WO2021187902A1 - Nucleic acid-based anticancer agent - Google Patents

Nucleic acid-based anticancer agent Download PDF

Info

Publication number
WO2021187902A1
WO2021187902A1 PCT/KR2021/003328 KR2021003328W WO2021187902A1 WO 2021187902 A1 WO2021187902 A1 WO 2021187902A1 KR 2021003328 W KR2021003328 W KR 2021003328W WO 2021187902 A1 WO2021187902 A1 WO 2021187902A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
linker
anticancer agent
dna
rna
Prior art date
Application number
PCT/KR2021/003328
Other languages
French (fr)
Korean (ko)
Inventor
김성천
Original Assignee
김성천
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 김성천 filed Critical 김성천
Publication of WO2021187902A1 publication Critical patent/WO2021187902A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/006—Oral mucosa, e.g. mucoadhesive forms, sublingual droplets; Buccal patches or films; Buccal sprays
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to a nucleic acid-based anticancer agent.
  • cancer is a disease whose mortality rate is continuously increasing every year due to aging, westernized eating habits, and lack of exercise. According to statistics on the cause of death in Korea in 2019, the death rate from cancer, the number one cause of death (158.2 per 100,000 population), is 2.5 times higher than the death rate from heart disease, the second most common cause (60.4 per 100,000 population). There is a need to develop effective anticancer therapies for
  • Cancer refers to a disease that occurs when a cell mass is formed by indiscriminate cell proliferation due to an abnormal physiological environment, which invades surrounding tissues or metastasizes to other tissues of the body through blood vessels.
  • Methods for treating such cancer include surgery, radiation therapy, chemotherapy, and the like, and chemotherapy is basically used to prevent cancer recurrence and metastasis.
  • chemotherapy is a systemic treatment in which cytotoxic anticancer drugs are administered orally or by injection to act on cancer cells that have spread throughout the body.
  • Cytotoxic anticancer drugs show cytotoxicity to cancer cells by directly or indirectly blocking DNA replication, transcription, or translation, interfering in the metabolic pathway of nucleic acid synthesis, interfering with nucleic acid synthesis, or inhibiting cell division by acting on microtubules. drugs are collectively referred to as
  • cytotoxic anticancer drugs were developed using the characteristic that cancer cells grow faster than normal cells, they act not only on cancer cells but also on normal cells such as bone marrow tissue cells, gastrointestinal epithelial cells, and hair follicle epithelial cells, which are active in cell division, resulting in decreased bone marrow function. It causes side effects such as decreased immune function, loss of appetite, vomiting, diarrhea, and alopecia.
  • cancer cells acquire resistance to anticancer drugs.
  • the present invention is a nucleic acid that can be loaded with a high content of anticancer agents, can be combined with two or more types of anticancer drugs, and has a targeting function to cancer cells, thereby reducing the side effects and producing homogeneous Disclosed is an anticancer drug based.
  • Another object of the present invention is to provide a nucleic acid-based anticancer agent having a targeting function in which a targeting region to a cancer cell is bound to the nucleic acid-based anticancer agent.
  • the nucleic acid-based anticancer agent of the present invention may be identified as a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue bound to an anticancer agent are integrated.
  • the nucleic acid-based anticancer agent of the present invention may be designed to have a targeting function by binding a targeting domain to a cancer cell to the DNA or RNA nucleic acid.
  • the nucleic acid-based anticancer agent of the present invention having such a targeting function is (i) DNA or RNA nucleic acid in which one or more molecules of a nucleotide analog to which an anticancer agent is bound are integrated (ii) by specifically recognizing a target molecule expressed on the surface of cancer cells.
  • the binding targeting region has a bound configuration.
  • the nucleotide analog to which the anticancer agent is bound refers to a covalent bond between the anticancer agent and a natural nucleotide or a nucleotide analog into which a functional group is artificially introduced through a functional group introduced by the anticancer agent or a functional group introduced through a linker.
  • Natural nucleotides have functional groups such as an amino group, a phosphate group, and a hydroxyl group, and an anticancer agent having a functional group capable of reacting with these functional groups can be covalently bonded to a natural nucleotide.
  • an anticancer agent having a functional group capable of reacting with the introduced functional group can be covalently bound to a natural nucleotide even in an artificially introduced functional group-introduced nucleotide analogue.
  • a functional group may be artificially introduced into an anticancer drug through a linker, and the anticancer agent into which the functional group is introduced may be reacted with a natural nucleotide or a nucleotide analog into which the functional group has been artificially introduced to covalently bond.
  • the anticancer agent exhibits activity even when a functional group is introduced through a linker in addition to a moiety that binds to a receptor or an enzyme in the anticancer agent (Chemistry. 2019, 25(65):14740-14757 ).
  • a sulfo-NHS (N-hydroxysulfosuccinimide) linker is conjugated to a DOX (doxorubicin) anticancer agent to have an NHS ester functional group, such as Succinyl Dox NHS ester (CellMosaic, USA), or SN38 (7- By conjugating a sulfo-NHS (N-hydroxysulfosuccinimide) linker to an ethyl-10-hydroxycamptothecin) anticancer drug, O-Succinyl SN38 NHS ester (CellMosaic, USA) or DOX (doxorubicin) having an NHS ester functional group (N- ⁇ - Aldoxorubicin ChemScence, USA), which has a hydrazone functional group by conjugation of maleimidocaproic acid hydrazide, or EMCH) linker, etc. )
  • an NHS ester functional group such as Succinyl Dox NHS ester (C
  • examples of the nucleotide analogue in which a functional group is introduced through a linker include, for example, a dAMP analogue in which an amino group is introduced into dAMP (Deoxyadenosine monophosphate) (amino deoxyadenosine dA C6, Gene Link, USA), a dGMP analogue in which an amino group is introduced into dGMP (Deoxyguanosine monophosphate) ( amino deoxyguanocine dG C6, Gene Link, USA), dCMP ((deoxycytidine monophosphate) with an amino group introduced into it (amino deoxycytosine dC C6, Gene Link, USA), dTMP analog with an amino group introduced with dTMP (deoxythymine monophosphate) (4-Thio-dT ((S4-dT), Gene Link Co.), and the like, and these nucleotide analogues can be integrated at the corresponding position in the DNA nucleic acid by replacing each
  • nucleotide analog in which a functional group is introduced through a linker for example, an UMP analog in which an amino group is introduced into UMP (Uridine monophosphate) (amino C6 U, Gene Link Co.), a UMP analog in which an amino group is introduced into UMP (Uridine monophosphate) (4-Uridine monophosphate) Thio-Uridine (s4U), Gene Link Inc.) can be integrated at the corresponding position of the RNA nucleic acid by replacing the native UTP.
  • a purine nucleotide analogue having an amino group (2-amino Purine Ribose, Gene Link) can be integrated at the corresponding position in the RNA nucleic acid by replacing ATP or GTP.
  • Functional groups introduced through a linker into nucleotide analogues or anticancer agents are amine group, carboxyl group, sulfhydryl group, phosphate group, hydroxyl group, isothiocyanate (isothiocyanate), isocyanate (isocyanates), acyl azide (acyl azide), NHS ester (NHS ester), sulfonyl chloride (sulfonyl chloride), aldehyde (aldehyde), glyoxal (glyoxal), epoxide (epoxide), Oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride, fluorophenyl ester, hydroxymethyl It may be phosphine (hydroxymethyl phosphine), maleimide (maleimide), haloacetyl (haloacetyl), pyridyldisulfide (pyridyldisul
  • the linker may be a linker cleavable by a protease, cleavable under acid or base conditions, cleavable under high temperature or light irradiation, or cleavable under reducing or oxidizing conditions, or a linker that is not cleavable under these conditions. may be
  • cleavable linker examples include a hydrazone linker cleaved under acidic conditions, a peptide linker cleaved by a protease, and a linker having a disulfide functional group cleaved under reducing conditions.
  • non-cleavable linkers include: MCC (Maleimidomethyl cyclohexane-1-carboxylate) linker, MC (maleimidocaproyl) linker, or a derivative thereof, such as succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (sMCC) linker or sulfosuccin imidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).
  • the linker may also be a self-immolative linker or a traceless linker after cleavage.
  • Self-immolative linkers are, for example, linkers disclosed in U.S. Patent No. 9,089,614 entitled “Hydrophilic self-immolative linkers and conjugates thereof", titled “SELF-IMMOLATIVE LINKERS CONTAINING MANDELIC ACID DERIVATIVES, DRUG-LIGAND CONJUGATES FOR TARGETED THERAPIES AND USP THEREOF,” which is a linker disclosed in WO2015038426, and as a linker that does not leave a trace after cleavage, a phenylhydrazide linker, an aryl-triazene linker, Blaney, et al., “Traceless solid-phase organic synthesis” ,” Chem Rev. 102: 2607-2024 (2002), and the like.
  • the linker may also be a homobifunctional linker (a linker having two or more identical reactive functional groups) or a heterobifunctional linker (a linker having two or more different reactive functional groups).
  • Homobifunctional linkers include, for example, 3'3'-dithiobis(sulfosuccinimidyl propionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), Disuccinimidyl Tartrate (DST), Disulfosuccinimidyl Tartrate (Sulfo DST), Ethylene Glycobis (Succinimidyl Succinate) (EGS), Disuccinimidyl Glutarate (DSG), N,N '-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate ( DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamido)butane (DP
  • Heterobifunctional linkers include amine-reactive and sulfhydryl-reactive cross-linkers, carbonyl-reactive and sulfhydryl-reactive cross-linkers, amine-reactive and photoreactive cross-linkers, sulfhydryl-reactive and photoreactive cross-linkers, and the like.
  • Amine-reactive and sulfhydryl-reactive cross-linkers include, for example, N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long chain N-succinimidyl 3-(2-pyridyldithio) propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl- ⁇ -methyl- ⁇ -(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6- ⁇ -methyl- ⁇ -(2-pyridyldithio)toluamidohexanoate (sulfo-LC-sMPT), Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carbox
  • an amine- Reactive and photoreactive cross-linkers include, for example, N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA).
  • sulfosuccinimidyl-(4-azidosalicylamido)hexanoate sulfo-NHs-LC-AsA
  • sulfosuccinimidyl-2-( ⁇ -azidosalicylamido)ethyl-1 , 3'-dithiopropionate sAsD
  • HsAB N-hydroxysuccinimidyl-4-azidobenzoate
  • HsAB N-hydroxysulfosuccinimidyl-4-azidobenzoate
  • sANPAH N-Succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate
  • sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino) hexanoate sulfo-sANPAH
  • sulfhydryl-reactive and photoreactive cross-linker examples include 1-( ⁇ -azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-4-( ⁇ -azidosalicylamido)butyl-3'-(2'-pyridyldithio) and propionamide (APDP), benzophenone-4-iodoacetamide, and benzophenone-4-maleimide.
  • the linker is a dendritic type of linker.
  • Resin type linkers have branched, multifunctional linkers, such as, for example, PAMAM dendrimers.
  • linkers exemplified above numerous linkers applicable to the present invention are known in the art through a significant number of documents.
  • Castaneda, et al "Acid-cleavable thiomaleamic acid linker for homogeneous antibodydrug conjugation," Chem Commun. 49: 8187-8189 (2013), Lyon, et al, “Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat Biotechnol.
  • the DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue bound to an anticancer agent are integrated is prepared by using a sequence consisting of a 5' end region - an intermediate region of an arbitrary sequence - 3' end region as a template, and preparing a DNA nucleic acid It can be obtained through polymerase chain reaction (PCR), PCR and in vitro transcription for RNA nucleic acid production.
  • PCR polymerase chain reaction
  • the DNA nucleic acid may be a double-stranded DNA nucleic acid obtained directly through PCR or a single-stranded DNA nucleic acid having substantially the same sequence as the template obtained by isolating the double-stranded DNA nucleic acid.
  • substantially identical in sequence to the template means that when a nucleotide analogue to which an anticancer agent is bound is integrated in place of the original nucleotide at the position where the original nucleotide is to be integrated, the sequence in which the nucleotide analogue is integrated, and the original nucleotide is It is considered to be the same sequence as the template sequence in the
  • the 5' end region and the 3' end region are regions where the forward primer and the reverse primer bind, respectively.
  • the 5' end region may be configured to have a promoter sequence capable of initiating transcription by RNA polymerase if it is to produce RNA nucleic acid.
  • the 5' end region and the 3' end region may have any length as long as a primer can be bound thereto to perform PCR or an RNA polymerase can bind to initiate transcription for RNA nucleic acid production. Usually it will be 15-30 nucleotides in length.
  • Any sequence region of the intermediate region in the template is a sequence for integrating a nucleotide analog to which an anticancer agent is bound.
  • Such a sequence may be designed and manufactured to have any appropriate sequence and any length in consideration of the content of the anticancer agent to be loaded on the nucleic acid, the type of anticancer agent to be loaded, and the location where the anticancer agent is to be loaded.
  • any one or more NTPs of the four nucleoside triphosphates (NTPs) are replaced with an anticancer drug-bound nucleotide analog by using such an arbitrary sequence region, so that the anticancer agent-bound nucleotide analog is converted to the original NTP. It makes it possible to be integrated at the location to be integrated.
  • a three-molecule doxorubicin (DOX)-integrated nucleic acid using a doxorubicin (DOX)-conjugated nucleotide analog which can be incorporated by replacing CTP
  • a doxorubicin (DOX)-conjugated nucleotide analog which can be incorporated by replacing CTP
  • N is any nucleotide other than C
  • the arbitrary sequence region can contain two C (cytosine) and two It can be configured such that A (adenine) is located and nucleotides other than C and A are located at all other positions, for example, to have a ⁇ NNCACANN ⁇ sequence or ⁇ ACNCANN ⁇ sequence (where N is any other than C and A) nucleotides).
  • the arbitrary sequence region of the intermediate region can be configured to have an arbitrary length in consideration of the content of the anticancer agent to be loaded, the type of the anticancer agent to be loaded, and the position of the loaded anticancer agent, It is possible to determine and control the content or type of the anticancer agent to be loaded and the location where the anticancer agent is loaded as intended.
  • the DNA nucleic acid in which one or more molecules of the anticancer agent-bound nucleotide analogue of the present invention are integrated is (a) a template DNA nucleic acid having the above configuration, that is, the 5' end region - the middle region of the arbitrary sequence - 3' end region A step of preparing a template DNA nucleic acid having a composition, (b) PCR using a nucleotide analogue bound with an anticancer agent to the template DNA nucleic acid with a dNTP mixture excluding the natural dNTP (deoxynucleoside triphosphate) corresponding to the analogue It can be obtained by a manufacturing method comprising the steps of obtaining an amplification product of the template DNA nucleic acid through, and (c) recovering the amplification product.
  • the dNTP mixture when using a nucleotide analog to which an anticancer agent is bound as a nucleotide analogue that can be integrated into a DNA nucleic acid by replacing dATP, the dNTP mixture includes dGTP, dCTP, and dTTP excluding dATP.
  • the PCR may be performed using a forward primer and a reverse primer that complementarily bind to the 5' end region and the 3' end region of the template DNA nucleic acid.
  • nucleotide analogue to which the anticancer agent is bound can be used without any particular limitation as long as it can be incorporated into the amplification product by replacing the natural dNTP.
  • Nucleotide analogues to which these anticancer agents are bound are natural nucleotides having functional groups such as an amine group, a phosphate group, and a hydroxyl group, as described above, or a nucleotide analogue in which a functional group is introduced through a linker, It can be obtained by reacting an anticancer agent having a functional group capable of reacting with a functional group of such natural nucleotides or nucleotide analogues or an anticancer agent artificially introduced with a functional group through a linker (ie, a linker drug conjugate).
  • the template DNA nucleic acid has an arbitrary sequence region in the intermediate region as described above, taking into account the content of the anticancer agent to be loaded, the type of anticancer agent to be loaded, and the position of the loaded anticancer agent. It can be configured to have any length.
  • a DNA nucleic acid into which one or more molecules of the nucleotide analogue bound to the anticancer agent of the present invention are integrated may be obtained by a method different from the above.
  • Such a production method comprises the steps of (a) preparing a template DNA nucleic acid having the configuration of a 5' end region-intermediate region-3' end region of any sequence, (b) preparing a nucleotide analog having a functional group with respect to the template DNA nucleic acid , obtaining an amplification product in which a nucleotide analogue having a functional group is incorporated through PCR by using it with a dNTP mixture in which the natural dNTP corresponding to the analogue is excluded, (c) in the amplification product, the functional group of the nucleotide analogue is A step of reacting an anticancer agent having a functional group that can be used, (d) recovering the reaction product.
  • nucleotide analogues in which a functional group is introduced through a linker dAMP analogues (amino deoxyadenosine dA C6, Gene Link), dGMP analogues (amino deoxyguanocine dG C6, Gene Link), dCMP analogues (amino deoxycytosine dC C6, Gene) as described above Link, Inc.), dTMP analogues (4-Thio-dT ((S4-dT), Gene Link Inc.), etc.), and these nucleotide analogues replace each corresponding dNTP in nature and can be integrated at the corresponding position in the DNA nucleic acid. have.
  • an anticancer agent or a conjugate of a linker and an anticancer agent having a functional group capable of reacting with the functional group of the nucleotide analogue is reacted to induce a covalent bond between these functional groups to finally DNA nucleic acid having an anticancer agent at a desired position as much as a desired number of molecules at a desired position can be prepared.
  • thermostable DNA that can be integrated by recognizing and integrating the nucleotide analogue in the same way as the corresponding natural dNPT during the amplification process to integrate the nucleotide analogue. It is preferable to use a polymerase (DNA polymerase).
  • KOD XL polymerase which originated from Thermococcus kodakaraensis
  • Pwo polymerase which originated from the Pyrococcus woesei
  • 3 ' ⁇ 5 ' exonuclease which activity is lacking artificially
  • Thermo kusu Lee TB-less (Thermoccus literalis ) origin such as Deep Vent exo-polymerase or Vent exo-polymerase can be used.
  • RNA nucleic acid in which one or more molecules of the anticancer agent-bound nucleotide analogue of the present invention are integrated can be obtained by obtaining an amplification product from the template DNA through PCR and performing in vitro transcription, specifically (a) 5' end region-any Preparing a template DNA nucleic acid having the configuration of the intermediate region-3' end region of the sequence, (b) obtaining an amplification product through PCR using a natural NTP for the template DNA nucleic acid, (c) the amplification Using the product as a template and using a nucleotide analogue to which an anticancer agent is bound, together with a mixture of NTPs excluding natural NTPs corresponding to the analogue, to prepare RNA into which the nucleotide analogue is integrated through in vitro transcription, and (d) and recovering the prepared RNA.
  • RNA nucleic acids in which one or more molecules of the nucleotide analogues bound to the anticancer agent of the present invention are integrated can be obtained by other preparation methods.
  • Its preparation method can be specifically obtained by obtaining an amplification product through PCR from template DNA and obtaining it through in vitro transcription, specifically (a) having the configuration of a 5' end region - an intermediate region of an arbitrary sequence - 3' end region A step of preparing a template DNA nucleic acid, (b) obtaining an amplification product through PCR using a natural NTP for the template DNA nucleic acid, (c) using the amplification product as a template, a nucleotide analogue having a functional group, the A step of preparing an RNA in which the nucleotide analogue is integrated through in vitro transcription by using it with a NTP mixture in which the natural NTP corresponding to the analogue is excluded, (d) in the prepared RNA, a functional group of the nucleotide analogue capable of reacting A step of reacting an anticancer agent having a functional group, (e) recovering the reaction product.
  • the 5' end region is designed to have the promoter sequence of RNA polymerase.
  • mutant T7 polymerase capable of incorporating a nucleotide analog into RNA as well as a corresponding natural NTP as the RNA polymerase.
  • mutant T7 polymerase Y639F, mutant T7 polymerase Y639F/H784A, mutant T7 polymerase H784A and the like are known in the art (Science, 286:2305-2308, 1999; Nucleic Acids Res30(24):138, 2002).
  • the NTP mixture for performing the in vitro transcription may include nucleotides chemically modified (modified) at the sugar position, phosphate position, and base position of the nucleotide.
  • nucleotides chemically modified (modified) at the sugar position, phosphate position, and base position of the nucleotide.
  • wild type RNA has the property of being easily degraded by endonuclease or exonuclease in vivo.
  • These chemically modified aptamers can improve the stability in vivo, thereby increasing the biological half-life to improve pharmacodynamic and pharmacokinetic properties, and in addition, by giving resistance to chemical and physical degradation, storage stability, etc. can improve
  • the chemically modified nucleotide may be 2'F-CTP or 2'F-UTP.
  • nucleotide analogue having a functional group the above-described UMP analogue having an amino group (amino C6 U or 4-Thio-Uridine (s4U), Gene Link Corporation), a purine nucleotide analogue having an amino group (2) -amino Purine Ribose, Gene Link) etc. can be illustrated.
  • the nucleotide analogue to which the anticancer agent is bound is, for example, a DOX (doxorubicin) anticancer drug having an NHS ester functional group or a SN38 (7-ethyl-10-hydroxycamptothecin) anticancer drug having an NHS ester functional group to a UMP analogue having an amino group. What is obtained by making it react, etc. can be illustrated.
  • the cancer cell is any cancer cell (or cancer stem cell) that needs to be removed or killed for therapeutic purposes.
  • Cancer cells include esophageal cancer, stomach cancer, colorectal cancer, rectal cancer, oral cancer, pharyngeal cancer, laryngeal cancer, lung cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, ovarian cancer, prostate cancer, testicular cancer, bladder cancer, kidney cancer, liver cancer, pancreatic cancer, bone cancer, Carcinomas such as connective tissue cancer, skin cancer, brain cancer, thyroid cancer, leukemia, Hodgkin's disease, lymphoma, multiple myeloma, and blood cancer are irrelevant.
  • the target molecule is any antigen or any receptor present on the surface of cancer cells.
  • Such antigen or receptor preferably refers to an antigen or receptor that is expressed only in cancer cells or is overexpressed in cancer cells compared to normal cells.
  • epidermal growth factor receptor variant III EGFRvIII
  • EGFRvIII epidermal growth factor receptor variant III
  • EGFR epidermal growth factor receptor
  • EGFR epidermal growth factor receptor
  • EGFR epidermal growth factor receptor
  • anaplastic thyroid cancer breast cancer, lung cancer, glioma, etc., papillary thyroid cancer
  • metastin receptor ErbB receptor tyrosine kinases overexpressed in breast cancer, breast cancer, bladder cancer, gallbladder cancers, cholangiocarcinomas, esophagogastric HER2 (Human epidermal growth factor receptor 2) overexpressed in junction cancers, etc.
  • tyrosine kinase-18-receptor c-Kit
  • HGF receptor c-Met overexpressed in esophageal adenocarcinoma
  • CEA carcinoembryonic antigen
  • MSLN epidermal cell adhesion molecule
  • MSLN Mesothelin
  • GD2 disialoganglioside
  • GPC3 hepatocellular carcinoma
  • PSMA Prostate Specific Membrane Antigen
  • TAG-72 tumor-associated glycoprotein 72 overexpressed in ovarian cancer, breast cancer, colon cancer, lung cancer and pancreatic cancer, melanoma, etc.
  • GD3 dialoganglioside
  • HLA-DR human leukocyte antigen-DR
  • MUC1 Moc 1
  • LMP1 Latent membrane protein 1
  • NY-ESO-1 New York esophageal squamous cell carcinoma 1
  • nasopharyngeal neoplasms lung cancer, non-Hodgkin's lymphoma, ovarian cancer, colon cancer, colorectal cancer, pancreatic cancer, etc.
  • Target molecules may include overexpressed tumor-necrosis factor-related apoptosis-inducing ligand receptor (TRAILR2), vascular endothelial growth factor receptor 2 (VEGFR2), overexpressed hepatocyte growth factor receptor (HGFR), etc.
  • TRAILR2 tumor-necrosis factor-related apoptosis-inducing ligand receptor
  • VEGFR2 vascular endothelial growth factor receptor 2
  • HGFR hepatocyte growth factor receptor
  • CD44, CD166, etc. which are surface antigens of cancer stem cells, may also be target molecules.
  • the targeting region is a portion that specifically recognizes and binds to a target molecule of a cancer cell, and is an antibody, an antibody derivative, an antibody analog, or an aptamer.
  • the antibody may be an antibody derivative or an antibody analog in addition to a complete antibody having specific binding ability with a target molecule.
  • An antibody derivative refers to a fragment of a complete antibody or a modified antibody comprising at least one antibody variable region having specific binding ability with a target molecule. Examples of such antibody derivatives include antibody fragments such as Fab, scFv, Fv, VhH, VH, and VL; polyvalent or multispecific modified antibodies such as Fab2, Fab3, minibody, diabody, tribody, tetrabody, bis-scFv, etc.
  • Antibody analog refers to an artificial peptide or polypeptide having specific binding ability with a target molecule like an antibody, but having a structure different from an antibody and generally having a lower molecular weight than an antibody.
  • antibody analogs include ABD, adhron, affibody, affilin, affimer, alphabody, anticalin, armadillo repeat protein, centimeter. Lin (centyrin), dalpin (DARPin), pinomer (fynomer), Kunitz region, pronectin (pronectin), repeat body (repebody) and the like.
  • Antibodies as a cell targeting region include antibodies that have been developed and sold in the past, such as Cetuximab, Trastuzumab, Oregovomab, Edrecolomab, Alemtuzumab. , Labetuzumab, Bevacizumab, Ibritumomab, Ofatumumab, Panitumumab, Rituximab, Tositumomab , Ipilimumab, Gemtuzumab, Brentuximab, Vadastuximab, Glebatumumab, Depatuxizumab, Polatuzumab , Denintuzumab, etc. may be used.
  • the aptamer as the targeting region may be a single-stranded DNA aptamer or a single-stranded RNA aptamer.
  • the aptamer refers to a nucleic acid ligand capable of specifically binding to a target molecule, such as a target antigen, like an antibody. If it can specifically bind to a target molecule, the aptamer may be a double-stranded DNA or RNA aptamer.
  • the preparation and selection methods of the aptamer capable of specific binding to the target molecule are all known in the art, and in particular, the SELEX technology or a technology improved this SELEX technology, such as Counter- to increase specificity with the target molecule SELEX technology (Science 263(5152):1425-1429, 1994), Spiegelmer technology using enantiomers of a target molecule and an aptamer (Chem Biol 9(3):351-359, 2002), etc. can be used.
  • the SELEX technology is a technology named as an abbreviation of "Systematic Evolution of Ligands by EXponential enrichment", and the technology is described in Documents Science 249 (4968):505-510, 1990, U.S. Patent No.
  • U.S. Patent No. 5,270,163 , International Patent Publication No. WO 91/19813, etc. may be referred to, and for specific methods for the selection of aptamers or the use of appropriate reagents, materials, etc., Methods Enzymol 267:275-301, 1996, Methods Enzymol 318:193 -214, 2000, etc. may be referred to.
  • the aptamer may be modified with sugar, phosphate and/or base to improve half-life in vivo. Nucleotides modified in such sugars, phosphates and/or bases are specifically known in the art, including methods for their preparation.
  • Nucleotides modified in sugars are those in which the hydroxyl group (2'-OH group) of the sugar is modified with a halogen group (especially fluorine (F)), an aliphatic group, an ether group, an amine group, or in particular OMe, O-alkyl, O- Those modified with allyl, S-alkyl, S-allyl or halogen, etc., sugar analogues ⁇ -anomeric sugars, arabinose, in which the sugar ribose or deoxyribose itself can replace it; and epimeric sugars such as xylose or lyxoses, pyranose sugars, furanose sugars, and the like.
  • a halogen group especially fluorine (F)
  • F fluorine
  • modifications in the phosphate can be modified so that the phosphate is P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO or those modified with formacetal (CH2).
  • R or R' is H or substituted or unsubstituted alkyl, etc.
  • the linking group becomes -O-, -N-, -S- or -C-, so that adjacent nucleotides through this linking group will combine with each other.
  • An aptamer is its target even if one or more nucleotides are added, substituted, or deleted at the site where it binds to the target molecule or at sites other than the binding site, and even if it is chemically modified or other sequences are added at both ends of the aptamer. Since it is well known in the art that the binding capacity with a molecule does not change or can be maintained even if the binding capacity is lowered (Molecules. 2020 Jan; 25(1):3; Int J Mol Sci. 2017 Aug; 18(8)) :1683), one or more nucleotides are added, substituted, deleted, or one or more ends of both ends are modified.
  • aptamers can be newly selected, amplified, separated, purified, or chemically synthesized for any target molecule according to methods known in the art, such as SELEX technology, and, if necessary, as shown in Table 1 below, It is also possible to use an aptamer of a known sequence.
  • nucleic acid-based anticancer agent of the present invention when a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analog to which an anticancer agent is bound is integrated is combined with a targeting region to have a targeting function, the DNA or RNA nucleic acid is combined with the targeting region They may be directly covalently or non-covalently bound to each other without the mediation of a linker, or may be covalently bound to each other via a linker.
  • the targeting region is a single-stranded DNA or RNA aptamer
  • the sequence of the end region is designed and manufactured so that the aptamer complementarily binds to the 5' end region or 3' end region of the DNA or RNA nucleic acid to which the anticancer drug is bound. They can be bound by non-covalent complementary hydrogen bonds.
  • the targeting region is a single-stranded DNA or RNA aptamer
  • the DNA or RNA nucleic acid to which the anticancer agent is bound to the aptamer T4 DNA ligase, T4, which is an appropriate ligase depending on the substrate, known in the art It can also be covalently linked using RNA ligase or the like.
  • a spacer consisting of several or tens of nucleotides may be placed so that the binding ability of the aptamer to the target molecule is not affected by the DNA or RNA nucleic acid binding thereto.
  • nucleic acid-based anticancer agent of the present invention when a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue to which an anticancer agent is bound is integrated has a targeting function by binding to a targeting region, the targeting region is the DNA or RNA nucleic acid through a linker. may be covalently bonded to
  • the linker is an amine group, a carboxyl group, or a sulfhydryl group or a phosphate group of a nucleic acid such as an aptamer of a protein such as an antibody, an antibody derivative, or an antibody analog, which is a targeting region. group), any linker having a functional group capable of bonding through a hydroxyl group may be used.
  • linkers are isothiocyanate, isocyanates, acyl azide, NHS ester, sulfonyl chloride, aldehyde, as described above. , glyoxal, epoxide, oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride , fluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, or vinylsulfone ( vinylsulfone) and the like.
  • the linker may be a cleavable linker as described above or a non-cleavable linker.
  • the linker may also be a self-immolative linker or a traceless linker after cleavage.
  • a linker may also be a homobifunctional linker (a linker having two or more identical reactive functional groups) or a heterobifunctional linker (a linker having two or more different reactive functional groups).
  • the linker may also be a dendritic type of linker.
  • the cytotoxic anticancer agent is an anti-metabolites, microtubulin targeting agents (Tubulin polymerase inhibitor and tubulin depolymerisation), alkylating agents, antimitotic agents, DNA cleavage agents ), DNA cross-linker agents, DNA intercalator agents, and DNA topoisomerase inhibitors.
  • Folic acid derivatives Purine derivatives such as Cladribine, pyrimidine derivatives such as Azacitidine, Doxifluridine, Fluorouracil and the like are known in the art, and as microtubule targeting agents, auristatin-based drugs such as monomethylauristatin E (MMAE), monomethylauristatin F (MMAF), and dolastatin, maytansines and the like are known in the art, and examples of the alkylating agent include alkyl sulfonate preparations such as Busulfan and Treosulfan, nitrogen Mustard derivatives such as Bendamustine, Platinum preparations such as Cisplatin and Heptaplatin are known in the art.
  • auristatin-based drugs such as monomethylauristatin E (MMAE), monomethylauristatin F (MMAF), and dolastatin
  • MMAE monomethylauristatin E
  • MMAF monomethylauristatin F
  • dolastatin maytansines and the like
  • Taxane preparations such as Docetaxel and Paclitaxel, Vinca alkalids such as Vinflunine, and Etoposide Podophyllotoxin derivatives and the like are known in the art
  • Calicheamicins are known as a DNA cleavage agent
  • PBD as a DNA cross-linker agent.
  • duplexes and the like are known.
  • doxorubicin and the like are known in the art
  • SN-28 and the like are known in the art.
  • the nucleic acid-based anticancer agent of the present invention may be PEGylated to improve in vivo stability and half-life.
  • the site to be pegylated may be the exposed end (ie, the 5' end and/or the 3' end) of the nucleic acid or aptamer in the nucleic acid-based anticancer agent of the present invention or the targeted anticancer agent thereof.
  • PEGylation can be accomplished by polyethylene glycol or a derivative thereof whose chemical formula is H(OCH 2 CH 2 )nOH (n is an integer greater than or equal to 4).
  • Polyethylene glycol or a derivative thereof used for pegylation is not particularly limited in its molecular weight as long as it can exhibit the intended in vivo stability and half-life. PEGylation will generally be effected by polyethylene glycol or its derivatives having a molecular weight in the range of 0.2-50 kDa, 0.5-50 kDa or 10-45 kDa.
  • the exposed ends (ie, 5' ends and/or 3' ends) of nucleic acids or aptamers are 5' in order to improve in vivo stability by preventing degradation by nucleases in vivo.
  • the terminal or 3' terminal nucleotide is LNA (Locked Nucleic Acid or bridged nucleic acid, a nucleic acid in which 2'O and 4C of the terminal nucleotide are linked) or idT (inverted deoxythymidine) form, or 2'-methoxy nucleoside, It may be in a form having 2'-amino nucleoside or 2'F-nucleoside, or chemically modified with an amine linker, a thiol linker, cholesterol, or the like.
  • the oligonucleotide of a complementary sequence with the 5' or 3' terminal region of a nucleic acid or an aptamer may be bound to cholesterol, and may be bound by a complementary hydrogen bond.
  • the nucleic acid-based anticancer agent of the present invention may be prepared in the form of particles containing the same.
  • the particles containing the nucleic acid-based anticancer agent of the present invention are polymeric particles, lipid particles, solid lipid particles, inorganic particles ( inorganic particles), or a combination thereof (eg, lipid stabilized polymeric particles).
  • the particles are polymeric particles or comprise a polymeric matrix.
  • the particles may include one or more biodegradable polymers.
  • a biodegradable polymer may be a water-insoluble or poorly water-soluble polymer that is converted in the body chemically or enzymatically into water-soluble substances.
  • the biodegradable polymer in the particle may be polyamide, polycarbonate, polyalkylene, polyalkylene glycol, polyalkylene oxide, polyalkylene terephthalate, polyvinyl halide, polyvinylpyrrolidone, polyglycolide, polysiloxane, poly urethane, a copolymer thereof, or the like.
  • the biodegradable polymer in the particles may be alkyl cellulose such as methyl cellulose and ethyl cellulose, hydroxyalkyl cellulose such as hydroxypropyl cellulose, cellulose ether, cellulose ester, nitro cellulose, cellulose acetate, cellulose sulfate sodium salt, and the like.
  • the biodegradable polymer in the particles is a polymer of acrylic acid and methacrylic acid ester such as polymethyl methacrylate, polyethyl methacrylate, polybutyl methacrylate, and polyisobutyl methacrylate, and a linear or branched copolymer thereof. , a block copolymer, or the like.
  • biodegradable polymer in the particles may be polyester, polyorthoester, polyethyleneimine, polycaprolactone, polyhydroxyalkanoate, polyhydroxyvalerate, polyacrylic acid, polyglycolide, or the like.
  • the particles may include one or more hydrophilic polymers.
  • the hydrophilic polymer includes cationic polypeptides such as protamine, poly-L-glutamic acid (PGS), poly-L-aspartic acid, poly-L-lysine, polyamidoamine, cationic peptides (eg, cell penetrating peptides, etc.) , cationic polysaccharides such as chitosan and glycochitosan, hepanin, hyaluronic acid, chondroitin sulfate, carboxy methyl cellulose, and anionic polymers such as pectin, starch and polysaccharides and polyalkylene glycols such as polyethylene glycol (PEG) and polypropylene glycol (PPG), polyalkylene oxides such as polyethylene oxide (PEO), polyoxyethylated polyols, polyolefinic alcohols, and the like.
  • cationic polypeptides such as protamine, poly-
  • the nucleic acid-based anticancer agent or the targeted anticancer agent of the present invention may be granulated with a hydrophilic polymer.
  • it may be coated with a cationic polymer, and the cationic polymer may be coated with an anionic polymer again.
  • the particles may include one or more hydrophobic polymers.
  • Hydrophobic polymers include polyhydroxy acids such as polylactic acid and polyglycolic acid, rehydroxyalkanoates such as poly3-hydroxybutyrate, polycarbonates such as polycaprolactone and tyrosine polycarbonates, polyamides, polypeptides, and polyesters amides, polyurethanes, and the like.
  • the hydrophobic polymer is polylactic acid, polyglycolic acid, or poly(lactic acid-co-glycolic acid).
  • the particles may include one or more amphoteric polymers.
  • the amphiphilic polymer may be composed of a hydrophobic polymer block and a hydrophilic polymer block.
  • the hydrophobic polymer block may include at least one of the hydrophobic polymer or a derivative or copolymer thereof.
  • the hydrophilic polymer block may include at least one of the hydrophilic polymer or a derivative or copolymer thereof.
  • the particles may comprise one or more neutral or anionic lipids, cationic lipids, solid lipids or amphoteric compounds.
  • the neutral or anionic lipid may be cholesterol, phospholipid, lysolipid, pegylated lipid, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, including 1,2-diacyl-glycero-3-phosphocholine.
  • Phingomyelin, ceramide galactopyranoside, ganglioside, 1,2-distearoylphosphatidylcholine (DSPC), 1,2-dipalmitoyl phosphatidylcholine (DPPC), 1,2-dimyristoylphosphatidylcholine (DMPC), etc. can be cholesterol, phospholipid, lysolipid, pegylated lipid, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, including 1,2-diacyl-glycero-3-phosphocholine.
  • cationic lipid examples include dimethyldioctadecyl ammonium bromide (DDAB), 1,2-diacyloxy-3-trimethylammonium propane, N-1-(2,3-dioloyloxy)propyl-N,N-dimethyl Amine (DODAP), 1,2-Diacyloxy-3-dimethylammonium propane, N-1-(2,3-dioleyloxy)propyl-N,N,N-trimethylammonium chloride (DOTMA), 1,2 -dialkyloxy-3-dimethylammonium propane, dioctadecylamidoglycylspermine (DOGS), and the like.
  • DDAB dimethyldioctadecyl ammonium bromide
  • DODAP 1,2-diacyloxy-3-trimethylammonium propane
  • DODAP 1,2-Diacyloxy-3-dimethylammonium propane
  • DOTMA 1,2-Diacyloxy-3-dimethylammoni
  • the solid lipids may be highly saturated alcohols, aliphatic alcohols, higher fatty acids such as stearic acid, palmitic acid and decanoic acid, sphingolipids, synthetic esters, mono-, di-, triglycerides of highly saturated fatty acids.
  • the amphoteric compound may be phosphatidyl choline, phosphatidyl ethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidylinositol, lysophosphatidyl derivative, cardiolipin, or the like.
  • the lipid particles may be liposomes, which are spherical small vesicles composed of an aqueous medium surrounded by lipids arranged in a bilayer. Liposomes contain a hydrophilic drug in an aqueous interior or a hydrophobic agent in the bilayer.
  • the lipid particles may be lipid micelles.
  • Lipid micelles for drug delivery are known in the art.
  • Lipid micelles can be formed, for example, as water-in-oil emulsions with a lipid surfactant.
  • Lipid micelles are generally useful for delivering hydrophobic drugs.
  • the lipid particle may be a solid lipid particle.
  • Solid lipid particles are formed from lipids that are solid at room temperature, and the solid lipid particles can be obtained from oil-in-water emulsions using solid lipids.
  • polymeric particles can be prepared by methods known in the art.
  • polymeric particles can be prepared by spray drying, interfacial polymerization, hot melt encapsulation, phase separation encapsulation (spontaneous emulsion microencapsulation, solvent evaporation microencapsulation, and solvent removal microencapsulation), coacervation, low temperature microsphere formation, phase transfer nanoencapsulation, It can be prepared by methods such as emulsion and nano-precipitation.
  • the lipid particles may be prepared by a method such as a high-pressure homogenization technique, a supercritical fluid method, an emulsion method, a solvent diffusion method, spray drying, or the like.
  • a method for preparing such particles reference may be made to the literature Remington's Pharmaceutical Sciences 16th edition, Osol, A. (ed.), (1980) and the like.
  • the size of the particles can be adjusted for the intended effect.
  • the particles may be nanoparticles or microparticles, but nanoparticles are preferred.
  • the particles may have a diameter of from about 10 nm to about 10 ⁇ m, from about 10 nm to about 1 ⁇ m, from about 10 nm to about 500 nm, from about 20 nm to about 500 nm, or from about 25 nm to about 250 nm. In a preferred embodiment, the particles are nanoparticles having a diameter of about 25 nm to about 250 nm.
  • nanoparticles as a drug carrier must be large enough to not pass through normal blood vessels during blood circulation and must be small enough to avoid macrophage predation.
  • the size of the fenestra of the sinusoid of the spleen and the Kupffer's cells located in the liver is between 150 and 200 nm, and the distance between the endothelial cells of the blood vessels distributed in the tumor is between 100 and 600 nm. . Therefore, in order to reach the tumor through these two types of characteristic vascular structures, it is preferable that the size of the nanoparticles be less than 100 nm.
  • the particle surface hydrophilic there are two methods for making the particle surface hydrophilic. One is to cover the surface of nanoparticles with a hydrophilic polymer such as polyethylene glycol (PEG), or to make micellar-type nanoparticles using an amphiphilic block copolymer having hydrophobicity and hydrophilicity on the surface of the hydrophilic polymer. is to be located.
  • a hydrophilic polymer such as polyethylene glycol (PEG)
  • PEG polyethylene glycol
  • micellar-type nanoparticles using an amphiphilic block copolymer having hydrophobicity and hydrophilicity on the surface of the hydrophilic polymer. is to be located.
  • the nucleic acid-based anticancer agent of the present invention may be mixed with a pharmaceutically acceptable carrier and formulated in a lyophilized form or in the form of an aqueous solution.
  • a pharmaceutically acceptable carrier is a component that does not inhibit the efficacy, biological activity or properties of the aptamer-based targeting complex anticancer agent of the present invention, which is an active ingredient, at the content or concentration included in the formulation of the present invention, for example, phosphate, citrate Buffers containing organic acids such as, antioxidants such as ascorbic acid and methionine, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as Preservatives such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentan
  • acceptable pharmaceutical carriers in compositions such as injections formulated as liquid solutions include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like.
  • the carrier is not particularly limited thereto, but in the case of oral administration, a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a fragrance, etc. may be used, and in the case of an injection, a buffer, A preservative, an analgesic agent, a solubilizer, an isotonic agent, a stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used.
  • composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like, and in the case of injections, it may be prepared in the form of unit dose ampoules or multiple doses.
  • it can be formulated as a solution, suspension, tablet, pill, capsule, sustained-release preparation, and the like.
  • carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, a preservative, and the like.
  • the pharmaceutical composition of the present invention can be prepared according to a conventional method for tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, and freeze-drying, respectively. It may have any one formulation selected from the group consisting of formulations and suppositories.
  • composition is formulated in a dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, preferably in a formulation useful for the administration of peptide pharmaceuticals, and administration commonly used in the art.
  • the aptamer-based targeting complex anticancer agent of the present invention can be used by mixing with several acceptable carriers such as physiological saline or organic solvents, and with glucose, sucrose or dextran to increase stability or absorption.
  • Antioxidants such as carbohydrates, ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers can be used as pharmaceuticals.
  • Formulation of pharmaceutical compositions is known in the art, and specifically, reference may be made to Remington's Pharmaceutical Sciences (19th ed., 1995) and the like.
  • a preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, patient's severity, and administration route. It can be in the range /kg. Administration may be performed once or divided into several times a day. Such dosages should not be construed as limiting the scope of the invention in any respect.
  • the present invention it is possible to load a high content of anticancer drugs, and it is possible to combine two or more kinds of anticancer drugs, and by designing to have a targeting function to cancer cells, the side effects can be reduced and uniform ( It is possible to provide a nucleic acid-based anticancer drug that can be produced homogeneous).
  • RNA1-SN38/MMAE is a nucleic acid to which two drugs are multiplexed.
  • 5 is a result of examining stability in serum by binding cholesterol to a drug-bound nucleic acid by a hybridization method.
  • 6 is an electrophoresis result showing that a particulated drug is generated.
  • drug-bound nucleotide analogs were prepared by reacting a nucleotide analog having a functional group in Table 2 below with a linker-drug conjugate.
  • Nucleotide analogues having functional groups in the table below were purchased from Gene Link (USA), Aldoxorubicin, a linker-drug conjugate, was purchased from ChemScence (USA), and the rest of the linker-drug conjugates were purchased from CellMosaic (USA). .
  • Nucleotide analogues with functional groups and linker-drugs Type functional group Nucleotide analogues with functional groups Linker-Drug Conjugates DNA amine-reactive groups amino deoxycytosine dC C6, amino deoxyguanocine dG C6, amino deoxyadenosine dA C6 Succinyl Dox NHS ester O-Succinyl SN38 NHS ester Sulfhydryl-reactive groups 6-Thio-dG (S6-dG), 4-Thio-dT((S4-dT) Aldoxorubicin MC-VC-PAB-MMAE (VcMMAE) RNA amine-reactive groups amino C6 U, 2-amino Purine Ribose Succinyl Dox NHS ester Succinyl SN38 NHS este Sulfhydryl-reactive groups 4-Thio-Uridine (s4U) Aldoxorubicin MC-VC-PAB-MMAE (V
  • the nucleotide analogue having the functional group has a structure in which an amine group (-NH 2 ) and a thiol group (-SH) functional group are bonded to the base of NMP (Nucleoside Monophosphate), and the Succinyl Dox NHS ester is sulfo in DOX (doxorubicin) -NHS (N-hydroxysulfosuccinimide) linker has a NHS ester functional group by conjugation, O-Succinyl SN38 NHS ester is NHS ester by conjugating sulfo-NHS (N-hydroxysulfosuccinimide) linker to SN38 (7-ethyl-10-hydroxycamptothecin) It has a functional group, and Aldoxorubicin has a hydrazone functional group by conjugating a (N- ⁇ -maleimidocaproic acid hydrazide, or EMCH) linker to DOX (doxorubicin).
  • MC-VC-PAB-MMAE has a maleimidocaproyl (MC) functional group by conjugating MC-VC-PAB-NH2 linker to MMAE ((Monomethyl auristatin E).
  • amino deoxycytosine dC C6 represent CTP, amino deoxyguanocine dG C6, GTP, amino deoxyadenosine dA C6, ATP, 6-Thio-dG(S6-dG), GTP, 4-Thio-dT ((S4-dT) replaces TTP, amino C6 U replaces UTP, and 4-Thio-Uridine (s4U) replaces UTP, respectively, and can be incorporated into DNA and RNA, and 2-amino Purine Ribose is a natural It can be integrated into DNA and RNA by replacing ATP and GTP.
  • Example 1-2 Preparation of a nucleotide analogue in which a drug is bound from a nucleotide analogue having an amine group as a functional group and a linker-drug conjugate
  • a drug-conjugated nucleotide analogue was prepared by reacting a nucleotide analogue having an amine group as a functional group with Succinyl Dox NHS ester and O-Succinyl SN38 NHS ester, which are linker-drug conjugates.
  • Nucleotide analogs to which drugs are bound are used as units in the preparation of nucleic acids to which drugs are bound.
  • the freeze-dried nucleotide analogues having an amine group of Table 2 were dissolved in deionized water to prepare a final concentration of 25 ⁇ g/ ⁇ L.
  • the stock solution of the nucleotide analogue having an amine group thus obtained was used while being stored frozen at -20 °C or lower.
  • pH 8.5 labeling buffer was prepared by dissolving 0.038 g of sodium tetraborate decahydrate per mL of water and adjusting the pH to 8.5 with HCl. This labeling buffer was prepared immediately before the labeling reaction (NHS Ester Labeling of Amino-Biomolecules).
  • the drug-conjugated nucleotide analogues thus obtained are units for DNA nucleic acid production, including a unit combining amino deoxycytosine dC C6 and Succinyl Dox NHS ester (DCAD), amino deoxycytosine dC C6 and succinyl SN38 NHS ester (DCAS), amino deoxyguanocine dG C6 and succinyl dox NHS ester combined (DGAD), amino deoxyguanocine dG C6 and succinyl SN38 NHS ester combined (DGAS), amino deoxyadenosine dA C6 and succinyl dox NHS ester combined (DAAD), amino deoxyA Monomer combined with Succinyl SN38 NHS ester (DAAS), 6-Thio-dG (S6-dG) and Aldoxorubicin (DGAD), 4-Thio-dT ((S4-dT) with MC-VC-PAB-MMAE (VcMMAE) conjugated unit (DT
  • RNA nucleic acid production amino C6 U and Succinyl Dox NHS ester (RUAD), amino C6 U and Succinyl SN38 NHS ester (RUAS), 2- A unit of amino-purine ribose and succinyl dox NHS ester (RPAD) and a unit of 2-amino-purine ribose and succinyl SN38 NHS ester (RPAS) are used.
  • RUAD amino C6 U and Succinyl Dox NHS ester
  • RUAS amino C6 U and Succinyl SN38 NHS ester
  • RPAD 2- A unit of amino-purine ribose and succinyl dox NHS ester
  • RPAS 2-amino-purine ribose and succinyl SN38 NHS ester
  • the drug-coupled nucleotide analogue (DrNA), used as a unit in the preparation of the thus obtained DNA or RNA nucleic acid, is a structure in which a drug is bound to a base of dNMP (DeoxyNucleoside Monophosphate) through a reaction between functional groups.
  • dNMP DeoxyNucleoside Monophosphate
  • a nucleotide analogue having a thiol group as a functional group of Table 2 was dissolved in a plastic vial containing a PBS buffer having a pH of 7-7.5.
  • the linker-drug conjugate was dissolved in DMSO or fresh DMF (1-10 mg per 100 uL).
  • the linker-drug conjugate solution is placed in a solution of a nucleotide analogue having a thiol group (more than 20 times the concentration of the linker-drug conjugate), the vial is washed with an inert gas, tightly closed, and thoroughly mixed, overnight at room temperature or 4°C kept.
  • the nucleotide analogue thus obtained is a unit for preparing DNA nucleic acids, a unit combining 6-Thio-dG and Aldoxorubicin (DGTD), a unit combining 6-Thio-dG and MC-VC-PABC-MMAE (DGTM), and 4-Thio- A unit combining dT and Aldoxorubicin (DTTD), a unit combining 4-Thio-dT and MC-VC-PABC-MMAE (DTTM), etc. , a unit (RUTM) in which 4-Thio-Uridine and MC-VC-PABC-MMAE are combined.
  • DGTD 6-Thio-dG and Aldoxorubicin
  • DTTD 4-Thio-A unit combining dT and Aldoxorubicin
  • DTTM 4-Thio-dT and MC-VC-PABC-MMAE
  • RUTM unit in which 4-Thio-Uridine and MC-VC-PABC-MMAE are
  • the drug-coupled nucleotide analogue (DrNA) obtained in this way also has a structure in which the drug is bound to the base of NMP (Nucleoside Monophosphate) through a reaction between functional groups.
  • NMP Nucleoside Monophosphate
  • the drug-bound nucleotide analogues were purified by reverse-phase HPLC using a standard analytical (4.6 ⁇ 250 mm) C8 column.
  • the reaction mixture was placed on a 0.1M TEAA (triethylammonium acetate) column and a linear 5-65% acetonitrile gradient was performed over 30 minutes. This gradient increases acetonitrile by 2% per minute.
  • TEAA triethylammonium acetate
  • FIG. 1 One of the results of HPLC purification of the drug-bound nucleotide analogue is shown in FIG. 1 .
  • the nucleotide analog with a functional group and the nucleotide analog to which the drug is bound moved the fastest than the free drug (linker-drug conjugate).
  • Nucleotide analogues to which all other drugs were bound also showed the same trend and were purified in the same manner.
  • a nucleic acid (MDrNA1) in which two drugs are multiplexed was prepared using the bound nucleotide analogue of the drug prepared in Example 1 as a unit.
  • a DNA nucleic acid (MDrDNA1) was prepared by using as a unit the nucleotide analogue of the drug prepared in Example 1 as a DNA nucleic acid in which two drugs were multiplexed.
  • 6-Thio-dG S6-dG
  • DGAD Aldoxorubicin-coupled unit
  • DTMA 4-Thio-dT
  • MC-VC-PAB-MMAE VcMMAE
  • a template DNA fragment for the preparation of the drug-multiplied nucleic acid was custom-made with the following nucleotide sequence (Bioneer, Korea).
  • the template DNA is 1 a nucleotide sequence consisting of a promoter portion of T7 RNA polymerase (the 5' underlined portion in the base sequence, a primer is also designed from this sequence) and GG to increase transcription efficiency of T7 RNA polymerase , 2 drug A nucleotide sequence in which the bound nucleotide analogue is inserted as a unit (the part indicated in bold in the nucleotide sequence) and 3 a nucleotide sequence complementary to the ligand binding site (the 3' underlined part of the nucleotide sequence, this sequence from which primers were also designed).
  • Each of 0.25 ⁇ M forward and reverse primers, 10X PCR buffer, 200 ⁇ M dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process.
  • the PCR reaction was carried out at 95°C for 5 minutes, followed by 20 cycles of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, followed by reaction at 72°C for 5 minutes to prepare a DNA fragment.
  • the dNTP mixture is CTP, ATP, the DGAD (a unit combining 6-Thio-dG (S6-dG) and Aldoxorubicin that can be integrated by replacing GTP), DTMA (4-Thio- that can be integrated by replacing TTP) It is a mixture of dT ((S4-dT) and MC-VC-PAB-MMAE(VcMMAE) bonded unit).
  • DNA (MDrDNA1) to which the drug was multiplied.
  • S6-dG 6-Thio-dG
  • DGAD monomer bound to Aldoxorubicin
  • DTMA monomer in which 4-Thio-dT ((S4-dT) and MC-VC-PAB-MMAE (VcMMAE) are combined was used, DOX (doxorubicin) drug and MMAE drug are combined.
  • an RNA nucleic acid (MDrNA1) to which two drugs are multiplexed, an RNA nucleic acid (MDrRNA1) was prepared using the bound nucleotide analogue of the drug prepared in Example 1 as a unit.
  • the drug can be integrated by replacing the unit (RPAS) and UTP combined with 2-amino Purine Ribose and Succinyl SN38 NHS ester, which can be integrated by replacing ATP and GTP as a unit for manufacturing the nucleic acid (MDrRNA1) to which the drug is multi-coupled.
  • the template DNA fragment and primer for the preparation of the drug-multiplied nucleic acid are the same as in ⁇ Example 2-1>.
  • Each of 0.25 ⁇ M forward and reverse primers, 10X PCR buffer, 200 ⁇ M dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process using the template DNA fragment.
  • the PCR reaction was carried out at 95°C for 5 minutes, followed by 20 cycles of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, followed by reaction at 72°C for 5 minutes to prepare a DNA fragment.
  • the 2' hydroxyl group is substituted with a fluorine group so as to have resistance to the bound nucleotide analogue of the drug prepared in Example 1 and natural NTP and RNA degrading enzymes.
  • Nucleic acid (MDrRNA1) enzymatically bound to multiple drugs was synthesized using an NTP mixture containing 2'-F CTP, a midine base, and a bacteriophage T7 RNA polymerase mutant that can also incorporate modified nucleotides in this synthesis.
  • Y639F (Epicentre Technologies) was used.
  • the in vitro transcription process was carried out in the DNA fragment prepared above, 10X transcription buffer, 5 mM DTT, a nucleotide analog of the drug prepared in Example 1 above, natural NTP, and 2' a pyrimidine base in which a 2' hydroxyl group is substituted with a fluorine group.
  • 5 mM NTP mixture containing -F CTP and T7 polymerase (Epicentre Technologis), it was reacted at 37° C. for 4 hours.
  • RUTM unit
  • 2'-F CTP which is a pyrimidine base in which the 2' hydroxyl group is substituted with a fluorine group.
  • RNA (MDrRNA1) was multiplied.
  • MDrRNA1 is a nucleotide analogue, which can be integrated by replacing ATP and GTP, and can be integrated by replacing the unit (RPAS) and UTP combined with 2-amino Purine Ribose and Succinyl SN38 NHS ester. Since the unit (RUTM) in which 4-Thio-Uridine and MC-VC-PABC-MMAE are combined is used, the SN38 drug and the MMAE drug are combined.
  • RNA (RNA1-SN38/MMAE) bound to SN38 and MMAE forms a single band.
  • a nucleic acid to which one type of drug is multiplied is first prepared by using a nucleotide analog having a functional group in Table 2 above, and then DNA and RNA nucleic acid backbones are prepared, and the linker drug conjugate of Table 2 is reacted thereto.
  • a nucleic acid (MDrNA2) to which one type of multiple drugs was bound was prepared.
  • a DNA nucleic acid backbone was prepared using the sequence of SEQ ID NO: 39 of Example 2 as a template and nucleotide analogues having functional groups in Table 2 above.
  • KOD XL DNA Polymerase (Fisher Scientific UK Ltd, UK), which can also act on nucleotide analogues, was used as the polymerase.
  • each 0.25 ⁇ M forward and reverse primers, 10X PCR buffer, 200 ⁇ M dNTP mixture containing the nucleotide analogues having the functional groups in Table 2 and natural NTP, Merck Millipore NovagenTM KOD XL DNA 5 U of Polymerase (Fisher Scientific UK Ltd, UK) were mixed.
  • the functionalized nucleotide analogue amino deoxycytosine dC C6 was used instead of CTP.
  • the PCR reaction is a method of reacting at 95°C for 5 minutes, then setting the conditions of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, repeating 20 cycles, and reacting at 72°C for 5 minutes.
  • a DNA backbone comprising a nucleotide analogue with
  • RNA nucleic acid backbone was also prepared by amplifying a DNA fragment through PCR using the sequence of SEQ ID NO: 39 of Example 2 as a template, and then using the nucleotide analogues having the functional groups in Table 2 above to prepare it through an in vitro transcription process.
  • PCR construct reagents for DNA fragment amplification 0.25 ⁇ M each of forward and reverse primers, 10X PCR buffer, 200 ⁇ M dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed.
  • the PCR reaction was performed at 95°C for 5 minutes, then set to 95°C 30 seconds, 58°C 30 seconds, 72°C 30 seconds, repeated 20 cycles, and then reacted at 72°C for 5 minutes to prepare a DNA fragment. .
  • the in vitro transcription process for preparing the RNA backbone is the prepared DNA fragment, 10X transcription buffer, 5 mM DTT, nucleotide analogues having the functional groups in Table 2 above, natural NTP and a pyrimidine base in which the 2' hydroxyl group is substituted with a fluorine group.
  • 5 mM NTP mixture containing 2'-F CTP and T7 polymerase (Epicentre Technologis) were mixed and reacted at 37°C for 4 hours.
  • 4-Thio-Uridine (s4U) a nucleotide analogue having a functional group in Table 2 was used instead of UTP
  • 2'-F CTP was used instead of CTP.
  • RNA backbone containing the nucleotide analogues having the functional groups of Table 2 as a unit.
  • Example 3-2 Preparation of drug-bound nucleic acid (MDrNA2) through reaction between DNA nucleic acid backbone or RNA nucleic acid backbone and linker-drug conjugate
  • Example 3-2-1 Preparation of drug-bound nucleic acid (MDrNA2) through reaction between DNA nucleic acid backbone and linker-drug conjugate
  • Example 3-1 the freeze-dried nucleic acid prepared in Example 3-1 was dissolved in deionized water to prepare a final concentration of 25 ⁇ g/ ⁇ L.
  • the nucleic acid thus obtained was used while being stored frozen at -20 °C or lower.
  • pH 8.5 labeling buffer was prepared by dissolving 0.038 g of sodium tetraborate decahydrate per mL of water and adjusting the pH to 8.5 with HCl. This labeling buffer was prepared just before the labeling reaction.
  • MDrNA2 through the reaction between the Succinyl Dox NHS ester of Table 2 and the DNA nucleic acid backbone of Example 3-1 was performed using the PerKitTM Antibody Doxorubicin Conjugation Kit (CellMosaic, Inc. USA) according to the manufacturer's protocol. . In this way, a DNA nucleic acid (DNA2-Dox) bound to DOX was prepared.
  • MDrNA2 through the reaction of the O-Succinyl SN38 NHS ester of Table 2 with the DNA nucleic acid of Example 3-1 was performed using the PerKitTM Antibody SN38 Conjugation Kit (CellMosaic, Inc., USA) using the manufacturer's protocol. followed In this way, SN38-conjugated DNA nucleic acids (DNA2-SN38) were prepared.
  • Example 3-2-2 Preparation of drug-bound nucleic acid (MDrNA2) through reaction between RNA nucleic acid backbone and linker-drug conjugate
  • MC-VC-PABC-MMAE as a linker-drug conjugate, it was reacted with the RNA nucleic acid backbone having a thiol group prepared in Example 3-1 above to prepare MDrNA2.
  • RNA2-MMAE MMAE-conjugated nucleic acids
  • the preparation of MDrNA2 through the reaction of the MC-VC-PABC-MMAE of Table 2 with the RNA nucleic acid of Example 3-1 was performed using the PerKitTM Antibody MMAE Conjugation Kit (CellMosaic, Inc., USA) of the manufacturer. was done according to the protocol.
  • the reaction mixture of the nucleic acid backbone and the linker-drug conjugate in Example 3-2 was purified by reverse-phase HPLC using a standard analytical (4.6 ⁇ 250 mm) C8 column.
  • reaction mixture was placed on a 0.1M TEAA (triethylammonium acetate) column and a linear 5-65% acetonitrile gradient acetonitrile gradient was performed over 30 minutes. This gradient increases acetonitrile by 2% per minute.
  • TEAA triethylammonium acetate
  • FIG. 3 The results of HPLC purification of DNA2-Dox among the prepared drugs, DNA2-Dox, DNA2-SN38 and RNA2-MMAE, are shown in FIG. 3 .
  • the nucleic acid backbone and the linker-drug-bound nucleic acids moved faster than the drug conjugate.
  • a targeting drug (MDrNAL) by binding an aptamer as a ligand to the DNA and RNA nucleic acids to which the drugs obtained in Examples 2 and 3 were bound by a hybridization method, an aptamer ligand was first prepared.
  • an aptamer specifically for EGFR was used, and the aptamer sequence and the sequence for preparing the aptamer are shown in Table 3 above.
  • Target molecule, aptamer sequence and template of aptamer sequence target molecule type Base sequence (5' ⁇ 3') EGFR aptamer GGC GCU CCG ACC UUA GUC UCU GUG CCG CUA UAA UGC ACG GAU UUA AUC GCC GUA GAA AAG CAU GUC AAA GCC GGA ACC GUG UAG CAC AGC AGA (SEQ ID NO:42) template GGC GCT CCG ACC TTA GTC TCT GTG CCG CTA TAA TGC ACG GAT TTA ATC GCC GTA GAA AAG CAT GTC AAA GCC GGA ACC GTG TAG CAC AGC AGA (SEQ ID NO:42)
  • a DNA template having the following structure was used for the preparation of the aptamer.
  • the 5' side underlined sequence is the promoter sequence of T7 RNA polymerase and the forward primer of SEQ ID NO: 40 binds, and the 3' side underlined sequence is complementary to the drug-bound nucleic acid. It is a binding sequence and a sequence to which the reverse primer sequence of SEQ ID NO: 41 binds.
  • an EGFR-targeting RNA aptamer a target molecule
  • the template sequence for constructing the EGFR-targeting RNA aptamer was custom-made (Bioneer, Korea).
  • Each of 0.25 ⁇ M forward and reverse primers, 10X PCR buffer, 200 ⁇ M dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process.
  • the PCR reaction was performed at 95°C for 5 minutes, then set to 95°C 30 seconds, 58°C 30 seconds, 72°C 30 seconds, repeated 20 cycles, and then reacted at 72°C for 5 minutes, the promoter of T7 RNA polymerase A DNA fragment containing the portion was prepared.
  • 2'-F CTP and 2'-F UTP which are pyrimidine bases in which the 2' hydroxy group is substituted with a fluorine group, are used to have resistance to RNA degrading enzymes.
  • In vitro transcription was performed to prepare an EGFR-targeting RNA aptamer.
  • the in vitro transcription process for preparing the EGFR-targeting RNA aptamer includes the prepared DNA fragment, 10X transcription buffer, 5 mM DTT, 5 mM 2'-F CTP and 2'-F UTP-containing NPT mixture, T7 polymerase mixture (Epicentre Technologis) was mixed and reacted at 37°C for 4 hours.
  • DNaseI (Epaicentre Technologies) was added and reacted at 37°C for 15 minutes to remove the DNA used as a template, and then purified by ethanol precipitation to obtain an EGFR-targeting RNA aptamer including 2'-F CTP and 2'-F UTP. produced.
  • the prepared EGFR-targeting RNA aptamer was designed and prepared to have a sequence capable of complementary binding to the DNA nucleic acid or RNA nucleic acid to which the drug prepared in Examples 2 and 3 was bound in the 3' region.
  • DNA1-Dox/MMAE, RNA1-SN38/MMAE, DNA2-Dox, DNA2-SN38 and RNA2-MMAE which are nucleic acids to which the drugs prepared in Examples 2 and 3 are bound
  • the prepared EGFR-targeting RNA aptamer The EGFR-targeting RNA aptamer was bound to the drug-bound nucleic acid by heating at 95° C. for 5 minutes and hybridization at room temperature for 1 hour.
  • a targeting drug (MDrNAL) was prepared by binding a ligand to the drug-bound nucleic acid, and electrophoresis before and after hybridization of the reaction mixture (before and after reaction) is shown in FIG. 4 .
  • a targeting drug (MDrNAL) was obtained by the reaction of the drug-bound nucleic acid with the ligand.
  • the targeting drug (MDrNAL) thus obtained is named DNA1-Dox/MMAE/ApEGFR, RNA1-SN38/MMAE/ApEGFR, DNA2-Dox/ApEGFR, DNA2-SN38/ApEGFR and RNA2-MMAE/ApEGFR for convenience, respectively.
  • EGFR-targeting RNA aptamer (Apt EGFR-chol) conjugated to the 5' end of cholesterol and an oligonucleotide (oligo-chol) conjugated with cholesterol were custom manufactured (Bioneer, Korea).
  • This oligonucleotide is designed and manufactured so that it can complementarily bind to the drug-bound nucleic acid in the 3' region (the sequence of the 3' underlined portion of SEQ ID NO: 39).
  • RNA1-SN38/MMAE which is a drug-bound RNA nucleic acid (MDrRNA1) prepared in Example 2, was used.
  • the oligo-chol or Apt EGFR-chol was hybridized to the RNA1-SN38/MMAE so that cholesterol was bound.
  • the stability of the cholesterol-added, drug-binding nucleic acid prepared by the above hybridization method was investigated in the serum. That is, the serum solution was treated with cholesterol-added, drug-binding nucleic acids, samples were collected over time, and the remaining nucleic acids were analyzed.
  • a drug-conjugated nucleic acid prepared in the above example and a cationic biocompatible polymer, protamine, and anionic biocompatible polymer, hyaluronic acid, to the nucleic acid to which the nucleic acid is targeted. did.
  • the drug obtained in the above example and the cationic polymer protamine were mixed in sterile distilled water at a concentration ratio of 30:75 ( ⁇ g / ml) and reacted, and then freeze-dried. After preparing the bound particles by , the particles were dissolved in sterile distilled water at 1 mg/mL to prepare a 0.1% (w/v) solution.
  • the prepared 0.1% (w/v) solution and 0.1% (w/v) hyaluronic acid solution were mixed at a molar ratio of 1:0.5, 1:1, 1:1.5, 1:2, reacted for about 5 minutes, and frozen It was dried to obtain a granulated drug.
  • the granulated drug thus obtained was electrophoresed on a 2% agarose gel using 1x TBE buffer at 80 Volts for 20 minutes, and then the nucleic acid drug was stained with 0.5 ⁇ g/ml Etbr (ethidium bromide).
  • the nucleic acid drug that is, RNA1-SN38/MMAE or RNA1-SN38/MMAE/ApEGFR
  • NAC nucleic acid drug
  • the non-particulate nucleic acid drug remained in the reaction solution at a molar ratio of 1:1, only 40% remained in the reaction solution, and at a molar ratio of 1:1.5 and 1:2, it did not remain in the reaction solution.
  • This can be said to show that all nucleic acid drugs are stably granulated when the molar ratio of hyaluronic acid added is 1:1.5 or more. .
  • Example 6 In order to confirm the cytotoxicity to cancer cells, the sample was prepared in Example 6 with the particle-forming drug of RNA1-SN38/MMAE (RNA1-SN38/MMAE/PS/HA) and RNA1-SN38/MMAE/ApEGFR. Drugs (RNA1-SN38/MMAE/ApEGFR/PS/HA) were used.
  • the cell lines used in this Example are EGFR+ (EGFR-expressing) lung cancer cell line A549, colorectal cancer cell line SW48, and skin cancer cell line A431; and EGFR-(non-EGFR) breast cancer cell line MDA-MB-453, colorectal cancer cell line HT-29 and neuroblastoma cell line SK-N-MC.
  • Cytotoxicity experiments for cancer cell lines were performed by adding a sample to each cell culture solution in a 96-well plate, incubating for 4 hours, washing, incubating for 72 hours, and performing MTT analysis.
  • the cytotoxicity result of the particle-forming drug of RNA1-SN38/MMAE without EGFR ligand is shown in FIG. shown in
  • the particle-forming drug of RNA1-SN38/MMAE without EGFR ligand showed concentration-dependent cytotoxicity to all cancer cell lines regardless of EGFR expression.
  • the particle-forming drug of RNA1-SN38/MMAE/ApEGFR with EGFR ligand is concentration-dependent on EGFR+ lung cancer cell line A549 cells, lung cancer cell line A549, colorectal cancer cell line SW48 and skin cancer cell line A431. Although it showed toxicity, it did not show cytotoxicity against EGFR- breast cancer cell line, MDA-MB-453 cell, colorectal cancer cell line HT-29 and neuroblastoma cell line SK-N-MC.
  • This cytotoxicity result can be said to be a result showing that the particle-forming drug of RNA1-SN38/MMAE/ApEGFR with EGFR ligand selectively exhibits cytotoxicity to cancer cells depending on the expression of the EGFR target molecule.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed is a nucleic acid-based anticancer agent designed to be capable of being loading with a high content of an anticancer agent or being loading with two kinds or more anticancer agents in combination and to have a cancer cell-targeting function, and thus, side effects thereof can be reduced, and homogeneous preparation is also possible.

Description

핵산 기반 항암제Nucleic acid-based anticancer drugs
본 발명은 핵산 기반 항암제에 관한 것이다.The present invention relates to a nucleic acid-based anticancer agent.
현대사회는 경제가 발전하고 의료기술이 발전함에 따라 감염성 질환이나 급성질환은 감소하고 있으나, 암, 비반, 당뇨, 고혈압 등 만성질환의 발병은 증가하고 있다. 이 중 암은 고령화, 서구화된 식생활 습관, 운동 부족 등으로 사망률이 매년 지속적으로 증가하고 있는 질환이다. 2019년 우리나라의 사망원인 통계에 따르면, 사망 원인 1위인 암에 의한 사망률(인구 10만 명당 158.2명)은 2위인 심장질환에 의한 사망률(인구 10만 명당 60.4명)의 2.5배 수준으로 생존율 향상을 위한 효과적인 항암 치료법 개발이 필요하다.In modern society, as the economy develops and medical technology advances, infectious diseases and acute diseases are decreasing, but the incidence of chronic diseases such as cancer, liver disease, diabetes, and high blood pressure is increasing. Among these, cancer is a disease whose mortality rate is continuously increasing every year due to aging, westernized eating habits, and lack of exercise. According to statistics on the cause of death in Korea in 2019, the death rate from cancer, the number one cause of death (158.2 per 100,000 population), is 2.5 times higher than the death rate from heart disease, the second most common cause (60.4 per 100,000 population). There is a need to develop effective anticancer therapies for
암은 비정상적인 생리환경으로 인하여 무분별한 세포 증식에 의하여 세포괴가 생기고 이것이 주변 조직을 침범하거나 혈관을 통해 몸의 다른 조직으로 전이됨으로써 일어나는 질병을 말한다. 이러한 암을 치료하는 방법으로는 수술 요법, 방사선 요법, 화학 요법 등이 있으며, 암의 재발과 전이 방지를 위하여 화학 요법이 기본적으로 사용된다. 화학 요법은 국소적인 다른 치료법과 달리 세포독성 항암제을 경구나 주사로 투여하여 전신에 퍼져 있는 암세포에 작용하도록 하는 전신적인 치료법이다. Cancer refers to a disease that occurs when a cell mass is formed by indiscriminate cell proliferation due to an abnormal physiological environment, which invades surrounding tissues or metastasizes to other tissues of the body through blood vessels. Methods for treating such cancer include surgery, radiation therapy, chemotherapy, and the like, and chemotherapy is basically used to prevent cancer recurrence and metastasis. Unlike other topical treatments, chemotherapy is a systemic treatment in which cytotoxic anticancer drugs are administered orally or by injection to act on cancer cells that have spread throughout the body.
세포독성 항암제는 직·간접적으로 DNA 복제, 전사, 번역을 차단하거나 핵산 합성의 대사 경로에 개입하여 핵산 합성을 방해하거나 미세소관(microtuble)에 작용하여 세포분열을 저해함으로써 암세포에 대한 세포독성을 나타내는 약제를 총칭한다.Cytotoxic anticancer drugs show cytotoxicity to cancer cells by directly or indirectly blocking DNA replication, transcription, or translation, interfering in the metabolic pathway of nucleic acid synthesis, interfering with nucleic acid synthesis, or inhibiting cell division by acting on microtubules. drugs are collectively referred to as
대부분의 세포독성 항암제는 암세포가 정상세포보다 빨리 자란다는 특징을 이용하여 개발되었기 때문에 암세포 뿐만 아니라 세포분열이 활발한 골수 조직 세포, 위장관의 상피세포, 모근 상피세포 등의 정상세포에도 작용하여 골수 기능 저하, 면역 기능 저하, 식욕 부진, 구토, 설사, 탈모증 등의 부작용을 유발한다. Because most cytotoxic anticancer drugs were developed using the characteristic that cancer cells grow faster than normal cells, they act not only on cancer cells but also on normal cells such as bone marrow tissue cells, gastrointestinal epithelial cells, and hair follicle epithelial cells, which are active in cell division, resulting in decreased bone marrow function. It causes side effects such as decreased immune function, loss of appetite, vomiting, diarrhea, and alopecia.
또한 세포독성 항암제는 그 투여횟수가 증가할수록 암세포가 항암제에 대한 내성을 획득하게 되므로 항암제 투여량을 늘리거나 다른 항암제와 복합적으로 사용하여야 항암 효과를 유지시킬 수 있다. In addition, as the number of administration of cytotoxic anticancer drugs increases, cancer cells acquire resistance to anticancer drugs.
따라서 세포독성 항암제의 부작용을 줄이면서 항암제 내성을 극복하기 위해 높은 함량의 항암제의 탑재가 가능하거나 2종 이상 항암제의 복합적인 탑재가 가능한 약물의 개발이 요구된다. Therefore, it is required to develop a drug that can be loaded with a high content of anticancer drugs or can be loaded with two or more types of anticancer drugs in order to overcome the resistance to anticancer drugs while reducing the side effects of cytotoxic anticancer drugs.
기존 항체 약물 접합체(antibody-drug conjugate, ADC)의 경우 항체에 부착되는 약물의 양에 한계가 있어 효과적인 항암 효과를 나타내지 못하였다(Korean J Otolaryngol 2007;50:562-72). 또한 대부분 ADC는 IgG의 백본에 2~8개의 약물이 항체의 리신 잔기의 ε-아미노기에 접합되는데, 이러한 접합이 무작위적으로 일어나므로 불균일한(heterogeneous) 즉 서로 동일하지 아니한 ADC가 생산되는 문제도 있었다(생화학분자생물학회, 2011, 31(2): 43-52).In the case of the existing antibody-drug conjugate (ADC), the amount of drug attached to the antibody was limited, and thus did not exhibit an effective anticancer effect (Korean J Otolaryngol 2007;50:562-72). In addition, in most ADCs, 2 to 8 drugs are conjugated to the ε-amino group of the lysine residue of the antibody to the backbone of the IgG. (Society of Biochemical and Molecular Biology, 2011, 31(2): 43-52).
본 발명은 높은 함량의 항암제의 탑재가 가능하고 또 2종 이상 항암제의 복합적인 답재가 가능하면서 암세포에의 표적화 기능을 가지도록 설계하여 그 부작용은 줄일 수 있고 또한 균일한(homogeneous) 제조가 가능한 핵산 기반 항암제를 개시한다.The present invention is a nucleic acid that can be loaded with a high content of anticancer agents, can be combined with two or more types of anticancer drugs, and has a targeting function to cancer cells, thereby reducing the side effects and producing homogeneous Disclosed is an anticancer drug based.
본 발명의 목적은 핵산 기반 항암제와 그 제조 방법을 제공하는 데 있다.It is an object of the present invention to provide a nucleic acid-based anticancer agent and a method for preparing the same.
본 발명의 다른 목적은 상기 핵산 기반 항암제에 암세포에의 표적화 영역이 결합된, 표적화 기능을 가지는 핵산 기반 항암제를 제공하는 데 있다. Another object of the present invention is to provide a nucleic acid-based anticancer agent having a targeting function in which a targeting region to a cancer cell is bound to the nucleic acid-based anticancer agent.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.Other objects or specific objects of the present invention will be set forth below.
본 발명의 핵산 기반 항암제는 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 또는 RNA 핵산으로 파악될 수 있다.The nucleic acid-based anticancer agent of the present invention may be identified as a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue bound to an anticancer agent are integrated.
또 본 발명의 핵산 기반 항암제는 그 DNA 또는 RNA 핵산에 암세포에의 표적화 영역(targeting domain)이 결합되어 표적화 기능을 가지도록 설계될 수 있다. 이러한 표적화 기능을 가지는 본 발명의 핵산 기반 항암제는 (i) 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 또는 RNA 핵산에 (ii) 암세포의 표면에 발현되는 표적분자를 특이적으로 인식하여 결합하는 표적화 영역이 결합된 구성을 가진다. In addition, the nucleic acid-based anticancer agent of the present invention may be designed to have a targeting function by binding a targeting domain to a cancer cell to the DNA or RNA nucleic acid. The nucleic acid-based anticancer agent of the present invention having such a targeting function is (i) DNA or RNA nucleic acid in which one or more molecules of a nucleotide analog to which an anticancer agent is bound are integrated (ii) by specifically recognizing a target molecule expressed on the surface of cancer cells. The binding targeting region has a bound configuration.
상기 항암제가 결합된 뉴클레오티드 유사체는, 항암제가 천연의 뉴클레오티드 또는 인위적으로 작용기가 도입된 뉴클레오티드 유사체에, 그 항암제가 본래 가지고 있던 작용기나 링커를 통해 도입된 작용기를 통해 공유결합된 것을 말한다. The nucleotide analog to which the anticancer agent is bound refers to a covalent bond between the anticancer agent and a natural nucleotide or a nucleotide analog into which a functional group is artificially introduced through a functional group introduced by the anticancer agent or a functional group introduced through a linker.
천연의 뉴클레오티드는 아미노기(amine group), 인산기(phosphate group), 히드록시기(hydroxyl group) 등의 작용기를 가지고 있어, 이러한 작용기와 반응할 수 있는 작용기를 가진 항암제는 천연의 뉴클레오티드와 공유결합될 수 있다. 예컨대 DOX(독소루비신) 항암제는 당 성분에 일차 아미노기(primary amine group)와 -C=OCH2 OH 그룹의 일차 히드록시기(primary hydroxyl group) 등의 작용기를 가지고 있어 천연의 뉴클레오티드의 아미노기(amine group) 작용기와 EDC((1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide Hydrochloride) ) 매개 반응(EDC mediated reaction) 반응 등을 통해 공유결합될 수 있다.Natural nucleotides have functional groups such as an amino group, a phosphate group, and a hydroxyl group, and an anticancer agent having a functional group capable of reacting with these functional groups can be covalently bonded to a natural nucleotide. For example, DOX (doxorubicin) anticancer drug has functional groups such as a primary amine group and a primary hydroxyl group of -C=OCH2 OH group in its sugar component. ((1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide Hydrochloride) ) can be covalently bonded through an EDC mediated reaction.
또 인위적으로 작용기 도입된 뉴클레오티드 유사체에도 그 도입된 작용기와 반응할 수 있는 작용기를 가진 항암제는 천연의 뉴클레오티드와 공유결합될 수 있다. In addition, an anticancer agent having a functional group capable of reacting with the introduced functional group can be covalently bound to a natural nucleotide even in an artificially introduced functional group-introduced nucleotide analogue.
또 항암제에 링커를 통하여 인위적으로 작용기를 도입하고 그 작용기가 도입된 항암제를 천연의 뉴클레오티드나 인위적으로 작용기가 도입된 뉴클레오티드 유사체와 반응시켜 공유결합시킬 수도 있다. 일반적으로 당업계에는 항암제에서 수용체나 효소와 결합하여 활성을 나타내는 부분(moiety) 이외에 링커를 통하여 작용기를 도입하더라도 그 항암제가 활성을 나타냄이 알려져 있다(Chemistry. 2019, 25(65):14740-14757). In addition, a functional group may be artificially introduced into an anticancer drug through a linker, and the anticancer agent into which the functional group is introduced may be reacted with a natural nucleotide or a nucleotide analog into which the functional group has been artificially introduced to covalently bond. In general, it is known in the art that the anticancer agent exhibits activity even when a functional group is introduced through a linker in addition to a moiety that binds to a receptor or an enzyme in the anticancer agent (Chemistry. 2019, 25(65):14740-14757 ).
링커를 통하여 작용기가 도입된 항암제로서는 예컨대 DOX(독소루비신) 항암제에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있는 Succinyl Dox NHS ester(CellMosaic 사, 미국)나, SN38(7-ethyl-10-hydroxycamptothecin) 항암제에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있는 O-Succinyl SN38 NHS ester(CellMosaic 사, 미국)나, DOX(독소루비신)에 (N-ε-maleimidocaproic acid hydrazide, or EMCH) 링커가 접합됨으로써 hydrazone작용기를 가지고 있는 AldoxorubicinChemScence 사, 미국) 등을 들 수 있으며, 또 MMAE((Monomethyl auristatin E)에 MC-VC-PAB-NH2 링커가 접합됨으로써 maleimidocaproyl(MC) 작용기를 가지고 있는 또 MC-VC-PAB-MMAE(VcMMAE)(CellMosaic 사, 미국) 등을 들 수 있다. As an anticancer agent in which a functional group is introduced through a linker, for example, a sulfo-NHS (N-hydroxysulfosuccinimide) linker is conjugated to a DOX (doxorubicin) anticancer agent to have an NHS ester functional group, such as Succinyl Dox NHS ester (CellMosaic, USA), or SN38 (7- By conjugating a sulfo-NHS (N-hydroxysulfosuccinimide) linker to an ethyl-10-hydroxycamptothecin) anticancer drug, O-Succinyl SN38 NHS ester (CellMosaic, USA) or DOX (doxorubicin) having an NHS ester functional group (N-ε- Aldoxorubicin ChemScence, USA), which has a hydrazone functional group by conjugation of maleimidocaproic acid hydrazide, or EMCH) linker, etc. ) and MC-VC-PAB-MMAE (VcMMAE) (CellMosaic, USA) having a functional group.
또 링커를 통하여 작용기가 도입된 뉴클레오티드 유사체로서는 예컨대 dAMP(Deoxyadenosine monophosphate)에 아미노기가 도입된 dAMP 유사체(amino deoxyadenosine dA C6, Gene Link 사, 미국), dGMP(Deoxyguanosine monophosphate)에 아미노기가 도입된 dGMP 유사체(amino deoxyguanocine dG C6, Gene Link 사, 미국), dCMP((deoxycytidine monophosphate)에 아미노기가 도입된 dCMP 유사체(amino deoxycytosine dC C6, Gene Link 사, 미국), dTMP(deoxythymine monophosphate)에 아미노기가 도입된 dTMP 유사체(4-Thio-dT((S4-dT), Gene Link 사) 등을 들 수 있으며, 이들 뉴클레오티드 유사체는 천연의 각 NTP((nucleoside triphosphate)를 대체하여 DNA 핵산의 해당 위치에 통합될 수 있다. In addition, examples of the nucleotide analogue in which a functional group is introduced through a linker include, for example, a dAMP analogue in which an amino group is introduced into dAMP (Deoxyadenosine monophosphate) (amino deoxyadenosine dA C6, Gene Link, USA), a dGMP analogue in which an amino group is introduced into dGMP (Deoxyguanosine monophosphate) ( amino deoxyguanocine dG C6, Gene Link, USA), dCMP ((deoxycytidine monophosphate) with an amino group introduced into it (amino deoxycytosine dC C6, Gene Link, USA), dTMP analog with an amino group introduced with dTMP (deoxythymine monophosphate) (4-Thio-dT ((S4-dT), Gene Link Co.), and the like, and these nucleotide analogues can be integrated at the corresponding position in the DNA nucleic acid by replacing each NTP (nucleoside triphosphate) in nature.
또 링커를 통하여 작용기가 도입된 뉴클레오티드 유사체로서, 예컨대 UMP(Uridine monophosphate)에 아미노기가 도입된 UMP 유사체(amino C6 U, Gene Link 사), UMP(Uridine monophosphate)에 아미노기가 도입된 UMP 유사체(4-Thio-Uridine(s4U), Gene Link 사) 등은 천연의 UTP를 대체하여 RNA 핵산의 해당 위치에 통합될 수 있다. 또 아미노기를 갖고 있는 퓨린 뉴클레오티드 유사체(2-amino Purine Ribose, Gene Link 사)는 ATP나 GTP를 대체하여 RNA 핵산의 해당 위치에 통합될 수 있다. Also, as a nucleotide analog in which a functional group is introduced through a linker, for example, an UMP analog in which an amino group is introduced into UMP (Uridine monophosphate) (amino C6 U, Gene Link Co.), a UMP analog in which an amino group is introduced into UMP (Uridine monophosphate) (4-Uridine monophosphate) Thio-Uridine (s4U), Gene Link Inc.) can be integrated at the corresponding position of the RNA nucleic acid by replacing the native UTP. In addition, a purine nucleotide analogue having an amino group (2-amino Purine Ribose, Gene Link) can be integrated at the corresponding position in the RNA nucleic acid by replacing ATP or GTP.
뉴클레오티드 유사체나 항암제에 링커를 통해 도입되는 작용기는 아민기(amine group), 카르복시기(carboxyl group), 설프히드릴기(sulfhydryl group), 인산기(phosphate group), 히드록시기(hydroxyl group), 아이소티오시아네이트(isothiocyanate), 아이소시아네이트(isocyanates), 아실 아자이드(acyl azide), NHS 에스터(NHS ester), 설포닐 클로라이드(sulfonyl chloride), 알데하이드(aldehyde), 글리옥살(glyoxal), 에폭사이드(epoxide), 옥시레인(oxirane), 칼보네이트(carbonate), 아릴 할라이드(aryl halide), 이미도에스터(imidoester), 카보이미드(carbodiimide), 안하이드라이드(anhydride), 플루오로페닐 에스터(fluorophenyl ester), 히드록시메틸포스핀(hydroxymethyl phosphine), 말레이미드(maleimide), 할로아세틸(haloacetyl), 피리딜디설파이드(pyridyldisulfide), 티오술포네이트(thiosulfonate), 또는 비닐술폰(vinylsulfone) 등일 수 있다.Functional groups introduced through a linker into nucleotide analogues or anticancer agents are amine group, carboxyl group, sulfhydryl group, phosphate group, hydroxyl group, isothiocyanate (isothiocyanate), isocyanate (isocyanates), acyl azide (acyl azide), NHS ester (NHS ester), sulfonyl chloride (sulfonyl chloride), aldehyde (aldehyde), glyoxal (glyoxal), epoxide (epoxide), Oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride, fluorophenyl ester, hydroxymethyl It may be phosphine (hydroxymethyl phosphine), maleimide (maleimide), haloacetyl (haloacetyl), pyridyldisulfide (pyridyldisulfide), thiosulfonate (thiosulfonate), or vinyl sulfone (vinylsulfone).
링커는 프로테아제에 의해서 절단 가능하거나, 산이나 염기 조건에서 절단 가능하거나, 고온이나 광조사에 의해서 절단 가능하거나 또는 환원 또는 산화 조건에서 절단 가능한 링커일 수 있고, 또는 이러한 조건들에서 절단 가능하지 않은 링커일 수도 있다. The linker may be a linker cleavable by a protease, cleavable under acid or base conditions, cleavable under high temperature or light irradiation, or cleavable under reducing or oxidizing conditions, or a linker that is not cleavable under these conditions. may be
절단 가능한 링커로서는 예컨대 산성 조건에서 절단되는 히드라존(hydrazone) 링커, 프로테아제에 의해 절단되는 펩타이드 링커, 환원 조건에서 절단되는 디설파이드(disulfide) 작용기를 갖는 링커 등을 들 수 있고, 절단 가능하지 않은 링커로서는 MCC(Maleimidomethyl cyclohexane-1-carboxylate) 링커, MC(maleimidocaproyl) 링커, 또는 그 유도체로서 석신이미딜-4-(N-말레이미도메틸)사이클로헥산-1-카르복실레이트(sMCC) 링커나 설포석신이미딜-4-(N-말레이미도메틸)사이클로헥산-1-카르복실레이트(sulfo-sMCC)를 들 수 있다.Examples of the cleavable linker include a hydrazone linker cleaved under acidic conditions, a peptide linker cleaved by a protease, and a linker having a disulfide functional group cleaved under reducing conditions. Examples of non-cleavable linkers include: MCC (Maleimidomethyl cyclohexane-1-carboxylate) linker, MC (maleimidocaproyl) linker, or a derivative thereof, such as succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (sMCC) linker or sulfosuccin imidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).
또한 링커는 자가 희생 링커(self-immolative linker) 또는 절단 후 흔적을 남기지 않는 링커(traceless linker)일 수 있다. 자가 희생 링커는 예컨대 발명의 명칭이 "Hydrophilic self-immolative linkers and conjugates thereof "인 미국 특허 제9,089,614호에 개시된 링커, 명칭이 "SELF-IMMOLATIVE LINKERS CONTAINING MANDELIC ACID DERIVATIVES, DRUG-LIGAND CONJUGATES FOR TARGETED THERAPIES AND USES THEREOF"인 국제공개 제WO2015038426호에 개시된 링커를 들 수 있으며, 절단 후 흔적을 남기지 않는 링커로서는 페닐하이드라지드 링커, 아릴-트리아젠 링커, 문헌Blaney, et al., "Traceless solid-phase organic synthesis," Chem Rev. 102: 2607-2024 (2002)에 개시된 링커 등일 수 있다.The linker may also be a self-immolative linker or a traceless linker after cleavage. Self-immolative linkers are, for example, linkers disclosed in U.S. Patent No. 9,089,614 entitled "Hydrophilic self-immolative linkers and conjugates thereof", titled "SELF-IMMOLATIVE LINKERS CONTAINING MANDELIC ACID DERIVATIVES, DRUG-LIGAND CONJUGATES FOR TARGETED THERAPIES AND USP THEREOF," which is a linker disclosed in WO2015038426, and as a linker that does not leave a trace after cleavage, a phenylhydrazide linker, an aryl-triazene linker, Blaney, et al., "Traceless solid-phase organic synthesis" ," Chem Rev. 102: 2607-2024 (2002), and the like.
또한 링커는 동종 이작용성 링커(둘 이상의 동일한 반응성 작용기를 갖는 링커) 또는 이종 이작용성 링커(둘 이상의 서로 다른 반응성 작용기를 갖는 링커)일 수도 있다. The linker may also be a homobifunctional linker (a linker having two or more identical reactive functional groups) or a heterobifunctional linker (a linker having two or more different reactive functional groups).
동종 이작용성 링커는 예컨대 3'3'-디티오비스(설포석신이미딜 프로피오네이트(DTSSP), 디석신이미딜 수베레이트(DSS), 비스(설포석신이미딜)수베레이트(BS), 디석신이미딜 타르트레이트(DST), 디설포석신이미딜 타르트레이트(설포 DST), 에틸렌 글리코비스(석신이미딜석시네이트)(EGS), 디석신이미딜 글루타레이트(DSG), N,N'-디석신이미딜 카보네이트(DSC), 디메틸 아디피미데이트(DMA), 디메틸 피멜리미데이트(DMP), 디메틸 수베르이미데이트(DMS), 디메틸-3,3'-디티오비스프로피온이미데이트(DTBP), 1,4-디-3'-(2'-피리딜디티오)프로피온아미도)부탄(DPDPB), 비스말레이미도헥산(BMH), 아릴 할로겐화물 함유 화합물(DFDNB), 비스말레이미도헥산(BMH), 아릴 할로겐화물 함유 화합물(DFDNB), 비스-β-(4-아지도살리실아미도)에틸디설파이드(BASED), 포름알데하이드, 글루타르알데하이드, 1,4-부탄디올 디글리시딜 에테르, 아디프산 디하이드라지드, 카르보하이드라지드, o-톨루이딘, 3,3'-디메틸벤지딘, 벤지딘, α,α'-p-디아미노디페닐, 디아이오도-p-자일렌 설폰산, N,N'-에틸렌-비스(아이오도아세트아미드), N,N'-헥사메틸렌-비스(아이오도아세트아미드) 등을 들 수 있다.Homobifunctional linkers include, for example, 3'3'-dithiobis(sulfosuccinimidyl propionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), Disuccinimidyl Tartrate (DST), Disulfosuccinimidyl Tartrate (Sulfo DST), Ethylene Glycobis (Succinimidyl Succinate) (EGS), Disuccinimidyl Glutarate (DSG), N,N '-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate ( DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), aryl halide containing compound (DFDNB), bismaleimido Hexane (BMH), compound containing aryl halide (DFDNB), bis-β-(4-azidosalicylamido)ethyldisulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether , adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid , N,N'-ethylene-bis(iodoacetamide), N,N'-hexamethylene-bis(iodoacetamide), and the like.
이종 이작용성 링커는 아민 반응성 및 설프하이드릴 반응성 교차-링커, 카르보닐 반응성 및 설프하이드릴 반응성 교차 링커, 아민 반응성 및 광반응성 교차 링커, 설프하이드릴 반응성 및 광반응성 교차 링커 등을 들 수 있는데, 아민 반응성 및 설프하이드릴 반응성 교차-링커로서는 예컨대 N-석신이미딜 3-(2-피리딜디티오)프로피오네이트(sPDP), 장쇄 N-석신이미딜 3-(2-피리딜디티오)프로피오네이트(LC-sPDP), 수용성-장쇄 N-석신이미딜 3-(2-피리딜디티오) 프로피오네이트(설포-LC-sPDP), 석신이미딜옥시카르보닐-α-메틸-α-(2-피리딜디티오)톨루엔(sMPT), 설포석신이미딜-6-α-메틸-α-(2-피리딜디티오)톨루아미도헥사노에이트(설포-LC-sMPT), 석신이미딜-4-(N-말레이미도메틸)사이클로헥산-1-카르복실레이트(sMCC), 설포석신이미딜-4-(N-말레이미도메틸)사이클로헥산-1-카르복실레이트(설포-sMCC), m-말레이미도벤조일-N-하이드록시석신이미드 에스테르(MBs), m-말레이미도벤조일-N-하이드록시설포석신이미드 에스테르(설포-MBs), N-석신이미딜(4-아이오도아세틸)아미노벤조에이트(sIAB) 등을 들 수 있고, 카르보닐 반응성 및 설프하이드릴 반응성 교차 링커로서는 예컨대 4-(4-N-말레이미도페닐)부티르산 하이드라지드(MPBH), 4-(N-말레이미도메틸)사이클로헥산-1-카르복실-하이드라지드-8(M2C2H), 3-(2-피리딜디티오)프로피오닐 하이드라지드(PDPH) 등을 들 수 있고, 아민-반응성 및 광반응성 교차-링커로서는, 예컨대 N-하이드록시석신이미딜-4-아지도살리실산(NHs-AsA), N-하이드록시설포석신이미딜-4-아지도살리실산(설포-NHs-AsA), 설포석신이미딜-(4-아지도살리실아미도)헥사노에이트(설포-NHs-LC-AsA), 설포석신이미딜-2-(ρ-아지도살리실아미도)에틸-1,3'-디티오프로피오네이트(sAsD), N-하이드록시석신이미딜-4-아지도벤조에이트(HsAB), N-하이드록시설포석신이미딜-4-아지도벤조에이트(설포-HsAB), N-석신이미딜-6-(4'-아지도-2'-니트로페닐아미노)헥사노에이트(sANPAH), 설포석신이미딜-6-(4'-아지도-2'-니트로페닐아미노)헥사노에이트(설포-sANPAH), N-5-아지도-2-니트로벤조일옥시석신이미드(ANB-NOs) 등을 들 수 있으며, 설프하이드릴 반응성 및 광반응성 교차 링커로서는 예컨대, 1-(ρ-아지도살리실아미도)-4-(아이오도아세트아미도)부탄(AsIB), N-4-(ρ-아지도살리실아미도)부틸-3'-(2'-피리딜디티오)프로피온아미드(APDP), 벤조페논-4-아이오도아세트아미드, 벤조페논-4-말레이미드 등을 들 수 있다.Heterobifunctional linkers include amine-reactive and sulfhydryl-reactive cross-linkers, carbonyl-reactive and sulfhydryl-reactive cross-linkers, amine-reactive and photoreactive cross-linkers, sulfhydryl-reactive and photoreactive cross-linkers, and the like. Amine-reactive and sulfhydryl-reactive cross-linkers include, for example, N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long chain N-succinimidyl 3-(2-pyridyldithio) propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α -(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-α-methyl-α-(2-pyridyldithio)toluamidohexanoate (sulfo-LC-sMPT), Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo -sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl (4 -iodoacetyl)aminobenzoate (sIAB) and the like, and examples of the carbonyl-reactive and sulfhydryl-reactive crosslinker include 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4- (N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), etc. are mentioned, and an amine- Reactive and photoreactive cross-linkers include, for example, N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA). ), sulfosuccinimidyl-(4-azidosalicylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1 , 3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo- HsAB), N -Succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino) hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), and the like. Examples of the sulfhydryl-reactive and photoreactive cross-linker include 1-( ρ-azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-4-(ρ-azidosalicylamido)butyl-3'-(2'-pyridyldithio) and propionamide (APDP), benzophenone-4-iodoacetamide, and benzophenone-4-maleimide.
일부 양태에 있어서, 링커는 수지 유형(dendritic type)의 링커이다. 수지 유형 링커는 분지형, 다기능성 연결부를 가지며, 그러한 링커로서는 예컨대 PAMAM 덴드리머를 들 수 있다.In some embodiments, the linker is a dendritic type of linker. Resin type linkers have branched, multifunctional linkers, such as, for example, PAMAM dendrimers.
당업계에서는 상기 예시한 바의 링커 이외에도 본 발명에 적용 가능한 수많은 링커가 상당한 수의 문헌을 통해 공지되어 있다. 그러한 문헌으로서 구체적으로 문헌Castaneda, et al, "Acid-cleavable thiomaleamic acid linker for homogeneous antibodydrug conjugation," Chem Commun. 49: 8187-8189 (2013), 문헌Lyon, et al, "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat Biotechnol. 32(10):1059-1062 (2014), 문헌Dawson, et al "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779, 문헌Dawson, et al "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J Am Chem Soc. 1997, 119, 4325-4329 문헌Hackeng, et al "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology," Proc Natl Acad Sci USA 1999, 96, 10068-10073, 문헌Wu, et al "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol," Angew Chem Int Ed 2006, 45, 4116-4125, 문헌Geiser et al "Automation of solid-phase peptide synthesis" in Macromolecular Sequencing and Synthesis, Alan R Liss, Inc, 1988, pp 199-218, 문헌Fields, G and Noble, R (1990) "Solid phase peptide synthesis utilizing 9-fluoroenylmethoxycarbonyl amino acids", Int J Peptide Protein Res 35:161-214 등이나, 미국 특허 제6,884,869호, 미국 특허 제7,498,298호, 미국 특허 제8,288,352호, 미국 특허 제8,609,105호, 미국 특허 제8,697,688호, 미국 특허공개 제2014/0127239호, 미국 특허공개 제2013/028919호, 미국 특허공개 제2014/286970호, 미국 특허공개 제2013/0309256호, 미국 특허공개 제2015/037360호, 미국 특허공개 제2014/0294851호, 국제 특허공개 WO2015057699, 국제 특허공개 WO2014080251, 국제 특허공개 제WO2014197854, 국제 특허공개 WO2014145090, 국제 특허공개 WO2014177042 등을 참조할 수 있다.In addition to the linkers exemplified above, numerous linkers applicable to the present invention are known in the art through a significant number of documents. As such, specifically, Castaneda, et al, "Acid-cleavable thiomaleamic acid linker for homogeneous antibodydrug conjugation," Chem Commun. 49: 8187-8189 (2013), Lyon, et al, "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat Biotechnol. 32(10):1059-1062 (2014), Dawson, et al "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779, Dawson, et al "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J Am Chem Soc. 1997, 119, 4325-4329 Hackeng, et al "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology," Proc Natl Acad Sci USA 1999, 96, 10068-10073, Wu, et al "Building complex glycopeptides : Development of a cysteine-free native chemical ligation protocol," Angew Chem Int Ed 2006, 45, 4116-4125, Geiser et al "Automation of solid-phase peptide synthesis" in Macromolecular Sequencing and Synthesis, Alan R Liss, Inc, 1988, pp 199-218, Fields, G and Noble, R (1990) "Solid phase peptide synthesis utilizing 9-fluoroenylmethoxycarbonyl amino acids", Int J Peptide Protein Res 35:161-214 et al., U.S. Patent No. 6,884,869, U.S. Patent No. 7,498,298, U.S. Patent No. 8,288,352, U.S. Patent No. 8,609,105, U.S. Patent No. 8,697,688, U.S. Patent Publication No. 2014/0127239, U.S. Patent Publication No. 2013/028919, U.S. Patent Publication No. 2014/286970 , U.S. Patent Publication No. 2013/0309256, U.S. Patent Publication No. 2015/037360, U.S. Patent Publication No. 2014/0294851, International Patent Publication WO20150557699, International Patent Publication WO2014080251, International Patent Publication No. WO2014197854, International Patent Publication WO2014145090, International Patent publication WO2014177042 and the like may be referred to.
본 발명에서, 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 또는 RNA 핵산은, 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역으로 구성된 서열을 주형으로 하여, DNA 핵산 제조를 위해서는 중합효소연쇄반응(PCR, polymerase chain reaction), RNA 핵산 제조를 위해서는 PCR과 체외 전사(In vitro transcription)를 통하여 얻어질 수 있다. In the present invention, the DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue bound to an anticancer agent are integrated, is prepared by using a sequence consisting of a 5' end region - an intermediate region of an arbitrary sequence - 3' end region as a template, and preparing a DNA nucleic acid It can be obtained through polymerase chain reaction (PCR), PCR and in vitro transcription for RNA nucleic acid production.
DNA 핵산은 PCR를 통해 직접 얻어지는 이중가닥의 DNA 핵산이거나 그 이중가닥의 DNA 핵산을 분리하여 얻어지는, 주형과 실질적으로 서열이 같은 단일가닥의 DNA 핵산일 수 있다. 여기서 "주형과 실질적으로 서열이 같다"는 것은 항암제가 결합된 뉴클레오티드 유사체가 본래의 뉴클레오티드가 통합될 위치에 본래의 뉴클레오티드를 대신하여 통합되었을 때 그 뉴클레오티드 유사체가 통합된 서열을, 그 본래의 뉴클레오티드가 있는 주형 서열과 같은 서열로 간주한다는 것이다.The DNA nucleic acid may be a double-stranded DNA nucleic acid obtained directly through PCR or a single-stranded DNA nucleic acid having substantially the same sequence as the template obtained by isolating the double-stranded DNA nucleic acid. Herein, "substantially identical in sequence to the template" means that when a nucleotide analogue to which an anticancer agent is bound is integrated in place of the original nucleotide at the position where the original nucleotide is to be integrated, the sequence in which the nucleotide analogue is integrated, and the original nucleotide is It is considered to be the same sequence as the template sequence in the
상기 주형에서 5' 말단 영역과 3' 말단 영역은 각각 정방향 프라이머와 역방향 프라이머가 결합하는 영역이다. 5' 말단 영역은 RNA 핵산을 제조하기 위한 경우라면 RNA 중합효소가 전사를 개시할 수 있는 프로모터 서열을 가지도록 구성될 수도 있다. 상기 5' 말단 영역과 3' 말단 영역은 거기에 프라이머가 결합하여 PCR를 수행할 수 있거나 RNA 핵산 제조를 위해서 RNA 중합효소가 결합하여 전사를 개시할 수 있으면 임의의 길이를 가질 수 있다. 통상은 15~30 뉴클레오티드의 길이를 가질 것이다. In the template, the 5' end region and the 3' end region are regions where the forward primer and the reverse primer bind, respectively. The 5' end region may be configured to have a promoter sequence capable of initiating transcription by RNA polymerase if it is to produce RNA nucleic acid. The 5' end region and the 3' end region may have any length as long as a primer can be bound thereto to perform PCR or an RNA polymerase can bind to initiate transcription for RNA nucleic acid production. Usually it will be 15-30 nucleotides in length.
상기 주형에서 중간 영역의 임의의 서열 영역은 항암제가 결합된 뉴클레오티드 유사체가 통합되기 위한 서열이다. 이러한 서열은 항암제가 핵산에 탑재되는 함량이나 탑재시키고자 하는 항암제의 종류, 항암제를 탑재시킬 위치를 고려하여 임의의 적정 서열과 임의의 길이를 가지도록 설계, 제작될 수 있다. Any sequence region of the intermediate region in the template is a sequence for integrating a nucleotide analog to which an anticancer agent is bound. Such a sequence may be designed and manufactured to have any appropriate sequence and any length in consideration of the content of the anticancer agent to be loaded on the nucleic acid, the type of anticancer agent to be loaded, and the location where the anticancer agent is to be loaded.
이러한 임의의 서열 영역은 PCR 또는 체외 전사 시에, 4개의 NTP(nucleoside triphosphate) 중 어느 하나 이상의 NTP를, 항암제가 결합된 뉴클레오티드 유사체로 대체하여 사용함으로써 그러한 항암제가 결합된 뉴클레오티드 유사체가 본래의 NTP가 통합될 위치에 통합되도롤 하는 것을 가능하게 한다. In the case of PCR or in vitro transcription, any one or more NTPs of the four nucleoside triphosphates (NTPs) are replaced with an anticancer drug-bound nucleotide analog by using such an arbitrary sequence region, so that the anticancer agent-bound nucleotide analog is converted to the original NTP. It makes it possible to be integrated at the location to be integrated.
예컨대 1종의 항암제가 3분자 결합된 핵산을 제조하기 위한 경우로서, CTP를 대체하여 통합될 수 있는, 독소루비신(DOX)이 결합된 뉴클레오티드 유사체를 사용하여 3분자의 독소루비신(DOX)이 통합된 핵산을 제조하고자 할 경우라면, 상기 임의의 서열 영역은 그 서열의 임의의 위치에 3개의 C(cytosine)가 위치하고 나머지 모든 위치에서는 C 이외의 다른 염기가 위치하도록, 예컨대 ~NNCNCNCN~ 서열이나 ~NCNCCNN~ 서열을 갖도록 구성할 수 있다(여기서 N은 C 이외의 임의의 뉴클레오티드이다).For example, in the case of one anticancer agent for producing a three-molecular-associated nucleic acid, a three-molecule doxorubicin (DOX)-integrated nucleic acid using a doxorubicin (DOX)-conjugated nucleotide analog, which can be incorporated by replacing CTP In the case of preparing sequence (where N is any nucleotide other than C).
또 예컨대 2종의 항암제가 각각 2분자씩 결합된 핵산을 제조하기 위한 경우로서, CTP를 대체하여 통합될 수 있는, 독소루비신(DOX)이 결합된 뉴클레오티드 유사체와 ATP를 대체하여 통합될 수 있는, SN38(7-ethyl-10-hydroxycamptothecin)이 결합된 뉴클레오티드 유사체를 사용하여, 독소루비신(DOX)과 SN38이 2분자씩 통합된 핵산을 제조하고자 할 경우라면, 상기 임의의 서열 영역은 그 서열의 임의의 위치에 2개의 C(cytosine)와 2개의 A(adenine)가 위치하고 나머지 모든 위치에서는 C와 A 이외의 다른 염기의 뉴클레오티드가 위치하도록, 예컨대 ~NNCACANN~ 서열이나 ~ACNCANN~ 서열을 갖도록 구성할 수 있다(여기서 N은 C와 A 이외의 임의의 뉴클레오티드이다).Also, for example, for producing a nucleic acid in which two anticancer agents are bound by two molecules, SN38, which can be integrated by replacing ATP and a nucleotide analogue to which doxorubicin (DOX) is bound, which can be integrated by replacing CTP (7-ethyl-10-hydroxycamptothecin) If it is intended to prepare a nucleic acid in which doxorubicin (DOX) and SN38 are integrated by two molecules by using a linked nucleotide analog, the arbitrary sequence region can contain two C (cytosine) and two It can be configured such that A (adenine) is located and nucleotides other than C and A are located at all other positions, for example, to have a ~NNCACANN~ sequence or ~ACNCANN~ sequence (where N is any other than C and A) nucleotides).
전술한 바와 같이, 상기 중간 영역의 임의의 서열 영역은 항암제가 탑재되는 함량, 탑재하고자 하는 항암제의 종류, 탑재되는 항암제의 위치를 고려하여 임의의 서열을 갖도록 임의의 길이로 구성할 수 있기 때문에, 탑재시키고자 하는 항암제의 함량이나 종류 그리고 항암제가 탑재되는 위치를 의도한 대로 결정하고 조절하는 것이 가능하다. As described above, the arbitrary sequence region of the intermediate region can be configured to have an arbitrary length in consideration of the content of the anticancer agent to be loaded, the type of the anticancer agent to be loaded, and the position of the loaded anticancer agent, It is possible to determine and control the content or type of the anticancer agent to be loaded and the location where the anticancer agent is loaded as intended.
본 발명의 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 핵산은, (a) 상기와 같은 구성을 갖는 주형 DNA 핵산 즉 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 항암제가 결합된 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 dNTP(deoxynucleoside triphosphate)가 제외된 dNTP 혼합물과 함께 사용하여 PCR를 통해 주형 DNA 핵산의 증폭 산물을 얻는 단계, 및 (c) 증폭 산물을 회수하는 단계를 포함하는 제조 방법에 의하여 얻어질 수 있다.The DNA nucleic acid in which one or more molecules of the anticancer agent-bound nucleotide analogue of the present invention are integrated is (a) a template DNA nucleic acid having the above configuration, that is, the 5' end region - the middle region of the arbitrary sequence - 3' end region A step of preparing a template DNA nucleic acid having a composition, (b) PCR using a nucleotide analogue bound with an anticancer agent to the template DNA nucleic acid with a dNTP mixture excluding the natural dNTP (deoxynucleoside triphosphate) corresponding to the analogue It can be obtained by a manufacturing method comprising the steps of obtaining an amplification product of the template DNA nucleic acid through, and (c) recovering the amplification product.
본 발명의 제조 방법에서 항암제가 결합된 뉴클레오티드 유사체로서 dATP를 대체하여 DNA 핵산에 통합될 수 있는 것을 사용할 경우, 상기 dNTP 혼합물은 dATP가 제외된 dGTP, dCTP, dTTP를 포함한 것을 사용하게 된다. In the production method of the present invention, when using a nucleotide analog to which an anticancer agent is bound as a nucleotide analogue that can be integrated into a DNA nucleic acid by replacing dATP, the dNTP mixture includes dGTP, dCTP, and dTTP excluding dATP.
본 발명의 제조 방법에서, 상기 PCR은 상기 주형 DNA 핵산의 5' 말단 영역과 3' 말단 영역에 상보적으로 결합하는 정방향 프라이머와 역방향 프라이머를 사용하여 수행될 수 있다.In the production method of the present invention, the PCR may be performed using a forward primer and a reverse primer that complementarily bind to the 5' end region and the 3' end region of the template DNA nucleic acid.
또 본 발명의 제조 방법에서, 항암제가 결합된 뉴클레오티드 유사체는 천연의 dNTP를 대체하여 증폭 산물에 통합될 수 있는 것이면 특별한 제한없이 사용될 수 있다. 이러한 항암제가 결합된 뉴클레오티드 유사체는 전술한 바와 같이 아민기(amine group), 인산기(phosphate group), 히드록시기(hydroxyl group) 등의 작용기를 가진 천연의 뉴클레오티드나 링커를 통하여 작용기가 도입된 뉴클레오티드 유사체에, 그러한 천연의 뉴클레오티드나 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제나 인위적으로 링커를 통하여 작용기가 도입된 항암제(즉 링커 약물 접합체)를 반응시켜 얻어질 수 있다.In addition, in the preparation method of the present invention, the nucleotide analogue to which the anticancer agent is bound can be used without any particular limitation as long as it can be incorporated into the amplification product by replacing the natural dNTP. Nucleotide analogues to which these anticancer agents are bound are natural nucleotides having functional groups such as an amine group, a phosphate group, and a hydroxyl group, as described above, or a nucleotide analogue in which a functional group is introduced through a linker, It can be obtained by reacting an anticancer agent having a functional group capable of reacting with a functional group of such natural nucleotides or nucleotide analogues or an anticancer agent artificially introduced with a functional group through a linker (ie, a linker drug conjugate).
또 본 발명의 제조 방법에서, 주형 DNA 핵산은 전술한 바와 같이 그 중간 영역의 임의의 서열 영역은 항암제가 탑재되는 함량, 탑재하고자 하는 항암제의 종류, 탑재되는 항암제의 위치를 고려하여 임의의 서열, 임의의 길이로 가지도록 구성할 수 있다.In addition, in the preparation method of the present invention, the template DNA nucleic acid has an arbitrary sequence region in the intermediate region as described above, taking into account the content of the anticancer agent to be loaded, the type of anticancer agent to be loaded, and the position of the loaded anticancer agent. It can be configured to have any length.
본 발명의 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 핵산은 상기와 다른 제조 방법으로 얻어질 수도 있다. A DNA nucleic acid into which one or more molecules of the nucleotide analogue bound to the anticancer agent of the present invention are integrated may be obtained by a method different from the above.
그러한 제조 방법은 (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 작용기를 가진 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 dNTP가 제외된 dNTP 혼합물과 함께 사용하여 PCR를 통해 작용기를 가진 뉴클레오티드 유사체가 통합된 증폭 산물을 얻는 단계, (c) 증폭 산물에, 상기 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제를 반응시키는 단계, (d) 그 반응 산물을 회수하는 단계를 포함한다.Such a production method comprises the steps of (a) preparing a template DNA nucleic acid having the configuration of a 5' end region-intermediate region-3' end region of any sequence, (b) preparing a nucleotide analog having a functional group with respect to the template DNA nucleic acid , obtaining an amplification product in which a nucleotide analogue having a functional group is incorporated through PCR by using it with a dNTP mixture in which the natural dNTP corresponding to the analogue is excluded, (c) in the amplification product, the functional group of the nucleotide analogue is A step of reacting an anticancer agent having a functional group that can be used, (d) recovering the reaction product.
또 링커를 통하여 작용기가 도입된 뉴클레오티드 유사체로서는 전술한 바의 dAMP 유사체(amino deoxyadenosine dA C6, Gene Link 사), dGMP 유사체(amino deoxyguanocine dG C6, Gene Link 사), dCMP 유사체(amino deoxycytosine dC C6, Gene Link 사), dTMP 유사체(4-Thio-dT((S4-dT), Gene Link 사) 등을 들 수 있으며, 이들 뉴클레오티드 유사체는 천연의 각 해당 dNTP를 대체하여 DNA 핵산의 해당 위치에 통합될 수 있다.In addition, as nucleotide analogues in which a functional group is introduced through a linker, dAMP analogues (amino deoxyadenosine dA C6, Gene Link), dGMP analogues (amino deoxyguanocine dG C6, Gene Link), dCMP analogues (amino deoxycytosine dC C6, Gene) as described above Link, Inc.), dTMP analogues (4-Thio-dT ((S4-dT), Gene Link Inc.), etc.), and these nucleotide analogues replace each corresponding dNTP in nature and can be integrated at the corresponding position in the DNA nucleic acid. have.
이러한 작용기를 가진 뉴클레오티드 유사체가 통합된 증폭 산물이 얻어진 후에는 이러한 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제(또는 링커와 항암제의 접합체)를 반응시켜 이들 작용기 사이의 공유결합을 유도하여 최종적으로 원하는 위치에 원하는 분자 수만큼 원하는 위치에 항암제를 가지는 DNA 핵산을 제조할 수 있다. 이러한 작용기를 가진 항암제는 전술한 바와 같이 아미노기와 히드록시기 작용기를 갖는 DOX(독소루비신) 항암제, DOX(독소루비신) 항암제에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있는 Succinyl Dox NHS ester(CellMosaic 사, 미국)나, SN38(7-ethyl-10-hydroxycamptothecin) 항암제에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있는 O-Succinyl SN38 NHS ester(CellMosaic 사, 미국)나, DOX(독소루비신)에 (N-ε-maleimidocaproic acid hydrazide, or EMCH) 링커가 접합됨으로써 hydrazone작용기를 가지고 있는 AldoxorubicinChemScence 사, 미국) 등을 들 수 있으며, 또 MMAE((Monomethyl auristatin E)에 MC-VC-PAB-NH2 링커가 접합됨으로써 maleimidocaproyl(MC) 작용기를 가지고 있는 또 MC-VC-PAB-MMAE(VcMMAE)(CellMosaic 사, 미국) 등을 들 수 있다. After an amplification product in which a nucleotide analogue having such a functional group is integrated is obtained, an anticancer agent (or a conjugate of a linker and an anticancer agent) having a functional group capable of reacting with the functional group of the nucleotide analogue is reacted to induce a covalent bond between these functional groups to finally DNA nucleic acid having an anticancer agent at a desired position as much as a desired number of molecules at a desired position can be prepared. Succinyl Dox NHS ester having an NHS ester functional group by conjugating a sulfo-NHS (N-hydroxysulfosuccinimide) linker to a DOX (doxorubicin) anticancer drug and DOX (doxorubicin) anticancer drug having an amino group and a hydroxyl functional group as described above. (CellMosaic, USA) or O-Succinyl SN38 NHS ester having NHS ester functional groups by conjugating a sulfo-NHS (N-hydroxysulfosuccinimide) linker to SN38 (7-ethyl-10-hydroxycamptothecin) anticancer drug (CellMosaic, USA) I, Aldoxorubicin ChemScence, USA), which has a hydrazone functional group by conjugating a (N-ε-maleimidocaproic acid hydrazide, or EMCH) linker to DOX (doxorubicin), and MMAE (Monomethyl auristatin E) to MC- and MC-VC-PAB-MMAE (VcMMAE) (CellMosaic, USA) having a maleimidocaproyl (MC) functional group by conjugation of a VC-PAB-NH2 linker.
본 발명의 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 핵산은 그 뉴클레오티드 유사체를 통합시키는 증폭 과정에서 뉴클레오티드 유사체를 그에 상응하는 천연의 dNPT와 마찬가지로 동일하게 인식하여 통합시킬 수 있는 열안정성 DNA 중합효소(DNA polymerase)를 사용하는 것이 바람직하다. 그러한 효소로서 예컨대 KOD XL 중합효소(Thermococcus kodakaraensis에서 기원함), Pwo 중합효소(Pyrococcus woesei에서 기원함), 3'→5' 엑소뉴클레아제 활성이 인위적으로 결여시킨, 써모쿠스 리테라리스(Thermoccus literalis) 기원의 Deep Vent exo- 중합효소나 Vent exo- 중합효소 등을 사용할 수 있다. A DNA nucleic acid in which one or more molecules of the nucleotide analogue to which the anticancer drug of the present invention is bound is integrated is thermostable DNA that can be integrated by recognizing and integrating the nucleotide analogue in the same way as the corresponding natural dNPT during the amplification process to integrate the nucleotide analogue. It is preferable to use a polymerase (DNA polymerase). For example, KOD XL polymerase (which originated from Thermococcus kodakaraensis) as such an enzyme, Pwo polymerase (which originated from the Pyrococcus woesei), 3 '→ 5 ' exonuclease which activity is lacking artificially, Thermo kusu Lee TB-less (Thermoccus literalis ) origin, such as Deep Vent exo-polymerase or Vent exo-polymerase can be used.
본 발명의 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 RNA 핵산은 주형 DNA에서 PCR를 통해 증폭 산물을 얻고 체외 전사를 통해 얻어질 수 있는데, 구체적으로 (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 천연의 NTP를 사용하여 PCR를 통해 증폭 산물을 얻는 단계, (c) 그 증폭 산물을 주형으로 하여 항암제가 결합된 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 NTP가 제외된 NTP 혼합물과 함께 사용하여 체외 전사를 통해 그 뉴클레오티드 유사체가 통합된 RNA를 제조하는 단계, 및 (d) 제조된 RNA를 회수하는 단계를 포함하여 구성된다.The RNA nucleic acid in which one or more molecules of the anticancer agent-bound nucleotide analogue of the present invention are integrated can be obtained by obtaining an amplification product from the template DNA through PCR and performing in vitro transcription, specifically (a) 5' end region-any Preparing a template DNA nucleic acid having the configuration of the intermediate region-3' end region of the sequence, (b) obtaining an amplification product through PCR using a natural NTP for the template DNA nucleic acid, (c) the amplification Using the product as a template and using a nucleotide analogue to which an anticancer agent is bound, together with a mixture of NTPs excluding natural NTPs corresponding to the analogue, to prepare RNA into which the nucleotide analogue is integrated through in vitro transcription, and (d) and recovering the prepared RNA.
본 발명의 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 RNA 핵산은 다른 제조 방법에 의해서도 얻어질 수 있다. RNA nucleic acids in which one or more molecules of the nucleotide analogues bound to the anticancer agent of the present invention are integrated can be obtained by other preparation methods.
그 제조 방법은 구체적으로 주형 DNA에서 PCR를 통해 증폭 산물을 얻고 체외 전사를 통해 얻어질 수 있는데, 구체적으로 (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 천연의 NTP를 사용하여 PCR를 통해 증폭 산물을 얻는 단계, (c) 그 증폭 산물을 주형으로 하여 작용기를 가진 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 NTP가 제외된 NTP 혼합물과 함께 사용하여 체외 전사를 통해 그 뉴클레오티드 유사체가 통합된 RNA를 제조하는 단계, (d) 제조된 RNA에, 상기 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제를 반응시키는 단계, (e) 그 반응 산물을 회수하는 단계를 포함한다.Its preparation method can be specifically obtained by obtaining an amplification product through PCR from template DNA and obtaining it through in vitro transcription, specifically (a) having the configuration of a 5' end region - an intermediate region of an arbitrary sequence - 3' end region A step of preparing a template DNA nucleic acid, (b) obtaining an amplification product through PCR using a natural NTP for the template DNA nucleic acid, (c) using the amplification product as a template, a nucleotide analogue having a functional group, the A step of preparing an RNA in which the nucleotide analogue is integrated through in vitro transcription by using it with a NTP mixture in which the natural NTP corresponding to the analogue is excluded, (d) in the prepared RNA, a functional group of the nucleotide analogue capable of reacting A step of reacting an anticancer agent having a functional group, (e) recovering the reaction product.
본 발명의 제조 방법에서, 5' 말단 영역은 RNA 중합효소의 프로모터 서열을 갖도록 설계된다.In the production method of the present invention, the 5' end region is designed to have the promoter sequence of RNA polymerase.
또 본 발명의 제조 방법에서, RNA 중합효소는 뉴클레오티드 유사체도 그에 상응하는 천연의 NTP와 마찬가지로 RNA에 통합시킬 수 있는 돌연변이 T7 중합효소를 사용하는 것이 바람직하다. 그러한 중합효소로서 돌연변이 T7 중합효소 Y639F, 돌연변이 T7 중합효소 Y639F/H784A, 돌연변이 T7 중합효소 H784A 등이 당업계에 알려져 있다(Science, 286:2305-2308, 1999; Nucleic Acids Res30(24):138, 2002).Also, in the preparation method of the present invention, it is preferable to use a mutant T7 polymerase capable of incorporating a nucleotide analog into RNA as well as a corresponding natural NTP as the RNA polymerase. As such polymerases, mutant T7 polymerase Y639F, mutant T7 polymerase Y639F/H784A, mutant T7 polymerase H784A and the like are known in the art (Science, 286:2305-2308, 1999; Nucleic Acids Res30(24):138, 2002).
또 본 발명의 제조 방법에서, 상기 체외 전사를 수행하기 위한 NTP 혼합물은 그 뉴클레오티드의 당 위치, 포스페이트 위치, 염기 위치에서 화학적으로 변형된(수식된) 뉴클레오티드를 포함할 수도 있다. 당업계에서는 천연형(wild type)의 RNA가 생체 내 엔도뉴클레아제나 엑소뉴클레아제에 의해 쉽게 분해되는 특성이 있다는 것이 당업계에 주지되어 있다. 이러한 화학적으로 수식된 압타머는 생체 내에서의 안정성을 향상시킬 수 있고, 그에 따라 생체 반감기를 늘려 약력학적 및 약동학적 성질을 향상시킬 수 있으며, 더불어 화학적·물리적 분해에 저항성을 부여하여 보관 안정성을 등을 향상시킬 수 있다. 바람직하게는 상기 화학적으로 수식된 뉴클레오티드는 2'F-CTP 또는 2'F-UTP일 수 있다.In addition, in the production method of the present invention, the NTP mixture for performing the in vitro transcription may include nucleotides chemically modified (modified) at the sugar position, phosphate position, and base position of the nucleotide. In the art, it is well known in the art that wild type RNA has the property of being easily degraded by endonuclease or exonuclease in vivo. These chemically modified aptamers can improve the stability in vivo, thereby increasing the biological half-life to improve pharmacodynamic and pharmacokinetic properties, and in addition, by giving resistance to chemical and physical degradation, storage stability, etc. can improve Preferably, the chemically modified nucleotide may be 2'F-CTP or 2'F-UTP.
또 본 발명의 제조 방법에서, 작용기를 갖는 뉴클레오티드 유사체로서는 전술한 바의 아미노기를 갖는 UMP 유사체(amino C6 U 또는 4-Thio-Uridine(s4U), Gene Link 사), 아미노기를 가진 퓨린 뉴클레오티드 유사체(2-amino Purine Ribose, Gene Link 사) 등을 예시할 수 있다. Also, in the production method of the present invention, as the nucleotide analogue having a functional group, the above-described UMP analogue having an amino group (amino C6 U or 4-Thio-Uridine (s4U), Gene Link Corporation), a purine nucleotide analogue having an amino group (2) -amino Purine Ribose, Gene Link) etc. can be illustrated.
또 본 발명의 제조 방법에서, 항암제가 결합된 뉴클레오티드 유사체는 예컨대 아미노기를 갖는 UMP 유사체에 NHS ester 작용기를 가진 DOX(독소루비신) 항암제나 NHS ester 작용기를 갖는 SN38(7-ethyl-10-hydroxycamptothecin) 항암제를 반응시켜 얻어지는 것 등을 예시할 수 있다. In addition, in the preparation method of the present invention, the nucleotide analogue to which the anticancer agent is bound is, for example, a DOX (doxorubicin) anticancer drug having an NHS ester functional group or a SN38 (7-ethyl-10-hydroxycamptothecin) anticancer drug having an NHS ester functional group to a UMP analogue having an amino group. What is obtained by making it react, etc. can be illustrated.
본 발명의 표적화 항암제에 있어서, 암세포는 치료 목적으로 제거 또는 사멸의 필요성을 가진 임의의 암세포(또는 암 줄기세포)이다. 암세포라면 식도암, 위암, 대장암, 직장암, 구강암, 인두암, 후두암, 폐암, 결장암, 유방암, 자궁 경부암, 자궁 내막체암, 난소암, 전립선암, 고환암, 방광암, 신장암, 간암, 췌장암, 골암, 결합 조직암, 피부암, 뇌암, 갑상선암, 백혈병, 호지킨(Hodgkin) 질환, 림프종, 다발성 골수종혈액암 등 암종을 불문한다. In the targeted anticancer agent of the present invention, the cancer cell is any cancer cell (or cancer stem cell) that needs to be removed or killed for therapeutic purposes. Cancer cells include esophageal cancer, stomach cancer, colorectal cancer, rectal cancer, oral cancer, pharyngeal cancer, laryngeal cancer, lung cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, ovarian cancer, prostate cancer, testicular cancer, bladder cancer, kidney cancer, liver cancer, pancreatic cancer, bone cancer, Carcinomas such as connective tissue cancer, skin cancer, brain cancer, thyroid cancer, leukemia, Hodgkin's disease, lymphoma, multiple myeloma, and blood cancer are irrelevant.
또 본 발명의 표적화 항암제에서, 표적분자는 암세포의 표면에 존재하는 임의의 항원 또는 임의의 수용체이다.In addition, in the targeted anticancer agent of the present invention, the target molecule is any antigen or any receptor present on the surface of cancer cells.
이러한 항원 또는 수용체는 바람직하게는 암세포에서만 발현되거나 정상세포에 비해 암세포에서 과발현되는 항원 또는 수용체를 말한다. 예컨대 교모세포종(glioblastoma)에서 발현되는 EGFRvⅢ(epidermal growth factor receptor variantⅢ), 역형성 갑상선암이나 유방암, 폐암, 신경교종(glioma) 등에 과발현되는 EGFR(Epidermal growth factor receptor), 유두성 갑상선 암(papillary thyroid cancer) 등에서 과발현 메타스틴 수용체(Metastin receptor), 유방암 등에서 과발현되는 ErbB 계열의 수용체 타이로신 카이나제(Receptor tyrosine kinases), 유방암, 방광암, 담낭암(Gallbladder cancers), 담관암(Cholangiocarcinomas), 위식도접합부암(esophagogastric junction cancers) 등에서 과발현되는 HER2(Human epidermal growth factor receptor 2), 육두성 신암종 등에서 과발현되는 타이로신 카이나제-18-수용체(c-Kit), 식도 선암 등에 과발현되는 HGF 수용체 c-Met, 유방암 등에서 과발현되는 CXCR4 또는 CCR7, 전림선암에서 과발현되는 엔도테린-A 수용체, 직장암 등에서 과발현되는 PPAR-δ(peroxisome proliferator activated receptor δ), 난소암 등에서 과발현되는 PDGFR-α(Platelet-derived growth factor receptor α), 간암, 다발성 골수종 등에서 과발현되는 CD133, 폐암, 대장암, 위암, 췌장암, 유방암, 직장암, 결장암, 갑상선 수질암 등에서 과발현되는 CEA(carcinoembryonic antigen), 간암, 위암, 대장암, 췌장암, 유방암 등에서 과발현되는 EpCAM(Epithelial cell adhesion molecule), 폐암, 유방암, 췌장암, 난소암 등에서 과발현되는 MSLN(Mesothelin), 신경모세포종 등에서 과발현되는 GD2(disialoganglioside), 간세포암 등에서 과발현되는 GPC3(Glypican 3), 전립선암 등에서 과발현되는 PSMA(Prostate Specific Membrane Antigen), 난소암, 유방암, 결장암, 폐암, 췌장암 등에서 과발현되는 TAG-72(tumor-associated glycoprotein 72), 흑색종 등에서 과발현되는 GD3(disialoganglioside), 혈액암, 고형암 등에서 과발현되는 HLA-DR(human leukocyte antigen-DR), 진행성 고형암 등에서 과발현되는 MUC1(Mucin 1), 진행성 폐암(advanced non-small-cell lung cancer) 등에서 과발현되는 NY-ESO-1(New York esophageal squamous cell carcinoma 1), 비인두종양(Nasopharyngeal neoplasms) 등에서 과발현되는 LMP1(Latent membrane protein 1), 폐암, 비호지킨 림프종, 난소암, 결장암, 대장암, 췌장암 등에서 과발현되는 TRAILR2(tumor-necrosis factor-related apoptosis-inducing ligand receptor), 혈관 신생 인자 수용체인 VEGFR2(vascular endothelial growth factor receptor 2), 간세포암 등에서 과발현되는 HGFR(hepatocyte growth factor receptor) 등이 표적분자일 수 있으며, 또한 암 줄기세포의 표면 항원인 CD44, CD166 등이 또한 표적 분자일 수 있다. Such antigen or receptor preferably refers to an antigen or receptor that is expressed only in cancer cells or is overexpressed in cancer cells compared to normal cells. For example, epidermal growth factor receptor variant III (EGFRvIII) expressed in glioblastoma, epidermal growth factor receptor (EGFR) overexpressed in anaplastic thyroid cancer, breast cancer, lung cancer, glioma, etc., papillary thyroid cancer ) overexpressed metastin receptor, ErbB receptor tyrosine kinases overexpressed in breast cancer, breast cancer, bladder cancer, gallbladder cancers, cholangiocarcinomas, esophagogastric HER2 (Human epidermal growth factor receptor 2) overexpressed in junction cancers, etc., tyrosine kinase-18-receptor (c-Kit) overexpressed in nutritive renal carcinoma, etc., HGF receptor c-Met overexpressed in esophageal adenocarcinoma, etc., in breast cancer, etc. CXCR4 or CCR7 overexpressed, endothelin-A receptor overexpressed in prostate cancer, peroxisome proliferator activated receptor δ (PPAR-δ) overexpressed in rectal cancer, platelet-derived growth factor receptor α (PDGFR-α) overexpressed in ovarian cancer, etc.; CD133 overexpressed in liver cancer, multiple myeloma, etc., carcinoembryonic antigen (CEA) overexpressed in lung cancer, colorectal cancer, stomach cancer, pancreatic cancer, breast cancer, rectal cancer, colon cancer, medullary thyroid cancer, etc., and EpCAM overexpressed in liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, breast cancer, etc. (Epithelial cell adhesion molecule), MSLN (Mesothelin) overexpressed in lung cancer, breast cancer, pancreatic cancer, ovarian cancer, etc., GD2 (disialoganglioside) overexpressed in neuroblastoma, hepatocellular carcinoma GPC3 (Glypican 3) overexpressed in follicular cancer, PSMA (Prostate Specific Membrane Antigen) overexpressed in prostate cancer, etc., TAG-72 (tumor-associated glycoprotein 72) overexpressed in ovarian cancer, breast cancer, colon cancer, lung cancer and pancreatic cancer, melanoma, etc. Overexpression in GD3 (disialoganglioside) overexpressed, human leukocyte antigen-DR (HLA-DR) overexpressed in blood cancer and solid cancer, MUC1 (Mucin 1) overexpressed in advanced solid cancer, and advanced non-small-cell lung cancer LMP1 (Latent membrane protein 1) overexpressed in NY-ESO-1 (New York esophageal squamous cell carcinoma 1), nasopharyngeal neoplasms, lung cancer, non-Hodgkin's lymphoma, ovarian cancer, colon cancer, colorectal cancer, pancreatic cancer, etc. Target molecules may include overexpressed tumor-necrosis factor-related apoptosis-inducing ligand receptor (TRAILR2), vascular endothelial growth factor receptor 2 (VEGFR2), overexpressed hepatocyte growth factor receptor (HGFR), etc. In addition, CD44, CD166, etc., which are surface antigens of cancer stem cells, may also be target molecules.
당업계에는 정상세포에 비해 암세포에서 과발현되는 많은 표적분자가 알려져 있으며, 상기 예시된 것 이외의 기타의 표적분자와 관련해서 더 구체적인 것은 문헌[Anne T Collins et al. Prospective Identification of Tumorigenic Prostate Cancer Stem Cells. Cancer Res. 2005 Dec 1;65(23):10946-51], 문헌[Chenwei Li et al. Identification of Pancreatic Cancer Stem Cells. Cancer Res. 2007 Feb 1;67(3):1030-7], 문헌[Shuo Ma et al. Current Progress in CAR-T Cell Therapy for Solid Tumors. Int J Biol Sci. 2019 Sep 7;15(12):2548-2560], 문헌[Dhaval S Sanchala et al. Oncolytic Herpes Simplex Viral Therapy: A Stride Toward Selective Targeting of Cancer Cells. Front Pharmacol. 2017 May 16;8:270] 등을 참조할 수 있다. Many target molecules are known in the art that are overexpressed in cancer cells compared to normal cells, and more specific target molecules other than those exemplified above are described in Anne T Collins et al. Prospective Identification of Tumorigenic Prostate Cancer Stem Cells. Cancer Res. 2005 Dec 1;65(23):10946-51], Chenwei Li et al. Identification of Pancreatic Cancer Stem Cells. Cancer Res. 2007 Feb 1;67(3):1030-7], Shuo Ma et al. Current Progress in CAR-T Cell Therapy for Solid Tumors. Int J Biol Sci. 2019 Sep 7;15(12):2548-2560], Dhaval S Sanchala et al. Oncolytic Herpes Simplex Viral Therapy: A Stride Toward Selective Targeting of Cancer Cells. Front Pharmacol. 2017 May 16;8:270] and the like.
본 발명에서, 표적화 영역은 암세포의 표적분자를 특이적으로 인식하여 결합하는 부분으로서, 항체, 항체 유도체, 항체 유사체 또는 압타머이다. In the present invention, the targeting region is a portion that specifically recognizes and binds to a target molecule of a cancer cell, and is an antibody, an antibody derivative, an antibody analog, or an aptamer.
상기 항체는 표적분자와 특이적 결합능을 가지는 완전한 항체 이외에도 항체 유도체, 항체 유사체일 수 있다. 항체 유도체는 표적분자와 특이적 결합능을 가지는 항체 가변 영역을 적어도 하나 이상 포함하는 완전한 항체의 단편 또는 변형 항체을 의미한다. 이러한 항체 유도체로서는 Fab, scFv, Fv, VhH, VH, VL 등의 항체 단편, Fab2, Fab3, 미니바디, 디아바디, 트리바디, 테트라바디, 비스-scFv 등의 다가성 또는 다중특이적 변형 항체 등을 들 수 있다. 항체 유사체는 항체와 마찬가지로 표적분자와 특이적 결합능을 갖지만 구조상 항체와는 다르고 일반적으로 항체보다 낮은 분자량을 갖는 인위적 펩티드 또는 폴리펩티드를 의미한다. 이러한 항체 유사체로서 ABD, 애드히론 (adhiron), 애피바디(affibody), 애필린(affilin), 애피머(affimer), 알파바디(alphabody), 안티칼린(anticalin), 아르마딜로(armadillo) 반복 단백질, 센티린 (centyrin), 달핀(DARPin), 피노머(fynomer), Kunitz 영역, 프로넥틴 (pronectin), 리피바디(repebody) 등을 들 수 있다.The antibody may be an antibody derivative or an antibody analog in addition to a complete antibody having specific binding ability with a target molecule. An antibody derivative refers to a fragment of a complete antibody or a modified antibody comprising at least one antibody variable region having specific binding ability with a target molecule. Examples of such antibody derivatives include antibody fragments such as Fab, scFv, Fv, VhH, VH, and VL; polyvalent or multispecific modified antibodies such as Fab2, Fab3, minibody, diabody, tribody, tetrabody, bis-scFv, etc. can be heard Antibody analog refers to an artificial peptide or polypeptide having specific binding ability with a target molecule like an antibody, but having a structure different from an antibody and generally having a lower molecular weight than an antibody. Such antibody analogs include ABD, adhron, affibody, affilin, affimer, alphabody, anticalin, armadillo repeat protein, centimeter. Lin (centyrin), dalpin (DARPin), pinomer (fynomer), Kunitz region, pronectin (pronectin), repeat body (repebody) and the like.
이러한 항체, 항체 유도체, 항체 유사체, 그 제조와 관련해서는 당업계에 상당히 많은 문헌이 축적되어 있으며, 그러한 문헌으로서는 예컨대 문헌[Renate Kunert & David Reinhart, Advances in recombinant antibody manufacturing. Appl Microbiol Biotechnol. 2016 Apr;100(8):3451-61], 문헌[Holliger P1, Hudson PJ., Engineered antibody fragments and the rise of single domains, Nat Biotechnol. 2005 Sep;23(9):1126-36], 문헌[Xiaowen Yu et al., Beyond Antibodies as Binding Partners: The Role of Antibody Mimetics in Bioanalysis, Annual Review of Analytical Chemistry, 2017, 10:293-320], 문헌[Abdul Rasheed Baloch et al., Antibody mimetics: promising complementary agents to animal-sourced antibodies, Critical Reviews in Biotechnology, 2016, 36:268-275] 등을 들 수 있다.A considerable amount of literature has been accumulated in the art with respect to such antibodies, antibody derivatives, antibody analogs, and their manufacture, and such literatures include, for example, Renate Kunert & David Reinhart, Advances in recombinant antibody manufacturing. Appl Microbiol Biotechnol. 2016 Apr; 100(8):3451-61], Holliger P1, Hudson PJ., Engineered antibody fragments and the rise of single domains, Nat Biotechnol. 2005 Sep;23(9):1126-36], Xiaowen Yu et al., Beyond Antibodies as Binding Partners: The Role of Antibody Mimetics in Bioanalysis, Annual Review of Analytical Chemistry, 2017, 10:293-320, Abdul Rasheed Baloch et al., Antibody mimetics: promising complementary agents to animal-sourced antibodies, Critical Reviews in Biotechnology, 2016, 36:268-275, and the like.
세포 표적화 영역으로서의 항체는 기존에 개발되어 판매되고 있는 항체 예컨대 세툭시맙(Cetuximab), 트라스투주맙(Trastuzumab), 오레고보맙(Oregovomab), 에드레콜로맙(Edrecolomab),　알렘투주맙(Alemtuzumab), 라베투주맙(Labetuzumab), 베바시주맙(Bevacizumab), 이브리투모맙(Ibritumomab), 오파투무맙(Ofatumumab), 파니투무맙(Panitumumab), 리툭시맙(Rituximab), 토시투모맙(Tositumomab), 이필리무맙(Ipilimumab), 겜투주맙(Gemtuzumab), 브렌투시맙(Brentuximab), 베다스툭시맙(Vadastuximab), 글렙바투무맙(Glembatumumab), 데파투시주맙(Depatuxizumab), 폴라투주맙(Polatuzumab), 데닌투주맙(Denintuzumab) 등을 사용할 수도 있다. Antibodies as a cell targeting region include antibodies that have been developed and sold in the past, such as Cetuximab, Trastuzumab, Oregovomab, Edrecolomab, Alemtuzumab. , Labetuzumab, Bevacizumab, Ibritumomab, Ofatumumab, Panitumumab, Rituximab, Tositumomab , Ipilimumab, Gemtuzumab, Brentuximab, Vadastuximab, Glebatumumab, Depatuxizumab, Polatuzumab , Denintuzumab, etc. may be used.
항체의 제조 방법, 천연 항체에 인위적 변형을 가하여 표적 항원에 대한 특이성을 항상시키거나 면역원성을 개선시킨 항체 등과 관련해서는 당업계에 공지된 다양한 문헌 예컨대 미국 특허 4,444,887, 미국 특허 4,716,111, 미국 특허 5,545,806, 미국 특허 5,814,318, 국제 공개특허 WO 98/46645, 국제 공개특허 WO 98/50433, 국제 공개특허 WO 98/24893, 국제 공개특허 WO 98/16654, 국제 공개특허 WO 96/34096, 국제 공개특허 WO 96/33735, 문헌[Protein Eng 1994, 7(6):805-814], 문헌[Proc Natl Acad Sci U S A 1994, 91:969-973] 등을 참조할 수 있다.Various documents known in the art, such as U.S. Patent 4,444,887, U.S. Patent 4,716,111, U.S. Patent 5,545,806, US Patent 5,814,318, International Patent Publication WO 98/46645, International Patent Publication WO 98/50433, International Patent Publication WO 98/24893, International Patent Publication WO 98/16654, International Patent Publication WO 96/34096, International Patent Publication WO 96/ 33735, Protein Eng 1994, 7(6):805-814, Proc Natl Acad Sci USA 1994, 91:969-973, and the like.
본 발명에서 표적화 영역으로서의 압타머는 단일가닥 DNA 압타머 또는 단일가닥 RNA 압타머일 수 있다. 압타머는 항체와 마찬가지로 표적 항원 등 표적분자에 특이적으로 결합할 수 있는 핵산 리간드를 의미하는데, 표적분자와 특이적으로 결합할 수 있다면, 압타머는 이중가닥 DNA 또는 RNA 압타머일 수도 있다. 이러한 표적분자와의 특이적 결합할 수 있는 압타머의 제조, 선별 방법 등은 모두 당업계에 공지되어 있으며, 특히 SELEX 기술이나 이 SELEX 기술을 개량한 기술 예컨대 표적분자와의 특이성을 높이기 위한 Counter-SELEX 기술(Science 263(5152):1425-1429, 1994), 표적분자와 압타머의 거울상 이성질체를 이용하는 Spiegelmer 기술(Chem Biol 9(3):351-359, 2002) 등을 이용할 수 있다. 상기 SELEX 기술은 "Systematic Evolution of Ligands by EXponential enrichment"의 준말로 이름 붙여진 기술로, 해당 기술에 대해서는 문헌Science 249 (4968):505-510, 1990, 미국 등록특허 제5,475,096, 미국 특허등록 제5,270,163호, 국제특허공개 WO 91/19813 등을 참조할 수 있으며, 압타머의 선별을 위한 구체적인 방법이나 적절한 시약, 재료 등의 사용에 대해서는 문헌Methods Enzymol 267:275-301, 1996, 문헌Methods Enzymol 318:193-214, 2000 등을 참조할 수 있다. 압타머는 생체 내 반감기 향상을 위하여 당, 포스페이트 및/또는 염기에서 변형된 것일 수 있다. 이러한 당, 포스페이트 및/또는 염기에서 변형된 뉴클레오티드는 당업계에 그 제조방법을 포함하여 구체적으로 공지되어 있다. 예컨대 당에서 변형된 뉴클레오티드는, 그 당의 하이드록실 기(2'-OH group)가 할로겐 기(특히 불소(F)), 지방족 기, 에테르 기, 아민 기로 수식되거나 특히 OMe, O-알킬, O-알릴, S-알킬, S-알릴 또는 할로겐 등으로 수식된 것, 당인 리보스 또는 디옥시 리보오스 자체가 이를 대신할 수 있는 당 유사체 α-아노머 당(α-anomeric sugars), 아라비노스(arabinose), 자일로스(xyloses) 또는 릭소오스(lyxoses)와 같은 에피머 당(epimeric sugars), 피라노오스 당(pyranose sugars), 퓨라노오스 당(furanose sugars) 등으로 치환된 것을 들 수 있다. 또한 예컨대 포스페이트에서의 변형은 포스페이트가 P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO 또는 CH2(formacetal)로의 변형된 것 등을 들 수 있다. 여기서 상기 R 또는 R'는 H 또는 치환되거나 치환되지 않은 알킬 등이며, 포스페이트에서 변형될 경우 그 연결기는 -O-, -N-, -S- 또는 -C-가 되어, 이러한 연결기를 통해 인접 뉴클레오티드가 서로 결합하게 된다. In the present invention, the aptamer as the targeting region may be a single-stranded DNA aptamer or a single-stranded RNA aptamer. The aptamer refers to a nucleic acid ligand capable of specifically binding to a target molecule, such as a target antigen, like an antibody. If it can specifically bind to a target molecule, the aptamer may be a double-stranded DNA or RNA aptamer. The preparation and selection methods of the aptamer capable of specific binding to the target molecule are all known in the art, and in particular, the SELEX technology or a technology improved this SELEX technology, such as Counter- to increase specificity with the target molecule SELEX technology (Science 263(5152):1425-1429, 1994), Spiegelmer technology using enantiomers of a target molecule and an aptamer (Chem Biol 9(3):351-359, 2002), etc. can be used. The SELEX technology is a technology named as an abbreviation of "Systematic Evolution of Ligands by EXponential enrichment", and the technology is described in Documents Science 249 (4968):505-510, 1990, U.S. Patent No. 5,475,096, U.S. Patent No. 5,270,163 , International Patent Publication No. WO 91/19813, etc. may be referred to, and for specific methods for the selection of aptamers or the use of appropriate reagents, materials, etc., Methods Enzymol 267:275-301, 1996, Methods Enzymol 318:193 -214, 2000, etc. may be referred to. The aptamer may be modified with sugar, phosphate and/or base to improve half-life in vivo. Nucleotides modified in such sugars, phosphates and/or bases are specifically known in the art, including methods for their preparation. Nucleotides modified in sugars, for example, are those in which the hydroxyl group (2'-OH group) of the sugar is modified with a halogen group (especially fluorine (F)), an aliphatic group, an ether group, an amine group, or in particular OMe, O-alkyl, O- Those modified with allyl, S-alkyl, S-allyl or halogen, etc., sugar analogues α-anomeric sugars, arabinose, in which the sugar ribose or deoxyribose itself can replace it; and epimeric sugars such as xylose or lyxoses, pyranose sugars, furanose sugars, and the like. Also, for example, modifications in the phosphate can be modified so that the phosphate is P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO or those modified with formacetal (CH2). wherein R or R' is H or substituted or unsubstituted alkyl, etc., and when modified in phosphate, the linking group becomes -O-, -N-, -S- or -C-, so that adjacent nucleotides through this linking group will combine with each other.
압타머는 그것이 표적분자와 결합하는 부위나 그 결합 부위 이외의 다른 부위에서 하나 이상의 뉴클레오티드의 부가, 치환이나 결손되더라도 또 그 압타머 양단(兩端)에서 화학적으로 수식되거나 다른 서열이 부가되더라도 그것의 표적분자와의 결합능은 변하지 않거나, 결합능이 낮아지더라도 유지될 수 있음이 당업계에 잘 알려져 있기 때문에(Molecules. 2020 Jan; 25(1):3; Int J Mol Sci. 2017 Aug; 18(8):1683), 하나 이상의 뉴클레오티드의 부가, 치환, 결손되거나 그 양단 중 어나 하나의 이상의 말단이 수식된 것일 수 있다.An aptamer is its target even if one or more nucleotides are added, substituted, or deleted at the site where it binds to the target molecule or at sites other than the binding site, and even if it is chemically modified or other sequences are added at both ends of the aptamer. Since it is well known in the art that the binding capacity with a molecule does not change or can be maintained even if the binding capacity is lowered (Molecules. 2020 Jan; 25(1):3; Int J Mol Sci. 2017 Aug; 18(8)) :1683), one or more nucleotides are added, substituted, deleted, or one or more ends of both ends are modified.
이러한 압타머는 SELEX 기술 등 당업계에 공지된 방법에 따라 임의의 표적분자에 대해 새로이 선별, 증폭, 분리·정제하거나 화학적으로 합성하여 사용할 수 있고, 필요에 따라서는 아래 표 1과 제시된 바의, 기존에 알려진 공지 서열의 압타머를 이용할 수도 있다.These aptamers can be newly selected, amplified, separated, purified, or chemically synthesized for any target molecule according to methods known in the art, such as SELEX technology, and, if necessary, as shown in Table 1 below, It is also possible to use an aptamer of a known sequence.
표적분자와 RNA 압타머의 서열Sequence of target molecule and RNA aptamer
표적분자target molecule Aptamer sequence(5’ → 3’) Aptamer sequence(5’ → 3’) 서열번호SEQ ID NO:
AMPA receptor GluR2QflipAMPA receptor GluR2Qflip GGGCGAAUUCAACUGCCAUCUAGGCAGUAACCAGGAGUUAGUAGGACAAGUUUCGUCCGGGCGAAUUCAACUGCCAUCUAGGCAGUAACCAGGAGUUAGUAGGACAAGUUUCGUCC 1 One
CD4 CD4
CUCAGACAGAGCAGAAACGACAGUUCAAGCCGAA CUCAGACAGAGCAGAAACGACAGUUCAAGCCGAA 22
CTLA-4CTLA-4 GGGAGAGAGGAAGAGGGAUGGGCCGACGUGCCGCAACUUCAACCCUGCACAACCAAUCCGCCCAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC GGGAGAGAGGAAGAGGGAUGGGCCGACGUGCCGCAACUUCAACCCUGCACAACCAAUCCGCCCAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC 33
EGFR(E07) EGFR (E07) UGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG UGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG 44
GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGCp3 GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGCp3 55
EGFR(J18) EGFR (J18) GGCGCUCCGACCUUAGUCUCUGCAAGAUAAACCGUGCUAUUGACCACCCUCAACACACUUAUUUAAUGUAUUGAACGGACCUACGAACCGUGUAGCACAGCAGA GGCGCUCCGACCUUAGUCUCUGCCAAGAUAAACCGUGCUAUUGACCACCCUCAACACACUUAUUUAAUGUAUUGAACGGACCUACGAACCGUGUAGCACAGCAGA 66
EGFRvIII(E17) EGFRvIII (E17) ACCAAAAUCAACGCAAAGAGCGCGCCUGCACGUCACCUCA ACCAAAAUCAACGCAAAGAGCGCGCCUGCACGUCACCUCA 77
Erythrocyte membrane protein1(PfEMP1)Erythrocyte membrane protein1 (PfEMP1) GGGAAUUCGACCUCGGUACCAACAAUACGACUACACCAUCAAAAGUAUUAUCUUGCAUCGAAGGUUGGCGUAGCAAGCUCUGCAGUCG GGGAAUUCGACCUCGGUACCAACAAUACGACUACACCAUCAAAAGUAUUAUCUUGCAUCGAAGGUUGGCGUAGCAAGCUCUGCAGUCG 88
gp120 gp120 GGGAGACAAGACUAGACGGUGAAUGUGGGCCACGCCCGAUUUUACGC UUUUACCCGCACGCGAUUGGUUUGUUUCCCGGGAGACAAGACUAGACGGUGAAUGUGGGCCACGCCCGAUUUUACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCC 99
HER2 HER2 AGC CGCGAGGGGAGGGAAGGGTAGGGCGCGGCTAGCCGCGAGGGGAGGGAAGGGTAGGGCGCGGCT 1010
HER3 HER3 GGGAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCCUCGGGAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCCUC 1111
Human keratinocyte growth factorHuman keratinocyte growth factor CCCAGGACGAUGCGGUGGUCUCC CAAUUCUAAACUUUCUCCAUCGUAUCUGGG CCCAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGG 1212
GGGAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGCAGACGACUCGCCCGAGGGAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGCAGACGACUCGCCCGA 1313
L-selectinL-selectin UAACAACAAU CAAGGCGGGUUCACCGCCCCAGUAUGAGUA UAACAACAAUCAAGGCGGGUUCACCGCCCCAGUAUGAGUA 1414
Neruotensin-1(NTS-1) Neruotensin-1 (NTS-1) ACAGATACGGAACTACAGAGGTCAATTACGGTGGCCACGC ACAGATACGGAACTACAGAGGTCAATTACGGTGGCCACGC 1515
NF-κB NF-κB CAUACUUGAAACUGUAAGGUUGGCGUAUG CAUACUUGAAACUGUAAGGUUGGCGUAUG 1616
Phosphatidylcholine: cholesterol liposomesPhosphatidylcholine: cholesterol liposomes GGGAUCUACACGUGACUGACUUACGAGACUGUCUCGCCAAUUCCAGUGGGCCUGCGGAUCCUGGGAUCUACACGUGACUGACUUACGAGACUGUCUCGCCAAUUCCAGUGGGCCUGCGGAUCCU 1717
PSMA(A10) PSMA (A10) GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGCAGACUCGCCCGAGGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGCAGACUCGCCCGA 1818
Raf-1 Raf-1 GGGAGAUCGAAUAAACGCUCAAUUUGCCUCGACGGUCUGCGAAUAGAACGCGAACCGUGAUUAGUGUACAAGGAUUCGGUUUUCGACAUGAGGCCCCUGCAGGGCGGGGAGAUCGAAUAAACGCUCAAUUUGCCUCGACGGUCUGCGAAUAGAACGCGAACCGUGAUUAGUGUACAAGGAUUCGGUUUUCGACAUGAGGCCCCUGCAGGGCG 1919
RET receptor tyrosine kinase RET receptor tyrosine kinase GCGCGGGAATAGTATGGAAG GATACGTATACCGTGCAATCCAGGGCAACG GCGCGGGAATAGTATGGAAGGATACGTATACCGTGCAATCCAGGGCAACG 2020
TCF-1 TCF-1 GGGGAGCUCGGUACCGGUGCGAUCCCCUGUUUACAUUGCAUGCUAGGACGACGCGCCCGAGCGGGUACCGAUUGUGUCGUCGGAAGCUUUGCAGAGGAUCGGGGAGCUCGGUACCGGUGCGAUCCCCUGUUUACAUUGCAUGCUAGGACGACGCGCCCGAGCGGGUACCGAUUGUGUCGUCGGAAGCUUUGCAGAGGAUC 2121
Tenascin-C(AptamerTTA1) Tenascin-C (AptamerTTA1) GGGAGGACGCGUCGCCGUAAUGGAUGUUUUGCUCCCUG GGGAGGACGCGUCGCCGUAAUGGAUGUUUUGCUCCCUG 2222
TGF-β type III receptor TGF-β type III receptor GGGCCAGGCAGCGAGAGAUAAGCAGAAGAAGUAUGUGACCAUGCUCCAGAGAGCAACUUCACAUGCGUAGCCAAACCGACCACACGCGUCCGAGAGGGCCAGGCAGCGAGAGAUAAGCAGAAGAAGUAUGUGACCAUGCUCCAGAGAGCAACUUCACAUGCGUAGCCAAACCGACCACACGCGUCCGAGA 2323
Tumor necrosis factor superfamily member 4-1BBTumor necrosis factor superfamily member 4-1BB GGGAAGAGAGGAAGAGGGAUGGGCGACCGAACGUGCCCUUCAAAGCCGUUCACUAACCAGUGGCAUAACCCAGAGGUCGAUAGUACUGGUCCCCCCGGGAAGAGAGGAAGAGGGAUGGGCGACCGAACGUGCCCUUCAAAGCCGUUCACUAACCAGUGGCAUAACCCAGAGGUCGAUAGUACUGGUCCCCCC 2424
Tumor necrosis factor superfamily member OX40Tumor necrosis factor superfamily member OX40 GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUU CCCACCAGACGACUCGCUGAGGAUCCGAGAGGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCAGACGACUCGCUGAGGAUCCGAGA 2525
VEGF VEGF CGGAAUCAGUGAAUGCUUAUACAUCCG CGGAAUCAGUGAAUGCUUAUACAUCCG 2626
Wilms tumor protein(WT1)Wilms tumor protein (WT1) GAUAUGGUGACCACCCCGGCGAUAUGGUGACCACCCCGGC 2727
αvβ3 integrin αvβ3 integrin GGGAGACAAGAAUAAACGCUCAAUUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCCUUCGACAGGAGGCUCACAAAAGGCGGGAGACAAGAAUAAACGCUCAAUUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCCUUCGACAGGAGGCUCACAAAAGGC 2828
β-catenin β-catenin GGACGCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUCGGACCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC 2929
MUC1(DNA)MUC1 (DNA) GCAGTTGATCCTTTGGATACCCTGGGCAGTTGATCCTTTGGATACCCTGG 3030
EpCAMEpCAM GCGACUGGUUACCCGGUCGGCGACUGGUUACCCGGUCG 3131
BAFFBAFF GGGAGGACGAUGCGGGAGGCUCAACAAUGAUAGAGCCCGCAAUGUUGAUAGUUGUGCCCAGUCUGCAGACGACUCGCCCGA′GGGAGGACGAUGCGGGAGGCUCAACAAUGAUAGAGCCCGCAAUGUUGAUAGUUGUGCCCAGUCUGCAGACGACUCGCCCGA′ 3232
Endothelial Integrin Alpha-V Beta-3Endothelial Integrin Alpha-V Beta-3 UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCCUUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC 3333
Osteopontin Osteopontin CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUGCGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG 3434
Receptor Tyrosine Kinase(RET) Mutant(D4)Receptor Tyrosine Kinase (RET) Mutant (D4) GCGCGGGAAUAGUAUGGAAGGAUACGUAUACCGUGCAAUCCAGGGCAACGGCGCGGGAAUAGUAUGGAAGGAUACGUAUACCGUGCAAUCCAGGGCAACG 3535
PSMA Aptamer(A10-3) PSMA Aptamer (A10-3) GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGCGGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC 3636
P-Selectin P-Selectin ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC'ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC' 3737
Carcinoembryonic Antigen AptamerCarcinoembryonic Antigen Aptamer GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU'GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU' 3838
본 발명의 핵산 기반 항암제에서, 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 또는 RNA 핵산이 표적화 영역과 결합되어 표적화 기능을 가지도록 제조될 때, 상기 DNA 또는 RNA 핵산은 그 표적화 영역과 링커의 매개 없이 직접 서로 공유적으로 또는 비공유적으로 결합하거나 링커를 매개로 공유적으로 결합할 수 있다. In the nucleic acid-based anticancer agent of the present invention, when a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analog to which an anticancer agent is bound is integrated is combined with a targeting region to have a targeting function, the DNA or RNA nucleic acid is combined with the targeting region They may be directly covalently or non-covalently bound to each other without the mediation of a linker, or may be covalently bound to each other via a linker.
표적화 영역이 단일가닥의 DNA 또는 RNA 압타머일 경우, 항암제가 결합된 DNA 또는 RNA 핵산의 5' 말단 영역이나 3' 말단 영역에 이러한 압타머가 상보적으로 결합하도록 그 말단 영역의 서열을 설계, 제작하여 비공유적인 상보적 수소결합으로 결합시킬 수 있다. When the targeting region is a single-stranded DNA or RNA aptamer, the sequence of the end region is designed and manufactured so that the aptamer complementarily binds to the 5' end region or 3' end region of the DNA or RNA nucleic acid to which the anticancer drug is bound. They can be bound by non-covalent complementary hydrogen bonds.
표적화 영역이 단일가닥의 DNA 또는 RNA 압타머일 경우, 이러한 압타머에, 항암제가 결합된 DNA 또는 RNA 핵산을, 당업계에 공지된, 기질에 따른 적절한 리가제(ligase)인 T4 DNA 리가제, T4 RNA 리가제 등을 사용하여 공유적으로 결합시킬 수도 있다. 이 경우 압타머의 표적분자와의 결합능이 이에 결합하는 DNA 또는 RNA 핵산에 의하여 영향을 받지 않도록 수개 또는 수십개의 뉴클레오티드로 이루어진 스페이서(spacer)를 게재시킬 수도 있다. When the targeting region is a single-stranded DNA or RNA aptamer, the DNA or RNA nucleic acid to which the anticancer agent is bound to the aptamer, T4 DNA ligase, T4, which is an appropriate ligase depending on the substrate, known in the art It can also be covalently linked using RNA ligase or the like. In this case, a spacer consisting of several or tens of nucleotides may be placed so that the binding ability of the aptamer to the target molecule is not affected by the DNA or RNA nucleic acid binding thereto.
본 발명의 핵산 기반 항암제에서, 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 DNA 또는 RNA 핵산이 표적화 영역과 결합하여 표적화 기능을 가질 때, 그 표적화 영역은 링커를 매개로 상기 DNA 또는 RNA 핵산과 공유결합할 수도 있다.In the nucleic acid-based anticancer agent of the present invention, when a DNA or RNA nucleic acid in which one or more molecules of a nucleotide analogue to which an anticancer agent is bound is integrated has a targeting function by binding to a targeting region, the targeting region is the DNA or RNA nucleic acid through a linker. may be covalently bonded to
본 발명에서 링커는 표적화 영역인 항체, 항체 유도체, 항체 유사체 등의 단백질의 아민기(amine group), 카르복시기(carboxyl group) 또는 설프히드릴기(sulfhydryl group)나 압타머 등의 핵산의 인산기(phosphate group), 히드록시기(hydroxyl group)를 통해 결합할 수 있는 작용기를 가진 임의의 링커를 사용할 수 있다.In the present invention, the linker is an amine group, a carboxyl group, or a sulfhydryl group or a phosphate group of a nucleic acid such as an aptamer of a protein such as an antibody, an antibody derivative, or an antibody analog, which is a targeting region. group), any linker having a functional group capable of bonding through a hydroxyl group may be used.
이러한 링커의 작용기는 전술한 바와 같이 아이소티오시아네이트(isothiocyanate), 아이소시아네이트(isocyanates), 아실 아자이드(acyl azide), NHS 에스터(NHS ester), 설포닐 클로라이드(sulfonyl chloride), 알데하이드(aldehyde), 글리옥살(glyoxal), 에폭사이드(epoxide), 옥시레인(oxirane), 칼보네이트(carbonate), 아릴 할라이드(aryl halide), 이미도에스터(imidoester), 카보이미드(carbodiimide), 안하이드라이드(anhydride), 플루오로페닐 에스터(fluorophenyl ester), 히드록시메틸포스핀(hydroxymethyl phosphine), 말레이미드(maleimide), 할로아세틸(haloacetyl), 피리딜디설파이드(pyridyldisulfide), 티오술포네이트(thiosulfonate), 또는 비닐술폰(vinylsulfone) 등일 수 있다. The functional groups of these linkers are isothiocyanate, isocyanates, acyl azide, NHS ester, sulfonyl chloride, aldehyde, as described above. , glyoxal, epoxide, oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride , fluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, or vinylsulfone ( vinylsulfone) and the like.
링커는 전술한 바와 같이 절단 가능한 링커이거나 절단 가능하지 않은 링커일 수 있다. The linker may be a cleavable linker as described above or a non-cleavable linker.
링커는 또한 자가 희생 링커(self-immolative linker) 또는 절단 후 흔적을 남기지 않는 링커(traceless linker)일 수 있다. The linker may also be a self-immolative linker or a traceless linker after cleavage.
링커는 또한 동종 이작용성 링커(둘 이상의 동일한 반응성 작용기를 갖는 링커) 또는 이종 이작용성 링커(둘 이상의 서로 다른 반응성 작용기를 갖는 링커)일 수도 있다. A linker may also be a homobifunctional linker (a linker having two or more identical reactive functional groups) or a heterobifunctional linker (a linker having two or more different reactive functional groups).
링커는 또한 수지 유형(dendritic type)의 링커일 수도 있다.The linker may also be a dendritic type of linker.
이들 링커의 구체적인 예와 관련해서는 전술한 바를 참조할 수 있다.For specific examples of these linkers, reference may be made to the foregoing.
본 발명에서 세포독성 항암제는 대사길항제(Antimetabolites), 미세관(microtubulin) 표적화제(Tubulin polymerase inhibitor 및 Tubulin depolymerisation), 알킬화제(Alkylating agents), 유사분열 억제제(Antimitotic Agents), DNA 절단제(DNA cleavage agent), DNA 가교제(DNA cross-linker agent), DNA 인터컬레이터제(DNA intercalator agents), DNA 토포아이소머라아제 억제제(DNA topoisomerase inhibitor) 등으로 대별될 수 있는데, 대사길항제로서는 메토트렉세이트(Methotrexate) 등의 폴산(Folic acid) 유도체, 클라드리빈(Cladribine) 등의 퓨린(Purine) 유도체, 아자시티딘(Azacitidine) 등의 피리미딘(pyrimidine) 유도체, 독시플루리딘(Doxifluridine), 플루오로우라실(Fluorouracil) 등이 당업계에 공지되어 있고, 미세관 표적화제로서는 모노메틸아우리스타틴 E(MMAE), 모노메틸아우리스타틴 F(MMAF), 돌라스타틴 등의 아우리스타틴 계열의 약물, 메이탄신(Maytansines) 등이 당업계에 공지되어 있으며, 알킬화제로서는 부설판(Busulfan), 트레오설판(Treosulfan) 등의 알킬 설포네이트(Alkyl Sulfonate) 제제, 벤다머스틴(Bendamustine) 등의 니트로젠 머스타드(Nitrogen Mustard) 유도체, 시스플라틴(Cisplatin), 헵타플라틴(Heptaplatin) 등의 플라티늄(Platinum) 제제 등이 당업계에 공지되어 있다. 또 유사분열 억제제(Antimitotic Agents)로서는 도세탁셀(Docetaxel), 파크리탁셀(Paclitaxel) 등의 탁산(Taxane) 제제, 빈플루닌(Vinflunine) 등의 빈카 알칼리드(Vinca alkalids), 에토포시드(Etoposide) 등의 포도필로톡신(Podophyllotoxin) 유도체 등이 당업계에 공지되어 있고, DNA 절단제(DNA cleavage agent)로서는 칼리채미신(Calicheamicins) 등이 공지되어 있으며, DNA 가교제(DNA cross-linker agent)로서는 PBD 이중체 등이 공지되어 있다. 또 DNA 인터컬레이터제로서는 독소루비신 등이 당업계에 공지되어 있으며 DNA 토포아이소머라아제 억제제로서는 SN-28 등이 당업계에 공지되어 있다.In the present invention, the cytotoxic anticancer agent is an anti-metabolites, microtubulin targeting agents (Tubulin polymerase inhibitor and tubulin depolymerisation), alkylating agents, antimitotic agents, DNA cleavage agents ), DNA cross-linker agents, DNA intercalator agents, and DNA topoisomerase inhibitors. Folic acid derivatives, Purine derivatives such as Cladribine, pyrimidine derivatives such as Azacitidine, Doxifluridine, Fluorouracil and the like are known in the art, and as microtubule targeting agents, auristatin-based drugs such as monomethylauristatin E (MMAE), monomethylauristatin F (MMAF), and dolastatin, maytansines and the like are known in the art, and examples of the alkylating agent include alkyl sulfonate preparations such as Busulfan and Treosulfan, nitrogen Mustard derivatives such as Bendamustine, Platinum preparations such as Cisplatin and Heptaplatin are known in the art. In addition, as Antimitotic Agents, Taxane preparations such as Docetaxel and Paclitaxel, Vinca alkalids such as Vinflunine, and Etoposide Podophyllotoxin derivatives and the like are known in the art, and Calicheamicins are known as a DNA cleavage agent, and PBD as a DNA cross-linker agent. duplexes and the like are known. Also, as a DNA intercalator agent, doxorubicin and the like are known in the art, and as a DNA topoisomerase inhibitor, SN-28 and the like are known in the art.
본 발명의 핵산 기반 항암제는 생체 내 안정성, 반감기의 향상을 위하여 페길화(PEGylation)될 수 있다. 페길화되는 부위는 본 발명의 핵산 기반 항암제나 그 표적화 항암제에서 핵산이나 압타머의 노출된 말단(즉 5' 말단 및/또는 3' 말단)일 수 있다. The nucleic acid-based anticancer agent of the present invention may be PEGylated to improve in vivo stability and half-life. The site to be pegylated may be the exposed end (ie, the 5' end and/or the 3' end) of the nucleic acid or aptamer in the nucleic acid-based anticancer agent of the present invention or the targeted anticancer agent thereof.
페길화는 그 화화식이 H(OCH2CH2)nOH(n은 4이상인 정수)인 폴리에틸렌글리콜이나 그 유도체에 의해 이루어질 수 있다.PEGylation can be accomplished by polyethylene glycol or a derivative thereof whose chemical formula is H(OCH 2 CH 2 )nOH (n is an integer greater than or equal to 4).
페길화에 이용되는 폴리에틸렌글리콜이나 그 유도체는 의도한 생체 내 안정성, 반감기를 나타낼 수 있는 한 그 분자량에 특별한 제한이 없다. 페길화는 일반적으로는 0.2-50 kDa, 0.5-50 kDa 또는 10-45 kDa 범위의 분자량를 갖는 폴리에틸렌글리콜이나 그 유도체에 의해 이루어질 것이다.Polyethylene glycol or a derivative thereof used for pegylation is not particularly limited in its molecular weight as long as it can exhibit the intended in vivo stability and half-life. PEGylation will generally be effected by polyethylene glycol or its derivatives having a molecular weight in the range of 0.2-50 kDa, 0.5-50 kDa or 10-45 kDa.
본 발명의 핵산 기반 항암제는, 핵산이나 압타머의 노출된 말단(즉 5' 말단 및/또는 3' 말단)은 생체 내 뉴클레아제에 의한 분해를 방지함으로써 생체 내 안정성을 향상시키기 위하여 그 5' 말단 또는 3' 말단의 뉴클레오티드가 LNA(Locked Nucleic Acid 또는 bridged nucleic acid, 말단 뉴클레오티드의 2'O와 4C가 연결된 형태의 핵산)이거나 idT(inverted deoxythymidine) 형태이거나, 2'-메톡시 뉴클레오시드, 2'-아미노 뉴클레오시드 또는 2'F-뉴클레오시드를 갖는 형태이거나 아민 링커, 티올 링커, 콜레스테롤 등으로 화학적 수식된 것일 수 있다. 또 콜레스테롤에, 핵산이나 압타머의 5' 또는 3' 말단 영역과 상보적인 서열의 올리고뉴클레오티드를 결합시켜 상보적 수소결합으로 결합시킬 수도 있다. In the nucleic acid-based anticancer agent of the present invention, the exposed ends (ie, 5' ends and/or 3' ends) of nucleic acids or aptamers are 5' in order to improve in vivo stability by preventing degradation by nucleases in vivo. The terminal or 3' terminal nucleotide is LNA (Locked Nucleic Acid or bridged nucleic acid, a nucleic acid in which 2'O and 4C of the terminal nucleotide are linked) or idT (inverted deoxythymidine) form, or 2'-methoxy nucleoside, It may be in a form having 2'-amino nucleoside or 2'F-nucleoside, or chemically modified with an amine linker, a thiol linker, cholesterol, or the like. In addition, the oligonucleotide of a complementary sequence with the 5' or 3' terminal region of a nucleic acid or an aptamer may be bound to cholesterol, and may be bound by a complementary hydrogen bond.
본 발명의 핵산 기반 항암제는 이를 포함하는 입자 형태로 제조될 수 있다. 본 발명의 항암제가 입자 형태로 제조될 경우, 본 발명의 핵산 기반 항암제가 포함된 입자는 중합체성 입자(polymeric particles), 지질 입자(lipid particles), 고형 지질 입자(solid lipid particles), 무기 입자(inorganic particles), 또는 이들의 조합(예컨대, 지질 안정화된 중합체성 입자(lipid stabilized polymeric particles))일 수 있다. 바람직한 양태에서, 상기 입자는 중합체성 입자이거나 또는 중합체성 매트릭스(polymeric matrix)를 포함한다. The nucleic acid-based anticancer agent of the present invention may be prepared in the form of particles containing the same. When the anticancer agent of the present invention is prepared in the form of particles, the particles containing the nucleic acid-based anticancer agent of the present invention are polymeric particles, lipid particles, solid lipid particles, inorganic particles ( inorganic particles), or a combination thereof (eg, lipid stabilized polymeric particles). In a preferred embodiment, the particles are polymeric particles or comprise a polymeric matrix.
상기 입자는 하나 이상의 생체분해성 중합체(biodegradable polymer)를 포함할 수 있다. 생체분해성 중합체는 체내에서 수용해성 물질로 화학적으로 또는 효소로 전환되는 수불용성 또는 수난용성인 중합체일 수 있다.The particles may include one or more biodegradable polymers. A biodegradable polymer may be a water-insoluble or poorly water-soluble polymer that is converted in the body chemically or enzymatically into water-soluble substances.
입자 내의 생체분해성 중합체는 폴리아미드, 폴리카보네이트, 폴리알킬렌, 폴리알킬렌 글리콜, 폴리알킬렌 옥사이드, 폴리알킬렌 테레프탈레이트, 폴리비닐 할로겐화물, 폴리비닐피롤리돈, 폴리글리콜리드, 폴리실록산, 폴리우레탄, 이들의 공중합체 등일 수 있다.The biodegradable polymer in the particle may be polyamide, polycarbonate, polyalkylene, polyalkylene glycol, polyalkylene oxide, polyalkylene terephthalate, polyvinyl halide, polyvinylpyrrolidone, polyglycolide, polysiloxane, poly urethane, a copolymer thereof, or the like.
또 입자 내의 생체분해성 중합체는 메틸 셀룰로스, 에틸 셀룰로스 등의 알킬 셀룰로스, 하이드록시프로필 셀룰로스 등의 하이드록시알킬 셀룰로스, 셀룰로스 에테르, 셀룰로스 에스테르, 니트로 셀룰로스, 셀룰로스 아세테이트, 셀룰로스 설페이트 나트륨 염 등일 도 있다.In addition, the biodegradable polymer in the particles may be alkyl cellulose such as methyl cellulose and ethyl cellulose, hydroxyalkyl cellulose such as hydroxypropyl cellulose, cellulose ether, cellulose ester, nitro cellulose, cellulose acetate, cellulose sulfate sodium salt, and the like.
또 입자 내의 생체분해성 중합체는 폴리메틸메타크릴레이트, 폴리에틸메타크릴레이트, 폴리부틸메타크릴레이트, 폴리이소부틸메타크릴레이트 등의 아크릴산 및 메타크릴산 에스테르의 중합체, 이들의 선형 또는 분지형 공중합체, 블록 공중합체 등일 수도 있다.In addition, the biodegradable polymer in the particles is a polymer of acrylic acid and methacrylic acid ester such as polymethyl methacrylate, polyethyl methacrylate, polybutyl methacrylate, and polyisobutyl methacrylate, and a linear or branched copolymer thereof. , a block copolymer, or the like.
또 입자 내의 생체분해성 중합체는 폴리에스테르, 폴리오르토에스테르, 폴리에틸렌이민, 폴리카프로락톤, 폴리하이드록시알카노에이트, 폴리하이드록시발레레이트, 폴리아크릴산, 폴리글리콜리드 등일 수도 있다. In addition, the biodegradable polymer in the particles may be polyester, polyorthoester, polyethyleneimine, polycaprolactone, polyhydroxyalkanoate, polyhydroxyvalerate, polyacrylic acid, polyglycolide, or the like.
상기 입자는 하나 이상의 친수성 중합체를 포함할 수 있다. 친수성 중합체는 프로타민(protamine), 폴리-L-글루탐산(PGS), 폴리-L-아스파르트산, 폴리-L-라이신, 폴리아미도아민, 양이온성 펩타이드(예컨대 세포 투과성 펩타이드 등) 등 등의 양이온성 폴리펩티드, 키토산, 글리코키토산 등의 양이온성 다당류, 헤파닌, 히알루론산, 콘드로이틴황산(chondroitin sulfate), 카르복시 메틸 셀룰로스(carboxy methyl cellulose), 펙틴(pectin) 등의 음이온성 고분자를 비롯하여 전분, 폴리사카라이드를 포함하여 폴리에틸렌 글리콜(PEG), 폴리프로필렌 글리콜(PPG) 등의 폴리알킬렌글리콜, 폴리에틸렌옥사이드(PEO) 등의 폴리알킬렌옥사이드, 폴리옥시에틸화폴리올, 폴리올레핀성 알콜 등을 포함한다. The particles may include one or more hydrophilic polymers. The hydrophilic polymer includes cationic polypeptides such as protamine, poly-L-glutamic acid (PGS), poly-L-aspartic acid, poly-L-lysine, polyamidoamine, cationic peptides (eg, cell penetrating peptides, etc.) , cationic polysaccharides such as chitosan and glycochitosan, hepanin, hyaluronic acid, chondroitin sulfate, carboxy methyl cellulose, and anionic polymers such as pectin, starch and polysaccharides and polyalkylene glycols such as polyethylene glycol (PEG) and polypropylene glycol (PPG), polyalkylene oxides such as polyethylene oxide (PEO), polyoxyethylated polyols, polyolefinic alcohols, and the like.
본 발명의 핵산 기반 항암제나 표적화 항암제는 친수성 중합체로 입자화된 것일 수 있다. 특히 양이온성 고분자로 코팅되고 그 양이온성 고분자가 다시 음이온성 고분자로 코팅된 것일 수 있다.The nucleic acid-based anticancer agent or the targeted anticancer agent of the present invention may be granulated with a hydrophilic polymer. In particular, it may be coated with a cationic polymer, and the cationic polymer may be coated with an anionic polymer again.
상기 입자는 하나 이상의 소수성 중합체를 포함할 수 있다. 소수성 중합체는 폴리락트산, 폴리글리콜산 등의 폴리하이드록시산, 폴리3-하이드록시부티레이트 등의 리하이드록시알카노에이트, 폴리카프로락톤, 티로신 폴리카보네이트 등의 폴리카보네이트, 폴리아미드, 폴리펩티드, 폴리에스테르아미드, 폴리우레탄 등일 수 있다. 바람직하게는 상기 소수성 중합체는 폴리락트산, 폴리글리콜산, 또는 폴리(락트산-co-글리콜산)(poly(lactic acid-co-glycolic acid)) 등이다.The particles may include one or more hydrophobic polymers. Hydrophobic polymers include polyhydroxy acids such as polylactic acid and polyglycolic acid, rehydroxyalkanoates such as poly3-hydroxybutyrate, polycarbonates such as polycaprolactone and tyrosine polycarbonates, polyamides, polypeptides, and polyesters amides, polyurethanes, and the like. Preferably, the hydrophobic polymer is polylactic acid, polyglycolic acid, or poly(lactic acid-co-glycolic acid).
상기 입자는 하나 이상의 양쪽성 중합체를 포함할 수 있다. 양쪽성 중합체는 소수성 중합체 블록 및 친수성 중합체 블록으 구성될 수 있다. 상기 소수성 중합체 블록은 상기 소수성 중합체 또는 이의 유도체 또는 공중합체 중 하나 이상을 포함할 수 있다. 상기 친수성 중합체 블록은 상기 친수성 중합체 또는 이의 유도체 또는 공중합체 중 하나 이상을 포함할 수 있다.The particles may include one or more amphoteric polymers. The amphiphilic polymer may be composed of a hydrophobic polymer block and a hydrophilic polymer block. The hydrophobic polymer block may include at least one of the hydrophobic polymer or a derivative or copolymer thereof. The hydrophilic polymer block may include at least one of the hydrophilic polymer or a derivative or copolymer thereof.
상기 입자는 하나 이상의 중성이나 음이온성 지질, 양이온성 지질, 고형 지질 또는 양쪽성 화합물을 포함할 수 있다. The particles may comprise one or more neutral or anionic lipids, cationic lipids, solid lipids or amphoteric compounds.
상기 중성이나 음이온성 지질로서는 콜레스테롤, 인지질, 라이소지질, 페길화된 지질일 수 있으며, 1,2-디아실-글리세로-3-포스포콜린을 포함하는 포스파티딜콜린, 포스파티딜세린, 포스파티딜글리세롤, 스핑고미엘린, 세라미드 갈락토피라노사이드, 강글리오사이드, 1,2-디스테아로일포스파티딜콜린(DSPC), 1,2-디팔미토일 포스파티딜콜린(DPPC), 1,2-디미리스토일포스파티딜콜린(DMPC) 등일 수 있다.The neutral or anionic lipid may be cholesterol, phospholipid, lysolipid, pegylated lipid, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, including 1,2-diacyl-glycero-3-phosphocholine. Phingomyelin, ceramide galactopyranoside, ganglioside, 1,2-distearoylphosphatidylcholine (DSPC), 1,2-dipalmitoyl phosphatidylcholine (DPPC), 1,2-dimyristoylphosphatidylcholine (DMPC), etc. can
상기 양이온성 지질로서는 디메틸디옥타데실 암모늄 브로마이드(DDAB), 1,2-디아실옥시-3-트리메틸암모늄 프로판, N-1-(2,3-디올로일옥시)프로필-N,N-디메틸 아민(DODAP), 1,2-디아실옥시-3-디메틸암모늄 프로판, N-1-(2,3-디올레일옥시)프로필-N,N,N-트리메틸암모늄 클로라이드(DOTMA), 1,2-디알킬옥시-3-디메틸암모늄 프로판, 디옥타데실아미도글리실스페르민(DOGS) 등일 수 있다.Examples of the cationic lipid include dimethyldioctadecyl ammonium bromide (DDAB), 1,2-diacyloxy-3-trimethylammonium propane, N-1-(2,3-dioloyloxy)propyl-N,N-dimethyl Amine (DODAP), 1,2-Diacyloxy-3-dimethylammonium propane, N-1-(2,3-dioleyloxy)propyl-N,N,N-trimethylammonium chloride (DOTMA), 1,2 -dialkyloxy-3-dimethylammonium propane, dioctadecylamidoglycylspermine (DOGS), and the like.
상기 고형 지질로서는 고도로 포화된 알콜, 지방족 알콜, 스테아르산, 팔미트산, 데칸산 등의 고급 지방산, 스핑고지질, 합성 에스테르, 고도로 포화된 지방산의 모노-, 디-, 트리글리세리드일 수 있다. The solid lipids may be highly saturated alcohols, aliphatic alcohols, higher fatty acids such as stearic acid, palmitic acid and decanoic acid, sphingolipids, synthetic esters, mono-, di-, triglycerides of highly saturated fatty acids.
상기 양쪽성 화합물은 포스파티딜 콜린, 포스파티딜 에탄올아민, 포스파티딜글리세롤, 포스파티딜세린, 포스파티딜리노시톨, 리소포스파티딜 유도체, 카르디올리핀 등일 수 있다.The amphoteric compound may be phosphatidyl choline, phosphatidyl ethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidylinositol, lysophosphatidyl derivative, cardiolipin, or the like.
상기 지질 입자는 이중층으로 배열된 지질로 둘러싸인 수성 매질로 구성된 구형의 작은 소낭인 리포좀일 수 있다. 리포좀은 친수성 약물을 수성 내부에서 또는 소수성 제제를 상기 이중층 내에 포함한다.The lipid particles may be liposomes, which are spherical small vesicles composed of an aqueous medium surrounded by lipids arranged in a bilayer. Liposomes contain a hydrophilic drug in an aqueous interior or a hydrophobic agent in the bilayer.
상기 지질 입자는 지질 미셀(lipid micelles)일 수 있다. 약물 전달용 지질 미셀이 당업계에 공지되어 있다. 지질 미셀은, 예를 들면, 지질 계면활성제를 갖는 유중수 에멀젼으로서 형성될 수 있다. 지질 미셀은 일반적으로, 소수성 약물을 전달하는데 유용하다.The lipid particles may be lipid micelles. Lipid micelles for drug delivery are known in the art. Lipid micelles can be formed, for example, as water-in-oil emulsions with a lipid surfactant. Lipid micelles are generally useful for delivering hydrophobic drugs.
상기 지질 입자는 고형 지질 입자일 수 있다. 고형 지질 입자는 실온에서 고형인 지질로 형성되며, 이 고형 지질 입자는 고형 지질을 사용하여 수중유 에멀젼으로부터 얻어질 수 있다.The lipid particle may be a solid lipid particle. Solid lipid particles are formed from lipids that are solid at room temperature, and the solid lipid particles can be obtained from oil-in-water emulsions using solid lipids.
이러한 중합체성 입자, 지질 입자는 당업계에 공지된 방법으로 제조될 수 있다. 예컨대 중합체성 입자는 분무 건조, 계면 중합, 고온 용융 캡슐화, 상 분리 캡슐화(자발적 에멀젼 마이크로캡슐화, 용매 증발 마이크로캡슐화, 및 용매 제거 마이크로캡슐화), 코아세르베이션, 저온 마이크로구체 형성, 상 전이 나노캡슐화, 에멀젼, 나노 침전 등의 방법으로 제조될 수 있다. 또 예컨대 지질 입자는 고압 균질화 기술, 초임계 유체 방법, 에멀젼 방법, 용매 확산 방법, 분무 건조 등의 방법으로 제조될 수 있다. 이러한 입자의 제조 방법과 관련하여 구체적인 것은 문헌 Remington's Pharmaceutical Sciences 16th edition, Osol, A.(ed.),(1980) 등을 참조할 수 있다.Such polymeric particles, lipid particles can be prepared by methods known in the art. For example, polymeric particles can be prepared by spray drying, interfacial polymerization, hot melt encapsulation, phase separation encapsulation (spontaneous emulsion microencapsulation, solvent evaporation microencapsulation, and solvent removal microencapsulation), coacervation, low temperature microsphere formation, phase transfer nanoencapsulation, It can be prepared by methods such as emulsion and nano-precipitation. Also, for example, the lipid particles may be prepared by a method such as a high-pressure homogenization technique, a supercritical fluid method, an emulsion method, a solvent diffusion method, spray drying, or the like. For details regarding a method for preparing such particles, reference may be made to the literature Remington's Pharmaceutical Sciences 16th edition, Osol, A. (ed.), (1980) and the like.
상기 입자의 크기는 의도하는 효과를 위해 조절할 수 있다. 상기 입자는 나노입자 또는 마이크로입자일 수 있지만, 나노입자가 바람직하다. 상기 입자는 약 10 nm 내지 약 10 ㎛, 약 10 nm 내지 약 1 ㎛, 약 10 nm 내지 약 500 nm, 약 20 nm 내지 약 500 nm, 또는 약 25 nm 내지 약 250 nm의 직경을 가질 수 있다. 바람직한 양태에서, 상기 입자는 약 25 nm 내지 약 250 nm의 직경을 갖는 나노입자이다.The size of the particles can be adjusted for the intended effect. The particles may be nanoparticles or microparticles, but nanoparticles are preferred. The particles may have a diameter of from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 20 nm to about 500 nm, or from about 25 nm to about 250 nm. In a preferred embodiment, the particles are nanoparticles having a diameter of about 25 nm to about 250 nm.
특히 약물 전달체로서의 나노 입자는 혈행 중 정상혈관을 통과할 수 없을 정도로 커야 하며 동시에 대식세포의 포식을 피할 수 있을 만큼 작아야 한다. 비장의 동양혈관(sinusoid)와 간에 위치하는 쿠퍼세포(Kupffer's cell)의 페네스트라(fenestra)의 크기는 150~200 nm 사이이며, 종양에 분포하는 혈관의 내피세포 간의 간격은 100~600 nm 사이이다. 따라서 이러한 특징적인 두 가지 종류의 혈관 구조를 통과하여 종양에 도달하기 위해서는 나노 입자의 크기가 100 nm 미만인 것이 바람직하다.In particular, nanoparticles as a drug carrier must be large enough to not pass through normal blood vessels during blood circulation and must be small enough to avoid macrophage predation. The size of the fenestra of the sinusoid of the spleen and the Kupffer's cells located in the liver is between 150 and 200 nm, and the distance between the endothelial cells of the blood vessels distributed in the tumor is between 100 and 600 nm. . Therefore, in order to reach the tumor through these two types of characteristic vascular structures, it is preferable that the size of the nanoparticles be less than 100 nm.
또 입자는 소수성 표면을 가질 경우 혈액에서 피브로넥틴(fibronectin), 보체(complement), IgG 등과 같은 혈장단백들이 달라붙게 되며(opsonization) 이들(opsonins)은 다시 세망내피계(reticulo-endothelial system)의 대식세포에 의하여 인지되어 결과적으로 나노 입자는 포식, 제거되게 된다. 따라서 입자 표면을 친수성으로 만드는 것이 바람직한데, 친수성으로 만드는 방법에 두 가지 방법이 있다. 하나는 폴리에틸렌글리콜(PEG)와 같은 친수성 폴리머로 나노 입자의 표면을 덮어주거나, 소수성 및 친수성을 가진 양친성 블록 공중합체(copolymer)를 이용하여 마이셀(micelle) 형태의 나노 입자를 만들어 표면에 친수성 폴리머가 위치하도록 하는 것이다.In addition, if the particle has a hydrophobic surface, plasma proteins such as fibronectin, complement, and IgG are attached to the blood (opsonization), and these (opsonins) are again macrophages of the reticulo-endothelial system. As a result, the nanoparticles are predated and removed. Therefore, it is desirable to make the particle surface hydrophilic. There are two methods for making the particle surface hydrophilic. One is to cover the surface of nanoparticles with a hydrophilic polymer such as polyethylene glycol (PEG), or to make micellar-type nanoparticles using an amphiphilic block copolymer having hydrophobicity and hydrophilicity on the surface of the hydrophilic polymer. is to be located.
본 발명의 핵산 기반 항암제는 약제학적으로 허용되는 담체와 혼합되어 동결건조된 형태 또는 수용액의 형태로 제형화될 수 있다. 약제학적으로 허용되는 담체는 본 발명의 제형에 포함되는 함량 또는 농도에서 그 유효성분인 본 발명의 압타머 기반 표적화 복합 항암제의 약효나 생물학적 활성 또는 특성을 저해하지 않은 성분으로, 예컨대 포스페이트, 시트레이트 등의 유기산을 포함하는 완충액, 아스코르브산 및 메티오닌 등의 항산화제, 옥타데실디메틸벤질 암모늄 클로라이드, 헥사메토늄 클로라이드, 벤즈알코늄 클로라이드, 벤즈에토늄 클로라이드, 페놀, 부틸 또는 벤질 알코올, 알킬 파라벤, 예컨대 메틸 또는 프로필 파라벤, 카테콜, 레소르시놀, 시클로헥사놀, 3-펜타놀, m-크레졸 등의 보존제, 혈청 알부민, 젤라틴, 또는 면역글로불린 등의 단백질, 폴리비닐피롤리돈 등의 중합체, 글리신, 글루타민, 아스파라긴, 히스티딘, 아르기닌, 라이신 등의 아미노산, 글루코오스, 만노오스, 수크로오스, 만니톨, 트레할로오스, 소르비톨, 덱스트린 등의 당류, EDTA(ethylenediaminetetraacetic acid) 등의 킬레이트제, 폴리에틸렌 글리콜(PEG) 등의 계면활성제 등일 수 있다. 특히 액상 용액으로 제제화되는 주사제 등의 조성물에 있어서 허용되는 약제학적 담체로는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등일 수 있다. The nucleic acid-based anticancer agent of the present invention may be mixed with a pharmaceutically acceptable carrier and formulated in a lyophilized form or in the form of an aqueous solution. A pharmaceutically acceptable carrier is a component that does not inhibit the efficacy, biological activity or properties of the aptamer-based targeting complex anticancer agent of the present invention, which is an active ingredient, at the content or concentration included in the formulation of the present invention, for example, phosphate, citrate Buffers containing organic acids such as, antioxidants such as ascorbic acid and methionine, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as Preservatives such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol; proteins such as serum albumin, gelatin, or immunoglobulin; polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, histidine, arginine, and lysine, sugars such as glucose, mannose, sucrose, mannitol, trehalose, sorbitol, and dextrin, chelating agents such as EDTA (ethylenediaminetetraacetic acid), polyethylene glycol (PEG) It may be a surfactant, such as these. In particular, acceptable pharmaceutical carriers in compositions such as injections formulated as liquid solutions include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like.
상기 담체는 특별히 이에 제한되지는 않으나, 경구투여시에는 결합제, 활택제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있고, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장화제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. The carrier is not particularly limited thereto, but in the case of oral administration, a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a fragrance, etc. may be used, and in the case of an injection, a buffer, A preservative, an analgesic agent, a solubilizer, an isotonic agent, a stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used.
본 발명의 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서, 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 환약, 캡슐, 서방형 제제 등으로 제형화할 수 있다.The formulation of the composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, oral administration may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like, and in the case of injections, it may be prepared in the form of unit dose ampoules or multiple doses. In addition, it can be formulated as a solution, suspension, tablet, pill, capsule, sustained-release preparation, and the like.
제제화에 적합한 담체, 부형제 및 희석제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 방부제 등을 추가로 포함할 수 있다. Examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, a preservative, and the like.
또한, 본 발명의 약학적 조성물은 각각 통상의 방법에 따라 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.In addition, the pharmaceutical composition of the present invention can be prepared according to a conventional method for tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, and freeze-drying, respectively. It may have any one formulation selected from the group consisting of formulations and suppositories.
또한, 상기 조성물은 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 제제, 바람직하게는 펩타이드 의약품의 투여에 유용한 제제 형태로 제형화시켜 당업계에서 통상적으로 사용하는 투여 방법을 이용하여 경구, 또는 피부, 정맥 내, 근육 내, 동맥 내, 골수 내, 수막강 내, 심실 내, 폐, 경피, 피하, 복 내, 비강 내, 소화관 내, 국소, 설하, 질 내 또는 직장 경로를 포함하는 비경구 투여 경로에 의하여 투여될 수 있으나, 이들에 한정되는 것은 아니다.In addition, the composition is formulated in a dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, preferably in a formulation useful for the administration of peptide pharmaceuticals, and administration commonly used in the art. Oral, or dermal, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, topical, sublingual, intravaginal or It may be administered by parenteral routes of administration including, but not limited to, rectal routes.
또한, 본 발명의 압타머 기반 표적화 복합 항암제는 생리식염수 또는 유기용매와 같이 약제로 허용된 여러 전달체(carrier)와 혼합하여 사용될 수 있고, 안정성이나 흡수성을 증가시키기 위하여 글루코스, 수크로스 또는 덱스트란과 같은 카보하이드레이트, 아스코르브 산 (ascorbic acid) 또는 글루타치온과 같은 항산화제 (antioxidants), 킬레이팅 물질 (chelating agents), 저분자 단백질 또는 다른 안정화제 (stabilizers)들이 약제로 사용될 수 있다.In addition, the aptamer-based targeting complex anticancer agent of the present invention can be used by mixing with several acceptable carriers such as physiological saline or organic solvents, and with glucose, sucrose or dextran to increase stability or absorption. Antioxidants such as carbohydrates, ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers can be used as pharmaceuticals.
약제학적 조성물의 제제화와 관련하여서는 당업계에 공지되어 있으며, 구체적으로 문헌Remington's Pharmaceutical Sciences(19th ed., 1995) 등을 참조할 수 있다. Formulation of pharmaceutical compositions is known in the art, and specifically, reference may be made to Remington's Pharmaceutical Sciences (19th ed., 1995) and the like.
본 발명의 약제학적 조성물의 바람직한 투여량은 환자의 상태, 체중, 성별, 연령, 환자의 중증도, 투여 경로에 따라 1일 0.001mg/kg ~ 10g/kg 범위, 바람직하게는 0.001mg/kg ~ 1g/kg 범위일 수 있다. 투여는 1일 1회 또는 수회로 나누어 이루어질 수 있다. 이러한 투여량은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 해석되어서는 아니 된다.A preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, patient's severity, and administration route. It can be in the range /kg. Administration may be performed once or divided into several times a day. Such dosages should not be construed as limiting the scope of the invention in any respect.
전술한 바와 같이, 본 발명에 따르면 높은 함량의 항암제의 탑재가 가능하고 또 2종 이상 항암제의 복합적인 답재가 가능하면서 암세포에의 표적화 기능을 가지도록 설계하여 그 부작용은 줄일 수 있고 또한 균일한(homogeneous) 제조가 가능한 핵산 기반 항암제를 제공할 수 있다.As described above, according to the present invention, it is possible to load a high content of anticancer drugs, and it is possible to combine two or more kinds of anticancer drugs, and by designing to have a targeting function to cancer cells, the side effects can be reduced and uniform ( It is possible to provide a nucleic acid-based anticancer drug that can be produced homogeneous).
도 1은 표준 분석용(4.6 x 250mm) C8 컬럼을 사용하여 역상 HPLC로, 약물이 결합된 뉴클레오티드 유사체를 분리, 정제한 결과를 나타낸 것이다. 1 shows the results of separation and purification of drug-bound nucleotide analogues by reverse-phase HPLC using a standard analytical (4.6 x 250 mm) C8 column.
도 2는 2종 약물이 다중으로 결합된 핵산인 RNA1-SN38/MMAE를 전기영동한 젤 이미지이다.2 is an electrophoresis gel image of RNA1-SN38/MMAE, which is a nucleic acid to which two drugs are multiplexed.
도 3은 표준 분석용(4.6 x 250mm) C8 컬럼을 사용하여 역상 HPLC로, 약물이 결합된 핵산을 분리, 정제한 결과를 나타낸 것이다. 3 shows the results of separation and purification of drug-bound nucleic acids by reverse-phase HPLC using a standard analytical (4.6 x 250 mm) C8 column.
도 4는 약물이 결합된 핵산과 리간드인 EGFR RNA 압타머의 혼성화 전후의 반응 혼합물을 전기영동한 결과이다. 4 is a result of electrophoresis of the reaction mixture before and after hybridization of the drug-bound nucleic acid and the ligand EGFR RNA aptamer.
도 5는 약물이 결합된 핵산에 콜레르스테롤을 혼성화 방법으로 결합시켜 혈청에서의 안정성을 살펴본 결과이다.5 is a result of examining stability in serum by binding cholesterol to a drug-bound nucleic acid by a hybridization method.
도 6은 입자화 약물이 생성된 것을 보여주는 전기영동 결과이다.6 is an electrophoresis result showing that a particulated drug is generated.
도 7은 입자화 약물의 암세포주에 대한 세포독성 결과를 MTT법으로 분석한 결과이다.7 is a result of analyzing the cytotoxicity results of the granulated drug to cancer cell lines by the MTT method.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 실시예에 이러한 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described with reference to Examples. However, the embodiments of the present invention are not limited to these examples.
<실시예 1> 약물이 결합된 뉴클레오티드 유사체의 제조<Example 1> Preparation of drug-conjugated nucleotide analogues
<실시예 1-1> 시약<Example 1-1> Reagent
약물이 결합된 핵산의 제조에 사용하기 위하여, 약물이 결합된 뉴클레오티드 유사체를, 아래 표 2의 작용기를 가진 뉴클레오티드 유사체와 링커-약물 접합체를 반응시켜 제조하였다.For use in the preparation of drug-bound nucleic acids, drug-bound nucleotide analogs were prepared by reacting a nucleotide analog having a functional group in Table 2 below with a linker-drug conjugate.
아래 표에서 작용기를 가진 뉴클레오티드 유사체는 Gene Link 사(미국)에서 구입하였고, 링커-약물 접합체인 Aldoxorubicin는 ChemScence 사(미국)에서 구입하였으며, 나머지의 링커-약물 접합체는 CellMosaic 사(미국)에서 구입하였다.Nucleotide analogues having functional groups in the table below were purchased from Gene Link (USA), Aldoxorubicin, a linker-drug conjugate, was purchased from ChemScence (USA), and the rest of the linker-drug conjugates were purchased from CellMosaic (USA). .
작용기를 가진 뉴클레오티드 유사체 및 링커-약물Nucleotide analogues with functional groups and linker-drugs
TypeType Functional groupfunctional group 작용기를 가진 뉴클레오티드 유사체Nucleotide analogues with functional groups 링커-약물 접합체Linker-Drug Conjugates
DNADNA amine- reactive groupsamine-reactive groups amino deoxycytosine dC C6,
amino deoxyguanocine dG C6,
amino deoxyadenosine dA C6amino deoxycytosine dC C6,
amino deoxyguanocine dG C6,
amino deoxyadenosine dA C6 		Succinyl Dox NHS ester
O-Succinyl SN38 NHS ester
Succinyl Dox NHS ester
O-Succinyl SN38 NHS ester
Sulfhydryl-reactive groupsSulfhydryl-reactive groups 6-Thio-dG(S6-dG),
4-Thio-dT((S4-dT)6-Thio-dG (S6-dG),
4-Thio-dT((S4-dT) 		Aldoxorubicin
MC-VC-PAB-MMAE(VcMMAE)Aldoxorubicin
MC-VC-PAB-MMAE (VcMMAE)
RNARNA amine- reactive groupsamine-reactive groups amino C6 U,
2-amino Purine Riboseamino C6 U,
2-amino Purine Ribose 		Succinyl Dox NHS ester
Succinyl SN38 NHS esteSuccinyl Dox NHS ester
Succinyl SN38 NHS este
Sulfhydryl-reactive groupsSulfhydryl-reactive groups 4-Thio-Uridine(s4U)4-Thio-Uridine (s4U) Aldoxorubicin
MC-VC-PAB-MMAE(VcMMAE)Aldoxorubicin
MC-VC-PAB-MMAE (VcMMAE)
상기 작용기를 가진 뉴클레오티드 유사체는 NMP(Nucleoside Monophosphate)의 염기에 아민기(-NH2), 티올기(-SH) 작용기가 결합되어 있는 구조이고, 또 상기 Succinyl Dox NHS ester는 DOX(독소루비신)에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있고, O-Succinyl SN38 NHS ester는 SN38(7-ethyl-10-hydroxycamptothecin)에 sulfo-NHS (N-hydroxysulfosuccinimide) 링커가 접합됨으로써 NHS ester 작용기를 가지고 있으며, Aldoxorubicin는 DOX(독소루비신)에 (N-ε-maleimidocaproic acid hydrazide, or EMCH) 링커가 접합됨으로써 hydrazone 작용기를 가지고 있다. 또 MC-VC-PAB-MMAE(VcMMAE)는 MMAE((Monomethyl auristatin E)에 MC-VC-PAB-NH2링커가 접합됨으로써 maleimidocaproyl(MC) 작용기를 가지고 있다. The nucleotide analogue having the functional group has a structure in which an amine group (-NH 2 ) and a thiol group (-SH) functional group are bonded to the base of NMP (Nucleoside Monophosphate), and the Succinyl Dox NHS ester is sulfo in DOX (doxorubicin) -NHS (N-hydroxysulfosuccinimide) linker has a NHS ester functional group by conjugation, O-Succinyl SN38 NHS ester is NHS ester by conjugating sulfo-NHS (N-hydroxysulfosuccinimide) linker to SN38 (7-ethyl-10-hydroxycamptothecin) It has a functional group, and Aldoxorubicin has a hydrazone functional group by conjugating a (N-ε-maleimidocaproic acid hydrazide, or EMCH) linker to DOX (doxorubicin). In addition, MC-VC-PAB-MMAE (VcMMAE) has a maleimidocaproyl (MC) functional group by conjugating MC-VC-PAB-NH2 linker to MMAE ((Monomethyl auristatin E).
상기 작용기를 가진 뉴클레오티드 유사체인 amino deoxycytosine dC C6는 CTP를, amino deoxyguanocine dG C6는 GTP를, amino deoxyadenosine dA C6는 ATP를, 6-Thio-dG(S6-dG)는 GTP를, 4-Thio-dT((S4-dT)는 TTP를, amino C6 U는 UTP를, 4-Thio-Uridine(s4U)는 UTP를 각각 대체하여 DNA, RNA에 통합될 수 있으며, 또 그리고 2-amino Purine Ribose는 천연의 ATP, GTP 대체하여 DNA, RNA에 통합될 수 있다. The nucleotide analogues with the above functional groups, amino deoxycytosine dC C6, represent CTP, amino deoxyguanocine dG C6, GTP, amino deoxyadenosine dA C6, ATP, 6-Thio-dG(S6-dG), GTP, 4-Thio-dT ((S4-dT) replaces TTP, amino C6 U replaces UTP, and 4-Thio-Uridine (s4U) replaces UTP, respectively, and can be incorporated into DNA and RNA, and 2-amino Purine Ribose is a natural It can be integrated into DNA and RNA by replacing ATP and GTP.
<실시예 1-2> 작용기로서 아민기를 가진 뉴클레오티드 유사체와 링커-약물접합체로부터 약물이 결합된 뉴클레오티드 유사체의 제조<Example 1-2> Preparation of a nucleotide analogue in which a drug is bound from a nucleotide analogue having an amine group as a functional group and a linker-drug conjugate
상기 표 2에서 작용기로서 아민기를 가진 뉴클레오티드 유사체와 링커-약물 접합체인 Succinyl Dox NHS ester 및 O-Succinyl SN38 NHS ester를 반응시켜 약물이 결합된 뉴클레오티드 유사체를 제조하였다. 약물이 결합된 뉴클레오티드 유사체는 약물이 결합된 핵산의 제조에 단위체로서 이용된다.In Table 2, a drug-conjugated nucleotide analogue was prepared by reacting a nucleotide analogue having an amine group as a functional group with Succinyl Dox NHS ester and O-Succinyl SN38 NHS ester, which are linker-drug conjugates. Nucleotide analogs to which drugs are bound are used as units in the preparation of nucleic acids to which drugs are bound.
먼저 상기 표 2의 동결 건조된, 아민기를 가진 뉴클레오티드 유사체를 탈 이온수에 녹여 25 μg/μL 최종 농도로 준비하였다. 이렇게 얻은, 아민기를 가진 뉴클레오티드 유사체 원액은 -20 ℃ 이하에서 냉동 보관하면서 사용하였다. First, the freeze-dried nucleotide analogues having an amine group of Table 2 were dissolved in deionized water to prepare a final concentration of 25 μg/μL. The stock solution of the nucleotide analogue having an amine group thus obtained was used while being stored frozen at -20 °C or lower.
물 1 mL 당 0.038 g의 sodium tetraborate decahydrate을 용해시켜 HCl로 pH를 8.5로 조정하여 0.1M sodium tetraborate, pH 8.5 표지 완충액을 준비하였다. 이 표지 버퍼는 표지화(Amino-Biomolecules의 NHS Ester Labeling) 반응 직전에 준비하였다. 0.1M sodium tetraborate, pH 8.5 labeling buffer was prepared by dissolving 0.038 g of sodium tetraborate decahydrate per mL of water and adjusting the pH to 8.5 with HCl. This labeling buffer was prepared immediately before the labeling reaction (NHS Ester Labeling of Amino-Biomolecules).
상기 표 2의 250 μg의 링커-약물 접합체를, 바이알에서 14 μL DMSO에 용해하였다. 250 μg of the linker-drug conjugate of Table 2 above was dissolved in 14 μL DMSO in a vial.
상기 링커-약물 접합체가 들어있는 바이알에 7 μL의 탈 이온수, 표지 버퍼 75 μL, 그리고 25 μg/μL의 상기 제조한 아민기를 가진 뉴클레오티드 유사체 스톡 용액 4 μL 을 첨가하고, 상온에서 최소한 6 시간 동안 반응시켰다. 이어서 0.5 KD 투석막(Float-A-Lyzer® Dialysis Device, Repligen Corporation, 미국)으로 투석 및 동결건조를 수행하여 약물이 결합된 뉴클레오티드 유사체(DrNA)를 수득하였다.To the vial containing the linker-drug conjugate, add 7 µL of deionized water, 75 µL of labeling buffer, and 4 µL of 25 µg/µL of the prepared nucleotide analogue stock solution having an amine group, and react at room temperature for at least 6 hours. did it Then, dialysis and lyophilization were performed with a 0.5 KD dialysis membrane (Float-A-Lyzer® Dialysis Device, Repligen Corporation, USA) to obtain a drug-conjugated nucleotide analogue (DrNA).
이렇게 얻어진, 약물이 결합된 뉴클레오티드 유사체는, DNA 핵산 제조용 단위체로서 amino deoxycytosine dC C6와 Succinyl Dox NHS ester이 결합한 단위체(DCAD), amino deoxycytosine dC C6와 Succinyl SN38 NHS ester이 결합한 단위체(DCAS), amino deoxyguanocine dG C6와 Succinyl Dox NHS ester이 결합한 단위체(DGAD), amino deoxyguanocine dG C6와 Succinyl SN38 NHS ester이 결합한 단위체(DGAS), amino deoxyadenosine dA C6와 Succinyl Dox NHS ester이 결합한 단위체(DAAD), amino deoxyadenosine dA C6와 Succinyl SN38 NHS ester이 결합한 단위체(DAAS), 6-Thio-dG(S6-dG)와 Aldoxorubicin이 결합한 단위체(DGAD), 4-Thio-dT((S4-dT)와 MC-VC-PAB-MMAE(VcMMAE)이 결합한 단위체(DTMA) 등이 사용되고, RNA 핵산 제조용 단위체로서는 amino C6 U와 Succinyl Dox NHS ester이 결합한 단위체(RUAD), amino C6 U와 Succinyl SN38 NHS ester이 결합한 단위체(RUAS), 2-amino Purine Ribose와 Succinyl Dox NHS ester이 결합한 단위체(RPAD), 2-amino Purine Ribose와 Succinyl SN38 NHS ester이 결합한 단위체(RPAS) 등이 사용된다.The drug-conjugated nucleotide analogues thus obtained are units for DNA nucleic acid production, including a unit combining amino deoxycytosine dC C6 and Succinyl Dox NHS ester (DCAD), amino deoxycytosine dC C6 and succinyl SN38 NHS ester (DCAS), amino deoxyguanocine dG C6 and succinyl dox NHS ester combined (DGAD), amino deoxyguanocine dG C6 and succinyl SN38 NHS ester combined (DGAS), amino deoxyadenosine dA C6 and succinyl dox NHS ester combined (DAAD), amino deoxyA Monomer combined with Succinyl SN38 NHS ester (DAAS), 6-Thio-dG (S6-dG) and Aldoxorubicin (DGAD), 4-Thio-dT ((S4-dT) with MC-VC-PAB-MMAE (VcMMAE) conjugated unit (DTMA), etc. are used. As a unit for RNA nucleic acid production, amino C6 U and Succinyl Dox NHS ester (RUAD), amino C6 U and Succinyl SN38 NHS ester (RUAS), 2- A unit of amino-purine ribose and succinyl dox NHS ester (RPAD) and a unit of 2-amino-purine ribose and succinyl SN38 NHS ester (RPAS) are used.
이렇게 얻어진 DNA 또는 RNA 핵산 제조에 단위체로서 사용되는, 약물이 결합된 뉴클레오티드 유사체(DrNA)는 dNMP(DeoxyNucleoside Monophosphate)의 염기에 작용기 사이의 반응을 통해 약물이 결합되어 있는 구조이다.The drug-coupled nucleotide analogue (DrNA), used as a unit in the preparation of the thus obtained DNA or RNA nucleic acid, is a structure in which a drug is bound to a base of dNMP (DeoxyNucleoside Monophosphate) through a reaction between functional groups.
<실시예 1-3> 작용기로서 티올기를 가진 뉴클레오티드 유사체와 링커-약물접합체로부터 약물이 결합된 뉴클레오티드 유사체의 제조<Example 1-3> Preparation of a nucleotide analogue in which a drug is bound from a nucleotide analogue having a thiol group as a functional group and a linker-drug conjugate
상기 표 2에서 작용기로서 티올기를 가진 뉴클레오티드 유사체와 링커-약물접합체인 Aldoxorubicin 및 MC-VC-PABC-MMAE를 작용기 사이의 티올-말레이미드 반응(thiol-maleimide chemistry)으로 반응시켜 약물-뉴클레오티드 유사체를 제조하였다. In Table 2, a nucleotide analog having a thiol group as a functional group and a linker-drug conjugate Aldoxorubicin and MC-VC-PABC-MMAE were reacted with a thiol-maleimide chemistry between the functional groups to prepare a drug-nucleotide analog did.
먼저 상기 표 2의 작용기로서 티올기를 가진 뉴클레오티드 유사체 1-10 mg/mL를, pH 7-7.5인 PBS 완충액이 들어있는 플라스틱 바이알에서 녹였다. 또 상기 링커-약물 접합체를, DMSO 또는 신선한 DMF(100 uL 당 1-10 mg)에서 녹였다. First, 1-10 mg/mL of a nucleotide analogue having a thiol group as a functional group of Table 2 was dissolved in a plastic vial containing a PBS buffer having a pH of 7-7.5. In addition, the linker-drug conjugate was dissolved in DMSO or fresh DMF (1-10 mg per 100 uL).
상기 링커-약물 접합체 용액을, 티올기를 가진 뉴클레오티드 유사체 용액 (링커-약물 접합체의 20 배 농도 초과)에 넣고, 바이알을 불활성 가스로 세척한 다음 단단히 닫은 후 완전히 혼합하고, 실내 온도 또는 4℃에서 밤새 보관하였다. The linker-drug conjugate solution is placed in a solution of a nucleotide analogue having a thiol group (more than 20 times the concentration of the linker-drug conjugate), the vial is washed with an inert gas, tightly closed, and thoroughly mixed, overnight at room temperature or 4°C kept.
이어서 0.5 KD 투석막으로 투석 및 동결건조를 수행하여 약물이 결합된 뉴클레오티드 유사체를 수득하였다.Then, dialysis and freeze-drying were performed with a 0.5 KD dialysis membrane to obtain a drug-conjugated nucleotide analogue.
이렇게 얻어진 뉴클레오티드 유사체는, DNA 핵산 제조용 단위체로서, 6-Thio-dG와 Aldoxorubicin이 결합한 단위체(DGTD), 6-Thio-dG와 MC-VC-PABC-MMAE이 결합한 단위체(DGTM), 4-Thio-dT와 Aldoxorubicin이 결합한 단위체(DTTD), 4-Thio-dT와 MC-VC-PABC-MMAE이 결합한 단위체(DTTM) 등이며, RNA 핵산 제조용 단위체로서는 4-Thio-Uridine와 Aldoxorubicin이 결합한 단위체(RUTD), 4-Thio-Uridine와 MC-VC-PABC-MMAE이 결합한 단위체(RUTM) 등이다.The nucleotide analogue thus obtained is a unit for preparing DNA nucleic acids, a unit combining 6-Thio-dG and Aldoxorubicin (DGTD), a unit combining 6-Thio-dG and MC-VC-PABC-MMAE (DGTM), and 4-Thio- A unit combining dT and Aldoxorubicin (DTTD), a unit combining 4-Thio-dT and MC-VC-PABC-MMAE (DTTM), etc. , a unit (RUTM) in which 4-Thio-Uridine and MC-VC-PABC-MMAE are combined.
이렇게 얻어진 약물이 결합된 뉴클레오티드 유사체(DrNA)도 NMP(Nucleoside Monophosphate)의 염기에 작용기 사이의 반응을 통해 약물이 결합된 구조이다.The drug-coupled nucleotide analogue (DrNA) obtained in this way also has a structure in which the drug is bound to the base of NMP (Nucleoside Monophosphate) through a reaction between functional groups.
<실시예 1-4> HPLC로 약물이 결합된 뉴클레오티드 유사체의 정제<Example 1-4> Purification of drug-conjugated nucleotide analogues by HPLC
표준 분석용 (4.6 × 250mm) C8 컬럼을 사용하여 역상 HPLC로 약물이 결합된 뉴클레오티드 유사체를 정제하였다. 상기 반응 혼합물을 0.1M TEAA (triethylammonium acetate) 컬럼에 넣고 30 분에 걸쳐 선형 5 ~ 65 % 아세토니트릴 구배 (acetonitrile gradient)를 실시하였다. 이 구배는 분당 아세토니트릴이 2 % 증가한다. The drug-bound nucleotide analogues were purified by reverse-phase HPLC using a standard analytical (4.6×250 mm) C8 column. The reaction mixture was placed on a 0.1M TEAA (triethylammonium acetate) column and a linear 5-65% acetonitrile gradient was performed over 30 minutes. This gradient increases acetonitrile by 2% per minute.
약물이 결합된 뉴클레오티드 유사체의 HPLC 정제 결과 중 하나를 도 1에 나타내었다. 도 1을 참조하여 보면, 작용기를 가진 뉴클레오티드 유사체와 유리 약물(링커-약물 접합체)보다 약물이 결합된 뉴클레오티드 유사체가 가장 빠르게 이동하였다. 다른 모든 약물이 결합된 뉴클레오티드 유사체도 모두 같은 경향을 나타내었으며 같은 방법으로 정제하였다. One of the results of HPLC purification of the drug-bound nucleotide analogue is shown in FIG. 1 . Referring to FIG. 1 , the nucleotide analog with a functional group and the nucleotide analog to which the drug is bound moved the fastest than the free drug (linker-drug conjugate). Nucleotide analogues to which all other drugs were bound also showed the same trend and were purified in the same manner.
<실시예 2> 약물이 결합된 핵산의 제조예 1 <Example 2> Preparation Example 1 of a nucleic acid to which a drug is bound
본 실시예에서는 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체를 단위체로 사용하여 2종의 약물이 다중으로 결합된 핵산(MDrNA1)을 제조하였다. In this example, a nucleic acid (MDrNA1) in which two drugs are multiplexed was prepared using the bound nucleotide analogue of the drug prepared in Example 1 as a unit.
<실시예 2-1> 약물이 결합된 DNA 핵산의 제조<Example 2-1> Preparation of drug-conjugated DNA nucleic acid
2종의 약물이 다중으로 결합된 DNA 핵산으로서, 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체를 단위체로 사용하여, DNA 핵산(MDrDNA1)을 제조하였다. A DNA nucleic acid (MDrDNA1) was prepared by using as a unit the nucleotide analogue of the drug prepared in Example 1 as a DNA nucleic acid in which two drugs were multiplexed.
상기 약물이 다중으로 결합된 핵산(MDrDNA1)의 제조용 단위체로는 GTP를 대체하여통합될 수 있는 6-Thio-dG(S6-dG)와 Aldoxorubicin이 결합한 단위체(DGAD), TTP를 대체하여 통합될 수 있는 4-Thio-dT((S4-dT)와 MC-VC-PAB-MMAE(VcMMAE)이 결합한 단위체(DTMA)를 사용하였다.6-Thio-dG (S6-dG), which can be integrated by replacing GTP, and Aldoxorubicin-coupled unit (DGAD), which can be integrated by replacing the TTP, can be integrated A unit (DTMA) in which 4-Thio-dT ((S4-dT) and MC-VC-PAB-MMAE (VcMMAE) were combined was used.
상기 약물이 다중으로 결합된 핵산(MDrRNA1)의 제조를 위한, 주형 DNA 절편은 아래의 염기서열로 주문 제작하였다(바이오니아, 한국). A template DNA fragment for the preparation of the drug-multiplied nucleic acid (MDrRNA1) was custom-made with the following nucleotide sequence (Bioneer, Korea).
5'-TAA TAC GAC TCA CTA TA G G AC TCG CAG GGA GCA TTG AGT CTC ACG GCG ATA TAT CGA CCG GAT TTA TGG CCC TTG AAT AGC ATC TGA AAG CGG CAT CCG AGT AGG AGA GCA GA C GGC TTT GAC ATG CT-3' (서열번호 39)5'- TAA TAC GAC TCA CTA TA GG AC TCG CAG GGA GCA TTG AGT CTC ACG GCG ATA TAT CGA CCG GAT TTA TGG CCC TTG AAT AGC ATC TGA AAG CGG CAT CCG AGT AGG AGA GCA GA C GGC TTT GAC ATG CT -3 ' (SEQ ID NO: 39)
상기 주형 DNA는 ① T7 RNA 중합효소의 프로모터 부분(상기 염기서열에서 5'쪽 밑줄친 부분, 이 서열로부터 프라이머도 설계됨)과 T7 RNA 중합효소 전사 효율을 높이기 위한 GG로 이루어진 염기서열과, ② 약물이 결합된 뉴클레오티드 유사체가 단위체로 삽입되는 염기서열(상기 염기서열에서 굵은 글씨로 표시된 부분) 그리고 ③ 리간드 결합부위와 상보적으로 결합하는 염기서열(상기 염기서열의 3'쪽 밑줄친 부분, 이 서열로부터 프라이머도 설계됨)로 이루어져 있다. The template DNA is ① a nucleotide sequence consisting of a promoter portion of T7 RNA polymerase (the 5' underlined portion in the base sequence, a primer is also designed from this sequence) and GG to increase transcription efficiency of T7 RNA polymerase , ② drug A nucleotide sequence in which the bound nucleotide analogue is inserted as a unit (the part indicated in bold in the nucleotide sequence) and ③ a nucleotide sequence complementary to the ligand binding site (the 3' underlined part of the nucleotide sequence, this sequence from which primers were also designed).
PCR 증폭 과정에는 주형 DNA의 밑줄친 양 말단 서열로부터 아래의 프라이머 서열을 설계, 제작하여 사용하였다. In the PCR amplification process, the following primer sequences were designed, manufactured and used from the underlined both ends of the template DNA.
5'-TAA TAC GAC TCA CTA TA-3' (정방향 프라이머, 서열번호 40)5'-TAA TAC GAC TCA CTA TA-3' (forward primer, SEQ ID NO: 40)
5'-AGC ATG TCA AAG CCG-3' (역방향 프라이머, 서열번호 41) 5'-AGC ATG TCA AAG CCG-3' (reverse primer, SEQ ID NO: 41)
PCR 증폭 과정의 구성 시약으로 각 0.25 μM 정방향, 역방향 프라이머, 10X PCR 버퍼, 200 μM dNTP 혼합물, DNA Taq 중합효소(BioFact) 5 U이 혼합하였다. Each of 0.25 μM forward and reverse primers, 10X PCR buffer, 200 μM dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process.
PCR 반응은 95℃에서 5분간 반응 시킨 후 95℃ 30초, 58℃ 30초, 72℃ 30초의 조건으로 설정하여 20 사이클을 반복한 뒤 72℃에서 5분동안 반응시켜 DNA 절편을 제조하였다. 상기 dNTP 혼합물은 CTP, ATP, 상기 DGAD(GTP를 대체하여통합될 수 있는 6-Thio-dG(S6-dG)와 Aldoxorubicin이 결합한 단위체), DTMA(TTP를 대체하여 통합될 수 있는 4-Thio-dT((S4-dT)와 MC-VC-PAB-MMAE(VcMMAE)이 결합한 단위체)의 혼합물이다.The PCR reaction was carried out at 95°C for 5 minutes, followed by 20 cycles of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, followed by reaction at 72°C for 5 minutes to prepare a DNA fragment. The dNTP mixture is CTP, ATP, the DGAD (a unit combining 6-Thio-dG (S6-dG) and Aldoxorubicin that can be integrated by replacing GTP), DTMA (4-Thio- that can be integrated by replacing TTP) It is a mixture of dT ((S4-dT) and MC-VC-PAB-MMAE(VcMMAE) bonded unit).
반응 후 Ethanol 침전법으로 정제하여 약물이 다중으로 결합한 DNA(MDrDNA1)를 수득하였다. 약물이 다중으로 결합한 DNA(MDrRNA1)의 제조에는 뉴클레오티드 유사체로서, GTP를 대체하여통합될 수 있는 6-Thio-dG(S6-dG)와 Aldoxorubicin이 결합한 단위체(DGAD), TTP를 대체하여 통합될 수 있는 4-Thio-dT((S4-dT)와 MC-VC-PAB-MMAE(VcMMAE)이 결합한 단위체(DTMA)를 사용하였으므로 DOX(독소루비신) 약물 및 MMAE 약물이 결합되어 있다.After the reaction, it was purified by ethanol precipitation to obtain DNA (MDrDNA1) to which the drug was multiplied. In the preparation of DNA (MDrRNA1) to which the drug is multiplied, 6-Thio-dG (S6-dG), which can be integrated by replacing GTP as a nucleotide analogue, and a monomer bound to Aldoxorubicin (DGAD), can be integrated by replacing TTP Since a monomer (DTMA) in which 4-Thio-dT ((S4-dT) and MC-VC-PAB-MMAE (VcMMAE) are combined was used, DOX (doxorubicin) drug and MMAE drug are combined.
이를 7 M urea 8% denatured polyacrylamide gel electrophoresis 전기영동하여 단일밴드를 형성함을 확인하고 이후 실험을 진행하였다.This was confirmed to form a single band by electrophoresis of 7 M urea 8% denatured polyacrylamide gel electrophoresis, and then the experiment was carried out.
<실시예 2-2> 약물이 결합된 RNA 핵산의 제조<Example 2-2> Preparation of drug-bound RNA nucleic acid
2종의 약물이 다중으로 결합된 핵산(MDrNA1)으로서, 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체를 단위체로 사용하여 RNA 핵산(MDrRNA1)을 제조하였다. As a nucleic acid (MDrNA1) to which two drugs are multiplexed, an RNA nucleic acid (MDrRNA1) was prepared using the bound nucleotide analogue of the drug prepared in Example 1 as a unit.
상기 약물이 다중으로 결합된 핵산(MDrRNA1)의 제조용 단위체로는 ATP와 GTP를 대체하여 통합될 수 있는 2-amino Purine Ribose와 Succinyl SN38 NHS ester이 결합한 단위체(RPAS)와 UTP를 대체하여 통합될 수 있는 4-Thio-Uridine와 MC-VC-PABC-MMAE이 결합한 단위체(RUTM)를 사용하였다.The drug can be integrated by replacing the unit (RPAS) and UTP combined with 2-amino Purine Ribose and Succinyl SN38 NHS ester, which can be integrated by replacing ATP and GTP as a unit for manufacturing the nucleic acid (MDrRNA1) to which the drug is multi-coupled. A unit (RUTM) in which 4-Thio-Uridine and MC-VC-PABC-MMAE were combined was used.
상기 약물이 다중으로 결합된 핵산(MDrRNA1)의 제조를 위한, 주형 DNA 절편과 프라이머는 상기 <실시예 2-1>와 같다. The template DNA fragment and primer for the preparation of the drug-multiplied nucleic acid (MDrRNA1) are the same as in <Example 2-1>.
주형 DNA 절편을 이용한 PCR 증폭 과정의 구성 시약으로 각 0.25 μM 정방향, 역방향 프라이머, 10X PCR 버퍼, 200 μM dNTP 혼합물, DNA Taq 중합효소(BioFact) 5 U이 혼합하였다. PCR 반응은 95℃에서 5분간 반응 시킨 후 95℃ 30초, 58℃ 30초, 72℃ 30초의 조건으로 설정하여 20 사이클을 반복한 뒤 72℃에서 5분동안 반응시켜 DNA 절편을 제조하였다. Each of 0.25 μM forward and reverse primers, 10X PCR buffer, 200 μM dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process using the template DNA fragment. The PCR reaction was carried out at 95°C for 5 minutes, followed by 20 cycles of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, followed by reaction at 72°C for 5 minutes to prepare a DNA fragment.
이렇게 제조된, T7 프로모터가 있는 DNA 절편을 주형으로 하여, 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체와 천연 NTP와 RNA 분해효소에 대한 저항성을 지니도록 2'히드록시기가 플루오르기로 치환된 피리미딘 염기인 2'-F CTP를 포함하는 NTP 혼합물을 이용하여 효소적으로 약물이 다중으로 결합된 핵산(MDrRNA1)을 합성하였으며, 이러한 합성에는 변형 뉴클레오티드도 통합시킬 수 있는 박테리오파지 T7 RNA 폴리머라제 돌연변이인 Y639F(Epicentre Technologies 사)를 사용하였다.Using the thus-prepared DNA fragment having the T7 promoter as a template, the 2' hydroxyl group is substituted with a fluorine group so as to have resistance to the bound nucleotide analogue of the drug prepared in Example 1 and natural NTP and RNA degrading enzymes. Nucleic acid (MDrRNA1) enzymatically bound to multiple drugs was synthesized using an NTP mixture containing 2'-F CTP, a midine base, and a bacteriophage T7 RNA polymerase mutant that can also incorporate modified nucleotides in this synthesis. Y639F (Epicentre Technologies) was used.
시험관 내 전사 과정은 상기 제조한 DNA 절편, 10X 전사 버퍼, 5 mM DTT, 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체와 천연 NTP와 2'히드록시기가 플루오르기로 치환된 피리미딘 염기인 2'-F CTP를 포함하는 5 mM NTP 혼합물, T7 중합효소(Epicentre Technologis 사)를 혼합한 후 37℃에서 4시간동안 반응시켰다. The in vitro transcription process was carried out in the DNA fragment prepared above, 10X transcription buffer, 5 mM DTT, a nucleotide analog of the drug prepared in Example 1 above, natural NTP, and 2' a pyrimidine base in which a 2' hydroxyl group is substituted with a fluorine group. After mixing 5 mM NTP mixture containing -F CTP and T7 polymerase (Epicentre Technologis), it was reacted at 37° C. for 4 hours.
상기 5 mM NTP 혼합물에서 상기 실시예 1에서 제조된 약물의 결합된 뉴클레오티드 유사체로서 As a bound nucleotide analogue of the drug prepared in Example 1 in the 5 mM NTP mixture,
ATP와 GTP를 대체하여 통합될 수 있는 2-amino Purine Ribose와 Succinyl SN38 NHS ester이 결합한 단위체(RPAS)와 UTP를 대체하여 통합될 수 있는 4-Thio-Uridine와 MC-VC-PABC-MMAE이 결합한 단위체(RUTM)와 2'히드록시기가 플루오르기로 치환된 피리미딘 염기인 2'-F CTP로 구성되어 있다.A unit (RPAS) combined with 2-aminopurine ribose and succinyl SN38 NHS ester that can be integrated by replacing ATP and GTP, and 4-Thio-Uridine and MC-VC-PABC-MMAE that can be integrated by replacing UTP It is composed of a unit (RUTM) and 2'-F CTP, which is a pyrimidine base in which the 2' hydroxyl group is substituted with a fluorine group.
반응 후 DNaseI(Epaicentre Technologies 사)을 첨가하고 37℃에서 15분간 반응시켜 주형으로 사용한 DNA를 제거한 후 Ethanol 침전법으로 정제하여 약물이 다중으로 결합한 RNA(MDrRNA1)를 수득하였다. 약물이 다중으로 결합한 RNA(MDrRNA1)의 제조에는 뉴클레오티드 유사체로서, ATP와 GTP를 대체하여 통합될 수 있는 2-amino Purine Ribose와 Succinyl SN38 NHS ester이 결합한 단위체(RPAS)와 UTP를 대체하여 통합될 수 있는 4-Thio-Uridine와 MC-VC-PABC-MMAE이 결합한 단위체(RUTM)를 사용하였으므로 SN38 약물 및 MMAE 약물이 결합되어 있다.After the reaction, DNaseI (Epaicentre Technologies) was added and reacted at 37° C. for 15 minutes to remove DNA used as a template, and then purified by ethanol precipitation to obtain RNA (MDrRNA1) to which the drug was multiplied. In the preparation of RNA (MDrRNA1) to which the drug is multiplied, it is a nucleotide analogue, which can be integrated by replacing ATP and GTP, and can be integrated by replacing the unit (RPAS) and UTP combined with 2-amino Purine Ribose and Succinyl SN38 NHS ester. Since the unit (RUTM) in which 4-Thio-Uridine and MC-VC-PABC-MMAE are combined is used, the SN38 drug and the MMAE drug are combined.
이를 7 M urea 8% denatured polyacrylamide gel electrophoresis 전기영동하여 결과를 도 2에 나타내었다.This was subjected to 7 M urea 8% denatured polyacrylamide gel electrophoresis electrophoresis, and the results are shown in FIG. 2 .
도 2를 참조하면, SN38와 MMAE이 결합된 RNA(RNA1-SN38/MMAE)이 단일밴드를 형성함을 확인할 수 있었다. Referring to FIG. 2 , it was confirmed that RNA (RNA1-SN38/MMAE) bound to SN38 and MMAE forms a single band.
<실시예 3> 약물이 결합된 핵산의 제조예 2 <Example 3> Preparation Example 2 of a nucleic acid bound to a drug
1종의 약물이 다중으로 결합된 핵산을, 상기 실시예 2와 다르게 상기 표 2의 작용기를 가진 뉴클레오티드 유사체를 사용하여 먼저 DNA와 RNA 핵산 백본을 제조하고 여기에 상기 표 2의 링커 약물 접합체를 반응시켜 1종의 다중 약물이 결합된 핵산(MDrNA2)을 제조하였다. In contrast to Example 2, a nucleic acid to which one type of drug is multiplied is first prepared by using a nucleotide analog having a functional group in Table 2 above, and then DNA and RNA nucleic acid backbones are prepared, and the linker drug conjugate of Table 2 is reacted thereto. A nucleic acid (MDrNA2) to which one type of multiple drugs was bound was prepared.
<실시예 3-1> 핵산 백본의 제조<Example 3-1> Preparation of nucleic acid backbone
<실시예 3-1-1> DNA 핵산 백본의 제조<Example 3-1-1> Preparation of DNA nucleic acid backbone
DNA 핵산 백본은 상기 실시예 2의 서열번호 39의 서열을 주형으로 하고 상기 표 2의 작용기를 가진 뉴클레오티드 유사체를 사용하여 제작하였다. 여기서 폴리머라제는 뉴클레오티드 유사체에도 작용할 수 있는 KOD XL DNA Polymerase(Fisher Scientific UK Ltd, 영국)를 사용하였다.A DNA nucleic acid backbone was prepared using the sequence of SEQ ID NO: 39 of Example 2 as a template and nucleotide analogues having functional groups in Table 2 above. Here, KOD XL DNA Polymerase (Fisher Scientific UK Ltd, UK), which can also act on nucleotide analogues, was used as the polymerase.
구체적으로 PCR 증폭 과정의 구성 시약으로, 각 0.25 μM 정방향, 역방향 프라이머, 10X PCR 버퍼, 상기 표 2의 작용기를 가진 뉴클레오티드 유사체와 천연의 NTP를 포함하는 200 μM dNTP 혼합물, Merck Millipore Novagen™ KOD XL DNA Polymerase(Fisher Scientific UK Ltd, 영국) 5 U를 혼합하였다. 여기서 NTP 혼합물은 작용기를 가진 뉴클레오티드 유사체 amino deoxycytosine dC C6가 CTP 대신에 사용되었다.Specifically, as the constituent reagents of the PCR amplification process, each 0.25 μM forward and reverse primers, 10X PCR buffer, 200 μM dNTP mixture containing the nucleotide analogues having the functional groups in Table 2 and natural NTP, Merck Millipore Novagen™ KOD XL DNA 5 U of Polymerase (Fisher Scientific UK Ltd, UK) were mixed. Here, in the NTP mixture, the functionalized nucleotide analogue amino deoxycytosine dC C6 was used instead of CTP.
PCR 반응은 95℃에서 5분간 반응 시킨 후 95℃ 30초, 58℃ 30초, 72℃ 30초의 조건으로 설정하여 20 사이클을 반복한 뒤 72℃에서 5분 동안 반응시키는 방법으로 상기 표 2의 작용기를 가진 뉴클레오티드 유사체를 단위체로 포함하는 DNA 백본을 제조하였다.The PCR reaction is a method of reacting at 95°C for 5 minutes, then setting the conditions of 95°C 30 seconds, 58°C 30 seconds, and 72°C 30 seconds, repeating 20 cycles, and reacting at 72°C for 5 minutes. A DNA backbone comprising a nucleotide analogue with
<실시예 3-1-2> RNA 핵산 백본의 제조<Example 3-1-2> Preparation of RNA nucleic acid backbone
RNA 핵산 백본도 상기 실시예 2의 서열번호 39의 서열을 주형으로 하여 PCR를 통해 DNA 절편 증폭하여 제조한 후에 상기 표 2의 작용기를 가진 뉴클레오티드 유사체를 사용하여 시험관 내 전사과정을 거쳐 제작하였다. The RNA nucleic acid backbone was also prepared by amplifying a DNA fragment through PCR using the sequence of SEQ ID NO: 39 of Example 2 as a template, and then using the nucleotide analogues having the functional groups in Table 2 above to prepare it through an in vitro transcription process.
DNA 절편 증폭을 위한 PCR 구성 시약으로, 각 0.25 μM 정방향, 역방향 프라이머, 10X PCR 버퍼, 200 μM dNTP 혼합물, DNA Taq 중합효소(BioFact) 5 U을 혼합하였다. As PCR construct reagents for DNA fragment amplification, 0.25 μM each of forward and reverse primers, 10X PCR buffer, 200 μM dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed.
PCR 반응은 95℃에서 5분간 반응 시킨 후 95℃ 30초, 58℃ 30초, 72℃ 30초의 조건으로 설정하여 20 사이클을 반복한 뒤 72℃에서 5분동안 반응시키는 방법으로 DNA 절편을 제조하였다.The PCR reaction was performed at 95°C for 5 minutes, then set to 95°C 30 seconds, 58°C 30 seconds, 72°C 30 seconds, repeated 20 cycles, and then reacted at 72°C for 5 minutes to prepare a DNA fragment. .
RNA 백본을 제조를 위한 시험관 내 전사과정은 상기 제조된 DNA 절편, 10X 전사버퍼, 5 mM DTT, 상기 표 2의 작용기를 가진 뉴클레오티드 유사체와 천연 NTP와 2'히드록시기가 플루오르기로 치환된 피리미딘 염기인 2'-F CTP를 포함하는 5 mM NTP 혼합물, T7 중합효소(Epicentre Technologis 사)를 혼합한 후 37℃에서 4시간동안 반응시켰다. 상기 5 mM NTP 혼합물에서 상기 표 2의 작용기를 가진 뉴클레오티드 유사체인 4-Thio-Uridine(s4U)이 UTP 대신에 사용되었고, 2'-F CTP가 CTP 대신에 사용되었다.The in vitro transcription process for preparing the RNA backbone is the prepared DNA fragment, 10X transcription buffer, 5 mM DTT, nucleotide analogues having the functional groups in Table 2 above, natural NTP and a pyrimidine base in which the 2' hydroxyl group is substituted with a fluorine group. 5 mM NTP mixture containing 2'-F CTP and T7 polymerase (Epicentre Technologis) were mixed and reacted at 37°C for 4 hours. In the 5 mM NTP mixture, 4-Thio-Uridine (s4U), a nucleotide analogue having a functional group in Table 2, was used instead of UTP, and 2'-F CTP was used instead of CTP.
반응 후 DNaseI(Epicentre Technologies)을 첨가하고 37℃에서 15분간 반응시켜 주형으로 사용한 DNA를 제거한 후 Ethanol 침전법으로 정제하여 상기 표 2의 작용기를 가진 뉴클레오티드 유사체를 단위체로 포함하는 RNA 백본을 제작하였다.After the reaction, DNaseI (Epicentre Technologies) was added and reacted at 37° C. for 15 minutes to remove the DNA used as a template, and then purified by ethanol precipitation to prepare an RNA backbone containing the nucleotide analogues having the functional groups of Table 2 as a unit.
<실시예 3-2> DNA 핵산 백본 또는 RNA 핵산 백본과 링커-약물 접합체와의 반응을 통한 약물이 결합된 핵산(MDrNA2)의 제조<Example 3-2> Preparation of drug-bound nucleic acid (MDrNA2) through reaction between DNA nucleic acid backbone or RNA nucleic acid backbone and linker-drug conjugate
<실시예 3-2-1> DNA 핵산 백본과 링커-약물 접합체와의 반응을 통한 약물이 결합된 핵산(MDrNA2)의 제조<Example 3-2-1> Preparation of drug-bound nucleic acid (MDrNA2) through reaction between DNA nucleic acid backbone and linker-drug conjugate
링커-약물 접합체로서, 상기 표 2의 Succinyl Dox NHS ester와 O-Succinyl SN38 NHS ester를 사용하여, 상기 실시예 3-1에서 제조된, 아미노기를 가진 DNA 핵산 백본과 반응시켜 약물이 결합된 핵산(MDrNA2)을 제조하였다.As a linker-drug conjugate, using the Succinyl Dox NHS ester and O-Succinyl SN38 NHS ester of Table 2 above, the DNA nucleic acid backbone having an amino group, prepared in Example 3-1, was reacted with the drug-bound nucleic acid ( MDrNA2) was prepared.
먼저 상기 실시예 3-1에서 제조된, 동결 건조된 핵산을 탈 이온수에 녹여 25 μg/μL 최종 농도로 준비하였다. 이렇게 얻어진 핵산은 -20 ℃ 이하에서 냉동 보관하면서 사용하였다. First, the freeze-dried nucleic acid prepared in Example 3-1 was dissolved in deionized water to prepare a final concentration of 25 μg/μL. The nucleic acid thus obtained was used while being stored frozen at -20 °C or lower.
물 1 mL 당 0.038 g의 소듐 테트라보레이트 sodium tetraborate decahydrate을 용해시켜 HCl로 pH를 8.5로 조정하여 0.1M sodium tetraborate, pH 8.5 표지 완충액을 준비하였다. 이 표지 버퍼는 표지화 반응 직전에 준비하였다. 0.1M sodium tetraborate, pH 8.5 labeling buffer was prepared by dissolving 0.038 g of sodium tetraborate decahydrate per mL of water and adjusting the pH to 8.5 with HCl. This labeling buffer was prepared just before the labeling reaction.
상기 표 2의 250 μg의 상기 링커-약물 접합체를 바이알에서 14 μL DMSO에 용해하였다.250 μg of the linker-drug conjugate of Table 2 above was dissolved in 14 μL DMSO in a vial.
DMSO에 상기 링커-약물 접합체가 들어있는 바이알에 7 μL의 탈 이온수, 표지 버퍼 75 μL 및 25 μg/μL 상기 제조된 핵산 스톡 용액 4 μL 을 첨가하였다. 상온에서 최소한 6 시간 동안 반응시켰다.To a vial containing the linker-drug conjugate in DMSO, 7 µL of deionized water, 75 µL of labeling buffer, and 4 µL of the prepared nucleic acid stock solution at 25 µg/µL were added. The reaction was carried out at room temperature for at least 6 hours.
여기서 상기 표 2의 Succinyl Dox NHS ester과 상기 실시예 3-1의 DNA 핵산 백본과의 반응을 통한 MDrNA2의 제조는 PerKit™ Antibody Doxorubicin Conjugation Kit(CellMosaic, Inc. 미국)를 사용하여 제조사의 프로토콜에 따랐다. 이렇게 하여 DOX가 결합된 DNA 핵산(DNA2-Dox)을 제조하였다.Here, the preparation of MDrNA2 through the reaction between the Succinyl Dox NHS ester of Table 2 and the DNA nucleic acid backbone of Example 3-1 was performed using the PerKit™ Antibody Doxorubicin Conjugation Kit (CellMosaic, Inc. USA) according to the manufacturer's protocol. . In this way, a DNA nucleic acid (DNA2-Dox) bound to DOX was prepared.
또 상기 표 2의 O-Succinyl SN38 NHS ester과 상기 실시예 3-1의 DNA 핵산과의 반응을 통한 MDrNA2의 제조는 PerKit™ Antibody SN38 Conjugation Kit(CellMosaic, Inc., 미국)를 사용하여 제조사의 프로토콜에 따랐다. 이렇게 하여 SN38이 결합된 DNA 핵산(DNA2-SN38)을 제조하였다.In addition, the preparation of MDrNA2 through the reaction of the O-Succinyl SN38 NHS ester of Table 2 with the DNA nucleic acid of Example 3-1 was performed using the PerKit™ Antibody SN38 Conjugation Kit (CellMosaic, Inc., USA) using the manufacturer's protocol. followed In this way, SN38-conjugated DNA nucleic acids (DNA2-SN38) were prepared.
<실시예 3-2-2> RNA 핵산 백본과 링커-약물 접합체와의 반응을 통한 약물이 결합된 핵산(MDrNA2)의 제조<Example 3-2-2> Preparation of drug-bound nucleic acid (MDrNA2) through reaction between RNA nucleic acid backbone and linker-drug conjugate
링커-약물 접합체로서 MC-VC-PABC-MMAE를 사용하여, 상기 실시예 3-1에서 제조된, 티올기를 가진 RNA 핵산 백본과 반응시켜 MDrNA2를 제조하였다.Using MC-VC-PABC-MMAE as a linker-drug conjugate, it was reacted with the RNA nucleic acid backbone having a thiol group prepared in Example 3-1 above to prepare MDrNA2.
상기 실시예 3-1에서 제조된, 티올기를 가진 RNA 핵산 백본과 상기 링커-약물 접합체를 pH 7.4에서 티올-말레이미드 화학 반응(thiol-maleimide chemistry)으로 4 시간 동안 반응시켰다. 이어서 12 KD 투석막 투석 및 동결 건조를 수행하여 MMAE가 결합된 핵산(RNA2-MMAE)을 제조하였다.The RNA nucleic acid backbone having a thiol group prepared in Example 3-1 and the linker-drug conjugate were reacted at pH 7.4 by thiol-maleimide chemistry for 4 hours. Then, 12 KD dialysis membrane dialysis and freeze-drying were performed to prepare MMAE-conjugated nucleic acids (RNA2-MMAE).
여기서 상기 표 2의 MC-VC-PABC-MMAE와 상기 실시예 3-1의 RNA 핵산과의 반응을 통한 MDrNA2의 제조는 PerKit™ Antibody MMAE Conjugation Kit(CellMosaic, Inc., 미국)를 사용하여 제조사의 프로토콜에 따라 이루어졌다.Here, the preparation of MDrNA2 through the reaction of the MC-VC-PABC-MMAE of Table 2 with the RNA nucleic acid of Example 3-1 was performed using the PerKit™ Antibody MMAE Conjugation Kit (CellMosaic, Inc., USA) of the manufacturer. was done according to the protocol.
<실시예 3-3> HPLC로 MDrNA2의 정제<Example 3-3> Purification of MDrNA2 by HPLC
상기 실시예 3-2에서 핵산 백본과 링커-약물 접합체의 반응 혼합물을 표준 분석용 (4.6 × 250mm) C8 컬럼을 사용하여 역상 HPLC로 정제하였다. The reaction mixture of the nucleic acid backbone and the linker-drug conjugate in Example 3-2 was purified by reverse-phase HPLC using a standard analytical (4.6 × 250 mm) C8 column.
상기 반응 혼합물을 0.1M TEAA (triethylammonium acetate) 컬럼에 넣고 30 분에 걸쳐 선형 5 ~ 65 % 아세토니트릴 구배 acetonitrile gradient를 실시하였다. 이 구배는 분당 아세토니트릴이 2 % 증가한다.The reaction mixture was placed on a 0.1M TEAA (triethylammonium acetate) column and a linear 5-65% acetonitrile gradient acetonitrile gradient was performed over 30 minutes. This gradient increases acetonitrile by 2% per minute.
제조된 약물인 DNA2-Dox, DNA2-SN38 및 RNA2-MMAE 중 DNA2-Dox의 HPLC 정제 결과를 도 3에 나타내었다. 도 3의 결과에 참조하여 보면, 핵산 백본과 링커-약물 접합체보다 약물이 결합된 핵산(DNA2-Dox, DNA2-SN38 및 RNA2-MMAE)이 빠르게 이동하였음을 알 수 있다. The results of HPLC purification of DNA2-Dox among the prepared drugs, DNA2-Dox, DNA2-SN38 and RNA2-MMAE, are shown in FIG. 3 . Referring to the results of Figure 3, it can be seen that the nucleic acid backbone and the linker-drug-bound nucleic acids (DNA2-Dox, DNA2-SN38 and RNA2-MMAE) moved faster than the drug conjugate.
<실시예 4> 약물이 결합된 핵산에의 리간드 결합에 의한 표적화 약물의 제조<Example 4> Preparation of targeting drug by ligand binding to nucleic acid to which drug is bound
<실시예 4-1> 리간드의 제조<Example 4-1> Preparation of ligand
상기 실시예 2와 실시예 3에서 얻어진 약물이 결합한 DNA, RNA 핵산에 리간드로서 압타머를 혼성화 방법으로 결합시켜 표적화 약물(MDrNAL)을 제조하기 위하여 먼저 압타머 리간드를 제조하였다.In order to prepare a targeting drug (MDrNAL) by binding an aptamer as a ligand to the DNA and RNA nucleic acids to which the drugs obtained in Examples 2 and 3 were bound by a hybridization method, an aptamer ligand was first prepared.
압타머 리간드로서는 예시적으로 EGFR에 특이적으로 압타머를 사용하였으며 그 압타머 서열과 그 압타머 제조를 위한 서열은 상기 표 3에 나타내었다.As an exemplary aptamer ligand, an aptamer specifically for EGFR was used, and the aptamer sequence and the sequence for preparing the aptamer are shown in Table 3 above.
표적분자와 압타머 서열 그리고 압타머 서열의 주형 Target molecule, aptamer sequence and template of aptamer sequence
표적분자target molecule 유형type 염기서열(5’ → 3’) Base sequence (5' → 3')
EGFREGFR aptameraptamer GGC GCU CCG ACC UUA GUC UCU GUG CCG CUA UAA UGC ACG GAU UUA AUC GCC GUA GAA AAG CAU GUC AAA GCC GGA ACC GUG UAG CAC AGC AGA (서열번호 42)GGC GCU CCG ACC UUA GUC UCU GUG CCG CUA UAA UGC ACG GAU UUA AUC GCC GUA GAA AAG CAU GUC AAA GCC GGA ACC GUG UAG CAC AGC AGA (SEQ ID NO:42)
templatetemplate GGC GCT CCG ACC TTA GTC TCT GTG CCG CTA TAA TGC ACG GAT TTA ATC GCC GTA GAA AAG CAT GTC AAA GCC GGA ACC GTG TAG CAC AGC AGA (서열번호 42)GGC GCT CCG ACC TTA GTC TCT GTG CCG CTA TAA TGC ACG GAT TTA ATC GCC GTA GAA AAG CAT GTC AAA GCC GGA ACC GTG TAG CAC AGC AGA (SEQ ID NO:42)
압타머의 제조에는 아래의 구조를 가진 DNA 주형을 사용하였다.A DNA template having the following structure was used for the preparation of the aptamer.
<압타머 제조를 위한 DNA 주형의 구조> <Structure of DNA template for aptamer production>
5'-TAA TAC GAC TCA CTA TAG G-압타머 서열의 주형-C GGC TTT GAC ATG CT-3' 5'- TAA TAC GAC TCA CTA TA G G-Template of aptamer sequence- C GGC TTT GAC ATG CT -3'
상기 5' 쪽 밑출진 부분의 서열은 T7 RNA 중합효소의 프로모터 서열이면서 상기 서열번호 40의 정방향 프라이머가 결합하는 서열이고 상기 3'쪽 밑줄친 부분의 서열은, 약물이 결합된 핵산과 상보적으로 결합하는 서열이면서 서열번호 41의 역방향 프라이머 서열이 결합하는 서열이다. The 5' side underlined sequence is the promoter sequence of T7 RNA polymerase and the forward primer of SEQ ID NO: 40 binds, and the 3' side underlined sequence is complementary to the drug-bound nucleic acid. It is a binding sequence and a sequence to which the reverse primer sequence of SEQ ID NO: 41 binds.
본 실시예에서는 아래의 서열을 바탕으로 표적분자인 EGFR 표적화 RNA 압타머를 시험관 내 전사 과정으로 제조하였다. 아래 굵은 글씨로 표시된 부분이 상기 표 2의 EGFR 표적화 RNA 압타머의 주형 서열이다(Cancer Res. 2010;70(22):9371-80).In this example, an EGFR-targeting RNA aptamer, a target molecule, was prepared through an in vitro transcription process based on the following sequence. The part indicated in bold below is the template sequence of the EGFR-targeting RNA aptamer of Table 2 (Cancer Res. 2010;70(22):9371-80).
5'-TAA TAC GAC TCA CTA TA G G G GCG CTC CGA CCT TAG TCT CTG TGC CGC TAT AAT GCA CGG ATT TAA TCG CCG TAG AAA AGC ATG TCA AAG CCG GAA CCG TGT AGC ACA GCA GA C GGC TTT GAC ATG CT-3' (서열번호 43) 5'- TAA TAC GAC TCA CTA TA GG G GCG CTC CGA CCT TAG TCT CTG TGC CGC TAT AAT GCA CGG ATT TAA TCG CCG TAG AAA AGC ATG TCA AAG CCG GAA CCG TGT AGC ACA GCA GA C GGC TTT GAC ATG CT -3 ' (SEQ ID NO: 43)
상기 EGFR 표적화 RNA 압타머 제작을 위한 주형 서열은 주문 제작하였다(바이오니아, 한국). The template sequence for constructing the EGFR-targeting RNA aptamer was custom-made (Bioneer, Korea).
PCR 증폭 과정의 구성 시약으로 각 0.25 μM 정방향, 역방향 프라이머, 10X PCR 버퍼, 200 μM dNTP 혼합물, DNA Taq 중합효소(BioFact) 5 U이 혼합하였다. PCR 반응은 95℃에서 5분간 반응 시킨 후 95℃ 30초, 58℃ 30초, 72℃ 30초의 조건으로 설정하여 20 사이클을 반복한 뒤 72℃에서 5분동안 반응시켜, T7 RNA 중합효소의 프로모터 부분을 포함하는 DNA 절편을 제조하였다. Each of 0.25 μM forward and reverse primers, 10X PCR buffer, 200 μM dNTP mixture, and 5 U of DNA Taq polymerase (BioFact) were mixed as constituent reagents of the PCR amplification process. The PCR reaction was performed at 95°C for 5 minutes, then set to 95°C 30 seconds, 58°C 30 seconds, 72°C 30 seconds, repeated 20 cycles, and then reacted at 72°C for 5 minutes, the promoter of T7 RNA polymerase A DNA fragment containing the portion was prepared.
이렇게 제조된, T7 프로모터가 있는 DNA 절편을 주형으로 하여, RNA 분해효소에 대한 저항성을 지니도록 2'히드록시기가 플루오르기로 치환된 피리미딘 염기인 2'-F CTP와 2'-F UTP를 사용하여 시험관 내 전사과정을 수행하여 EGFR 표적화 RNA 압타머를 제조하였다. Using the thus-prepared DNA fragment with the T7 promoter as a template, 2'-F CTP and 2'-F UTP, which are pyrimidine bases in which the 2' hydroxy group is substituted with a fluorine group, are used to have resistance to RNA degrading enzymes. In vitro transcription was performed to prepare an EGFR-targeting RNA aptamer.
EGFR 표적화 RNA 압타머를 제조하기 위한 시험관 내 전사과정은, 상기 제조된 DNA 절편, 10X 전사버퍼, 5 mM DTT, 5 mM 2'-F CTP와 2'-F UTP 포함 NPT 혼합물, T7 중합효소 혼합물(Epicentre Technologis)을 혼합한 후 37℃에서 4시간동안 반응시켰다.The in vitro transcription process for preparing the EGFR-targeting RNA aptamer includes the prepared DNA fragment, 10X transcription buffer, 5 mM DTT, 5 mM 2'-F CTP and 2'-F UTP-containing NPT mixture, T7 polymerase mixture (Epicentre Technologis) was mixed and reacted at 37°C for 4 hours.
반응 후 DNaseI(Epaicentre Technologies)을 첨가하고 37℃에서 15분간 반응시켜 주형으로 사용한 DNA를 제거한 후 Ethanol 침전법으로 정제하여 2'-F CTP와 2'-F UTP를 포함하는 EGFR 표적화 RNA 압타머를 제작하였다.After the reaction, DNaseI (Epaicentre Technologies) was added and reacted at 37°C for 15 minutes to remove the DNA used as a template, and then purified by ethanol precipitation to obtain an EGFR-targeting RNA aptamer including 2'-F CTP and 2'-F UTP. produced.
<실시예 4-2> 약물이 결합된 핵산에의 리간드 결합<Example 4-2> Ligand binding to drug-bound nucleic acid
상기 제조된 EGFR 표적화 RNA 압타머는 상기 실시예 2와 실시예 3에서 제조된 약물이 결합된 DNA 핵산 또는 RNA 핵산과 3' 영역에서 상보적으로 결합할 수 있는 서열을 가지도록 설계, 제조하였다. The prepared EGFR-targeting RNA aptamer was designed and prepared to have a sequence capable of complementary binding to the DNA nucleic acid or RNA nucleic acid to which the drug prepared in Examples 2 and 3 was bound in the 3' region.
상기 실시예 2와 실시예 3에서 제조된 약물이 결합된 핵산인 DNA1-Dox/MMAE, RNA1-SN38/MMAE, DNA2-Dox, DNA2-SN38 및 RNA2-MMAE과 상기 제조된 EGFR 표적화 RNA 압타머를 95℃에서 5분 동안 가열하고 실온에서 1시간 혼성화하여 EGFR 표적화 RNA 압타머를 약물이 결합된 핵산에 결합시켰다.DNA1-Dox/MMAE, RNA1-SN38/MMAE, DNA2-Dox, DNA2-SN38 and RNA2-MMAE, which are nucleic acids to which the drugs prepared in Examples 2 and 3 are bound, and the prepared EGFR-targeting RNA aptamer The EGFR-targeting RNA aptamer was bound to the drug-bound nucleic acid by heating at 95° C. for 5 minutes and hybridization at room temperature for 1 hour.
이렇게 약물이 결합된 핵산에 리간드 결합시켜 표적화 약물(MDrNAL)을 제조하였으며, 반응 혼합물의 혼성화 전후(반응 전과 반응 후)를 전기영동하여 그 결과를 도 4에 나타내었다. A targeting drug (MDrNAL) was prepared by binding a ligand to the drug-bound nucleic acid, and electrophoresis before and after hybridization of the reaction mixture (before and after reaction) is shown in FIG. 4 .
도 4를 참조하여 보면, 약물이 결합된 핵산과 리간드의 반응으로 표적화 약물(MDrNAL)이 얻어졌음을 확인할 수 있다.Referring to FIG. 4 , it can be confirmed that a targeting drug (MDrNAL) was obtained by the reaction of the drug-bound nucleic acid with the ligand.
이렇게 얻어진 표적화 약물(MDrNAL)은 편의상 각각 DNA1-Dox/MMAE/ApEGFR, RNA1-SN38/MMAE/ApEGFR, DNA2-Dox/ApEGFR, DNA2-SN38/ApEGFR 및 RNA2-MMAE/ApEGFR로 명명한다.The targeting drug (MDrNAL) thus obtained is named DNA1-Dox/MMAE/ApEGFR, RNA1-SN38/MMAE/ApEGFR, DNA2-Dox/ApEGFR, DNA2-SN38/ApEGFR and RNA2-MMAE/ApEGFR for convenience, respectively.
<실시예 5> 반감기 향상을 위한 콜레스테롤 부가<Example 5> Cholesterol addition to improve half-life
콜레스테롤이 5' 말단에 접합된 EGFR 표적화 RNA 압타머(Apt EGFR-chol)와 콜레스테롤이 접합된 올리고뉴클레오티드(oligo-chol)를 주문 제조하였다(바이오니아, 한국). 이 올리뉴클레오티드는 약물이 결합된 핵산에 3' 영역(서열번호 39의 3'쪽 밑줄친 부분의 서열)에서 상보적으로 결합할 수 있도록 설계, 제작되어 있다. An EGFR-targeting RNA aptamer (Apt EGFR-chol) conjugated to the 5' end of cholesterol and an oligonucleotide (oligo-chol) conjugated with cholesterol were custom manufactured (Bioneer, Korea). This oligonucleotide is designed and manufactured so that it can complementarily bind to the drug-bound nucleic acid in the 3' region (the sequence of the 3' underlined portion of SEQ ID NO: 39).
콜레스테롤 부가에는 실시예 2에서 제조된 약물이 결합된 RNA 핵산(MDrRNA1)인 RNA1-SN38/MMAE를 사용하였다.For the cholesterol addition, RNA1-SN38/MMAE, which is a drug-bound RNA nucleic acid (MDrRNA1) prepared in Example 2, was used.
상기 RNA1-SN38/MMAE에 상기 oligo-chol 또는 Apt EGFR-chol는 혼성화시키는 방법으로 콜레스테롤이 결합되도록 하였다. The oligo-chol or Apt EGFR-chol was hybridized to the RNA1-SN38/MMAE so that cholesterol was bound.
MDrRNA1 15 pmole과 Apt EGFR-chol 또는 oligo-chol 15 pmole을 섞어 total 5 ul가 되도록 nuclease free water를 넣어준 뒤 95℃에서 5분간 가열한 후 25℃에서 1시간 동안 혼성화하였다. 혼성화 비율은 MDrRNA1와 Apt EGFR-chol 또는 oligo-chol의 몰 비율로 1:1, 1:5, 1:10으로 하고 2% agarose gel로 retardation assay를 통해 확인한 결과 1:1로 혼성화하였을 때 단일밴드로 확인되었다. After mixing 15 pmole of MDrRNA1 with 15 pmole of Apt EGFR-chol or oligo-chol, adding nuclease free water to a total of 5 ul, heating at 95°C for 5 minutes, and hybridization at 25°C for 1 hour. The hybridization ratio was 1:1, 1:5, 1:10 in the molar ratio of MDrRNA1 and Apt EGFR-chol or oligo-chol, and as a result of retardation assay using 2% agarose gel, a single band was hybridized at 1:1. was confirmed as
상기 혼성화 방법으로 제조한 콜레스테롤이 부가된, 약물 결합 핵산의 혈청에서 안정성을 조사하였다. 즉 혈청 용액에 콜레스테롤이 부가된, 약물 결합 핵산을 처리하여 시간별 시료를 채취하여 남아있는 핵산을 분석하였다. The stability of the cholesterol-added, drug-binding nucleic acid prepared by the above hybridization method was investigated in the serum. That is, the serum solution was treated with cholesterol-added, drug-binding nucleic acids, samples were collected over time, and the remaining nucleic acids were analyzed.
결과를 도 5에 나타내었다. 도 5를 참조하여 보면, MDrRNA1(RNA1-SN38/MMAE) 경우 serum stability 수행 결과 24시간 이후부터 점차 분해되어 72시간에는 약 30 퍼센트 정도의 NAC만 남아있었으나(데이터 제시되어 있지 않음) RNA1-SN38/MMAE/oligo-chol의 경우에는 10일 까지도 약 40 퍼센트 남아있는 것으로 확인되었으며, RNA1-SN38/MMAE/Apt EGFR-chol 역시 5일차 까지 50퍼센트 정도 NAC가 남아있어 MDrRNA1보다 안정성이 확보되었음을 확인하였다.The results are shown in FIG. 5 . Referring to FIG. 5 , in the case of MDrRNA1 (RNA1-SN38/MMAE), as a result of performing serum stability, it was gradually degraded after 24 hours, and only about 30% of NAC remained at 72 hours (data not shown), but RNA1-SN38/ In the case of MMAE/oligo-chol, it was confirmed that about 40% remained until 10 days, and about 50% of the RNA1-SN38/MMAE/Apt EGFR-chol remained NAC until day 5, confirming that it was more stable than MDrRNA1.
<실시예 6> 입자화 약물의 제조<Example 6> Preparation of granulated drug
상기 실시예에서 제조된, 약물이 결합된 핵산과 이 핵산의 표적화 약물에 양이온성 생체적합 고분자인 프로타민(protamine)과 음이온성 생체적합 고분자인 히알루론산(hyaluronic acid)을 이용하여 입자화 약물을 제조하였다.A drug-conjugated nucleic acid prepared in the above example and a cationic biocompatible polymer, protamine, and anionic biocompatible polymer, hyaluronic acid, to the nucleic acid to which the nucleic acid is targeted. did.
상기 실시예에서 얻어진 약물과 양이온성 고분자인 프로타민을 30:75의 농도비(㎍/ml)로 멸균 증류수에 혼합하여 반응시킨 후 동결건조하여 상기 실시예의 약물에 양이온성 고분자인 프로타민이 정전기적 상호작용에 의한 결합한 입자를 제조한 후, 이 입자를 멸균 증류수에 1mg/mL로 용해시켜 0.1%(w/v) 용액을 제조하였다. The drug obtained in the above example and the cationic polymer protamine were mixed in sterile distilled water at a concentration ratio of 30:75 (㎍ / ml) and reacted, and then freeze-dried. After preparing the bound particles by , the particles were dissolved in sterile distilled water at 1 mg/mL to prepare a 0.1% (w/v) solution.
상기 제조한 0.1%(w/v) 용액과 0.1%(w/v) 히알루로산 용액을 1:0.5, 1:1, 1:1.5, 1:2 몰비로 섞어준 뒤 5분 정도 반응시키고 동결건조하여 입자화 약물을 얻었다. The prepared 0.1% (w/v) solution and 0.1% (w/v) hyaluronic acid solution were mixed at a molar ratio of 1:0.5, 1:1, 1:1.5, 1:2, reacted for about 5 minutes, and frozen It was dried to obtain a granulated drug.
이렇게 얻어진 입자화 약물은 2% agarose gel에서 1x TBE buffer를 이용해 80 Volt 조건에서 20분 동안 전기영동을 수행한 후, 0.5 μg/ml의 Etbr(ethidium bromide)을 이용해 핵산 약물을 염색하였다. The granulated drug thus obtained was electrophoresed on a 2% agarose gel using 1x TBE buffer at 80 Volts for 20 minutes, and then the nucleic acid drug was stained with 0.5 μg/ml Etbr (ethidium bromide).
RNA1-SN38/MMAE의 입자화 약물(RNA1-SN38/MMAE/PS/HA)과 RNA1-SN38/MMAE/ApEGFR의 입자화 약물(RNA1-SN38/MMAE/ApEGFR/PS/HA)의 전기영동 결과를 예시적으로 도 6에 나타내었다. Electrophoresis results of RNA1-SN38/MMAE particle drug (RNA1-SN38/MMAE/PS/HA) and RNA1-SN38/MMAE/ApEGFR particle drug (RNA1-SN38/MMAE/ApEGFR/PS/HA) As an example, it is shown in FIG. 6 .
도 6을 참조하여 보면, 핵산 약물(NAC, 즉 RNA1-SN38/MMAE 또는 RNA1-SN38/MMAE/ApEGFR)은 히알루론산의 첨가 몰비에 비례하여 점차 감소하는 것을 확인할 수 있다. 즉 1:0.5에서 82% 비입자화 핵산 약물이 반응 용액에 1:1의 몰비에서 40%만이 반응 용액에 남아 있었고, 1:1.5와 1:2 몰비에서는 반응 용액에 남아 있지 않다. 이는 히알루론산의 첨가 몰비가 1:1.5 이상에서는 핵산 약물이 모두 안정되게 입자화됨을 보여주는 것이라 할 수 있다. .Referring to FIG. 6 , it can be seen that the nucleic acid drug (NAC, that is, RNA1-SN38/MMAE or RNA1-SN38/MMAE/ApEGFR) gradually decreases in proportion to the addition molar ratio of hyaluronic acid. That is, at 1:0.5 and 82% of the non-particulate nucleic acid drug remained in the reaction solution at a molar ratio of 1:1, only 40% remained in the reaction solution, and at a molar ratio of 1:1.5 and 1:2, it did not remain in the reaction solution. This can be said to show that all nucleic acid drugs are stably granulated when the molar ratio of hyaluronic acid added is 1:1.5 or more. .
<실시예 7> 암세포에 세포독성 실험<Example 7> Cytotoxicity test on cancer cells
암세포에 대한 세포독성을 확인하기 위하여, 시료는 상기 실시예 6에서 제조된 RNA1-SN38/MMAE의 입자화 약물(RNA1-SN38/MMAE/PS/HA)과 RNA1-SN38/MMAE/ApEGFR의 입자화 약물(RNA1-SN38/MMAE/ApEGFR/PS/HA)을 사용하였다.In order to confirm the cytotoxicity to cancer cells, the sample was prepared in Example 6 with the particle-forming drug of RNA1-SN38/MMAE (RNA1-SN38/MMAE/PS/HA) and RNA1-SN38/MMAE/ApEGFR. Drugs (RNA1-SN38/MMAE/ApEGFR/PS/HA) were used.
본 실시예에 사용한 세포주는 EGFR+(EGFR 발현) 폐암세포주 A549, 대장암 세포주 SW48 및 피부암 세포주 A431; 그리고 EGFR-(EGFR 비발현) 유방암 세포주 MDA-MB-453, 대장암 세포주 HT-29 및 신경모세포종 세포주 SK-N-MC이다.The cell lines used in this Example are EGFR+ (EGFR-expressing) lung cancer cell line A549, colorectal cancer cell line SW48, and skin cancer cell line A431; and EGFR-(non-EGFR) breast cancer cell line MDA-MB-453, colorectal cancer cell line HT-29 and neuroblastoma cell line SK-N-MC.
암 세포주에 대한 세포독성 실험은 시료를 96 웰 플레이트에서 각 세포 배양 용액에 첨가하여 4시간 동안 배양하고 세척한 후, 72시간 동안 배양하여 MTT 분석을 실시하여 이루어졌다.Cytotoxicity experiments for cancer cell lines were performed by adding a sample to each cell culture solution in a 96-well plate, incubating for 4 hours, washing, incubating for 72 hours, and performing MTT analysis.
EGFR 리간드가 없는 RNA1-SN38/MMAE의 입자화 약물의 세포 독성 결과를 도 7의 a에 나타내었고, EGFR 리간드가 있는 RNA1-SN38/MMAE/ApEGFR의 입자화 약물의 세포 독성 결과를 도 7의 b에 나타내었다. The cytotoxicity result of the particle-forming drug of RNA1-SN38/MMAE without EGFR ligand is shown in FIG. shown in
도 7의 a를 참조하여 보면, EGFR 리간드가 없는 RNA1-SN38/MMAE의 입자화 약물은 EGFR 발현 유무를 불문하고 모든 암 세포주에 대해서 농도 의존적으로 세포독성을 나타내었다.Referring to FIG. 7A , the particle-forming drug of RNA1-SN38/MMAE without EGFR ligand showed concentration-dependent cytotoxicity to all cancer cell lines regardless of EGFR expression.
한편 도 7의 b를 참조하여 보면, EGFR 리간드가 있는 RNA1-SN38/MMAE/ApEGFR의 입자화 약물은 EGFR+ 폐암세포주 A549 세포, 폐암세포주 A549, 대장암 세포주 SW48 및 피부암 세포주 A431에 대해서는 농도 의존적으로 세포독성을 나타내었지만, EGFR- 유방암 세포주, MDA-MB-453 세포, 대장암 세포주 HT-29 및 신경모세포종 세포주 SK-N-MC에 대해서는 세포독성을 나타내지 않았다.On the other hand, referring to FIG. 7 b, the particle-forming drug of RNA1-SN38/MMAE/ApEGFR with EGFR ligand is concentration-dependent on EGFR+ lung cancer cell line A549 cells, lung cancer cell line A549, colorectal cancer cell line SW48 and skin cancer cell line A431. Although it showed toxicity, it did not show cytotoxicity against EGFR- breast cancer cell line, MDA-MB-453 cell, colorectal cancer cell line HT-29 and neuroblastoma cell line SK-N-MC.
이러한 세포독성 결과는 EGFR 리간드가 있는 RNA1-SN38/MMAE/ApEGFR의 입자화 약물이 EGFR 표적분자의 발현 유무에 따라 선택적으로 암세포에 대한 세포독성을 나타냄을 보여주는 결과라 할 수 있다. This cytotoxicity result can be said to be a result showing that the particle-forming drug of RNA1-SN38/MMAE/ApEGFR with EGFR ligand selectively exhibits cytotoxicity to cancer cells depending on the expression of the EGFR target molecule.

Claims (24)

  1. 핵산 기반 항암제로서, 그 핵산은 DNA 또는 RNA이고, 그 DNA 또는 RNA에는 화학 항암제가 결합된 뉴클레오티드 유사체가 1 분자 이상 통합되어 있는 것을 특징으로 하는 핵산 기반 항암제.A nucleic acid-based anticancer agent, wherein the nucleic acid is DNA or RNA, and one or more molecules of a nucleotide analog bound to a chemical anticancer agent are integrated into the DNA or RNA.
  2. 제1항에 있어서,According to claim 1,
    상기 화학 항암제가 결합된 뉴클레오티드 유사체가 2분자 이상 통합되어 있고, 상기 2분자 이상의 뉴클레오티드 유사체에 결합된 항암제는 서로 다른 종류인 것을 특징으로 하는 핵산 기반 항암제.A nucleic acid-based anticancer agent, characterized in that two or more molecules of the nucleotide analog to which the chemical anticancer agent is bound are integrated, and the anticancer agents bound to the two or more molecules of the nucleotide analog are different from each other.
  3. 제1항에 있어서,According to claim 1,
    상기 핵산은 단일가닥 핵산인 것을 특징으로 하는 핵산 기반 항암제.The nucleic acid is a nucleic acid-based anticancer agent, characterized in that the single-stranded nucleic acid.
  4. 제1항에 있어서,According to claim 1,
    상기 화학 항암제는 대사길항제(Antimetabolites), 미세관(microtubulin) 표적화제(Tubulin polymerase inhibitor 및 Tubulin depolymerisation), 알킬화제(Alkylating agents), 유사분열 억제제(Antimitotic Agents), DNA 절단제(DNA cleavage agent), DNA 가교제(DNA cross-linker agent), DNA 인터컬레이터제(DNA intercalator agents) 또는 DNA 토포아이소머라아제 억제제(DNA topoisomerase inhibitor)인 것을 특징으로 하는 핵산 기반 항암제.The chemical anticancer agents include antagonists of metabolism (Antimetabolites), microtubulin targeting agents (Tubulin polymerase inhibitor and Tubulin depolymerisation), Alkylating agents, Antimitotic Agents, DNA cleavage agents, DNA A nucleic acid-based anticancer agent, characterized in that it is a DNA cross-linker agent, a DNA intercalator agent, or a DNA topoisomerase inhibitor.
  5. 제1항에 있어서,According to claim 1,
    상기 화학 항암제가 결합된 뉴클레오티드 유사체는 화학 항암제와 뉴클레오티드가 서로 공유결합된 것을 특징으로 하는 핵산 기반 항암제.The nucleotide analogue to which the chemical anticancer agent is bound is a nucleic acid-based anticancer agent, characterized in that the chemical anticancer agent and the nucleotide are covalently bonded to each other.
  6. 제1항에 있어서,According to claim 1,
    상기 화학 항암제가 결합된 뉴클레오티드 유사체는 화학 항암제와 뉴클레오티드가 서로 링커를 매개로 공유결합된 것을 특징으로 하는 핵산 기반 항암제.The nucleotide analogue to which the chemical anticancer agent is bound is a nucleic acid-based anticancer agent, characterized in that the chemical anticancer agent and the nucleotide are covalently bonded to each other via a linker.
  7. 제6항에 있어서,7. The method of claim 6,
    상기 링커는 아민기(amine group), 카르복시기(carboxyl group), 설프히드릴기(sulfhydryl group), 인산기(phosphate group), 히드록시기(hydroxyl group), 아이소티오시아네이트(isothiocyanate), 아이소시아네이트(isocyanates), 아실 아자이드(acyl azide), NHS 에스터(NHS ester), 설포닐 클로라이드(sulfonyl chloride), 알데하이드(aldehyde), 글리옥살(glyoxal), 에폭사이드(epoxide), 옥시레인(oxirane), 칼보네이트(carbonate), 아릴 할라이드(aryl halide), 이미도에스터(imidoester), 카보이미드(carbodiimide), 안하이드라이드(anhydride), 플루오로페닐 에스터(fluorophenyl ester), 히드록시메틸포스핀(hydroxymethyl phosphine), 말레이미드(maleimide), 할로아세틸(haloacetyl), 피리딜디설파이드(pyridyldisulfide), 티오술포네이트(thiosulfonate), 또는 비닐술폰(vinylsulfone)의 작용기를 갖는 것을 특징으로 하는 핵산 기반 항암제.The linker is an amine group, a carboxyl group, a sulfhydryl group, a phosphate group, a hydroxyl group, isothiocyanate, isocyanates. , acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal, epoxide, oxirane, carbonate ( carbonate), aryl halide, imidoester, carbodiimide, anhydride, fluorophenyl ester, hydroxymethyl phosphine, maleimide (maleimide), haloacetyl (haloacetyl), pyridyldisulfide (pyridyldisulfide), thiosulfonate (thiosulfonate), or a nucleic acid-based anticancer agent having a functional group of vinyl sulfone (vinylsulfone).
  8. 제7항에 있어서,8. The method of claim 7,
    링커는 절단 가능한 링커 또는 절단 가능하지 않은 링커인 핵산 기반 항암제.The linker is a cleavable linker or a non-cleavable linker.
  9. 제8항에 있어서,9. The method of claim 8,
    상기 절단 가능한 링커는 프로테아제에 의해서 절단 가능한 링커, 산 또는 염기 조건에서 절단 가능한 링커, 또는 환원 또는 산화 조건에서 절단 가능한 링커이고,The cleavable linker is a linker cleavable by a protease, a linker cleavable under acid or base conditions, or a linker cleavable under reducing or oxidizing conditions,
    상기 절단 가능하지 않은 링커는 MCC(Maleimidomethyl cyclohexane-1-carboxylate)와 MC(maleimidocaproyl)를 포함하는 링커인 것을 특징으로 하는 핵산 기반 항암제.The non-cleavable linker is a nucleic acid-based anticancer agent, characterized in that it is a linker comprising maleimidomethyl cyclohexane-1-carboxylate (MCC) and maleimidocaproyl (MC).
  10. 제8항에 있어서,9. The method of claim 8,
    상기 링커는 2개 이상의 작용기를 갖는 링커이고,The linker is a linker having two or more functional groups,
    상기 2개 이상의 작용기를 갖는 링커는 동종 이작용성 링커, 이종 이작용성 링커 또는 수지 유형의 링커인 것을 특징으로 하는 핵산 기반 항암제.The linker having two or more functional groups is a nucleic acid-based anticancer agent, characterized in that it is a homobifunctional linker, a heterobifunctional linker, or a resin type linker.
  11. 제1항에 있어서,According to claim 1,
    상기 DNA 또는 RNA 핵산에는 암세포의 표면에 발현되는 표적분자를 특이적으로 인식하여 결합하는 표적화 영역에 결합되어 있어, 표적화 기능을 가지는 핵산 기반 항암제.The DNA or RNA nucleic acid is bound to a targeting region that specifically recognizes and binds a target molecule expressed on the surface of a cancer cell, and thus a nucleic acid-based anticancer agent having a targeting function.
  12. 제11항에 있어서,12. The method of claim 11,
    상기 표적분자는 암세포 표면에 존재하는 항원 또는 수용체인 것을 특징으로 하는, 핵산 기반 항암제.The target molecule is a nucleic acid-based anticancer agent, characterized in that the antigen or receptor present on the surface of the cancer cell.
  13. 제11항에 있어서,12. The method of claim 11,
    상기 표적분자는 EGFRvⅢ, EGFR, 메타스틴 수용체(Metastin receptor), 타이로신 카이나제, HER2, c-Kit, c-Met, CXCR4, CCR7, 엔도테린-A 수용체, PPAR-δ, PDGFR-α, CEA, EpCAM, GD2, GPC3, PSMA, TAG-72, GD3, HLA-DR, MUC1, NY-ESO-1, LMP1, TRAILR2, VEGFR2, HGFR, CD44, CD166, PD-1, PD-L1 또는 PD-L2인 것을 특징으로 하는, 핵산 기반 항암제.The target molecule is EGFRvIII, EGFR, metastin receptor, tyrosine kinase, HER2, c-Kit, c-Met, CXCR4, CCR7, endothelin-A receptor, PPAR-δ, PDGFR-α, CEA , EpCAM, GD2, GPC3, PSMA, TAG-72, GD3, HLA-DR, MUC1, NY-ESO-1, LMP1, TRAILR2, VEGFR2, HGFR, CD44, CD166, PD-1, PD-L1 or PD-L2 Characterized in that, a nucleic acid-based anticancer agent.
  14. 제11항에 있어서,12. The method of claim 11,
    상기 세포 표적화 영역은 표적분자와 특이적으로 결합할 수 있는 능력을 보유한, 항체, 항체 단편 또는 압타머인 것을 특징으로 하는, 핵산 기반 항암제.The cell targeting region has the ability to specifically bind to a target molecule, characterized in that the antibody, antibody fragment or aptamer, a nucleic acid-based anticancer agent.
  15. 제11항에 있어서,12. The method of claim 11,
    상기 DNA 또는 RNA 핵산과 상기 세포 표적화 영역은 공유결합되어 있는 것을 특징으로 하는, 핵산 기반 항암제.The DNA or RNA nucleic acid and the cell targeting region are characterized in that the covalent bond, nucleic acid-based anticancer agent.
  16. 제11항에 있어서,12. The method of claim 11,
    상기 DNA 또는 RNA 핵산과 상기 세포 표적화 영역은 링커를 매개로 공유결합되어 있는 것을 특징으로 하는, 핵산 기반 항암제.The DNA or RNA nucleic acid and the cell targeting region are covalently bonded via a linker, a nucleic acid-based anticancer agent.
  17. 제16항에 있어서,17. The method of claim 16,
    상기 링커는 아민기(amine group), 카르복시기(carboxyl group), 설프히드릴기(sulfhydryl group), 인산기(phosphate group), 히드록시기(hydroxyl group), 아이소티오시아네이트(isothiocyanate), 아이소시아네이트(isocyanates), 아실 아자이드(acyl azide), NHS 에스터(NHS ester), 설포닐 클로라이드(sulfonyl chloride), 알데하이드(aldehyde), 글리옥살(glyoxal), 에폭사이드(epoxide), 옥시레인(oxirane), 칼보네이트(carbonate), 아릴 할라이드(aryl halide), 이미도에스터(imidoester), 카보이미드(carbodiimide), 안하이드라이드(anhydride), 플루오로페닐 에스터(fluorophenyl ester), 히드록시메틸포스핀(hydroxymethyl phosphine), 말레이미드(maleimide), 할로아세틸(haloacetyl), 피리딜디설파이드(pyridyldisulfide), 티오술포네이트(thiosulfonate), 또는 비닐술폰(vinylsulfone)의 작용기를 갖는 것을 특징으로 하는 핵산 기반 항암제.The linker is an amine group, a carboxyl group, a sulfhydryl group, a phosphate group, a hydroxyl group, isothiocyanate, isocyanates. , acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal, epoxide, oxirane, carbonate ( carbonate), aryl halide, imidoester, carbodiimide, anhydride, fluorophenyl ester, hydroxymethyl phosphine, maleimide (maleimide), haloacetyl (haloacetyl), pyridyldisulfide (pyridyldisulfide), thiosulfonate (thiosulfonate), or a nucleic acid-based anticancer agent having a functional group of vinyl sulfone (vinylsulfone).
  18. 제16항에 있어서,17. The method of claim 16,
    링커는 절단 가능한 링커 또는 절단 가능하지 않은 링커인 핵산 기반 항암제.The linker is a cleavable linker or a non-cleavable linker.
  19. 제17항에 있어서,18. The method of claim 17,
    상기 절단 가능한 링커는 프로테아제에 의해서 절단 가능한 링커, 산 또는 염기 조건에서 절단 가능한 링커, 또는 환원 또는 산화 조건에서 절단 가능한 링커이고,The cleavable linker is a linker cleavable by a protease, a linker cleavable under acid or base conditions, or a linker cleavable under reducing or oxidizing conditions,
    상기 절단 가능하지 않은 링커는 MCC(Maleimidomethyl cyclohexane-1-carboxylate)와 MC(maleimidocaproyl)를 포함하는 링커인 것을 특징으로 하는 핵산 기반 항암제.The non-cleavable linker is a nucleic acid-based anticancer agent, characterized in that it is a linker comprising maleimidomethyl cyclohexane-1-carboxylate (MCC) and maleimidocaproyl (MC).
  20. 제16항에 있어서,17. The method of claim 16,
    상기 링커는 2개 이상의 작용기를 갖는 링커이고,The linker is a linker having two or more functional groups,
    상기 2개 이상의 작용기를 갖는 링커는 동종 이작용성 링커, 이종 이작용성 링커 또는 수지 유형의 링커인 것을 특징으로 하는 핵산 기반 항암제.The linker having two or more functional groups is a nucleic acid-based anticancer agent, characterized in that it is a homobifunctional linker, a heterobifunctional linker, or a resin type linker.
  21. (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 항암제가 결합된 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 dNTP가 제외된 dNTP 혼합물과 함께 사용하여 PCR를 통해 주형 DNA 핵산의 증폭 산물을 얻는 단계, 및 (c) 증폭 산물을 회수하는 단계를 포함하는, DNA 핵산 기반 항암제의 제조 방법.(a) preparing a template DNA nucleic acid having the configuration of the 5' end region-intermediate region-3' end region of any sequence, (b) preparing a nucleotide analogue to which an anticancer agent is bound to the template DNA nucleic acid, the analogue A method for preparing a DNA nucleic acid-based anticancer agent, comprising the steps of obtaining an amplification product of a template DNA nucleic acid through PCR using a dNTP mixture in which the corresponding natural dNTP is excluded, and (c) recovering the amplification product.
  22. (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 작용기를 가진 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 dNTP가 제외된 dNTP 혼합물을 사용하여 PCR를 통해 작용기를 가진 뉴클레오티드 유사체가 통합된 증폭 산물을 얻는 단계, (c) 증폭 산물에, 상기 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제를 반응시키는 단계, (d) 그 반응 산물을 회수하는 단계를 포함하는, DNA 핵산 기반 항암제의 제조 방법.(a) preparing a template DNA nucleic acid having the configuration of a 5' end region-intermediate region-3' end region of any sequence, (b) adding a nucleotide analogue having a functional group to the template DNA nucleic acid to the analogue Obtaining an amplification product in which a nucleotide analogue having a functional group is integrated through PCR using a dNTP mixture excluding the corresponding natural dNTP, (c) having a functional group capable of reacting with the functional group of the nucleotide analogue in the amplification product A method for preparing a DNA nucleic acid-based anticancer agent, comprising the step of reacting the anticancer agent, (d) recovering the reaction product.
  23. (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 천연의 NTP를 사용하여 PCR를 통해 증폭 산물을 얻는 단계, (c) 그 증폭 산물을 주형으로 하여 항암제가 결합된 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 NTP가 제외된 NTP 혼합물과 함께 사용하여 체외 전사를 통해 그 뉴클레오티드 유사체가 통합된 RNA를 제조하는 단계, 및 (d) 제조된 RNA를 회수하는 단계를 포함하는, RNA 핵산 기반 항암제의 제조 방법.(a) preparing a template DNA nucleic acid having the configuration of a 5' end region-intermediate region-3' end region of any sequence, (b) amplifying the template DNA nucleic acid through PCR using a native NTP obtaining a product, (c) using the amplification product as a template, using a nucleotide analogue bound with an anticancer agent as a template, with a NTP mixture excluding the natural NTP corresponding to the analogue, and integrating the nucleotide analogue through in vitro transcription A method for producing an RNA nucleic acid-based anticancer agent, comprising the steps of preparing RNA, and (d) recovering the prepared RNA.
  24. (a) 5' 말단 영역-임의의 서열의 중간 영역-3' 말단 영역의 구성을 갖는 주형 DNA 핵산을 제조하는 단계, (b) 그 주형 DNA 핵산에 대해서 천연의 NTP를 사용하여 PCR를 통해 증폭 산물을 얻는 단계, (c) 그 증폭 산물을 주형으로 하여 작용기를 가진 뉴클레오티드 유사체를, 그 유사체에 상응하는 천연의 NTP가 제외된 NTP 혼합물과 함께 사용하여 체외 전사를 통해 그 뉴클레오티드 유사체가 통합된 RNA를 제조하는 단계, (d) 제조된 RNA에, 상기 뉴클레오티드 유사체의 작용기와 반응할 수 있는 작용기를 가진 항암제를 반응시키는 단계, (e) 그 반응 산물을 회수하는 단계를 포함하는, RNA 핵산 기반 항암제의 제조 방법.(a) preparing a template DNA nucleic acid having the configuration of a 5' end region-intermediate region-3' end region of any sequence, (b) amplifying the template DNA nucleic acid through PCR using a native NTP obtaining a product, (c) using the amplification product as a template, using a nucleotide analogue having a functional group as a template, together with a NTP mixture excluding the natural NTP corresponding to the analogue, RNA into which the nucleotide analogue is integrated through in vitro transcription (d) reacting the prepared RNA with an anticancer agent having a functional group capable of reacting with a functional group of the nucleotide analogue, (e) recovering the reaction product, RNA nucleic acid-based anticancer agent manufacturing method.
PCT/KR2021/003328 2020-03-18 2021-03-18 Nucleic acid-based anticancer agent WO2021187902A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0032961 2020-03-18
KR20200032961 2020-03-18

Publications (1)

Publication Number Publication Date
WO2021187902A1 true WO2021187902A1 (en) 2021-09-23

Family

ID=77771449

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003328 WO2021187902A1 (en) 2020-03-18 2021-03-18 Nucleic acid-based anticancer agent

Country Status (2)

Country Link
KR (2) KR20210117209A (en)
WO (1) WO2021187902A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130041591A (en) * 2011-10-17 2013-04-25 성균관대학교산학협력단 Multi-functional nucleic acid-based anticancer agent for targeted delivery and therapy, preparation method thereof, and anticancer composition comprising the same
KR101537474B1 (en) * 2014-04-18 2015-07-16 성균관대학교산학협력단 Self-illuminative nanocomplexes, preparation method thereof and anticancer composition comprising thereof
KR20170050395A (en) * 2015-10-30 2017-05-11 한국과학기술연구원 Multiple tandem shDNA used for tumor-selective drug delivery and use thereof
WO2019241430A2 (en) * 2018-06-12 2019-12-19 Angiex, Inc. Antibody-oligonucleotide conjugates

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130041591A (en) * 2011-10-17 2013-04-25 성균관대학교산학협력단 Multi-functional nucleic acid-based anticancer agent for targeted delivery and therapy, preparation method thereof, and anticancer composition comprising the same
KR101537474B1 (en) * 2014-04-18 2015-07-16 성균관대학교산학협력단 Self-illuminative nanocomplexes, preparation method thereof and anticancer composition comprising thereof
KR20170050395A (en) * 2015-10-30 2017-05-11 한국과학기술연구원 Multiple tandem shDNA used for tumor-selective drug delivery and use thereof
WO2019241430A2 (en) * 2018-06-12 2019-12-19 Angiex, Inc. Antibody-oligonucleotide conjugates

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHI QINGJIA, YANG ZICHANG, XU KANG, WANG CHUNLI, LIANG HUAPING: "DNA Nanostructure as an Efficient Drug Delivery Platform for Immunotherapy", FRONTIERS IN PHARMACOLOGY, vol. 10, 28 January 2020 (2020-01-28), XP055851438, DOI: 10.3389/fphar.2019.01585 *

Also Published As

Publication number Publication date
KR20220005609A (en) 2022-01-13
KR20210117209A (en) 2021-09-28

Similar Documents

Publication Publication Date Title
ES2899612T3 (en) Saponin conjugated to epitope binding proteins
JP5350586B2 (en) Heterobifunctional polymer biocomplex
WO2018233571A9 (en) Antibody-drug conjugate having acidic self-stabilization junction
WO2013089522A1 (en) Novel oligonucleotide conjugates and use thereof
EP3322485B1 (en) Plant virus particles for delivery of antimitotic agents
JP2010235624A (en) Trialkyl-lock-facilitated polymeric prodrug of amino-containing bioactive agent
CN111989138B (en) Humanized anti-Prostate Specific Membrane Antigen (PSMA) antibody drug conjugates
JP2018506581A (en) Antibody-urease conjugates for therapeutic purposes
WO2019078611A1 (en) Nanoliposome-microbubble conjugate having cas9 protein, guide rna for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same
KR102182985B1 (en) Drug Delivery System Using pH-dependent Membrane Penetrating Peptide and Drug Conjugate Thereof
JP2024506300A (en) Immune stimulating compounds and conjugates
WO2021187902A1 (en) Nucleic acid-based anticancer agent
US7291463B2 (en) Nucleic acid labeling compounds
WO2021101258A2 (en) Aptamer-based targeted combination anticancer drug
CN112955434B (en) Drug conjugates comprising quinoline derivatives
KR20240015670A (en) Anthracycline antibody conjugate
CN114306634A (en) Compounds comprising a cleavable linker and uses thereof
TW202417053A (en) Immunostimulatory antibody-drug conjugates
WO2018084562A1 (en) Method for producing dextran polymer-based, amplified nucleic acid aptamer nanoconstruct selectively capturing target molecule
US12054714B2 (en) Peptide docking vehicle for targeted nucleic acid delivery
WO2020141930A1 (en) Drug delivery system using ph-dependent cell-penetrating peptides, and composite thereof with drug
CN116457023A (en) antibody-TLR agonist conjugates, methods and uses thereof
WO2021187851A1 (en) Particles encapsulating targeted aptamer conjugates, and use thereof
KR20220069143A (en) Targeting combination of anticancer drugs based on aptamers
WO2022191567A1 (en) Composition for administration of double-stranded oligonucleotide structures using ultrasonic nebulizer for prevention or treatment of respiratory viral infection including covid-19, pulmonary fibrosis caused by viral infection, or respiratory diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21772164

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21772164

Country of ref document: EP

Kind code of ref document: A1