GC376.

18. The composition of claim 16, wherein said compound is amodiaquine, optionally wherein the molar ratio of GC -441524: amodiaquine in the composition is within the range of about 20:1 to 0.5.

19. The composition of claim 18, which further comprises toremifene, optionally wherein the molar ratio of GC-441524:toremifene in the composition is within the range of about 20:1 to 0.5.

20. A composition comprising K777, or a pharmaceutically-acceptable salt or prodrug thereof, and at least one compound selected from the group consisting of lopinavir and toremifene, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier.

21. The composition of claim 20, wherein said compound is lopinavir, optionally wherein the molar ratio of K777: lopinavir in the composition is within the range of about 10:1 to 0.1:1.

22. A composition comprising lopinavir, or a pharmaceutically-acceptable salt or prodrug thereof, and ritonavir, or a pharmaceutically acceptable salt or prodrug thereof, in a pharmaceutically acceptable carrier, optionally wherein the molar ratio of lopinavinritonavir in the composition is within the range of about 10:1 to 0.1:1.

23. The composition of claim 22, which further comprises toremifene, optionally wherein the molar ratio of lopinavir: toremifene in the composition is within the range of about 10:1 to 0.1 : 1.

24. A composition according to any one of claims 1-23 formulated for intravenous, subcutaneous, ocular, dermal, mucosal, oral, rectal, or parenteral administration.

25. A composition according to any one of claims 1-24, further comprising at least one anti- coronavirus agent selected from the group consisting of: 3C-like protease inhibitor, 3C protease inhibitor, non-steroidal selective estrogen receptor modulator, anti-malarial, and nucleoside polymerase inhibitor.

26. A composition according to any one of claims 1-25, further comprising at least one anti- malarial agent selected from the group consisting of: quinine; a quinine derivative; chloroquine; a chloroquine derivative; artemisinin, and an artemisinin derivative.

27. A composition of any one of claims 1-26, wherein the composition comprises 0.01 to 98% by weight active agent.

28. A composition of any one of claims 1-27, wherein the pharmaceutically acceptable carrier comprises an excipient selected from the group consisting of water, hydroalcoholic solvents, organic solvents, cosolvents, osmotic agents, pH buffering agents, complexation agents, solubility enhancers, suspending agents, bulking agents, viscosity modifiers, antimicrobial agents, sustained release agents, and preservatives.

29. A method to limit coronavirus replication in a subject in need thereof comprising administering the composition of any one of claims 1-28 to said subject in a replication-limiting effective amount, optionally wherein the subject is a human.

30. A method to inhibit coronavirus in a subject in need thereof comprising administering the compositions of any one of claims 1-28 to said subject in a coronavirus-inhibiting effective amount, optionally wherein the subject is a human.

31. A method of treating a coronavirus infection in a subject in need thereof comprising administering: a composition comprising a therapeutically effective amount of a first protease inhibitor (PI), or a pharmaceutically acceptable salt or prodrug thereof; and a composition comprising a therapeutically effective amount of one or more of a second protease inhibitor (PI), a selective estrogen receptor modulator (SERM), an antimalarial agent, and a nucleoside polymerase inhibitor (NPI), or a pharmaceutically acceptable salt or prodrug thereof, wherein the first and second Pis are not the same, optionally wherein the subject is a wild or domesticated felid.

32. The method of claim 31, wherein the coronavirus infection causes feline infectious peritonitis (FIP).

33. The method of claim 32, wherein the subject is a cat at least 12 months old.

34. The method of claim 33, wherein the cat has neurologic FIP.

35. The method of claim 33, wherein the cat has FIP- associated ocular disease.

36. The method of claim 32, wherein the FIP is a wet form of FIP.

37. The method of claim 31, wherein the first PI is selected from the group consisting of GC376, K777, and lopinavir, or a pharmaceutically acceptable salt or prodrug thereof.

38. The method of claim 37, wherein 10 mg/kg to 50 mg/kg GC376 is administered every 12 hours.

39. The method of claim 31, wherein the first and second Pis, or pharmaceutically effective salts or prodmgs thereof are administered in combination, and the second PI is selected from the group consisting of K777, nelfinavir, lopinavir, and ritonavir, or a pharmaceutically acceptable salt or prodrug thereof.

40. The method of claim 39, further comprising administering the composition comprising the SERM or a pharmaceutically acceptable salt or prodrug thereof.

41. The method of claim 31, wherein the compositions comprising the first PI and the antimalarial agent, or the pharmaceutically acceptable salts or prodrug thereof are administered, and the antimalarial agent is amodiaquine or a pharmaceutically acceptable salt or prodrug thereof.

42. The method of claim 41, further comprising administering the composition comprising the SERM, optionally wherein the SERM is toremifene.

43. The method of claim 31, wherein the compositions comprising the first PI and the NPI, or the or pharmaceutically acceptable salts or prodrug thereof are administered in combination, and the NPI is GS-441524, optionally 1.0 to 4.0 mg/kg GS-441524 is administered every 24 hours.

44. The method of claim 31, wherein the administration is oral, buccal, nasal, mucosal, rectal, subcutaneous, ocular, intraperitoneal, pulmonary, or intrathecal administration.

45. The method of claim 31, wherein administration achieves at least a 100,000-fold reduction in viral titer in 24 hours.

46. The method of claim 31, wherein the first PI, or pharmaceutically acceptable salts or prodrug thereof, is administered daily for at least two weeks.

47. The method of claim 31, wherein a composition comprising GC376, or a pharmaceutically acceptable salt or prodrug thereof is administered with a composition comprising GS-441524, amodiaquine, K777, toremifene, or a pharmaceutically acceptable salt or prodrug thereof.

48. The method of claim 31, wherein compositions comprising GC376, amodiaquine, and toremifene, or pharmaceutically acceptable salts or prodrugs thereof are administered together.

49. A method of identifying an anti-coronavims therapy comprising: identifying a plurality of putative anti-coronavirus compounds with known mechanisms of antiviral activity; contacting a cell with the identified anti-coronavims compound in vitro to identify active compounds producing no more than low cytotoxicity; combining at least one identified active compound having a first mechanism of anti- viral activity and at least one identified active compound having a second mechanism of anti-viral activity to form a putative combined anti-coronavirus therapy (CACT), wherein the first and second mechanisms are not the same; identifying an effective CACT by contacting a coronavirus infected cell in vitro with the putative CACT, collecting RNA from the cell, and quantifying the level of RNA replication inhibition, wherein the effective CACT produces a greater level of inhibition than the sum of the identified active compounds contained therein.

50. The method of claim 49, further comprising administering the effective CACT to a subject in need of anti-coronavirus therapy.

51. The method of claim 49, wherein the identifying a putative anti-coronavirus compound includes viral plaquing, optionally with feline infectious peritonitis virus (FIPV).

52. The method of claim 49, wherein cytotoxicity is assessed in a feline cell, optionally a feline renal cell line.

53. The method of claim 49, wherein the coronavirus infected cell is a FIPV infected cell, optionally a feline renal cell.