WO2021190600A1 - Automated gene assembly system and method - Google Patents

Abstract

Provided is a mutant gene pool constructing method, comprising: for each type of mutant gene, segmenting a full-length sequence into one or more constant sequence fragments (containing a sequence identical to a corresponding section of a reference sequence or a complementary sequence thereof) and one or more variable sequence fragments (containing a mutant compared with the corresponding section of the reference sequence or the complementary sequence thereof); respectively generating constant sequence fragments of each mutant gene and respectively generating variable sequence fragments of each mutant gene; for each mutant gene, preparing a reaction system containing a set of constant sequence fragments and variable sequence fragments; and for each mutant gene, generating a full-length mutant gene insertion vector, and constructing a mutant gene pool. The operations are carried out in batches in a multi-compartment container.

Description

Gene automatic assembly system and method Technical field

The invention relates to the field of gene synthesis, in particular to the synthesis of gene mutation libraries or gene combinatorial libraries and their automated execution.

Background technique

Synthetic biology is based on the idea of engineering design, constructing standardized components and modules, transforming existing natural systems or synthesizing new artificial life systems from scratch. People use gene recombination technology and gene positioning editing to realize special programming of life systems and perform special functions; modularize metabolic pathways, optimize the combination and collocation of components, and realize the synthesis of chemicals in the best mode. Synthetic biology has made significant progress in the energy, chemical, and pharmaceutical industries.

In order to optimize the required functions, people will construct hundreds or even thousands of metabolic synthesis pathways at the same time, and then screen the best-performing one for downstream experiments, which means that synthetic biology has entered the era of high-throughput screening. However, due to the complexity of biological systems and the many unknown interactions between them, many rounds of screening and testing must be carried out. This is an important step towards the design, construction, and test automation cycle.

As far as the inventor knows, there are currently no suppliers on the market that provide this type of service. Downstream users either construct gene libraries in a low-throughput manner or spend a lot of money to maintain their production lines. For a long time, it has been hindered by high experimental cost, time cost and labor cost.

High-throughput DNA assembly methods have become an indispensable tool for synthetic biology applications, such as metabolic pathway optimization, microbial engineering and synthetic genome engineering, etc., which have been increasingly used in various biotechnologies. In the past few decades, a large number of DNA assembly methods have been developed, such as Genbuilder assembly, Golden-Gate assembly, Gibson assembly, etc. of Nanjing GenScript Biotechnology Company.

Summary of the invention

High-throughput, high-efficiency, and low-cost DNA synthesis is still a problem facing the nucleic acid synthesis industry. Large-scale DNA synthesis projects not only require a high-throughput platform, but also a highly automated production line from primer synthesis to product inspection. Therefore, we are committed to improving the degree of automation of the production line to solve the current problems. The invention can shorten the synthesis period, greatly reduce the cost (especially the labor cost), and the correct rate and the success rate of the one-time product can reach more than 95%.

In one aspect, the present invention relates to a method for constructing a mutant gene library, wherein each mutant gene in the mutant gene library contains a mutation relative to a reference sequence, and the method includes:

(1) For each mutant gene, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments contain the same segments as the reference sequence or its complementary sequence. Sequences, variable sequence fragments contain mutations compared to the corresponding segments of the reference sequence or its complementary sequence;

(2) Generate each constant sequence fragment of each mutant gene and each variable sequence fragment of each mutant gene separately;

(3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each mutant gene; and

(4) Generate a full-length mutant gene for each mutant gene, and optionally insert it into a vector,

Thus, a mutant gene library was constructed, wherein the method was carried out in batches in a multi-compartment container.

In another aspect, the present invention relates to a method for constructing a gene combinatorial library, wherein various gene combinations in the gene combinatorial library have sequence-unique segments and multi-sequence segments relative to each other, and the method includes:

(1) For each gene combination, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments correspond to the segments with unique sequences in the gene combination library, The variable sequence segment corresponds to a segment with multiple selection sequences in the gene combinatorial library;

(2) Generate each constant sequence fragment and each variable sequence fragment for each gene combination;

(3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each gene combination; and

(4) Generate a full-length gene combination for each gene combination, optionally insert a vector,

Thus, a gene combinatorial library is constructed, wherein the method is carried out in batches in a multi-compartment container.

In yet another aspect, the present invention relates to a method for automatically preparing a batch reaction system, which includes:

Generate a reagent transfer relationship table; and

Upload the reagent transfer relationship table to the automatic pipetting device, and the automatic pipetting device will automatically transfer the reagent from the container containing the reagent to the container for reaction according to the reagent transfer relationship table.

The reagent transfer relationship table is generated as follows:

(1) List the batch reactions to be carried out, list the reagents and their volumes required for each reaction;

(2) Determine the position of each reaction in terms of the reaction vessel;

(3) Determine the position of each reagent required for each reaction in terms of the reagent container;

(4) Determine the transfer starting point and end point of each reagent required for each reaction,

The method is carried out in a multi-compartment container.

The method can be used to construct mutant gene libraries and gene combinatorial libraries.

The implementation of the present invention can utilize various automation platforms, including, for example, an automated synthesis platform, an automated pipetting platform, and an automated reaction platform.

The implementation of the present invention can utilize various seamless splicing technologies, including, for example, the Gibson method, the Golden-Gate technology, and the Genbuilder technology. The implementation of the present invention can also use conventional molecular cloning techniques, such as site-directed mutagenesis, mutagenesis PCR, overlap PCR and restriction endonucleases.

The method of the present invention can perform at least 10 reactions, at least 25 reactions, at least 50 reactions, at least 100 reactions, at least 250 reactions, at least 500 reactions, at least 750 reactions, at least 1000 reactions, at least 1250 reactions at a time. Reactions, at least 1500 reactions, at least 1750 reactions, at least 2000 reactions, at least 2250 reactions, at least 2500 reactions, or at least 2750 reactions.

Description of the drawings

Figure 1A shows a schematic diagram of the structure of the pUC57 plasmid described in Example 1.

Figure 1B shows a schematic diagram of the structure of the pUC57-BsmBI plasmid described in Example 1.

Fig. 2A shows a schematic diagram of the target sequence and the A, B, and C fragments of the mutant gene bank described in Example 2.

FIG. 2B shows a schematic diagram of the assembly of the mutant gene library described in Example 2. FIG.

Figure 3 shows a schematic diagram of the distribution of PCR reaction plates and reagent plates for constructing the mutant gene library described in Example 2.

FIG. 4 shows a flowchart of the reagent transfer relationship table of the PCR system for constructing the mutant gene library described in Example 2. FIG.

Figure 5 shows the reagent transfer relationship table of the PCR system for constructing the mutant gene library described in Example 2.

Figure 6 shows the electrophoresis photographs of the PCR products for constructing the mutant gene library described in Example 2.

FIG. 7 shows a schematic diagram of the distribution of reaction plates and reagent plates of the splicing reaction for constructing the mutant gene library described in Example 2. FIG.

FIG. 8 shows a flowchart of the reagent transfer relationship table of the splicing reaction system for constructing the mutant gene library described in Example 2. FIG.

FIG. 9 shows the reagent transfer relationship table of the splicing reaction system for constructing the mutant gene library described in Example 2. FIG.

Figure 10 shows the electrophoresis photographs of the colony PCR test for constructing the mutant gene library described in Example 2. "Δ" represents the strip of the second reinspection.

11 shows a schematic diagram of the structure of the U692AEH070 intermediate carrier described in Example 3.

Figure 12 shows a schematic diagram of fragment fusion for constructing a gene combinatorial library described in Example 3

Figure 13 shows a schematic diagram of the assembly of the gene combinatorial library constructed in Example 3.

FIG. 14 shows a flowchart of the reagent transfer relationship table of PCR generated by fragments of the gene combinatorial library constructed in Example 3. FIG.

FIG. 15 shows the reagent distribution table and reagent transfer relationship table of the fragment generation PCR for constructing the gene combinatorial library described in Example 3. Among them, al means fragment 4, all means fragment 5, bl means fragment 6, bll means fragment 7, C means fragment 8, F means forward primer, R means reverse primer; for example, "113al-F" means amplified fragment 4 A forward primer required, 113al-R indicates a reverse primer required to amplify fragment 4, "113" is the set number; "item" indicates the template required to amplify the target fragment, and the following number is the number .

Figure 16 shows the electrophoresis photographs of PCR products generated from the fragments of the gene combinatorial library constructed in Example 3. "Δ" represents the strips that are supplemented twice.

FIG. 17 shows a flow chart of the reagent transfer relationship table of fragment fusion PCR for constructing a gene combinatorial library described in Example 3. FIG.

Figure 18 shows the reagent distribution table and reagent transfer relationship table of the fragment fusion PCR for constructing the gene combinatorial library described in Example 3. Among them, A represents the fragment amplified by the fusion of fragment a1 and fragment all, B is the fragment amplified by the fusion of fragments bl and b11, C refers to fragment 8, F refers to forward primer, R refers to reverse primer; such as 113al-F Indicates a forward primer needed for fusion amplified fragment 113A; 113all-R indicates a reverse primer needed for fusion amplified fragment 113A; 113al and 113all are templates for fusion amplified fragment 113A, "113" is the set number .

FIG. 19 shows the electrophoresis photograph of the PCR product of the fragment fusion for constructing the gene combinatorial library described in Example 3. FIG.

FIG. 20 shows a flow chart of the reagent transfer relationship table of the splicing reaction system for constructing the gene combinatorial library described in Example 3. FIG.

Figure 21 shows the reagent distribution table and reagent transfer relationship table of the splicing reaction system for constructing the gene combinatorial library described in Example 3. A represents the fragment after fusion and amplification of fragment a1 and fragment all, B represents the fragment after fusion and amplification of fragment bl and b11, C represents fragment 8, A, B and C are the three fragments required to assemble a full length; 113A, 113B, and 113C are used to splice three fragments of the full-length sequence of No. 113, and "113" is the set number.

FIG. 22 shows the electrophoresis photographs of colony PCR test for constructing the gene combinatorial library described in Example 3. FIG. "Δ" represents the strip of the second reinspection.

Figure 23 shows a schematic diagram of the numbering of the wells of a 96-well plate.

Detailed description of the invention

In the first aspect, the present invention provides a method for constructing a mutant gene library, wherein each mutant gene in the mutant gene library contains a mutation relative to a reference sequence, and the method includes:

(1) For each mutant gene, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments contain the same segments as the reference sequence or its complementary sequence. Sequences, variable sequence fragments contain mutations compared to the corresponding segments of the reference sequence or its complementary sequence;

(2) Generate each constant sequence fragment of each mutant gene and each variable sequence fragment of each mutant gene separately;

(3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each mutant gene; and

(4) Generate a full-length mutant gene for each mutant gene, and optionally insert it into a vector,

Thus, a mutant gene library was constructed, wherein the method was carried out in batches in a multi-compartment container.

In a second aspect, the present invention provides a method for constructing a gene combinatorial library, wherein various gene combinations in the gene combinatorial library have sequence-unique segments and multi-sequence segments relative to each other, and the method includes:

(1) For each gene combination, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments correspond to the segments with unique sequences in the gene combination library, The variable sequence segment corresponds to a segment with multiple selection sequences in the gene combinatorial library;

(2) Generate each constant sequence fragment and each variable sequence fragment for each gene combination;

(3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each gene combination; and

(4) Generate a full-length gene combination for each gene combination, optionally insert a vector,

Thus, a gene combinatorial library is constructed, wherein the method is carried out in batches in a multi-compartment container.

In a third aspect, the present invention provides a method for automatically preparing a batch reaction system, which includes:

Generate a reagent transfer relationship table; and

Upload the reagent transfer relationship table to the automatic pipetting device, and the automatic pipetting device will automatically transfer the reagent from the container containing the reagent to the container for reaction according to the reagent transfer relationship table.

The reagent transfer relationship table is generated as follows:

(1) List the batch reactions to be carried out, list the reagents and their volumes required for each reaction;

(2) Determine the position of each reaction in terms of the reaction vessel;

(3) Determine the position of each reagent required for each reaction in terms of the reagent container;

(4) Determine the transfer starting point and end point of each reagent required for each reaction,

The method is carried out in a multi-compartment container.

In a fourth aspect, the present invention provides a method for constructing a mutant gene library, wherein each mutant gene in the mutant gene library contains a mutation relative to a reference sequence, and the method includes:

(1) For each mutant gene, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments contain the same segments as the reference sequence or its complementary sequence. Sequences, variable sequence fragments contain mutations compared to the corresponding segments of the reference sequence or its complementary sequence;

(2) Generate each constant sequence fragment of each mutant gene and each variable sequence fragment of each mutant gene separately;

(3) Prepare a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each mutant gene by the third aspect of the method; and

(4) Generate a full-length mutant gene for each mutant gene, and optionally insert it into a vector,

Thus, a mutant gene library was constructed.

In a fifth aspect, the present invention provides a method for constructing a gene combinatorial library, wherein various gene combinations in the gene combinatorial library have sequence-unique segments and multi-sequence segments relative to each other, and the method includes:

(1) For each gene combination, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments correspond to the segments with unique sequences in the gene combination library, The variable sequence segment corresponds to a segment with multiple selection sequences in the gene combinatorial library;

(2) Generate each constant sequence fragment and each variable sequence fragment for each gene combination;

(3) Prepare a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each gene combination by the third aspect of the method; and

(4) Generate a full-length gene combination for each gene combination, optionally insert a vector,

Thus, a gene combinatorial library was constructed.

In one embodiment of any aspect of the invention, the multi-compartment container is a multi-well plate, such as a 96-well plate or a 384-well plate. In one embodiment, one or more multiwell plates are used at a time, such as 1-27, 4-25, or 9-16 96-well plates or 384-well plates, such as 1, 2, 3, 4, 5, 6, 8 , 9, 10, 12, 15, 16, 18, 20, 24, 25 or 27 96-well plates.

In one embodiment of any aspect of the present invention, reagents common to multiple reactions and/or reagents common to all reactions are combined in one or more wells on the reagent plate. In the case of combining common reagents, the common reagent may occupy only one hole on the reagent plate. Alternatively, the common reagent can also occupy multiple holes on the reagent plate, for example, 2-12, 2-8, or 2-4 holes, for example, 2, 4, 6, 8 or 12 holes. The number of wells occupied by public reagents on the reagent plate depends on many factors, such as the number of pipetting at one time for automatic pipetting (e.g. the number of pipetting at one time in an automated pipetting workstation), the number of pipetting at one time for manual pipetting (e.g., more The number of pipettes per pipette or high-throughput dispenser). The reagent can be molecular biology, especially reagents used in nucleic acid chemical synthesis, such as primers (oligonucleotides), templates (such as plasmids, genomes), buffers, restriction endonucleases, polymerases, ligases, dNTP mixture and so on. Common reagents can be multiple reactions in one run, or even reagents common to all reactions in one run, such as common primers, common templates, buffers, restriction endonucleases, polymerases, ligases, dNTP mixtures, etc. In one embodiment, reagents common to multiple reactions and/or reagents common to all reactions are added manually. In one embodiment, manual addition is performed using a multichannel pipette or high-throughput dispenser.

In one embodiment of any aspect of the present invention, at least 10 reactions, at least 25 reactions, at least 50 reactions, at least 96 reactions, at least 100 reactions, at least 192 reactions, at least 250 reactions, at least 288 reactions are performed at a time. Reactions, at least 384 reactions, at least 480 reactions, at least 500 reactions, at least 576 reactions, at least 750 reactions, at least 1,000 reactions, at least 1,250 reactions, at least 1,500 reactions, at least 1,750 reactions, at least 2,000 Reactions, at least 2,250 reactions, at least 2,500 reactions, or at least 2,750 reactions. The upper limit of the number of reactions performed at one time depends on the capacity of automated workstations (e.g., automated pipetting workstations, automated synthesis workstations, automated reaction workstations). Taking the Tecan EVO20018 used in the examples as an example, 27 96-well plates can be placed on the workstation, providing a total of 96 x 27 = 2592 wells, including wells for providing reagents and wells for performing reactions. Taking the conventional PCR (3 reagent wells and 1 reaction well) that requires one template and two primers as an example, a maximum of 648 reactions can be performed at a time.

In an embodiment of any aspect of the present invention, step (4) uses seamless splicing technology, including but not limited to Golden-Gate method, Gibson method or Genbuilder method. Those skilled in the art can determine the upper limit of the number of fragments that can be spliced in one reaction according to the seamless splicing technology specifically adopted. Generally, 2-9, 2-7, or 3-5 fragments are spliced at a time, for example, 2, 3, 4, 5, 6, 7, 8, or 9 fragments.

In one embodiment of any aspect of the present invention, step (4) utilizes conventional molecular biology techniques, including but not limited to restriction endonucleases. Those skilled in the art can determine the upper limit of the number of fragments that can be spliced in one reaction according to the specific restriction endonuclease used. Generally, 2-9, 2-7, or 3-5 fragments are spliced at a time, for example, 2, 3, 4, 5, 6, 7, 8, or 9 fragments.

In one embodiment of the method of constructing a mutant gene library, the mutation may be the substitution, addition or deletion of one or more nucleotide residues. In one embodiment, the plurality of nucleotide residues may be continuous or discontinuous. In one embodiment of the method of constructing a mutant gene library, the mutation may be the substitution, addition or deletion of one or more encoded amino acid residues. In one embodiment, the plurality of encoded amino acid residues may be continuous or discontinuous. In one embodiment, mutations are relative to each member of the mutation gene library. In one embodiment, the mutation is a member of the mutation gene library in terms of the reference sequence. The reference sequence may or may not be included in the mutant gene library.

In one embodiment of the method of constructing a gene combinatorial library, the full-length target sequence can be a single gene sequence composed of a sequence unique segment and a sequence multiple-selection segment, or it can be a sequence unique gene and sequence multiple-selection sequence. The multi-gene sequence composed of the genes of the above can even be a multi-gene sequence composed of a unique segment of the sequence and a multi-selected segment of the sequence. The polygene may be polycistronic, or a cascade or pathway (such as a metabolic pathway, a synthetic pathway, a signal transduction pathway), or even a complete genome (such as a genome of a lower organism (such as a virus)).

Those skilled in the art can reasonably divide the target sequence into segments (for example, a constant sequence segment and a variable sequence segment). In the embodiment of the mutant gene library, the variable sequence segment is a segment that contains a mutation. In the embodiment of the gene combinatorial library, the variable sequence segment is a sequence multiple-selected segment. Those skilled in the art can divide each segment by comparing all target sequences. Methods and tools (such as software) for sequence alignment are well known in the art. The length of each fragment depends on many factors, such as the full length of the target sequence, the optimal synthesis length of the synthesis system, the position of the mutation on the target sequence, and the distance between adjacent mutations. According to the specific method used (especially the method of assembling each fragment and the method of inserting the vector), there may be overlapping sequences (ie, the same sequence or complementary sequence) between the various fragments and/or between the fragments and the vector. According to the specific method used (especially the method of assembling each fragment and the method of inserting the vector), each fragment may contain sequences that are not on the target sequence, such as restriction sites (such as type II restriction endonucleases, especially Type IIs restriction endonuclease), homology arms, tags, etc.

The full length of the target sequence can be, for example, about 1-100,000, 10-10,000, 100-8,000, 150-8,000, 200-5,000, 250-1,000 or 400-600, for example about 100, 150, 250, 500, 750, 1,000 , 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 4,000, 5,000, 8,000, 10,000, 12,500, 15,000, 17,500, 20,000, 25,000, 50,000, 75,000 or 100,000 (including this number and ±10%). The length of each fragment (such as a variable sequence fragment or a constant sequence fragment) can be, for example, about 1-5,500, 150-5,000, 200-1,000, 250-500, or 400-600, such as about 50, 100, 150, 200, 250, 500, 750, 1,000 or 5,000 (including this number and ±10%).

For a single gene, the full length of the target sequence can be, for example, about 1-10,000, 100-8,000, 150-8,000, 150-5,000, 200-5,000, 250-1,000, or 400-600, such as about 100, 150, 250, 500 , 750, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 5,000, 8,000 or 10,000 (including this number and ±10%). The length of each fragment (such as a variable sequence fragment or a constant sequence fragment) may be, for example, about 1-5,500, 150-5,000, 200-1,000, 250-750, or 400-600, such as about 50, 100, 150, 200, 250, 500, 750, 1,000 or 5,000 (including this number and ±10%).

For polygenes, the full length of the target sequence can be, for example, about 1-100,000, 10-10,000, 100-10,000, 200-8,000, or 500-8,000, such as about 100, 250, 500, 750, 1,000, 1,250, 1,500, 1,750 , 2,000, 2,500, 3,000, 4,000, 5,000, 8,000, 10,000, 12,500, 15,000, 17,500, 20,000, 25,000, 50,000, 75,000 or 100,000 (including this number and ±10%). The length of each fragment (such as a variable sequence fragment or a constant sequence fragment) may be, for example, about 1-5,500, 100-5,000, 150-5,000, 250-1,000, or 250-500, such as about 50, 100, 150, 200, 250, 500, 1,000 or 5,000 (including this number and ±10%).

The reagent transfer relationship table can be performed using any tool (such as software), especially statistical software, such as Excel. You can list the reagents and their volumes required for each reaction (the volume of each reaction can be different); the location of the reagents (such as the code of the plate and the code of the well); the location of the reaction (such as the code of the plate and the code of the well); Hole code). You can search for reusable reagents, that is, common reagents, including reagents common to multiple reactions, and even reagents common to all reactions. You can use Excel's own countif module or pivot table to carry out relevant data statistics and calculate public reagents. The total demand for public reagents can be counted. The common reagents can be combined through the deduplication module of Excel to save the number of wells occupied by the common reagents, thereby saving the number of plates and increasing the number of reactions performed in one run. Various reagents (especially primers and templates) can be represented in various ways, such as name, code, sequence, number, synthetic order number. In the multi-step method, the information of the reagent transfer relationship table in the previous step can be used to generate the reagent transfer relationship table in the subsequent step. The data comparison, search, positioning, etc. involved in this process can be performed using the vlookup module. The reagent transfer relationship table can be output in various ways, such as CSV and other formats that can be recognized by the machine.

Example

Example 1: Construction of seamless splicing vector

1 Introduction

This example describes the construction of exemplary plasmids that can be used for seamless splicing (e.g., recognition sites for type IIS restriction enzymes (e.g., BsmB I) with a pair of head-to-head orientation) and blue-white spot screening functions (e.g., LacZ gene). In short, the plasmid pUC57 (GenBank: Y14837.1) was transformed to obtain the plasmid pUC57-BsmBI.

As shown in Figure 1A, the plasmid pUC57 contains the LacZ gene and two BsmB I restriction sites in a tail-to-tail orientation (that is, the recognition site is outside and the cleavage site is inside) on the same side. Based on the BsmB I restriction cloning procedure, the LacZ gene and the two BsmB I recognition sites are all retained. Therefore, pUC57 is not suitable as a seamless splicing vector.

As shown in Fig. 1B, the transformed plasmid pUC57-BsmBI contains the LacZ gene and a pair of BsmB I restriction sites in the head-to-head orientation (that is, the recognition site is inside, and the cleavage site is outside) of the LacZ gene. Based on the BsmB I restriction cloning procedure, both the LacZ gene and a pair of BsmB I recognition sites were excised. Therefore, pUC57-BsmBI is suitable as a seamless splicing vector.

2. Method

Based on the sequence of the plasmid pUC57 (including the LacZ gene) and the sequence of the BsmB I recognition site, the following four primers were designed and chemically synthesized (Nanjing GenScript Biotechnology Co., Ltd.):

pUC57-BsmBI-f: agaggcctgcatgcaagcttggcgtaatcatggtcatagctgttcgtctctcctgtgtgaaattgttatccgc (SEQ ID NO: 1);

pUC57-BsmBI-r: ggttatcaagtgagaaatcaccatgagtgacgactgaatcggtttcttagacgtcaggtggc (SEQ ID NO: 2);

pUC57-LacZ-f: gattcagtcgtcactcatggtgatttctcacttgataaccttcggtgatgacggtgaaaac (SEQ ID NO: 3);

pUC57-LacZ-r: gctatgaccatgattacgccaagctt (SEQ ID NO: 4).

Using plasmid pUC57 as a template, using primers pUC57-BsmBI-f and pUC57-BsmBI-r to amplify the pUC57 plasmid backbone (product length 2245bp), using primers pUC57-LacZ-f and pUC57-LacZ-r to amplify the LacZ gene insert Part (product length 528bp). The two PCR products have 40 bp homology arms at each end.

PCR system based on PrimeSTAR GXL DNA Polymerase (Takara Biotechnology Co., Ltd., R050A):

PCR program:

Use GenBuilder Plus (Nanjing GenScript Biotechnology Co., Ltd., IM00712) to splice the above two PCR products to obtain the plasmid pUC57-BsmBI.

Splicing reaction system:

Splicing reaction conditions:

Example 2: Construction of mutant gene library

Task:

Insert a collection of nucleic acid sequences into the vector, a total of 24 members (ie target sequences). The target sequence is 819 bp in length, in which the 720 bp core segment contains mutations relative to the starting sequence, and the 72 bp upstream segment and 27 bp downstream segment contain no mutations relative to the starting sequence. Moreover, the 720bp core segment can be divided into 24 continuous core sub-segments in units of 30 bp, and each target sequence contains mutations in a corresponding core sub-segment relative to the starting sequence, and in other core sub-segments. Does not contain mutations (as shown in Figure 2A).

basic design:

By PCR, three sets of fragments A, B, and C are generated, each with 24 kinds of sequences, of which: the middle B fragment is 80 bp long, contains a 30 bp moving window in the middle, corresponds to one of the above core sub-segments, and the flanking sequences on both sides total 50bp, providing a seamlessly spliced recognition site and protective base (for example, the same or complementary to the corresponding part of the starting sequence); the upstream A segment complements the upstream sequence that the corresponding B segment lacks relative to the starting sequence; the downstream C The fragments complement the corresponding downstream sequences that the B fragment lacks relative to the starting sequence; similar to the B fragment, the A fragment and the C fragment also contain flanking sequences, providing a seamlessly spliced recognition site and protective bases (for example, with the starting sequence The corresponding parts are the same or complementary; for example, overlap with the corresponding B fragment or plasmid). Through seamless splicing, the corresponding set of fragments A, B, and C is inserted into the vector (as shown in Figure 2B).

method:

(1) Fragment generation

As mentioned above, this step generates a total of 72 fragments from A1 to A24, B1 to B24, and C1 to C24. These fragments can be generated by PCR.

(1.1) Template

Synthesized (Nanjing GenScript Biotechnology Co., Ltd.) The starting sequence without any mutations was used as a common template for PCR to generate fragments A1 to A24, C1 to C24, and designed and synthesized (Nanjing GenScript Biotechnology Co., Ltd.) including all mutations The mutant sequence is used as a common template for PCR to generate fragments B1 to B24.

(1.2) Primer

Designed and synthesized (Nanjing GenScript Biotechnology Co., Ltd.) primers for PCR amplification of fragments A1 to A24, B1 to B24, and C1 to C24, and introduced a BsmB I recognition site (tail -Tail orientation). Wherein, the forward primer used for PCR amplification of the fragments A1 to A24 is a common primer, and the reverse primer used for PCR amplification of the C1 to C24 fragments is a common primer.

(1.3) Compile reagent position table and reaction position table

As mentioned above, there are 2 kinds of PCR templates and 98 kinds of PCR primers, resulting in 72 kinds of PCR products. If a 96-well plate is used, at least 2 reagent plates (labeled Source1 and Source2) and 1 reaction plate (labeled Destination1) are required. Among them, the reagent plate indicates the position of the primer and template, and the reaction plate indicates the position of the product. Usually, the position of the product on the reaction plate is determined first, and then the position of the primer and template on the reagent plate is determined according to the position of the product on the reaction plate (as shown in Figure 3).

The forward primers used for PCR amplification of fragments A1 to A24 are common primers, marked with GG-AF; the reverse primers used for PCR amplification of fragments A1 to A24 are marked with GG-AR1 to GG-AR24; used for PCR The forward and reverse primers used to amplify fragments B1 to B24 are labeled GG-BF1 to GG-BF24 and GG-BR1 to GG-BR24, respectively; the forward primers used for PCR amplification of fragments C1 to C24 are labeled GG-BF1 to GG-BF24, respectively. CF1 to GG-CF24 are labeled; the reverse primers used for PCR amplification of C1 to C24 fragments are common primers and are labeled GG-CR.

The starting sequence is used as a common template for PCR to generate fragments of A1 to A24 and C1 to C24, marked with A/C-T; the mutant sequence containing all possible mutations is used as a common template for PCR to generate fragments of B1 to B24, marked with B-T.

Common reagents (including primers and templates) can occupy one or more wells.

(1.4) Compile the reagent transfer relationship table

In order to perform PCR, it is necessary to transfer primers, templates, etc. from the reagent plate to the reaction plate. Determine the source and target locations of the reagents that need to be transferred, and the volume that needs to be transferred. Specifically, transfer the reverse primer of fragment A from GG-AR1 to GG-AR24 on the Source1 plate to the corresponding GG-A1 to GG-A24 on the Destination1 plate, and transfer the forward primer of fragment B from the GG-AR1 to GG-AR24 of the Source1 plate. GG-BF1 to GG-BF24 position is transferred to the corresponding Destination1 plate GG-B1 to GG-B24 position, the reverse primer of fragment B is transferred from GG-BR1 to GG-BR24 position of Source1 plate to the corresponding Destination1 plate GG-B1 to GG-B24 position, transfer the forward primer of fragment C from GG-CF1 to GG-CF24 position of Source1 plate to GG-C1 to GG-C24 position of corresponding Destination1 plate, and transfer the common positive of fragment A Transfer the primers from the GG-AF position of the Source2 plate to the GG-A1 to GG-A24 positions of the Destination1 plate, and transfer the common reverse primer of fragment C from the GG-CR position of the Source2 plate to the GG-C1 to GG of the Destination1 plate -C24 location. Transfer the common templates of the fragments A1 to A24 and C1 to C24 from the A/CT position of the Source2 plate to the GG-A1 to GG-A24 and GG-C1 to GG-C24 positions of the corresponding Destination1 plate. The common template is transferred from the BT position on the Source2 board to the GG-B1 to GG-B24 positions on the corresponding Destination1 board.

As shown in Figure 4, a reagent transfer relationship table is generated. The generated reagent transfer relationship table is shown in Figure 5.

(1.5) PCR system preparation and operation

As mentioned above, the primers are synthesized in the corresponding wells of a 96-well deep-well plate (Shanghai Best Biotechnology Co., Ltd., PCR-96M2-HS-C) according to the reagent position table. After synthesis, the template is added to the corresponding wells of the 96-well deep-well plate according to the reagent position table.

Upload the transfer relationship table to the Tecan workstation (Tecan, model EVO20018). The Tecan workstation automatically transfers primers and templates according to the transfer relationship table, from the reagent plate to the reaction plate.

Prepare the reaction working solution and distribute it to the wells of the reaction plate with primers and templates. Dispensing can be manually dispensed with an eight-channel pipette or automatically dispensed with a high-throughput microdispenser (Preddator, Model S4).

Fragments A, B, and C were generated by PCR as described below.

PCR system based on Fragments A and C of Phusion High-Fidelity DNA Polymerase (NEB Biotechnology Co., Ltd., M0530L):

PCR program for fragments A and C:

PCR system based on Fragment B of Phusion High-Fidelity DNA Polymerase (NEB Biotechnology Co., Ltd., M0530L):

PCR program for fragment B:

The expected size of the PCR product is shown in Table 1. The gel electrophoresis photograph of the recovered PCR product is shown in Figure 6.

Table 1

(2) Fragment splicing

As mentioned above, this step inserts the set of A, B, and C fragments into the plasmid. These fragments can be inserted into the plasmid pUC57-BsmBI by seamless splicing (see Example 1).

(2.1) The amount of insert and plasmid

Fragment B, the length is 80bp, the dosage is about 40ng. Fragment A and Fragment C have different lengths, the dosage is about 80ng if the length is less than 550bp, and the dosage is about 120ng if the length is greater than 550bp. The plasmid pUC57-BsmBI has a length of 2683bp and a dosage of about 140ng.

(2.2) Compile reagent position table and reaction position table

As mentioned above, there are 72 kinds of insert fragments (that is, 72 kinds of PCR products obtained in the previous step) and 1 kind of plasmid (that is, pUC57-BsmBI), resulting in 24 kinds of splicing products. If a 96-well plate is used, at least one reagent plate (labeled Source11) and one reaction plate (labeled Destination11) are required. Usually, the position of the product on the reaction plate is determined first, and then the position of the inserted fragment and plasmid on the reagent plate is determined according to the position of the product on the reaction plate (as shown in Figure 7).

The reagent position table of the splicing reaction can follow the reaction position table of the previous PCR (marked by Source11-Destination1), and the plasmid (marked by GG-V) is added.

(2.4) Compile the reagent transfer relationship table

For splicing, it is necessary to transfer inserts, plasmids, etc. from the reagent plate to the reaction plate. Determine the source and target locations of the reagents that need to be transferred, and the volume that needs to be transferred. Specifically, segment A is transferred from GG-A1 to GG-A24 of Source11-Destination1 to GoldenGate-1 to GoldenGate-24 of the corresponding Destination11 board, and segment B is transferred from GG-B1 to GG- of Source11-Destination1. Move the B24 position to the GoldenGate-1 to GoldenGate-24 positions of the corresponding Destination11 board, and transfer the fragment C from GG-B1～GG-B24 of Source11-Destination1 to the GoldenGate-1 to GoldenGate-24 positions of the corresponding Destination11 board. The plasmid GG-V was transferred to the positions of GoldenGate-1 to GoldenGate-24 on the corresponding Destination11 plate.

As shown in Figure 8, a reagent transfer relationship table is generated. The generated reagent transfer relationship table is shown in FIG. 9.

(2.5) Preparation and operation of splicing system

Upload the transfer relationship table to the Tecan workstation. The Tecan workstation automatically transfers inserts and plasmids according to the transfer relationship table, from the reagent plate to the reaction plate.

Prepare the reaction working solution and distribute it to the wells of the reaction plate with inserts and plasmids. Plasmids can also be formulated in working solutions. Dispensing can be manually dispensed with an eight-channel pipette or automatically dispensed with a high-throughput micro-dispenser. When the reaction solution is viscous, manual aliquoting can be carried out to reduce errors.

Splicing reaction system based on BsmB I restriction enzyme (NEB Biotechnology Co., Ltd., R0580L) and T4 DNA Ligase (NEB Biotechnology Co., Ltd., M0202M):

Splicing reaction procedure:

(3) Inspection

According to a conventional method, the splicing product was transformed into E. coli Top10 competent cells (Nanjing GenScript Biotechnology Co., Ltd.), and blue-white plate screening was performed (results not shown). Each splicing reaction uses Qpix (MolecμLar Devices, Qpix 420) to pick 4 single colonies to perform PCR inspection on the inserts (as shown in Figure 10); the colonies that are correct by PCR are submitted for sequencing inspection (data not shown). The test results are shown in Table 2. In short, the one-time success rate of splicing reaches 100%, and the one-time correct rate reaches more than 95%.

Table 2

serial number	PCR positive rate	Sequencing accuracy rate
1	3/4	+
2	3/4	+
3	4/4	+
4	2/4	+
5	4/4	+
6	4/4	+
7	4/4	+
8	2/4	+
9	3/4	+
10	3/4	+
11	4/4	+
12	4/4	+
13	3/4	+
14	4/4	+
15	4/4	+
16	4/4	+
17	3/4	+
18	4/4	+
19	4/4	+
20	1/4	+

twenty one	2/4	+
twenty two	3/4	+
twenty three	4/4	+
twenty four	2/4	+

Example 3: Construction of gene combinatorial library

Task:

Insert a collection of nucleic acid sequences into the vector, a total of 50 members (ie target sequences). The target sequence is composed of 9 parts, which are represented by fragments 1 to 9 in the 5'to 3'direction. Among them, the length of fragment 4 is 500 bp, and there are 4 kinds of sequences to choose; the length of fragment 5 is 301-1500 bp, there are 16 kinds of sequences to choose; the length of fragment 8 is 2050 bp, there are 4 kinds of sequences to choose; the length of fragment 6 is 711 bp, the sequence Unique; Fragment 7 has a length of 400bp with unique sequence; Fragments 1, 2, 3 and 9 have unique sequences. There are a total of 50 combinations of 9 fragments, that is, the target sequence.

basic design:

The sequences of fragments 1, 2, 3 and 9 at both ends are unique, so these four fragments can be integrated into the vector pUC57-KanR (SEQ ID NO: 5) constructed based on pUC57 to generate the intermediate vector U692AEH070-2 (Figure 11) Shown). In order to reduce the length difference between the fragments, according to the sequence length, fragment 4 and fragment 5 are fused into fragment A, fragment 6 and fragment 7 are fused into fragment B, and fragment 8 is used as fragment C alone (as shown in FIG. 12). Both ends of fragment B and fragments A and C each have 60 bp homology arms for seamless splicing. Finally, insert the corresponding set of A, B, and C fragments into the intermediate vector (as shown in Figure 13).

(1) Construction of intermediate vector

As mentioned above, through conventional methods, the four fragments, fragment 1, fragment 2, fragment 3, and fragment 9 were integrated into pUC57-KanR, and the Not I and Asc I restriction sites were introduced for subsequent cloning to generate intermediate vector U692AEH070 -2. The intermediate vector was linearized by Not I and Asc I restriction digestion, purified, and ready for use (concentration of about 20 ng/μL). Both ends of the intermediate vector have 40 bp homology arms with fragments A and C for seamless splicing.

(2) Fragment generation

As mentioned above, this step generates fragment 4, fragment 5, fragment 6, fragment 7, and fragment 8. These fragments can be generated by PCR.

Generated by conventional methods (Nanjing GenScript Biotechnology Co., Ltd.) A plasmid containing any sequence of fragment 4, any sequence of fragment 5, unique sequence of fragment 6, unique sequence of fragment 7, and any sequence of fragment 8 (a total of 26 types) ) As a template.

The primers used for PCR amplification of fragment 4, fragment 5, fragment 6, fragment 7, and fragment 8 were generated by conventional methods (Nanjing GenScript Biotechnology Co., Ltd.), and homology arms were introduced on both sides.

As shown in FIG. 14, the reagent transfer relationship table is generated as described below.

About templates

1. Confirm the number of types of fragments based on the sequence information of fragments 4, 5, 6, 7, and 8 of the 50 target sequences. For example, the number of types of segment 4 is 4, the number of types of segment 5 is 16, the number of types of segment 6 is 1, the number of types of segment 7 is 1, and the number of types of segment 8 is 4. There are 26 kinds in total. The total number of types of fragments corresponds to the total number of types of templates.

2. Give the positions of the above 26 templates (reagent plate numbers and well positions).

3. Count the number of times required for each template according to the needs of the reaction.

4. According to the number of times required by each template in step 3, the volume required by each template is obtained.

5. Establish the corresponding relationship between template position and volume.

About primers

6. Remove sequence repeat primers from all primers.

7. Give the position of the remaining primers (reagent plate number and well position).

8. According to the needs of the reaction, count the number of times required for each primer.

9. Obtain the required volume of each primer according to the number of times required for each primer in step 8.

10. Establish the corresponding relationship between primer position and volume.

About the correspondence between template/primer position and product position

11. Give the position of each PCR product (reaction plate number and well position), and establish the corresponding relationship between the position of the PCR product, the name of the product, the name of the required primer, and the name of the required template.

12. Find the position of the corresponding primer in step 7 according to the name of the primer in step 11, establish the corresponding relationship between the position of the PCR product, the position and volume of the primer, and obtain the transfer relationship table of the primer.

13. Find the position of the corresponding template in step 2 according to the template name in step 11, establish the corresponding relationship between the position of the PCR product, the position and volume of the template, and obtain the template transfer relationship table.

The reagent distribution diagram and the reagent transfer relationship table are shown in Figure 15.

Upload the reagent transfer relationship table to the Tecan workstation. The Tecan workstation automatically transfers primers and templates according to the reagent transfer relationship table, from the reagent plate to the reaction plate.

Prepare the reaction working solution and distribute it to the wells of the reaction plate with primers and templates. Dispensing can be manually dispensed with an eight-channel pipette or automatically dispensed with a high-throughput micro-dispenser.

PCR system based on KODFX DNA Polymerase (TOYOBO, KFX-101):

PCR program:

The gel electrophoresis photograph of the recovered PCR product is shown in FIG. 16.

(3) Fragment fusion

As mentioned above, in this step, fragment 4 and fragment 5 are fused into fragment A, and fragment 6 and fragment 7 are fused into fragment B. The fusion of the fragments can be performed by PCR.

As shown in FIG. 17, the reagent transfer relationship table is generated as described below.

About templates

1. Determine the position of the template (reagent plate number and well position) according to the recovery position of the above PCR product.

About primers

2. Remove sequence repeat primers from all primers.

3. Give the position of the remaining primers (reagent plate number and well position).

4. Count the number of times required for each primer according to the needs of the reaction.

5. Obtain the required volume of each primer according to the number of times required for each primer in step 4.

6. Establish the corresponding relationship between primer position and volume.

About the correspondence between template/primer position and product position

7. Give the position of each fusion product, and establish the corresponding position of the fusion product (fragment A or fragment B), product name, desired primer name, desired template name ( fragment 4 and 5 or fragment 6 and 7) relation.

8. Find the position of the corresponding primer in step 3 according to the primer name in step 7, establish the corresponding relationship between the position of the fusion product, the position and volume of the primer, and obtain the transfer relationship table of the primer.

9. Find the position of the corresponding template in step 1 according to the template name in step 7, establish the corresponding relationship between the position of the fusion product, the position and volume of the template, and obtain the transfer relationship table of the template.

The reagent distribution diagram and the reagent transfer relationship table are shown in Figure 18.

Upload the reagent transfer relationship table to the Tecan workstation. The Tecan workstation automatically transfers primers and templates according to the reagent transfer relationship table, from the reagent plate to the reaction plate.

Prepare the reaction working solution and distribute it to the wells of the reaction plate with primers and templates. Dispensing can be manually dispensed with an eight-channel pipette or automatically dispensed with a high-throughput micro-dispenser.

PCR system based on KOD-FX DNA Polymerase (TOYOBO, KFX-101):

PCR program:

The expected length of fragment A is 801-2000 bp, and the expected length of fragment B is 1111 bp. The gel electrophoresis photograph of the recovered PCR product is shown in FIG. 19.

(4) Final splicing

Use GenBuilder Plus (Nanjing GenScript Biotechnology Co., Ltd., IM00712) to insert the complete set of A, B, and C fragments into the intermediate plasmid.

For the final splicing, the required fragment A, fragment B, fragment C, etc. are transferred from the reagent plate to the reaction plate. A reagent transfer relationship table is generated as shown in FIG. 20. The reagent distribution table and the reagent transfer relationship table are shown in FIG. 21.

Upload the transfer relationship table to the Tecan workstation. The Tecan workstation automatically transfers fragment A, fragment B, and fragment C according to the transfer relationship table, and transfers from the reagent plate to the reaction plate.

Aliquot the plasmid fragments and GenBuilder Plus 2x Master Mix into the wells of the existing Fragment A, Fragment B, and Fragment C. Dispensing can be manually dispensed with an eight-channel pipette or automatically dispensed with a high-throughput micro-dispenser.

Splicing reaction system:

Splicing reaction conditions:

(5) Inspection

According to a conventional method, the spliced product was transformed into E. coli Top10 competent cells (Nanjing GenScript Biotechnology Co., Ltd.), and screened with antibiotics (such as kanamycin) on a plate (results not shown). Pick 6 single colonies for each splicing reaction to perform PCR inspection on the inserts (as shown in Figure 22); the colonies that were correctly tested by PCR were submitted for sequencing inspection (data not shown). The test results are shown in Table 3. In short, the one-time success rate of splicing reaches 100%, and the one-time correct rate reaches more than 95%.

table 3

serial number	PCR positive rate	Sequencing accuracy rate	serial number	PCR positive rate	Sequencing accuracy rate
1	2/6	+	26	4/6	+
2	4/6	+	27	3/6	+
3	3/6	+	28	3/6	+
4	3/6	+	29	3/6	+
5	3/6	+	30	5/6	+
6	6/6	+	31	5/6	+
7	3/6	+	32	6/6	+
8	5/6	+	33	1/6	+
9	3/6	+	34	3/6	+
10	6/6	+	35	3/6	+
11	4/6	+	36	6/6	+
12	3/6	+	37	1/6	+
13	1/6	+	38	6/6	+
14	3/6	+	39	2/6	+
15	2/6	+	40	5/6	+
16	2/6	+	41	5/6	+
17	1/6	+	42	6/6	+
18	2/6	+	43	4/6	+
19	4/6	+	44	6/6	+
20	5/6	+	45	2/6	+
twenty one	6/6	+	46	3/6	+
twenty two	6/6	+	47	6/6	+
twenty three	2/6	+	48	3/6	+
twenty four	6/6	+	49	6/6	+
25	3/6	+	50	3/6	+

The well numbers of the 96-well plate are shown in Figure 23.

sequence

Claims (13)

1. A method for constructing a mutant gene library, wherein each mutant gene in the mutant gene library contains a mutation relative to a reference sequence, the method comprising:

   (1) For each mutant gene, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments contain the same segments as the reference sequence or its complementary sequence. Sequences, variable sequence fragments contain mutations compared to the corresponding segments of the reference sequence or its complementary sequence;

   (2) Generate each constant sequence fragment of each mutant gene and each variable sequence fragment of each mutant gene separately;

   (3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each mutant gene; and

   (4) Generate a full-length mutant gene for each mutant gene, and optionally insert it into a vector,

   Thus, a mutant gene library was constructed, wherein the method was carried out in batches in a multi-compartment container.
2. A method for constructing a gene combination library, wherein various gene combinations in the gene combination library have segments with unique sequences and segments with multiple selections of sequences relative to each other, and the method includes:

   (1) For each gene combination, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments correspond to the segments with unique sequences in the gene combination library, The variable sequence segment corresponds to a segment with multiple selection sequences in the gene combinatorial library;

   (2) Generate each constant sequence fragment and each variable sequence fragment for each gene combination;

   (3) Formulating a reaction system containing a complete set of constant sequence fragments and variable sequence fragments for each gene combination; and

   (4) Generate a full-length gene combination for each gene combination, optionally insert a vector,

   Thus, a gene combinatorial library is constructed, wherein the method is carried out in batches in a multi-compartment container.
3. A method for automatically preparing a batch reaction system, which includes:

   Generate a reagent transfer relationship table; and

   Upload the reagent transfer relationship table to the automatic pipetting device, and the automatic pipetting device will automatically transfer the reagent from the container containing the reagent to the container for reaction according to the reagent transfer relationship table.

   The reagent transfer relationship table is generated as follows:

   (1) List the batch reactions to be carried out, list the reagents and their volumes required for each reaction;

   (2) Determine the position of each reaction in terms of the reaction vessel;

   (3) Determine the position of each reagent required for each reaction in terms of the reagent container;

   (4) Determine the transfer starting point and end point of each reagent required for each reaction,

   The method is carried out in a multi-compartment container.
4. A method for constructing a mutant gene library, wherein each mutant gene in the mutant gene library contains a mutation relative to a reference sequence, the method comprising:

   (1) For each mutant gene, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments contain the same segments as the reference sequence or its complementary sequence. Sequences, variable sequence fragments contain mutations compared to the corresponding segments of the reference sequence or its complementary sequence;

   (2) Generate each constant sequence fragment of each mutant gene and each variable sequence fragment of each mutant gene separately;

   (3) Formulating a reaction system containing a set of constant sequence fragments and variable sequence fragments by the method of claim 3 for each mutant gene; and

   (4) Generate a full-length mutant gene for each mutant gene, and optionally insert it into a vector,

   Thus, a mutant gene library was constructed.
5. A method for constructing a gene combination library, wherein various gene combinations in the gene combination library have segments with unique sequences and segments with multiple selections of sequences relative to each other, and the method includes:

   (1) For each gene combination, the full-length sequence is divided into one or more constant sequence fragments and one or more variable sequence fragments, where the constant sequence fragments correspond to the segments with unique sequences in the gene combination library, The variable sequence segment corresponds to a segment with multiple selection sequences in the gene combinatorial library;

   (2) Generate each constant sequence fragment and each variable sequence fragment for each gene combination;

   (3) Formulating a reaction system comprising a set of constant sequence fragments and variable sequence fragments by the method of claim 3 for each gene combination; and

   (4) Generate a full-length gene combination for each gene combination, optionally insert a vector,

   Thus, a gene combinatorial library was constructed.
6. The method of any one of claims 1-5, wherein the multi-compartment container is a multi-well plate, such as a 96-well plate or a 384-well plate.
7. The method according to any one of claims 1 to 6, wherein the reagents common to a plurality of reactions are combined in one or more wells on the reagent plate.
8. The method according to any one of claims 1 to 6, wherein the reagents common to multiple reactions and/or the reagents common to all reactions are added manually.
9. The method of claim 8, wherein the manual addition is performed using a multichannel pipette.
10. The method of any one of claims 1-9, wherein at least 10 reactions, at least 25 reactions, at least 50 reactions, at least 100 reactions, at least 250 reactions, at least 500 reactions, at least 750 reactions, at least 1000 reactions, at least 1250 reactions, at least 1500 reactions, at least 1750 reactions, at least 2000 reactions, at least 2250 reactions, at least 2500 reactions, or at least 2750 reactions.
11. The method of any one of claims 1, 2, 4, and 5, wherein step (4) uses a seamless splicing technique.
12. The method of claim 11, wherein the seamless splicing technique is selected from the group consisting of Golden-gate method, Gibson method or Genbuilder method.
13. The method of claim 1 or 4, wherein the mutant gene library comprises the reference sequence.

Images