WO2021184766A1 - Gene expression component, cloning vector constructed thereby and application - Google Patents

Abstract

A gene expression component, a cloning vector constructed thereby and an application. The gene expression component encodes β-galactosidase α peptide and ω peptide; the gene expression component comprises a constitutive promoter, and the constitutive promoter promotes expressed LacZα gene and LacZω gene. A constructed pWizard plasmid can produce substances having β-galactosidase activity in a host cell without IPTG induction, the application scope of the host cell is expanded, the pWizard plasmid is a high-copy plasmid, and therefore, the copy number of the LacZα gene and the LacZω gene in a host bacterium is high, the expression level of the host cell to an enzyme having β-galactosidase activity is significantly increased, the color development effect and the color development speed are enhanced, and the color development time is shortened.

Description

Gene expression component and its constructed cloning vector and application Technical field

This application belongs to the technical field of molecular biology and genetic engineering, and relates to a gene expression component and its constructed cloning vector and application, in particular to a gene expression component encoding β-galactosidase α peptide and ω peptide, and a construction Cloning vector and its construction method and application.

Background technique

PCR is an important technology in the fields of molecular biology and genetic engineering, and experimenters often need to clone PCR products into vectors. Currently commonly used cloning vectors are mainly based on the principle of blue-white spot screening, and the blue-white spot screening method brings great convenience to picking positive clones. The vector that can be used for blue-white spot screening contains the lacZ' gene, which can encode the α peptide chain, and contains a multiple cloning site (MCS) for cloning foreign DNA in the lacZ' gene. The existing vector with blue-white spot screening function is only suitable for β-galactosidase-deficient genetically engineered bacteria. The gene encoding β-galactosidase in the chromosome of this engineered bacteria is mutated, and the coding product of the mutant gene (ω peptide) Compared with wild-type β-galactosidase, it lacks 146 amino acids in the N segment, so it has no biological activity. Although the β-galactosidase-deficient strain cannot encode active β-galactosidase alone, when the bacterial cell contains a plasmid with the lacZ' gene, the α peptide encoded by the plasmid lacZ' gene and the strain expressed Omega peptides are complemented to obtain a complementary product with β-galactosidase activity, so that X-gal produces blue substances. This phenomenon is called α-complementation. The above is the phenotype produced by the strain carrying the empty vector. When the foreign DNA is ligated into the MCS of the lacZ' vector, the reading frame of the α peptide is destroyed, and the recombinant plasmid will no longer express the α peptide. After it is introduced into the β-galactosidase deficient strain, no α-complementation will be produced, and no α-complementation will be produced. It is a product with β-galactosidase activity, so it cannot decompose X-gal in the medium to produce blue color, and the culture phenotype presents a white colony. The pUC series vectors are commonly used blue-white screening vectors.

However, the existing vectors with blue-white spot screening function, such as the widely used pUC series vectors, have the following disadvantages: First, the scope of strains is limited, and this vector is only suitable for β-galactosidase-deficient types. Genetically engineered bacteria, but E. coli without β-galactosidase mutations is often used in practical applications, such as STBL2 and STBL3 strains, and the blue-white spot phenotype cannot be used to screen positive clones; second, each E. coli contains a lower The number of genome copies results in low expression of ω peptide. When the strain is transformed into a plasmid expressing α peptide, the β-galactosidase content formed is low. It takes a long time for the strain to form obvious blue spots, and the color development efficiency Low, affecting production efficiency and large-scale industrial applications; third, this kind of carrier requires the use of plates containing IPTG, but IPTG is expensive and toxic to the human body, with high cost and low safety.

Therefore, it is necessary to provide a plasmid suitable for a wide range of strains with blue-white spot screening function, so that the blue-white spot develops quickly and does not require IPTG induction.

Summary of the invention

This application provides a gene expression module and its constructed cloning vector and application. The cloning vector has the function of screening blue and white spots and is suitable for almost all types of E. coli. The blue spots develop fast and can be used in large quantities without IPTG induction. The expression of proteins or polypeptides with β-galactosidase activity has important significance and broad application prospects.

In the first aspect, the present application provides a gene expression module that encodes β-galactosidase α peptide and ω peptide;

The gene expression component includes a constitutive promoter, and the LacZα gene and LacZω gene that the constitutive promoter promotes expression.

In this application, a constitutive promoter is used to regulate the expression of LacZα gene and LacZω gene, so that LacZα gene and LacZω gene can be continuously and stably expressed in host cells, and the β-galactosidase α peptide and ω peptide obtained by transcription and translation pass The α-complementation effect produces a substance with β-galactosidase activity, which decomposes X-gal into blue 5-bromo-4-indigo, achieving the technical effect of producing β-galactosidase without IPTG induction. The scope of application of host cells is expanded, and positive clones can be screened for blue and white spots in any type of E. coli.

Preferably, the LacZα gene contains multiple cloning sites;

There is a ribosome binding site between the LacZα gene and the LacZω gene.

In this application, the multiple cloning site in the LacZα gene is used to insert foreign DNA, and the ribosome binding site is set between the LacZα gene and the LacZω gene to ensure that the foreign DNA is inserted or not inserted. All ω peptides can be translated normally.

Preferably, the constitutive promoter includes a resistance gene promoter, preferably a bla promoter (ie, Amp resistance gene promoter).

Preferably, the LacZα gene includes the nucleic acid sequence shown in SEQ ID NO:1;

SEQ ID NO:1:

Preferably, the LacZω gene includes the nucleic acid sequence shown in SEQ ID NO: 2;

SEQ ID NO: 2:

In this application, the wild-type LacZα gene and LacZω gene are used as optimization targets. According to the codon preference of E. coli, the most frequently used codon is selected, the coding sequence is redesigned, and the coding sequence is further optimized to optimize the second order of 5'UTR. Level structure, the LacZα gene shown in SEQ ID NO:1 and the LacZω gene shown in SEQ ID NO:2 are obtained, which significantly increases the expression of α peptide and ω peptide, enhances the color rendering effect and color rendering speed, and shortens Color development time.

Preferably, the gene expression component includes the nucleic acid sequence shown in SEQ ID NO: 3;

SEQ ID NO: 3:

In the second aspect, the present application provides a cloning vector, which includes the gene expression component described in the first aspect.

Preferably, the cloning vector also includes an E. coli replicon, preferably a pBR322 replicon.

Preferably, the pBR322 replicon includes the nucleic acid sequence shown in SEQ ID NO: 4;

SEQ ID NO: 4:

Preferably, the cloning vector also includes an antibiotic resistance gene.

Preferably, the antibiotic resistance gene includes a kanamycin resistance gene.

Preferably, the kanamycin resistance gene includes the nucleic acid sequence shown in SEQ ID NO: 5;

SEQ ID NO: 5:

Preferably, the cloning vector includes the nucleic acid sequence shown in SEQ ID NO: 6;

SEQ ID NO: 6:

In this application, from the 5'end, the 146th to 3127 bp reverse complementary sequence of the cloning vector is the coding sequence of β-galactosidase ω peptide, and the 3128 to 3176 bp reverse complementary sequence is the ribosome binding site (RBS) sequence, initial lacZω translation, the 3177～3542bp reverse complementary sequence is the coding sequence of β-galactosidase α peptide, the 3445～3533bp is the multiple cloning site (MCS) sequence, the 3543～3692bp The reverse complementary sequence of the bla promoter sequence, the 3935-4617 bp is the pBR322 replicon sequence, and the 4712-5527 bp reverse complementary sequence is the coding sequence of Kanamycin (Kan).

In this application, the constructed cloning vector pWizard plasmid adopts a constitutive promoter to regulate the expression of LacZα gene and LacZω gene, so that LacZα gene and LacZω gene can be continuously and stably expressed in host cells, without IPTG induction. Lactosidase-active substances can be screened for positive clones by blue and white spots in any type of E. coli; at the same time, the cloning vector pWizard plasmid is a high-copy plasmid, therefore, the LacZα gene and LacZω gene have a high copy number in the host bacteria. , Significantly increase the expression of α peptide and ω peptide by the host cell, form a large number of enzymes with β-galactosidase activity, enhance the color development effect and color development speed, and shorten the color development time.

In the third aspect, this application provides a method for constructing the cloning vector of the second aspect, and the method for constructing includes:

Mix the gene expression module, pBR322 replicon and the nucleic acid molecules of the kanamycin resistance gene, add exonuclease, DNA polymerase and DNA ligase, and react at 40-60℃ for 0.5-1h to obtain a closed circular double Strand DNA

The closed circular double-stranded DNA is transformed into competent cells, a single clone is picked, cultured, and the plasmid is extracted for sequencing identification, and the cloning vector is obtained, which is named pWizard plasmid.

In this application, the gene expression module, pBR322 replicon and the nucleic acid molecule of the kanamycin resistance gene have a 30bp homologous recombination arm, which is beneficial to be connected to a circular DNA by a homologous recombination method.

Preferably, the reaction temperature may be, for example, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C. °C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C or 60°C, preferably 50°C.

Preferably, the reaction time may be 0.5h, 0.6h, 0.7h, 0.8h, 0.9h or 1h, for example.

Preferably, the molar ratio of the nucleic acid molecules of the gene expression module, pBR322 replicon and kanamycin resistance gene is 1:1:1.

As a preferred technical solution, this application provides a method for constructing the cloning vector described in the second aspect, and the method for constructing includes:

Mix the gene expression module, pBR322 replicon and the nucleic acid molecules of the kanamycin resistance gene at a molar ratio of 1:1:1, add T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase, and react at 50°C 0.5～1h, get closed circular double-stranded DNA;

The closed circular double-stranded DNA is transformed into competent cells, a single clone is picked, cultured, and the plasmid is extracted for sequencing identification, and the cloning vector is obtained, which is named pWizard plasmid.

In a fourth aspect, the present application provides a recombinant vector, which is the cloning vector described in the second aspect in which a foreign gene is inserted.

Preferably, the foreign gene is inserted into the multiple cloning site of the cloning vector described in the second aspect.

In a fifth aspect, the present application provides a host cell that integrates the gene expression component described in the first aspect into the genome of the host cell, and/or the host cell includes the cloning vector described in the second aspect and/ Or the recombinant vector described in the fourth aspect.

Preferably, the host cell includes β-galactosidase wild-type genetically engineered bacteria and/or β-galactosidase-deficient genetically engineered bacteria, including but not limited to Top10, DH5α, STBL2 or STBL3 Escherichia coli.

In the sixth aspect, the present application provides a kit comprising the gene expression component described in the first aspect, the cloning vector described in the second aspect, the recombinant vector described in the fourth aspect, or the recombinant vector described in the fifth aspect. Any one or a combination of at least two of the above-mentioned host cells.

In a seventh aspect, this application provides a method for cloning an exogenous gene, the method comprising:

The foreign gene is inserted into the multiple cloning site of the cloning vector described in the second aspect, is introduced into the host cell, and after culture, a positive clone expressing the foreign gene is obtained by screening according to blue and white spots.

Preferably, the method further includes the step of separating and purifying the protein from the culture supernatant of the positive clone or the bacterial cell of the positive clone.

In the eighth aspect, the present application provides a gene expression module according to the first aspect, the cloning vector according to the second aspect, the recombinant vector according to the fourth aspect, the host cell according to the fifth aspect, or the sixth aspect The application of the kit in protein preparation.

Compared with the prior art, this application has the following beneficial effects:

(1) The pWizard plasmid of the present application uses a constitutive promoter to regulate the expression of LacZα gene and LacZω gene, so that LacZα gene and LacZω gene can be continuously and stably expressed in host cells, without the need for IPTG induction to produce β-galactoside Enzymatically active substances can be coated and cultured on a plate that does not contain IPTG and only contains X-gal, which expands the scope of application of host cells, and can screen positive clones for blue and white spots in any type of E. coli;

(2) This application has performed codon optimization on the wild-type LacZα gene and LacZω gene, and the constructed pWizard plasmid has a much higher copy number of the LacZα gene and LacZω gene in the host bacteria than the genome copy number, which significantly improves the host cell’s response to the α peptide The expression level of ω and ω peptides increases the expression level of enzymes with β-galactosidase activity through α-complementation, enhances the color development effect and color development speed, and shortens the color development time.

Description of the drawings

Figure 1 is a plasmid map of pWizard;

Figure 2 is the transformation of pUC57 plasmid into DH5α strain, and coating the plate containing IPTG and X-gal;

Figure 3 shows the transformation of Top10F' strain with pUC57 plasmid and coating on a plate containing IPTG and X-gal;

Figure 4 shows the transformation of STBL3 strain with pUC57 plasmid and coating of plates containing IPTG and X-gal;

Figure 5 shows the pWizard plasmid transforming the DH5α strain and coating the plate containing X-gal;

Figure 6 is the transformation of Top10F' strain with pWizard plasmid and coating on X-gal plate;

Figure 7 is the transformation of STBL3 strain with pWizard plasmid and coating the plate containing X-gal;

Figure 8 is the transformation of STBL3 strain with pET-30a plasmid and coating the plate containing IPTG and X-gal;

Figure 9 is the blunt-end cloning of the pWizard plasmid, the exogenous DNA is transformed into the DH5α strain, and the plate containing X-gal is coated;

Figure 10 is a pWizard plasmid blunt end cloned exogenous DNA transformed STBL3 strain, coated with X-gal plate;

Figure 11 shows the bacterial test results of blunt-ended clones of foreign DNA. Lanes 1-8 are DH5α bacterial test results, lanes 9-16 are STBL3 bacterial test results, and lane M is DNA ladder. The band sizes are 100bp, 250bp, 500bp, 750bp, 1kb, 1.5kb, 2kb, 3kb and 5kb;

Figure 12 is the cloned exogenous DNA of the sticky end of pWizard plasmid transforming the DH5α strain and coating the plate containing X-gal;

Figure 13 is the transformation of STBL3 strain with foreign DNA cloned from the sticky end of pWizard plasmid and coated with X-gal plate;

Figure 14 shows the results of bacterial detection of foreign DNA clones with sticky ends. Lanes 1-8 are the results of DH5α bacterial detection, lanes 9-16 are the results of STBL3 bacterial detection, and lane M is DNA ladder. The band sizes are 100bp, 250bp, 500bp, 750bp, 1kb, 1.5kb, 2kb, 3kb and 5kb.

Detailed ways

In order to further illustrate the technical means adopted by this application and its effects, the application will be further described below in conjunction with embodiments and drawings. It can be understood that the specific implementations described here are only used to explain the application, but not to limit the application.

If the specific technology or conditions are not indicated in the examples, it shall be carried out in accordance with the technology or conditions described in the literature in the field, or in accordance with the product specification. The reagents or instruments used without the manufacturer's indication are all conventional products that can be purchased through formal channels.

Term explanation:

LacZ gene: a gene widely used in the study of gene expression regulation. The encoded β-galactosidase (β-gal) is a tetramer composed of 4 subunits, which can catalyze the hydrolysis of lactose and stabilize β-gal It has good properties and is blue when stained with X-Gal as a substrate, which is convenient for detection and observation. The many advantages of LacZ gene make it a commonly used marker gene in genetic engineering experiments. For example, it is often used in the screening of transformed strains. Galactosidase color reaction selection method, that is, blue and white selection;

LacZα gene: encodes the N-terminal α fragment of β-galactosidase (lacZ), which can form an enzyme with β-galactosidase activity through α-complementation. The colorless compound X-gal (5-bromo-4-chloro -3-indole-β-D-galactoside) cleaved into galactose and the dark blue substance 5-bromo-4-indigo;

Endonuclease: an enzyme that hydrolyzes the phosphodiester bond in the nucleic acid molecule chain to generate oligonucleotides;

PCR technology: the polymerase chain reaction, the DNA is denatured to single-stranded at a high temperature of 95°C in vitro, and the primers and single-strands are combined in accordance with the principle of base complementary pairing at low temperatures (about 60°C), and then the temperature is adjusted to the DNA polymerase The most suitable reaction temperature (about 72℃), DNA polymerase synthesizes complementary strands along the direction of phosphoric acid to five carbon sugars (5'-3'); PCR machine based on polymerase is a temperature-controlled device that can denature The temperature change is well controlled between temperature, refolding temperature and extension temperature.

Material:

DH5α Competent Cell Thermo Fisher Scientific

Top10F’ Competent Cell Thermo Fisher Scientific

STBL3 Competent Cell Thermo Fisher Scientific

EcoRV restriction enzyme NEB company

KpnI restriction enzyme NEB company

HindIII restriction endonuclease NEB company

T4DNA Ligase NEB Corporation

λDNA NEB Company

Gibson

Master Mix Kit NEB Company

Primer synthesis Suzhou Jinweizhi Biological Technology Co., Ltd.

Example 1 Construction of pWizard plasmid

(1) Design and synthesize the gene expression module bla-α-RBS-ω shown in SEQ ID NO: 3, with a total length of 3700 bp, of which, from the 5'end, the reverse complementary sequence of 146 to 3127 bp is the LacZω gene , Encoding the ω peptide, the 3128～3176bp reverse complementary sequence is the RBS sequence, which initiates the transcription and translation of the LacZω gene, the 3177～3542 bp reverse complementary sequence is the LacZα gene, which encodes the α peptide, the 3445～3533 bp is a polyclonal Site (MCS) sequence, the 3543～3692 bp reverse complementary sequence is bla promoter;

(2) Design and synthesize the pBR322 replicon shown in SEQ ID NO: 4, with a total length of 1030 bp, starting from the 5'end, the 265-947 bp is the pBR322 gene sequence;

(3) Design and synthesize the Kan gene shown in SEQ ID NO: 5, with a total length of 1055 bp. From the 5'end, the 42-857 bp is the Kan gene sequence;

(4) There is a 30bp homologous sequence between the above three fragments, using Gibson

Connect Master Mix (NEB) kit, the reaction system is SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 three gene fragments each 2μL, sterilized deionized water 4μL, Gibson

Master Mix 10μL (contains T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase), the reaction conditions are 50 ℃ for 1 hour, assembled to form a circular cloning vector, named pWizard plasmid;

(5) The reaction product is transformed into DH5α competent cells and coated with Kan resistance plate;

(6) Pick a few single clones the next day, extract the plasmids after culture, and perform Sanger sequencing. The plasmid that is correctly sequenced is the pWizard plasmid, and the length of the plasmid is 5695bp.

As shown in Figure 1, the positions of the main elements in the pWizard plasmid are as follows: From the 5'end, the reverse complement sequence of 146～3127bp is LacZω gene, which encodes ω peptide, and the reverse complementary sequence of 3128～3176bp is RBS. Sequence, start the transcription and translation of LacZω gene, the 3177～3542bp reverse complementary sequence is LacZα gene, which encodes α peptide, the 3445～3533bp is the multiple cloning site (MCS) sequence, the 3543～3692bp reverse complementary sequence It is the bla promoter, the 3935-4617 bp is the pBR322 replicon sequence, and the 4712-5527 bp reverse complementary sequence is the Kan gene sequence.

Example 2 Transformation of pWizard plasmid into Escherichia coli to form blue spots under non-IPTG induction conditions

(1) Pipette about 50ng pWizard plasmid into Top10F', DH5α, STBL3 competent cells, respectively draw about 50ng pUC57 plasmid (preserved by Jin Weizhi) into Top10F', DH5α, STBL3 competent cells, at the same time, draw about 50ng pET-30a plasmid (preserved by Jin Weizhi) was added to STBL3 competent cells;

(2) Ice bath for 30 minutes;

(3) Heat shock at 42℃ for 90s, ice bath for 3min;

(4) Add 700 μL of pre-warmed LB medium to competent cells, and resuscitate at 37°C and 220 rpm for 1 hour;

(5) Suction an appropriate amount of bacterial liquid from the competent cells transformed with the pWizard plasmid and evenly spread it on the X-gal and Kan resistant LB plates, and at the same time, draw an appropriate amount from the competent cells transformed with the pUC57 and pET-30a plasmids Bacteria solution was evenly spread on LB plates containing IPTG, X-gal and Kan resistance;

(6) Place the plate at 37°C for overnight incubation.

The colony phenotype was observed the next day, and the results are shown in Figures 2-8. Figure 2 shows the transformation of pUC57 plasmid into DH5α strain and coating with IPTG and X-gal plates, and Figure 3 shows the transformation of pUC57 plasmid into Top10F' strain and coating with IPTG. And X-gal plate, Figure 4 is the pUC57 plasmid transformed STBL3 strain, coated with IPTG and X-gal plate, Figure 5 is pWizard plasmid transformed DH5α strain, coated with X-gal plate, Figure 6 is pWizard plasmid transformed Top10F' Strains, coated plates containing X-gal, Figure 7 shows the pWizard plasmid transformed STBL3 strain, coated plates containing X-gal, Figure 8 shows pET-30a plasmid transformed STBL3 strain, coated plates containing IPTG and X-gal.

It can be seen that all the clones on the plate are blue, indicating that the pWizard plasmid can express substances with β-galactosidase activity without IPTG induction, and STBL3 competent cells are not suitable for ordinary blue-white spot screening that requires IPTG induction. Vector; In addition, compared with competent cells transformed with pUC57 plasmid, the colony formed by competent cells transformed with pWizard plasmid is darker, indicating that the competent cells transformed with pWizard plasmid can express more activity in the same culture time β-Galactosidase makes the blue and white spots easier to distinguish, making it easier to pick positive clones.

Example 3 Using pWizard plasmid blunt ends to clone foreign DNA fragments

(1) Use λDNA as a template and F-λDNA-Blunt and R-λDNA-Blunt as primers for PCR amplification. The PCR amplification system and procedures are shown in Table 1 and Table 2;

F-λDNA-Blunt (SEQ ID NO: 7): ACGTTTGAGCAGAATAACCATGTGG;

R-λDNA-Blunt (SEQ ID NO: 8): AAATAACGTTCTCCACCGACCTCTG;

Table 1

Reagent	Dosage
ddH 2 O	75μL
5×Buffer	20μL
dNTP	1μL
F-λDNA-Blunt	1μL
R-λDNA-Blunt	1μL
λDNA	1μL
pfu	1μL
total capacity	100μL

Table 2

(2) After the PCR reaction, use 1% agarose gel for electrophoresis detection, the size of the target fragment is 600 bp, cut the target fragment, use Axygen's gel recovery kit for recovery and purification, and use Nanodrop2000 to determine the concentration of purified DNA About 120ng/μL;

(3) Use EcoRV restriction endonuclease to digest pWizard plasmid. The digestion reaction system is shown in Table 3, and digestion is performed at 37°C for 1 hour;

table 3

10×buffer(μL)	pWizard(μL)	EcoRV(μL)	Sterile ddH 2 O(μL)
6	10(～3μg)	3	41

(4) Use Axygen's gel recovery kit to recover and purify the digested product. Nanodrop2000 determines the concentration of the purified digested product to be about 20ng/μL;

(5) Prepare the ligation reaction system according to Table 4, ligate the purified PCR fragment with EcoRV digested pWizard plasmid, and ligate at 22°C for 1 hour;

Table 4

10×buffer(μL)	Linear pWizard plasmid (μL)	λDNA amplified fragment (μL)	Sterile ddH 2 O(μL)
1	1	2	6

(6) Take 5 μL of the ligation product to transform DH5α and STBL3 competent cells respectively, and spread the bacterial solution on LB plates containing X-gal and Kan resistance;

(7) Incubate overnight at 37°C.

The colony phenotype was observed the next day, and the results are shown in Figures 9-10. Figure 9 shows the blunt-end cloning of pWizard plasmid and exogenous DNA transforming the DH5α strain and coating the plate containing X-gal. Figure 10 shows the blunt-end cloning of pWizard plasmid. DNA was transformed into STBL3 strain and spread on a plate containing X-gal.

It can be seen that the pWizard plasmid as a cloning vector can form obvious blue and white spots without the induction of IPTG, indicating that the pWizard plasmid is suitable for STBL3 and other strains with no LacZ gene mutations, and positive clones can be screened by blue and white spots.

Eight single clones were randomly picked from the plate for colony PCR, using JJ-F-pWizard and JJ-R-pWizard as primers. The electrophoresis results are shown in Figure 11. Among them, lanes 1-8 are the results of DH5α bacterial detection. 9-16 are the results of STBL3 bacterial test, it can be seen that the size of the bacterial test product is about 900bp; two positive clones are randomly selected from each plate for Sanger sequencing, and the sequencing results show that the sequence is correct;

JJ-F-pWizard (SEQ ID NO: 9): CTTCTTCGCTGTTGCGCCAGCTCGC;

JJ-R-pWizard (SEQ ID NO: 10): GTATCCGCTCATGAGACAATAACCC.

Example 4 Cloning of foreign DNA fragments using the sticky ends of pWizard plasmid

(1) Use λDNA as a template and F-λDNA-Sticky and R-λDNA-Sticky as primers for PCR amplification. The PCR amplification system and procedures are shown in Table 1 and Table 2;

F-λDNA-Sticky (SEQ ID NO: 11):

CTGACCGC GGTACC CGTGGAACCCACCGAGTGAAAGTGT (underline is the KpnI restriction site);

R-λDNA-Sticky (SEQ ID NO: 12):

CAATGTTG AAGCTT CTGCGTATCCAGCTCACTCTCAATG (the underline is the HindⅢ restriction site);

(2) After the PCR reaction, use 1% agarose gel for electrophoresis detection. The size of the target fragment is about 758bp. The target fragment is cut into gel, and the gel recovery kit of Axygen is used for recovery and purification. Nanodrop2000 is used to determine the purified DNA. The concentration is about 160ng/μL;

(3) Use KpnI and HindⅢ restriction enzymes to digest the recovered PCR product, the digestion reaction system is shown in Table 5, digestion at 37°C for 1 hour;

table 5

10×buffer(μL)	Purified PCR product (μL)	KpnI(μL)	HindⅢ(μL)	Sterile ddH 2 O(μL)
4	13	2	2	19

(4) Use Axygen's gel recovery kit to recover and purify the digested product. Nanodrop2000 determines the concentration of the purified digested product to be about 20ng/μL;

(5) Use KpnI and HindⅢ restriction enzymes to digest pWizard plasmid. The digestion reaction system is shown in Table 6, and digestion is performed at 37°C for 1 hour;

Table 6

10×buffer(μL)	pWizard(μL)	KpnI(μL)	HindⅢ(μL)	Sterile ddH 2 O(μL)
6	10(～3μg)	3	3	38

(6) Use Axygen's gel recovery kit to recover and purify the digested product. Nanodrop2000 determines the concentration of the purified digested product to be about 15ng/μL;

(7) Prepare the ligation reaction system according to Table 4, ligate the purified PCR fragment with the pWizard plasmid digested with KpnI and HindⅢ, and ligate at 22°C for 1 hour;

(8) Take 5 μL of the ligation product to transform DH5α and STBL3 competent cells respectively, and spread the bacterial solution on an LB plate containing X-gal and Kan resistance;

(9) Incubate overnight at 37°C.

The colony phenotype was observed the next day, and the results are shown in Figure 12-13. Figure 12 shows the cohesive end cloning of pWizard plasmid and exogenous DNA transforming the DH5α strain and coating the plate containing X-gal. Figure 13 shows the cohesive end cloning of pWizard plasmid. DNA was transformed into STBL3 strain and spread on a plate containing X-gal.

It can be seen that the colonies formed are almost all white spots, only a few blue spots appear, and very few blue spots are likely to be formed by the transformation of residual plasmids that have not been digested by restriction enzymes.

Eight single clones were randomly picked from the plate for colony PCR, using JJ-F-pWizard and JJ-R-pWizard as primers. The electrophoresis results are shown in Figure 14. Among them, lanes 1-8 are the results of DH5α bacterial detection. 9-16 are the results of STBL3 bacterial test, it can be seen that the size of the bacterial test product is about 1kb; two positive clones are randomly selected from each plate for Sanger sequencing, and the sequencing results show that the sequence is correct.

In summary, this application uses a constitutive promoter to regulate the expression of LacZα and LacZω genes, so that LacZα and LacZω genes can be continuously and stably expressed in host cells. The constructed cloning vector has the function of screening blue and white spots, which is almost suitable for All types of Escherichia coli have fast blue spots and can express a large number of proteins or peptides with β-galactosidase activity without IPTG induction, which has important significance and wide application prospects.

The applicant declares that this application uses the above-mentioned embodiments to illustrate the detailed methods of this application, but this application is not limited to the above-mentioned detailed methods, which does not mean that this application must rely on the above-mentioned detailed methods to be implemented. Those skilled in the art should understand that any improvement to this application, the equivalent replacement of each raw material of the product of this application, the addition of auxiliary components, the selection of specific methods, etc., fall within the scope of protection and disclosure of this application.

Claims (15)

1. A gene expression module, which encodes β-galactosidase α peptide and ω peptide;

   The gene expression component includes a constitutive promoter, and the LacZα gene and LacZω gene that the constitutive promoter promotes expression.
2. The gene expression module of claim 1, wherein the LacZα gene contains multiple cloning sites; and

   There is a ribosome binding site between the LacZα gene and the LacZω gene.
3. The gene expression module according to claim 1 or 2, wherein the constitutive promoter includes a resistance gene promoter, preferably a bla promoter.
4. The gene expression module according to any one of claims 1 to 3, wherein the LacZα gene comprises the nucleic acid sequence shown in SEQ ID NO:1;

   Preferably, the LacZω gene includes the nucleic acid sequence shown in SEQ ID NO: 2;

   Preferably, the gene expression component includes the nucleic acid sequence shown in SEQ ID NO: 3.
5. A cloning vector comprising the gene expression module of any one of claims 1 to 4.
6. The cloning vector according to claim 5, wherein the cloning vector further comprises an E. coli replicon, preferably a pBR322 replicon;

   Preferably, the pBR322 replicon includes the nucleic acid sequence shown in SEQ ID NO:4.
7. The cloning vector according to claim 5 or 6, wherein the cloning vector further comprises an antibiotic resistance gene;

   Preferably, the antibiotic resistance gene includes a kanamycin resistance gene;

   Preferably, the kanamycin resistance gene includes the nucleic acid sequence shown in SEQ ID NO: 5;

   Preferably, the cloning vector includes the nucleic acid sequence shown in SEQ ID NO:6.
8. A method for constructing a cloning vector according to any one of claims 5 to 7, comprising:

   Mix the gene expression module, pBR322 replicon and the nucleic acid molecules of the kanamycin resistance gene, add exonuclease, DNA polymerase and DNA ligase, and react at 40-60℃ for 0.5-1h to obtain a closed circular double Strand DNA

   The closed circular double-stranded DNA is transformed into competent cells, a single clone is picked, cultured, and the plasmid is extracted for sequencing and identification, to obtain the cloning vector.
9. The construction method according to claim 8, wherein the molar ratio of the nucleic acid molecules of the gene expression module, pBR322 replicon and kanamycin resistance gene is 1:1:1.
10. A recombinant vector, wherein the recombinant vector is the cloning vector according to any one of claims 5 to 7 into which a foreign gene is inserted;

    Preferably, the foreign gene is inserted into the multiple cloning site of the cloning vector according to any one of claims 5 to 7.
11. A host cell, wherein the gene expression component of any one of claims 1 to 4 is integrated into the genome of the host cell, and/or the host cell comprises the gene expression component of any one of claims 5 to 7 The cloning vector and/or the recombinant vector of claim 10;

    Preferably, the host cell includes β-galactosidase wild-type genetically engineered bacteria and/or β-galactosidase-deficient genetically engineered bacteria;

    Preferably, the host cell includes Top10, DH5α, STBL2 or STBL3.
12. A kit, wherein the kit comprises the gene expression component of any one of claims 1 to 4, the cloning vector of any one of claims 5 to 7, and the recombination of claim 10 Any one or a combination of at least two of the vector or the host cell of claim 11.
13. A method for cloning an exogenous gene, wherein the method comprises:

    The foreign gene is inserted into the multiple cloning site of the cloning vector according to any one of claims 5 to 7, and then introduced into the host cell. After culturing, a positive clone expressing the foreign gene is obtained by screening according to blue and white spots.
14. The exogenous gene cloning method according to claim 13, wherein the method further comprises the step of separating and purifying the protein from the culture supernatant of the positive clone or the bacterial cell of the positive clone.
15. A gene expression module according to any one of claims 1 to 4, a cloning vector according to any one of claims 5 to 7, a recombinant vector according to claim 10, and a host cell according to claim 11 Or the application of the kit of claim 12 in the fields of gene cloning, protein preparation or sequencing.

Images